USE OF ANTI-HER2 ANTIBODY-DRUG CONJUGATE IN TREATING UROTHELIAL CARCINOMA
20200289663 ยท 2020-09-17
Inventors
Cpc classification
A61K47/6847
HUMAN NECESSITIES
A61K9/0021
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
C07K2317/24
CHEMISTRY; METALLURGY
A61K9/19
HUMAN NECESSITIES
A61P13/02
HUMAN NECESSITIES
A61K47/6803
HUMAN NECESSITIES
A61K47/6855
HUMAN NECESSITIES
A61K47/6861
HUMAN NECESSITIES
C07K2317/92
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
International classification
A61K47/68
HUMAN NECESSITIES
Abstract
The present invention relates to the use of an anti-HER2 antibody-drug conjugate (ADC) in preparing a drug for treating urothelial carcinoma. The drug is safe and effective for patients with urothelial carcinoma, especially locally advanced or metastatic urothelial carcinoma, and can effectively prolong the survival time of the patients.
Claims
1. A method for treating urothelial carcinoma, comprising administering an antibody-drug conjugate (ADC) to a subject in need thereof, wherein the antibody-drug conjugate is an anti-HER2 antibody or a functional fragment thereof coupled to a cytotoxic molecule.
2. The method according to claim 1, wherein the cytotoxic molecule includes a tubulin inhibitor and a DNA damaging agent.
3. The method according to claim 2, wherein the tubulin inhibitor includes dolastatin and derivatives thereof, auristatin and derivatives thereof, maytansinoid and derivatives thereof; the DNA damaging agent includes calicheamicins, duocarmycins, tretracycline derivative PBD, and camptothecin derivative SN-38.
4. The method according to claim 1, the cytotoxic molecule includes amanitins, anthracyclines, baccatins, camptothecins, cemadotins, colchicines, colcimids, combretastatins, cryptophycins, dicodermolides, docetaxel, doxorubicin, echinomycins, eleutherobins, epothilones, estramustines, lexitropsins, maytansines, methotrexate, netropsins, puromycins, rhizoxins, taxanes, tubulysins, and vinca alkaloids.
5. The method according to claim 3, wherein the auristatin and derivatives thereof include MMAE, MMAF, and derivatives thereof; the maytansinoid and derivatives thereof include DM1, DM4, and the derivatives thereof.
6. The method according to claim 1, wherein the antibody or the functional fragment thereof is capable of competing with a defined antibody against the same epitope, wherein the defined antibody comprises a heavy chain variable region and a light chain variable region defined by CDR sequences, and wherein (i) the heavy chain variable region comprises three CDRs, wherein the amino acid sequences of the CDRs are respectively set forth in SEQ ID NO: 1, 2 and 3; and (ii) the light chain variable region comprises three CDRs, wherein the amino acid sequences of the CDRs are respectively set forth in SEQ ID NO: 4, 5 and 6.
7. The method according to claim 1, wherein the antibody or the functional fragment thereof comprises a heavy chain variable region and a light chain variable region, wherein (i) the heavy chain variable region comprises three CDRs, wherein the amino acid sequences of the CDRs are respectively set forth in SEQ ID NO: 1, 2 and 3; and (ii) the light chain variable region comprises three CDRs, wherein the amino acid sequences of the CDRs are respectively set forth in SEQ ID NO: 4, 5 and 6.
8. The method according to claim 1, wherein the antibody-drug conjugate is represented by formula Ab-(L-U)n, wherein Ab is the antibody or the functional fragment thereof, L is a linker, U is a conjugated cytotoxic molecule, and n is an integer from 1 to 8, representing the number of therapeutic agent molecules bound to the antibody.
9. The method according to claim 8, wherein the conjugated cytotoxic molecule includes DM1, DM3, DM4, MMAE, MMAF, AF (auristatin F) and derivatives thereof.
10. The method according to claim 8, wherein the linker is attached to the antibody or the functional fragment thereof via a thiol and/or an amino.
