Cucumber Mosaic Virus Resistant Pepper Plants
20200291422 ยท 2020-09-17
Inventors
- Jaecheol Cha (Cheongju, KR)
- Hongmo Kim (Yongin-si, KR)
- Joel M. Kniskem (Sacramento, CA, US)
- Sanghyeon Nam (Cheongju-si, KR)
- Alexandria E. Quezada (Woodland, CA, US)
- Vijay Vontimitta (Bangalore, IN)
Cpc classification
International classification
Abstract
The present disclosure provides Capsicum annuum plants exhibiting increased resistance to resistance-breaking cucumber mosaic virus (rbCMV) strains. Such plants comprise novel introgressed genomic regions associated with disease resistance on chromosome 8. In certain aspects, compositions and methods for producing, breeding, identifying, and selecting plants or germplasm with an increased disease resistance phenotype are provided.
Claims
1. A cultivated variety of a Capsicum annuum plant comprising an introgressed allele on chromosome 8 that confers increased resistance to resistance-breaking cucumber mosaic virus (CMV) strains relative to a plant lacking said introgression.
2. The plant of claim 1, wherein said introgressed allele is further defined as: a) flanked by Marker1 (SEQ ID NO:5) and Marker4 (SEQ ID NO:16) in said plant; b) located between 32,904,383 bp and 2,992,472 bp of chromosome 8 in public pepper genome sequence Pepper.CM334v1.55; or c) comprising the resistance haplotype of HAS-ZF17-4448, wherein a sample of seed comprising said resistance haplotype was deposited under ATCC Accession Number PTA-124434.
3. The plant of claim 1, wherein a) said resistance comprises resistance to CMV isolate Bucheon; or b) the plant is homozygous for said introgressed allele.
4-5. (canceled)
6. A seed that produces the plant of claim 1.
7. A plant part of the plant of claim 1.
8. The plant part of claim 7, wherein the plant part is a cell, a seed, a root, a stem, a leaf, a fruit, a flower, or pollen.
9. A method for producing a cultivated variety of a Capsicum annuum plant with improved resistance to resistance-breaking cucumber mosaic virus (CMV) strains, comprising introgressing into said plant a chromosomal segment from chromosome 8 that confers resistance to resistance-breaking cucumber mosaic virus (CMV) strains relative to a plant lacking said introgression.
10. The method of claim 9, wherein said introgressing comprises: a) crossing a plant comprising said chromosomal segment with itself or with a second Capsicum annuum plant of a different genotype to produce one or more progeny plants; and b) selecting a progeny plant comprising said chromosomal segment.
11. The method of claim 9, wherein selecting a progeny plant comprises: a) detecting at least one allele flanked by Marker1 (SEQ ID NO:5) and Marker4 (SEQ ID NO:16) on chromosome 8; or b) detecting Marker1 (SEQ ID NO:5) or Marker4 (SEQ ID NO:16).
12. (canceled)
13. The method of claim 10, wherein a) the progeny plant is an F.sub.2-F.sub.6 progeny plant; or b) said crossing comprises backcrossing.
14. (canceled)
15. The method of claim 13, wherein said backcrossing comprises from 2-7 generations of backcrosses.
16. The method of claim 9, wherein said introgressed allele comprises the resistance haplotype of HAS-ZF17-4448, wherein a sample of seed comprising said resistance haplotype was deposited under ATCC Accession Number PTA-124434.
17. A Capsicum annuum plant produced by the method of claim 9.
18. A method of producing food or feed comprising obtaining a plant according to claim 1, or a part thereof, and producing said food or feed from said plant or part thereof.
19. A Capsicum annuum plant obtainable by a method comprising the step of introgressing into a plant a resistance to resistance-breaking cucumber mosaic virus (CMV) strains allele, wherein said resistance allele is defined as located in a genomic region flanked by Marker1 (SEQ ID NO:5) and Marker4 (SEQ ID NO:16) on chromosome 8.
20. The Capsicum annuum plant of claim 19, wherein said introgressing comprises backcrossing, marker-assisted selection or assaying for said resistance to resistance-breaking cucumber mosaic virus (CMV) strains.
21. A method of selecting a Capsicum annuum plant exhibiting resistance to resistance-breaking cucumber mosaic virus (CMV) strains, comprising: a) crossing the Capsicum annuum plant of claim 1 with itself or with a second Capsicum annuum plant of a different genotype to produce one or more progeny plants; and b) selecting a progeny plant comprising said introgressed allele.