11. The method according to claim 10, wherein the linker is selected from the group consisting of maleimidocaproyl valine citrulline p-amino-benzyl (mc-vc-pAB), maleimidocaproyl (mc), triglycyl peptide linker, 3-maleimido-propionic acid, Mal-di-EG-OPFP (perfluorophenyl 3-(2-(2-(3-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)propanamido)ethoxy)ethoxy)propanoate), Mal-di-EG-OSu (2,5-dioxopyrrolidin-1-yl 3-(2-(2-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)ethoxy)ethoxy)propanoate), Mal-Tri-EG-OSu (2,5-dioxopyrrolidin-1-yl 3-(2-(2-(2-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)ethoxy)ethoxy)ethoxy)ethoxypropanoate), Mal-Tetra-EG-OSu (2,5-dioxopyrrolidin-1-yl 1-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)-3-oxo-7,10,13,16-tetraoxa-4-azanonadecan-19-oate), Br-di-EG-OSu (2,5-dioxopyrrolidin-1-yl 3 (2-(2-(2-bromoacetamido)ethoxy)ethoxy)propanoate), Py-ds-prp-OSu (2-5-dioxopyrrolidin-1-yl 3-(pyridine-2-yldisulfanyl)propanoate), Py-ds-Prp-OPEP (perfluorophenyl 3-(pyridine-2-yldisulfanyl)propanoate), Py-ds-dmBut-OSu (2,5-dioxopyrrolidin-1-yl 4-methyl-4-(pyridine-2-yldisulfanyl)pentanoate, Py-ds-dmBut-OPF (perfluorophenyl 4-methyl-4-(pyridine-2-yldisulfanyl)pentanoate), SMCC (N-succinimidyl 4-(maleimidomethyl) cyclohexanecarboxylate), MB S (3-maleimidobenzoic acid N-hydroxysuccinimide ester), SATA (S(N-succinimidyl)thioacetate), SPDP ((N-succinimidyl 3-(2-pyridyldithio)propionate), and SMPT ((N-succinimidyloxy carbonyl)-1-methyl-1-(2-pyridyldithio)toluene).
12. The method according to claim 1, wherein the cytotoxic molecule is conjugated to the antibody through site-directed or undirected conjugation.
13. The method according to claim 1, wherein the antibody or the functional fragment thereof is murine, chimeric or humanized.
14. The method according to claim 1, wherein the antibody or the functional fragment thereof is derived from the antibody secreted by the hybridoma deposited at the China General Microbiological Culture Collection Center of China Committee for Culture Collection of Microorganisms on Aug. 22, 2013, with an accession number of CGMCC No. 8102.
15. The method according to claim 1, wherein the antibody is a humanized antibody, preferably, the antibody is secreted by CHO cells deposited at the China Center for Type Culture Collection on Nov. 6, 2013, with an accession number of CCTCC C2013170.
16. The method according to claim 1, the urothelial carcinoma is selected from the group consisting of locally developed urothelial carcinoma which cannot be removed by surgery, locally advanced or metastatic urothelial carcinoma, HER2-positive urothelial carcinoma and HER2-positive locally advanced or metastatic urothelial carcinoma.
17. The method according to claim 1, wherein the antibody-drug conjugate further comprises a pharmaceutically acceptable carrier, and, the carrier is one or more selected from the group consisting of a stabilizer, a protective agent, a buffer, a lyoprotectant, an activity protective agent, a surfactant, an adsorption carrier and an absorption promoter.
18. The method according to claim 1, the antibody-drug conjugate can be administered intranasally, subcutaneously, intradermally, intramuscularly, or intravenously.
19. The method according to claim 17, wherein the antibody-drug conjugate is in a form of a lyophilized formulation or a liquid formulation.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
DETAILED DESCRIPTION OF THE INVENTION
Example 1. Preparation and Sequence Analysis of Murine Monoclonal Antibody mRC48
[0037] 1. Expression and Purification of HER2 Antigen
[0038] The cDNA fragment encoding HER2-ECD (from Thr23 to Thr652, GenBank accession No. M11730) was cloned into pcDNA3 expression vector (Invitrogen) by PCR.
[0039] The detailed method: the cDNA of HER2-ECD coding region was obtained from HER2.sup.+ SKBR3 cell line (ATCC No. HTB-30) by RT-PCR (using ImProm-IITM Reverse Transcription System of Promega).
[0040] The primers are:
TABLE-US-00002 P1: (SEQIDNO:7) 5CGGGATCCTGCCACCAGCTGTGCGCC, P2: (SEQIDNO:8) 5GCTCTAGATCAGTTGATGGGGCAAGGCT,
the underlined sequences are the introduced BamHI and XbaI restriction enzyme cutting sites, respectively. The HER2-ECD cDNA obtained by reverse transcription was used as a template for PCR amplification using the above primers. The amplification conditions: denaturing at 94 C. for 30 s, annealing at 60 C. for 30 s, extending at 72 C. for 1 minute, for a total of 30 cycles, and then extending at 72 C. for 10 minutes. The PCR fragment was then recovered, digested with BamHI and XbaI (from NEB), and ligated with pcDNA3 vector. A polyhistidine tag was added to the C-terminus of HER2-ECD to facilitate purification. HEK293 cells (ATCC, USA) were transfected with the constructed DNA expression vector, and soluble protein HER2-ECD with his-tag was purified from the culture medium by Ni-NTA affinity chromatography (Qiagen). SDS-PAGE and Coomassie brilliant blue staining showed that the purified HER2-ECD protein had more than 95% homogeneity, as shown in
[0041] 2. Generating and Screening of Hybridoma Cells
[0042] Mice were immunized with the HER2-ECD prepared above as the antigen to produce antibodies. Immunization, hybridoma cell fusion, and preliminary screening were performed according to standard procedures (Reference: WHO Technical Report Series, No. 822, 1992 Annex 3). 0.25 mL of HER2-ECD protein (50-100 g) and 0.25 ml of Freund's complete adjuvant (Difco Lab) were mixed in equal volume and used to immunize 4 Balb/c mice (purchased from Shanghai SLAC Laboratory Animal Co., Ltd). The second injection was performed after 2 weeks. Freund's incomplete adjuvant (Difco Lab) and antigen with the amount of 25-50 g/0.5 mL/per mouse were used for the second injection. 3 weeks after, the third injection was performed at the same dose as that of the second injection. Blood was taken 10 days after the third injection. The serum of the mice was analyzed by enzyme-linked immunosorbent assay (ELISA). The cells from the spleens of the two mice with the highest anti-HER2 antibody titers were taken, and then fused with myeloma cells P3X63Ag8 (ATCC, CRL-1580). The fused cells were diluted into 96-well plate, and screened preliminarily by ELISA according to the binding ability with HER2-ECD. In a typical ELISA, Nunc Maxisorb 96-well plate was coated with HER2-ECD (0.2-1 g/mL) and then incubated with a gradient dilution of mouse serum or hybridoma supernatant (100 L). The mouse anti-HER2 antibody was detected using a horseradish peroxidase-conjugated goat F(ab).sub.2 anti-mouse IgG Fc (Invitrogen) secondary antibody.
[0043] ELISA was used to screen the supernatants of 400 hybridoma cell lines, of which 36 showed strong binding with HER2-ECD. Ten hybridoma cells with the strongest HER2 binding ability were selected and subcloned hybridoma cell lines were screened again by limiting dilution method. The subcloned hybridoma cell lines were cultured in suspension, proteins were purified, and the binding affinity with HER2 was determined by ELISA. The binding ability of the above antibodies to HER2 expressed on the surface of human breast cancer cell lines was further tested by flow cytometry (BD FACS Calibur) (see Example 4 for detailed description). Finally, a hybridoma cell line mRC48 (murine IgGlk) was identified through sequence analysis, which has strong HER2 binding capacity. The hybridoma cell mRC48 was deposited with accession No. 8102 at China General Microbiological Culture Collection Center of China Committee for Culture Collection of Microorganisms on Aug. 22, 2013 (the date of conversion to deposit under the Budapest Treaty was Oct. 29, 2013).
[0044] 3. Sequence Analysis of Anti-HER2 Antibody from Hybridoma Cell Clone mRC48
[0045] The 5 ends of the heavy chain and light chain variable regions of clone mRC48 were rapidly amplified using the commercial SMART RACE cDNA Amplification Kit (Clontech) for sequencing according to the instructions.
[0046] Total RNA was extracted from hybridoma cells using RNApure Tissue Kit (Beijing ComWin Biotech Co., Ltd), and reverse transcription was performed using the SMART RACE cDNA Amplification Kit. First-strand cDNA for RACE-Ready was obtained by reverse transcription according to the protocol provided with the kit, using the total RNA as the template, the primers provided with the kit, and reverse transcriptase SMARTScribe Reverse Transcriptase. And then two rounds of PCR were carried out. For the first round PCR, the obtained cDNA was as template, the UPM provided with the kit was used as the 5 end primer and mRC48-VL-1/mRC48-VH-1 as the 3 end primer. The PCR reaction conditions: pre-denaturation at 94 C. for 5 minutes; 25 cycles (denaturation at 94 C. for 30 s, annealing at 68 C. for 30 s and extension at 72 C. for 2 minutes); and extension at 72 C. for 10 minutes.