22. The method of claim 21, wherein selecting said progeny plant comprises: a) identifying a genetic marker genetically linked to said introgression; b) identifying a genetic marker within or genetically linked to a genomic region flanked in the genome of said plant by Marker1 (SEQ ID NO:5) and Marker4 (SEQ ID NO:16) on chromosome 8; or c) detecting Marker1 (SEQ ID NO:5) or Marker4 (SEQ ID NO:16).
23-24. (canceled)
25. The method of claim 21, wherein a) said progeny plant is an F.sub.2-F.sub.6 progeny plant; or b) producing said progeny plant comprises backcrossing.
26. (canceled)
27. A method of producing food or feed comprising obtaining a plant according to claim 17, or a part thereof, and producing said food or feed from said plant or part thereof.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0012]
[0013]
[0014]
DETAILED DESCRIPTION
[0015] Cucumber mosaic virus (CMV) has one of the broadest host ranges of any virus throughout the temperate regions of the world. More than 800 species of plant can be infected, and more than 60 aphid species are vectors for this virus. CMV is a member of the cucumovirus group and is highly diverse. More than 60 strains of CMV have been identified. CMV is known to infect economically important plants, such as tomato, cucumber, potato, tobacco and pepper.
[0016] Previously, CMV resistance sources have been identified in pepper. Several studies have attempted to unravel the genetics for these resistance sources. Depending on the source, loci are reported to be located on multiple linkage groups. The genetic control of these loci differs and is highly source dependent. For source BJ0747 loci were identified on linkage groups 4, 7, 8 and 16, but control of the CMV resistance could not be attributed to a single locus leading to the conclusion that CMV resistance was a complex polygenic trait. Similarly, the CMV resistance of pepper line Perennial is controlled by multiple loci, although these loci were mapped to different linkage groups, namely LG4, 6, and 11. In contrast, only one case of single locus dominant resistance is known. This locus is located on chromosome 2. The locus on chromosome 2, often referred to as cmr-1, is widely used by breeding companies to ensure CMV resistance for their material. However, recent studies show that the dominant locus on chromosome 2 provide imperfect resistance to newly discovered CMV isolates. These resistance-breaking (rbCMV) strains, often referred to as CMVP1 or CMV.sub.P1, dominate Korea, are abundant in India, and likely occur in other regions of Asia. However, CMV is a worldwide problem and it cannot be excluded that these resistance-breaking strains might become dominant in other parts of the world. Especially, in regions where resistant pepper varieties are being grown there likely is strong selection for CMV strains that overcome the current resistance genes used by breeders. Many efforts have been made to identify sources that provide adequate resistance against these new resistance-breaking CMV (rbCMV) isolates, but this has proven to be difficult to such an extent that some researchers have relied on genetic modification to develop tolerant pepper varieties. A single recessive gene, called cmr-2, that provides resistance to one rbCMV isolate has been identified on chromosome 1. In addition, two resistance loci against the same rbCMV isolate have been identified and were mapped to LG4 of pepper.
[0017] The present invention represents a significant advance in that it provides an internal breeding line (internal resistant breeding line) that was identified to contain a single QTL that provides broad-spectrum resistance to CMV, including resistance to isolates of CMV that overcome the CMV resistance of the chromosome 2 locus cmr-1 and regular non-breaking CMV isolates. The QTL is located on the proximal end of chromosome 8 between Marker1 and Marker4. Resistance of the QTL was determined to have an additive effect indicating that homozygous deployment is better than heterozygous deployment.
I. Genomic Regions, Alleles, and Polymorphisms Associated with Increased Resistance to Resistance-Breaking Cucumber Mosaic Virus (CMV) Strains
[0018] The inventors identified a novel QTL on chromosome 8 from an internal resistant breeding line that provide resistance to isolates of rbCMV, such as rbCMV isolate Bucheon, or CMVP1, that can infect varieties with CMV resistance locus on chromosome 2, as well as resistance to regular CMV (non-resistance breaking) isolates. The best results are observed when the QTL is present as a homozygous trait.