[0047] The second round PCR was performed using the products of the first round PCR as the template, NUP15 provided with the kit as the 5 end primer and mRC48-VL-2/mRC48-VH-2 as the 3 end primer. PCR reaction conditions: pre-denaturation at 94 C. for 5 min; 25 cycles (denaturation at 94 C. for 30 s, annealing at 68 C. for 30 s and extension at 72 C. for 2 min); extension at 72 C. for 10 min. Both the heavy chain and light chain variable regions of the aforementioned antibody from hybridoma cell clone mRC48 were obtained.
[0048] The primers are as follows:
TABLE-US-00003 mRC48-VL-1: (SEQIDNO:9) 5-GTTGGTGCAGCATCAGCCCGTT-3; mRC48-VL-2: (SEQIDNO:10) 5-GTTCACTGCCATCAATCTTCCAC-3; mRC48-VH-1: (SEQIDNO:11) 5-GCCAGTGGATAGACAGATGG-3; mRC48-VH-2: (SEQIDNO:12) 5-AGGTCACTGTCACTGGCTCAG-3.
[0049] The PCR products were purified by agarose gel electrophoresis and then subcloned into the pCR2.1TOPO cloning vector (Invitrogen). Plasmid DNAs from ten independent clones were obtained by PCR, and then sequenced using M13 forward and reverse primers. DNA sequence analysis showed that all 10 clones had cDNA encoding the same VH or VL polypeptide. The amino acid sequences of the complementarity determining regions (CDRs) are analyzed by Kabat coding table and listed in Table 1. Sequence comparison analysis showed that the CDRs of anti-HER2 mRC48 were significantly different from that of the known HER2 antibodies including Herceptin (trastuzumab).
TABLE-US-00004 TABLE1 AminoacidsequencesoftheCDRsofanti-HER2 monoclonalantibodymRC48 VH VL CDR1 DYYIH KASQDVGTAVA (SEQIDNO:1) (SEQIDNO:4) CDR2 RVNPDHGDSYYNQKFKD WASIRHT (SEQIDNO:2) (SEQIDNO:5) CDR3 ARNYLFDHW HQFATYT (SEQIDNO:3) (SEQIDNO:6)
Example 2. Humanization of the Anti-HER2 Monoclonal Antibody mRC48 (Method as Described in CN105008398A)
[0050] Murine anti-HER2 monoclonal antibody mRC48 was humanized by transplanting light chain or heavy chain CDRs into human IgG1 framework regions.
[0051] The humanized RC48 antibody light chain variable region (RC48-VL) and the humanized RC48 antibody heavy chain variable region (RC48-VH) were designed and constituted the humanized anti-HER2 antibody: RC48. The similarity between the overall sequence of RC48-VH and human IgG1VH is 84%. The RC48 antibody comprises a light chain variable region RC48-VL and a heavy chain variable region RC48-VH.
[0052] Humanized anti-HER2 monoclonal antibody RC48 was obtained by CDR grafting. The nucleic acid sequences of heavy chain and light chain variable regions were directly synthesized by Nanjing GenScript Biotech Corporation. The synthetic variable region comprises Kozak consensus sequence, start codon, heavy chain or light chain signal peptide, human framework region and murine CDRs. Variable regions and human IgGlk constant region were ligated into a complete fragment by overlap-extension PCR.
[0053] The primers for overlap-extension PCR:
TABLE-US-00005 HeavychainVH1: (SEQIDNO:13) 5CGCGGATCCGCCGCCACCATGGGATGGAGCT3 VH2: (SEQIDNO:14) 5GATGGGCCCTTGGTGCTAGCGGAGCTCACTGTCACCAGTGTT3 CH1: (SEQIDNO:15) 5GCTAGCACCAAGGGCCCATC3 CH2: (SEQIDNO:16) 5CCGGAATTCTTTACCGGGAGACAGGGAGA3 LightchainVL1: (SEQIDNO:17) 5CGCGGATCCGCCGCCACCATGGACATGAGGGT3 VL2: (SEQIDNO:18) 5GATGGTGCAGCCACAGTACGCTTTATCTCAACTTTTGTAC3 CL1: (SEQIDNO:19) 5CGTACTGTGGCTGCACCAT3 CL2: (SEQIDNO:20) 5CCGGAATTCACACTCTCCCCTGTTGAAGC3
[0054] For the generation of heavy chain nucleic acid, first, the heavy chain variable region was amplified using the synthetic variable region as the template and VH1 and VH2 as the primers, meanwhile, human IgG1 heavy chain constant region was used as the template and CH1 and CH2 as the primers to amplify the heavy chain constant region. The amplification conditions are: denaturation at 94 C. for 30 s, annealing at 60 C. for 30 s, extension at 72 C. for 1 minute, 30 cycles, and extension at 72 C. for 10 minutes. Then the heavy chain sequence of RC48 was amplified using the above two PCR products as the template and VH1 and CH2 as primers. The amplification conditions were: denaturation at 94 C. for 30 s, annealing at 60 C. for 30 s, extension at 72 C. for 2 minutes, 30 cycles, and extension at 72 C. for 10 minutes.
[0055] For the generation of light chain nucleic acid, first, the light chain variable region was amplified using the synthetic variable region as the template and VL1 and VL2 as the primers, meanwhile, the human IgG1 light chain constant region was used as the template and CL1 and CL2 as the primers to amplify the light chain constant region. The amplification conditions were: denaturation at 94 C. for 30 s, annealing at 60 C. for 30 s, extension at 72 C. for 1 minute, 30 cycles, and extension at 72 C. for 10 minutes. Then the light chain sequence of RC48 was amplified using the above two PCR products as the template and VL1 and CL2 as primers. The amplification conditions were: denaturation at 94 C. for 30 s, annealing at 60 C. for 30 s, extension at 72 C. for 2 minutes, 30 cycles, and extension at 72 C. for 10 minutes.
[0056] Thus, the humanized anti-HER2 monoclonal antibody RC48 sequence was obtained, wherein RC48 comprises human IgG1 heavy chain constant region and heavy chain variable region RC48-VH, and human IgG1 light chain constant region and light chain variable region RC48-VL.
[0057] Human-mouse chimeric antibody cRC48 was also obtained by the same method. The murine variable region and human IgGlk constant region were ligated into a complete sequence by overlap-extension PCR.
[0058] Each of the amplified fragments was subcloned into the expression vector pcDNA3.0, respectively. The obtained constructs were transfected into suspension CHO cells (Invitrogen) to produce different recombinant antibodies. The antibodies were purified by Protein A and subjected to subsequent characterization. Chimeric anti-HER2 RC48 (referred to as cRC48) comprises mouse-human chimeric heavy chain and light chain. RC48 comprises the humanized heavy chain RC48-VH and the humanized light chain RC48-VL. Both cRC48 and RC48 can be expressed in cells. The antibodies were collected from the supernatants of CHO cells, purified by Protein A, and analyzed by SDS-PAGE under reducing and non-reducing conditions (see
Example 3. Characterization of Anti-HER2 RC48 Antibody
[0059] HER2-binding affinity constant (Kd) of cRC48 (chimeric antibody) and RC48 antibody (humanized antibody) was measured by ELISA. The specific method can be seen in Example 1. Briefly, a 96-well plate was coated with soluble HER2-ECD, followed by incubating with diluted antibodies (Herceptin and chimeric cRC48 as controls), and HRP-conjugated goat F(ab).sub.2 anti-human IgG Fc (Invitrogen) was used as the specific secondary antibody to detect HER2-ECD-related antibodies (all forms of human IgGlx). The surface binding affinity constant (Kd) value for each anti-HER2 antibody was calculated by drawing a binding curve and further using a single-site specific binding nonlinear equation (Journal of Immunological Methods, 270: 155-162, 2002) (
[0060] From three independent assays, it can be seen that RC48 (humanized antibody) shows an average affinity constant of 44 pM, indicating significantly improved HER2-ECD binding affinity compared to cRC48 (average affinity constant 77 pM) and Herceptin (average affinity constant 97 pM). The results are shown in Table 2.
TABLE-US-00006 TABLE 2 Comparison of average affinity constant between antibodies of this invention and Herceptin Sample Average affinity constant Herceptin 97 pM cRC48 77 pM RC48 44 pM
Example 4. Binding Affinity of RC48 (Humanized Antibody) to HER2
[0061] 1) Test for the Binding Affinity of RC48 Antibody to HER2
[0062] Flow cytometry was used to detect the binding affinity of endogenously expressed HER2 in human breast cancer cells with the humanized anti-HER2 antibody RC48. The results are shown in
TABLE-US-00007 Sample Binding affinity Kd Herceptin 10 nM cRC48 5 nM RC48 4 nM
[0063] 2) Antigen Binding Specificity Test
[0064] ELISA was used to determine the binding ability of Herceptin, cRC48, RC48 to different surface antigens: EGFR, HER2, HER3, HER4. The ELISA was carried out as described in Example 1. A 96-well plate was coated with EGFR, HER2, HER3 or HER4, 20 ng for each well, incubated with different anti-HER2 antibodies, i.e., Herceptin, cRC48, and RC48, and then detected using HRP-conjugated goat F (ab).sub.2 anti-mouse IgG-Fc secondary antibody (Invitrogen). The results are shown in
Example 5. Preparation of Antibody-Drug Conjugates
[0065] 1) Purification of Monoclonal Antibody RC48
[0066] Monoclonal antibody RC48 was collected from the supernatant of CHO cell culture using Protein A. The antibody was subjected to SDS-PAGE electrophoresis and SEC analysis and the purity was over 95%. The obtained antibody was dialyzed with a PBS buffer in a 30KD cutoff membrane bag, and concentrated. The antibody concentration was calibrated using a UV absorbance meter for subsequent conjugation.