[0019] The newly identified QTL on chromosome 8 covers a region of about 18 cM. The newly identified QTL on chromosome 8 is flanked by Marker1 (SEQ ID NO:5), a SNP change [A/G] at 32,904,383 bp on the public genome of Pepper CM334v.1.55 genome, which is available from solgenomics.net, and Marker4 (SEQ ID NO:16), a SNP change [C/T] at 2,992,472 bp on the public genome of Pepper CM334v.1.55. Thus, the present disclosure provides an elite or cultivated pepper plant comprising an introgressed allele on chromosome 8 of an internal resistant breeding line flanked by Marker1 and Marker4 that exhibits resistance to rbCMV.
II. Introgression of Genomic Regions Associated with Disease Resistance
[0020] Marker-assisted introgression involves the transfer of a chromosomal region defined by one or more markers from a first genetic background to a second. Offspring of a cross that contain the introgressed genomic region can be identified by the combination of markers characteristic of the desired introgressed genomic region from a first genetic background and both linked and unlinked markers characteristic of the second genetic background.
[0021] The present invention provides novel markers for identifying and tracking introgression of one or more of the genomic regions from a resistance source, which could be any pepper plant, such as the internal resistant breeding line used herein, into cultivated pepper plant lines. HAS-ZF17-4448, a line containing the resistance locus derived from the internal resistant breeding line used herein, has been deposited with the ATCC (see Section V, below). The invention further provides markers for identifying and tracking the novel introgressions disclosed herein during plant breeding.
[0022] The present invention provides a newly identified QTL that provides resistance to a resistance-breaking CMV (rbCMV) isolate. As used herein, the term rbCMV isolate refers to a CMV isolate capable of causing a disease in a pepper plant that has the widely used CMV resistance allele on chromosome 2, e.g., Bukang.
[0023] Markers within or linked to any of the genomic intervals of the present invention can be used in a variety of breeding efforts that include introgression of genomic regions associated with disease resistance into a desired genetic background. For example, a marker within 30 cM, 25 cM, 20 cM, 16 cM, 15 cM, 10 cM, 5 cM, 2 cM, or 1 cM of a marker associated with disease resistance described herein can be used for marker-assisted introgression of genomic regions associated with a disease resistant phenotype.
[0024] Pepper plants comprising one or more introgressed regions associated with a desired phenotype wherein at least 10%, 25%, 50%, 75%, 90%, or 99% of the remaining genomic sequences carry markers characteristic of the germplasm are also provided. Pepper plants comprising an introgressed region comprising regions closely linked to or adjacent to the genomic regions and markers provided herein and associated with resistance to isolates of CMV that can infect the varieties with a dominant CMV resistance locus on chromosome 2, such as the variety Bukang, and regular non-breaking CMV isolates are also provided.
III. Development of Disease Resistant Capsicum annuum Varieties
[0025] For most breeding objectives, commercial breeders work within germplasm that is cultivated type or elite. As used herein, elite or cultivated variety means a variety that has resulted from breeding and selection for superior horticultural performance for use in agriculture. This germplasm is easier to breed because it generally performs well when evaluated for horticultural performance. A number of cultivated pepper types have been developed, which are agronomically elite and appropriate for commercial cultivation. However, the performance advantage a cultivated germplasm provides can be offset by a lack of allelic diversity. Breeders generally accept this tradeoff because progress is faster when working with cultivated material than when breeding with genetically diverse sources.
[0026] In contrast, when cultivated germplasm is crossed with non-cultivated germplasm, a breeder can gain access to novel alleles from the non-cultivated type. However, this approach presents significant difficulties due to fertility problems associated with crosses between diverse lines, and negative linkage drag from the non-cultivated parent. For example, non-cultivated pepper lines can provide alleles associated with disease resistance. However, this non-cultivated type may have poor horticultural qualities such as vulnerability to necrosis or low fruit production.
[0027] The process of introgressing desirable resistance alleles from non-cultivated lines into elite cultivated lines while avoiding problems with linkage drag or low trait heritability is a long and often arduous process. Success in deploying alleles derived from wild relatives therefore strongly depends on minimal or truncated introgressions that lack detrimental effects and reliable marker assays that replace phenotypic screens. Success is further defined by simplifying genetics for key attributes to allow focus on genetic gain for quantitative traits such as disease resistance. Moreover, the process of introgressing genomic regions from non-cultivated lines can be greatly facilitated by the availability of informative markers.