[0067] 2) Conjugation of Monoclonal Antibody RC48 with Drug
[0068] Reducing agent and protecting agent were respectively prepared with PBS buffer as follows: 1-20 mmol/L TCEP (Tris-2-carboxyethyl-phosphine), 1-20 mmol/L DTPA (Diethylene triamine pentacetate acid) stock solution. The reducing agent was added within a certain concentration range according to the desired coupling ratio, mixed with a certain concentration of monoclonal antibodies (such as: 5-30 mg/mL) according to a certain volume ratio (such as 1:1), so that the final molar ratio of TCEP to antibody is 0.5-6.0:1, and stirred at 25 C. for 2 h. The free thiol group concentration was detected by DTNB method at 412 nm, and the number of free thiol groups was calculated by the molar ratio with the antibody. TCEP reduction has a good reproducibility, and the number of free thiol groups can reach 1.0-8.0 after reduction.
[0069] The antibodies can be directly subjected to conjugation after TCEP reduction. A certain concentration (10 mM) of drug (vc-MMAE, vc-MMAF, or mc-MMAF) (purchased from Shanghai HaoYuan Chemical Technology Co., Ltd.) was prepared in 25% DMSO (dimethyl sulfoxide). The drug was added slowly to the antibody solution according to a molar ratio of the drugs to thiol group at 0.3-2.8:1, and stirred to react at 25 C. for 2 h. DTNB method was used to detect the concentration of free thiol group (close to 0) at 412 nm. Remaining unreacted drugs were removed by Sephadex G-25 and free small molecules such as DMSO. SDS-PAGE, R-HPLC and HIC-HPLC were used to detect the conjugation.
Example 6. Binding Affinity of the Antibody Drug Conjugates
[0070] Binding Affinity Test by ELISA
[0071] The ELISA plate was coated with the recombinant protein HER2-ECD (concentration: 0.5 mg/ml), and incubated overnight at 2 C. to 8 C. After the plate was washed with a plate washer for 3 times, 3% BSA-PBST solution was added for blocking at 37 C. for 2 h, and then the plated was washed with a plate washer for 3 times. Sample loading: the standard, starting from 1000 ng/mL, was diluted with PBST buffer to obtain 11 dilution points, 100 L/well, incubated at 37 C. for 2 h. The plate was washed with a plate washer for 3 times. The secondary antibody (goat anti-human IgG-Fc-HRP) was diluted 5000-fold with PBST buffer. TMB developing solution was added and incubated at room temperature in the dark for 8-10 minutes. The reaction was terminated by 2M H.sub.2SO.sub.4, and microplate reader was used for reading at 450/655 nm. The results are shown in Table 4.
TABLE-US-00008 TABLE 4 Comparison of binding affinity of antibody-drug conjugates (VC is short for mc-vc-pAB) and T-DM1 Sample Binding affinity ng/mL Mole equivalent RC48-VC-MMAE 2.237 15.22 RC48-VC-MMAF 3.349 13.51 RC48-MC-MMAF 2.902 16.42 T-DM1 2.376 15.16
[0072] As shown in the results, of RC48-VC-MMAE (i.e. RC48-mc-vc-pAB-MMAE), RC48-VC-MMAF, and RC48-MC-MMAF have binding affinity to HER2-ECD equivalent to T-DM1.
Example 7. Efficacy and Safety Test of Monotherapy for HER2-Positive Locally Advanced or Metastatic Urothelial Carcinoma
[0073] The purpose of this experiment was to evaluate the efficacy and safety of monotherapy for HER2-positive locally advanced or metastatic urothelial carcinoma. The antibody-drug conjugate for test was RC48-mc-vc-pAB-MMAE. RC48 was coupled with MMAE via linker mc-vc-pAB, and the number of coupling drugs varied from 1 to 8.