[0028] One of skill in the art would therefore understand that the alleles, polymorphisms, and markers provided by the invention allow the tracking and introduction of any of the genomic regions identified herein into any genetic background. In addition, the genomic regions associated with disease resistance disclosed herein can be introgressed from one genotype to another and tracked phenotypically or genetically. Thus, Applicants' discovery of accurate markers associated with disease resistance will facilitate the development of pepper plants having beneficial phenotypes. For example, plants and seeds can be genotyped using the markers of the present invention in order to develop varieties comprising desired disease resistance. Moreover, marker-assisted selection (MAS) allows identification of plants which are homozygous or heterozygous for the desired introgression.
[0029] Meiotic recombination is essential for plant breeding because it enables the transfer of favorable alleles across genetic backgrounds, the removal of deleterious genomic fragments, and pyramiding traits that are genetically tightly linked. Limited recombination forces breeders to enlarge segregating populations for progeny screens. In the absence of markers breeders must rely on phenotypic evaluation, which is time-consuming, resource-intensive and not reproducible in every environment, particularly for traits like disease resistance. In contrast markers allow a breeder to select those individuals of interest without having to expose the whole population to phenotypic evaluation. The markers provided by the invention offer an effective alternative and therefore represent a significant advance in the art.
[0030] Phenotypic evaluation of large populations is time-consuming, resource-intensive and not reproducible in every environment. Marker-assisted selection offers a feasible alternative. Molecular assays designed to detect unique polymorphisms, such as SNPs, are versatile. However, they may fail to discriminate alleles within and among pepper species in a single assay, making it necessary to work with a combination of marker assays, e.g., haplotype assays. Structural rearrangements of chromosomes such as deletions impair hybridization and extension of synthetically labeled oligonucleotides. In the case of duplication events, multiple copies are amplified in a single reaction without distinction. The development and validation of accurate and highly predictive markers are therefore essential for successful MAS breeding programs.
IV. Molecular Assisted Breeding Techniques
[0031] Genetic markers that can be used in the practice of the present invention include, but are not limited to, restriction fragment length polymorphisms (RFLPs), amplified fragment length polymorphisms (AFLPs), simple sequence repeats (SSRs), simple sequence length polymorphisms (SSLPs), single nucleotide polymorphisms (SNPs), insertion/deletion polymorphisms (Indels), variable number tandem repeats (VNTRs), and random amplified polymorphic DNA (RAPD), isozymes, and other markers known to those skilled in the art. Vegetable breeders use molecular markers to interrogate a crop's genome and classify material based on genetic, rather than phenotypic, differences. Advanced marker technologies are based on genome sequences, the nucleotide order of distinct, polymorphic genotypes within a species. Such platforms enable selection for horticultural traits with markers linked to favorable alleles, in addition to the organization of germplasm using markers randomly distributed throughout the genome. In the past, a priori knowledge of the genome lacked for major vegetable crops that now have been sequenced. Scientists exploited sequence homology, rather than known polymorphisms, to develop marker platforms. Man-made DNA molecules are used to prime replication of genome fragments when hybridized pair-wise in the presence of a DNA polymerase enzyme. This synthesis, regulated by thermal cycling conditions that control hybridization and replication of DNA strands in the polymerase chain reaction (PCR) to amplify DNA fragments of a length dependent on the distance between each primer pair. These fragments are then detected as markers and commonly known examples include AFLP and RAPD. A third technique, RFLP does not include a DNA amplification step. Amplified fragment length polymorphism (AFLP) technology reduces the complexity of the genome. First, through digestive enzymes cleaving DNA strands in a sequence-specific manner. Fragments are then selected for their size and finally replicated using selective oligonucleotides, each homologous to a subset of genome fragments. As a result, AFLP technology consistently amplifies DNA fragments across genotypes, experiments and laboratories.
[0032] Polymorphisms comprising as little as a single nucleotide change can be assayed in a number of ways. For example, detection can be made by electrophoretic techniques including a single strand conformational polymorphism (Orita, et al., Genomics 8:271-278, 1989), denaturing gradient gel electrophoresis (Myers, E P 0273085), or cleavage fragment length polymorphisms (Life Technologies, Inc., Gaithersburg, Md.), but the widespread availability of DNA sequencing often makes it easier to simply sequence amplified products directly. Once the polymorphic sequence difference is known, rapid assays can be designed for progeny testing, typically involving some version of PCR amplification of specific alleles (PASA; Sommer, et al., Biotechniques 12:82-87, 1992), or PCR amplification of multiple specific alleles (PAMSA; Dutton and Sommer, Biotechniques 11:700-702, 1991).
[0033] Polymorphic markers serve as useful tools for assaying plants for determining the degree of identity of lines or varieties (U.S. Pat. No. 6,207,367). These markers form the basis for determining associations with phenotypes and can be used to drive genetic gain. In certain embodiments of methods of the invention, polymorphic nucleic acids can be used to detect in a Capsicum annuum plant a genotype associated with disease resistance, identify a Capsicum annuum plant with a genotype associated with disease resistance, and to select a Capsicum annuum plant with a genotype associated with disease resistance. In certain embodiments of methods of the invention, polymorphic nucleic acids can be used to produce a Capsicum annuum plant that comprises in its genome an introgressed locus associated with disease resistance. In certain embodiments of the invention, polymorphic nucleic acids can be used to breed progeny Capsicum annuum plants comprising a locus associated with disease resistance.
[0034] Genetic markers may include dominant or codominant markers. Codominant markers reveal the presence of two or more alleles (two per diploid individual). Dominant markers reveal the presence of only a single allele. Markers are preferably inherited in codominant fashion so that the presence of both alleles at a diploid locus, or multiple alleles in triploid or tetraploid loci, are readily detectable, and they are free of environmental variation, i.e., their heritability is 1. A marker genotype typically comprises two marker alleles at each locus in a diploid organism. The marker allelic composition of each locus can be either homozygous or heterozygous. Homozygosity is a condition where both alleles at a locus are characterized by the same nucleotide sequence. Heterozygosity refers to different conditions of the allele at a locus.
[0035] Nucleic acid-based analyses for determining the presence or absence of the genetic polymorphism (i.e., for genotyping) can be used in breeding programs for identification, selection, introgression, and the like. A wide variety of genetic markers for the analysis of genetic polymorphisms are available and known to those of skill in the art. The analysis may be used to select for genes, portions of genes, QTL, alleles, or genomic regions that comprise or are linked to a genetic marker that is linked to or associated with disease resistance in Capsicum annuum plants.
[0036] As used herein, nucleic acid analysis methods include, but are not limited to, PCR-based detection methods (for example, TaqMan assays), microarray methods, mass spectrometry-based methods and/or nucleic acid sequencing methods, including whole genome sequencing. In certain embodiments, the detection of polymorphic sites in a sample of DNA, RNA, or cDNA may be facilitated through the use of nucleic acid amplification methods. Such methods specifically increase the concentration of polynucleotides that span the polymorphic site, or include that site and sequences located either distal or proximal to it. Such amplified molecules can be readily detected by gel electrophoresis, fluorescence detection methods, or other means.
[0037] One method of achieving such amplification employs the polymerase chain reaction (PCR) (Mullis et al., Cold Spring Harbor Symp. Quant. Biol. 51:263-273, 1986; European Patent 50,424; European Patent 84,796; European Patent 258,017; European Patent 237,362; European Patent 201,184; U.S. Pat. Nos. 4,683,202; 4,582,788; and U.S. Pat. No. 4,683,194), using primer pairs that are capable of hybridizing to the proximal sequences that define a polymorphism in its double-stranded form. Methods for typing DNA based on mass spectrometry can also be used. Such methods are disclosed in U.S. Pat. Nos. 6,613,509 and 6,503,710, and references found therein.
[0038] Polymorphisms in DNA sequences can be detected or typed by a variety of effective methods well known in the art including, but not limited to, those disclosed in U.S. Pat. Nos. 5,468,613, 5,217,863; 5,210,015; 5,876,930; 6,030,787; 6,004,744; 6,013,431; 5,595,890; 5,762,876; 5,945,283; 5,468,613; 6,090,558; 5,800,944; 5,616,464; 7,312,039; 7,238,476; 7,297,485; 7,282,355; 7,270,981 and 7,250,252 all of which are incorporated herein by reference in their entirety. However, the compositions and methods of the present invention can be used in conjunction with any polymorphism typing method to type polymorphisms in genomic DNA samples. These genomic DNA samples used include but are not limited to, genomic DNA isolated directly from a plant, cloned genomic DNA, or amplified genomic DNA.