[0074] The selection criteria for the subjects are:
[0075] Age: 18 years (minimum age) to 80 years (maximum age) old;
[0076] wherein the selection criteria are:
[0077] 1. The subjects agree to participate in the research and sign an informed consent;
[0078] 2. Male or female, 18 to 60 years old;
[0079] 3. Expected survival time is 12 weeks or more;
[0080] 4. Locally advanced or metastatic bladder urothelial carcinoma which cannot be completely removed by surgery based on pathological diagnosis;
[0081] 5. Subjects who have been diagnosed as locally advanced or metastatic carcinoma that cannot be removed by surgery, and still have disease progression or resistance after receiving at least a first-line systemic chemotherapy;
[0082] 6. At least have measurable lesions specified by RECIST 1.1 standard;
[0083] 7. Positive HER2 expression confirmed by the test laboratory;
[0084] 8. ECOG physical status is 0 or 1 score;
[0085] 9. Adequate heart, bone marrow, liver, and kidney functions;
[0086] 10. Female subjects should be surgically sterilized or postmenopausal patients, or agree to use at least one medically approved contraceptive measures (such as an intrauterine device, contraceptive pills or condoms) during the treatment period and within 6 months after the treatment; male subjects should agree to use at least one medically approved contraceptive measures (such as condoms, abstinence, etc.) during the treatment period and within 6 months after the end of the treatment;
[0087] 11. Be willing and able to follow trial and follow-up procedures.
[0088] Meanwhile, the exclusion criteria are:
[0089] 1. Known to be allergic to recombinant humanized anti-HER2 monoclonal antibody-MMAE conjugate and components thereof;
[0090] 2. Received other anti-tumor treatments within 4 weeks before the treatment;
[0091] 3. Previously received a recombinant humanized anti-HER2 monoclonal antibody-MMAE conjugate;
[0092] 4. Subjected to major surgery within 4 weeks before the start of administration and not fully recovered;
[0093] 5. Received with live vaccine within 4 weeks prior to administration or plan to receive any vaccine during treatment period;
[0094] 6. Having other severe and uncontrollable concomitant diseases that may affect protocol compliance or interfere with interpretation of results;
[0095] 7. Having other malignant tumors within 5 years before the start of administration;
[0096] 8. Suffering from CNS metastatic and/or cancerous meningitis;
[0097] 9. Having active autoimmune disease that requires systemic treatment in the past 2 years;
[0098] 10. Previously received allogeneic hematopoietic stem cell transplant or solid organ transplant;
[0099] 11. Having a large amount of pleural fluid or ascites with clinical symptoms or requiring symptomatic treatment;
[0100] 12. Pregnant or lactating women;
[0101] 13. Positive HIV test results;
[0102] 14. Patients with active hepatitis B or C;
[0103] 15. History of active tuberculosis;
[0104] 16. Suffering from any other diseases, abnormal metabolism, abnormal results of physical examination or abnormal laboratory test, according to the researcher's judgment, it is reasonable to suspect that the subject has a certain disease or condition unsuitable for using the research drug, or affect the interpretation of the research results, or put the patient at high risk;
[0105] 17. Who is estimated to have enough patient compliance to this clinical study.
[0106] Experimental Methods:
[0107] This study include subjects with locally advanced or metastatic urothelial carcinoma who had previously failed or resistant to at least first-line systemic chemotherapy, and had measurable lesions, acceptable physical conditions and organ functions. The tumor tissue pathological sections of the subjects were submitted to the laboratory for HER2 expression confirmation, and the positive result was defined by score 2+ or 3+ in immunohistochemistry (IHC) assay (regardless the results of fluorescence in situ hybridization [FISH] detection).
[0108] The results determination of HER2 in immunohistochemistry (IHC) was according to the criteria for HER2 interpretation in Guideline for HER2 detection in breast cancer (2014 Edition, China). The details are shown in Table 5.
TABLE-US-00009 TABLE 5 Criteria for HER2 interpretation in Guideline for HER2 detection in breast cancer (2014 Edition, China). Up-regulated HER2 expression Scoring criteria IHC results level No cell membrane staining or 10% 0 negative of invasive cancer cells showed incomplete, weak cell membrane staining. >10% of invasive cancer cells showed 1+ negative weak and incomplete cell membrane staining. >10% of invasive cancer cells showed 2+ positive incomplete and/or weak to moderate cell membrane staining or 10% of invasive cancer cells showed strong and intact cell membrane staining. >10% of invasive cancer cells showed 3+ positive strong, complete, and uniform cell membrane staining.
[0109] Subjects meeting all the criteria received RC48-ADC treatment (2.0 mg/kg, intravenous infusion, once every 2 weeks), and the efficacy was evaluated every 6 weeks until disease progressed, intolerable toxicity was produced or the subject dropped out. The primary endpoint of the study was the objectively assessed objective response rate (ORR). The secondary endpoints were progression-free survival, overall survival, and safety of treatment.
[0110] Research Results:
[0111] The study was launched in December 2017. As of Jul. 31, 2018, a total of 18 subjects received treatment, including 15 males and 3 females, with a median age of 63 years. The primary lesions included the bladder (50.0%), renal pelvis (27.8%), and ureter (22.2%). The main metastatic sites were lung, liver, and lymph node. 16 patients (88.9%) had previously received first-line platinum therapy. The immunohistochemical (IHC) results for HER2 expression (performed by the laboratory) showed that there were 11 (61.1%) IHC2+ subjects and 7 (38.9%) IHC3+ subjects.
[0112] Efficacy evaluation was performed on 13 of the 18 subjects, and 10 subjects had partial remission (PR) (wherein 4 subjects had confirmed PR (two consecutive PRs are called confirmed PRs)). According to the RECIST standard: when every subject meets the criteria for partial or complete remission and the efficacy is confirmed again at a later time point (usually four weeks later), then the complete or partial remission can be established. That is, two consecutive evaluations of PR for a subject is called confirmed PR. The other 6 cases have not yet reached the time point for confirming the efficacy, and only one confirmation has been completed. The objective response rate (ORR) is 76.9% (10/13), and the disease control rate (DCR) (10 cases out of 13 subjected to efficacy evaluation were PRs and 2 cases were stable disease (SD)) were 92.3% (12/13). The current maximum treatment period received by the subjects was more than 7 months. Among the subjects achieved remission, 7 (53.8%) had received taxane treatment and 4 (30.8%) had received PD-1/PD-L1 treatment.
[0113] 16 of the 18 subjects were subject to safety evaluation. The most common treatment-related adverse reactions (TRAE5) in safety evaluation were elevated ALT (50.0%, grade 1-2), hypoesthesia (50.0%, grade 1-2) and reduced white blood cell count (50.0%, grade 1-2); TRAE which is greater than grade 3 is a decrease in neutrophil count (12.5%, grade 3). No drug-related serious adverse events (SAE) occurred.
[0114] Descriptions of the obvious effects of the treatment in some cases are shown as follows:
[0115] 1. Patient 01001: Female, 57 years old, with multiple lung metastases after right pelvic cancer surgery. Pathological diagnosis of urothelial carcinoma, HER2 IHC 3+;
[0116] According to
[0117] 2. Patient 01003: Female, 45 years old, with abdominal lymph node metastasis after right pelvic cancer surgery. Pathological diagnosis of urothelial carcinoma, HER2 IHC 3+;
[0118] According to
[0119] 3. Patient 01007: Male, 63 years old, with lung metastasis, liver metastasis, cervical lymph node metastasis, mediastinal metastasis and multiple bone metastasis after bladder cancer, and right pelvic cancer surgery. Pathological diagnosis of urothelial carcinoma, HER2 IHC 3+;
[0120] According to
[0121] The above clinical data and visual pathological changes have shown that the anti-HER2 monoclonal antibody-MMAE conjugate of the present disclosure has a very significant therapeutic effect. It can also be seen through comparison with the currently marketed drugs that it is significantly better than the current similar drugs approved by the European Union and the United States. For example, Atezolizumab (Roche) has an ORR of only 23% in Phase III clinical data and Nivolumab (Bristol-Myers Squibb) merely 19.6%. Erdafitinib (Jansen) only targets patients with urothelial cancer with certain FGFR gene mutations. In contrast, the ORR of the recombinant humanized anti-HER2 monoclonal antibody-MMAE conjugate of the present disclosure is 76.9%, and the disease control rate (DCR) is 92.3%, which is significantly better than similar drugs currently on the market, and the side effects are also significantly smaller than similar drug, without any serious adverse effects (SAE). These make it more available to patients, providing another option for patients with urothelial cancer in need of treatment. It can be seen that the anti-HER2 antibody conjugate of the present disclosure has excellent application prospects in the treatment of urothelial carcinoma, can effectively improve, or even reverse the disease development process in patients, and has achieved unexpected technical effects.