[0039] For instance, polymorphisms in DNA sequences can be detected by hybridization to allele-specific oligonucleotide (ASO) probes as disclosed in U.S. Pat. Nos. 5,468,613 and 5,217,863. U.S. Pat. No. 5,468,613 discloses allele specific oligonucleotide hybridizations where single or multiple nucleotide variations in nucleic acid sequence can be detected in nucleic acids by a process in which the sequence containing the nucleotide variation is amplified, spotted on a membrane and treated with a labeled sequence-specific oligonucleotide probe.
[0040] Target nucleic acid sequence can also be detected by probe ligation methods, for example as disclosed in U.S. Pat. No. 5,800,944 where sequence of interest is amplified and hybridized to probes followed by ligation to detect a labeled part of the probe.
[0041] Microarrays can also be used for polymorphism detection, wherein oligonucleotide probe sets are assembled in an overlapping fashion to represent a single sequence such that a difference in the target sequence at one point would result in partial probe hybridization (Borevitz, et al., Genome Res. 13:513-523, 2003; Cui, et al., Bioinformatics 21:3852-3858, 2005). On any one microarray, it is expected there will be a plurality of target sequences, which may represent genes and/or noncoding regions wherein each target sequence is represented by a series of overlapping oligonucleotides, rather than by a single probe. This platform provides for high throughput screening of a plurality of polymorphisms. Typing of target sequences by microarray-based methods is disclosed in U.S. Pat. Nos. 6,799,122; 6,913,879; and 6,996,476.
[0042] Other methods for detecting SNPs and Indels include single base extension (SBE) methods. Examples of SBE methods include, but are not limited, to those disclosed in U.S. Pat. Nos. 6,004,744; 6,013,431; 5,595,890; 5,762,876; and 5,945,283.
[0043] In another method for detecting polymorphisms, SNPs and Indels can be detected by methods disclosed in U.S. Pat. Nos. 5,210,015; 5,876,930; and 6,030,787 in which an oligonucleotide probe having a 5 fluorescent reporter dye and a 3 quencher dye covalently linked to the 5 and 3 ends of the probe. When the probe is intact, the proximity of the reporter dye to the quencher dye results in the suppression of the reporter dye fluorescence, e.g. by Forster-type energy transfer. During PCR forward and reverse primers hybridize to a specific sequence of the target DNA flanking a polymorphism while the hybridization probe hybridizes to polymorphism-containing sequence within the amplified PCR product. In the subsequent PCR cycle DNA polymerase with 5.fwdarw.3 exonuclease activity cleaves the probe and separates the reporter dye from the quencher dye resulting in increased fluorescence of the reporter.
[0044] In another embodiment, a locus or loci of interest can be directly sequenced using nucleic acid sequencing technologies. Methods for nucleic acid sequencing are known in the art and include technologies provided by 454 Life Sciences (Branford, Conn.), Agencourt Bioscience (Beverly, Mass.), Applied Biosystems (Foster City, Calif.), LI-COR Biosciences (Lincoln, Nebr.), NimbleGen Systems (Madison, Wis.), Illumina (San Diego, Calif.), and VisiGen Biotechnologies (Houston, Tex.). Such nucleic acid sequencing technologies comprise formats such as parallel bead arrays, sequencing by ligation, capillary electrophoresis, electronic microchips, biochips, microarrays, parallel microchips, and single-molecule arrays.
Definitions
[0045] The following definitions are provided to better define the present invention and to guide those of ordinary skill in the art in the practice of the present invention. Unless otherwise noted, terms are to be understood according to conventional usage by those of ordinary skill in the relevant art.
[0046] As used herein, the term plant includes plant cells, plant protoplasts, plant cells of tissue culture from which Capsicum annuum plants can be regenerated, plant calli, plant clumps and plant cells that are intact in plants or parts of plants such as pollen, flowers, seeds, leaves, stems, and the like.
[0047] As used herein, the term population means a genetically heterogeneous collection of plants that share a common parental derivation.
[0048] As used herein, the terms variety and cultivar mean a group of similar plants that by their genetic pedigrees and performance can be identified from other varieties within the same species.
[0049] As used herein, an allele refers to one of two or more alternative forms of a genomic sequence at a given locus on a chromosome.
[0050] A Quantitative Trait Locus (QTL) is a chromosomal location that encodes for at least a first allele that affects the expressivity of a phenotype.
[0051] As used herein, a marker means a detectable characteristic that can be used to discriminate between organisms. Examples of such characteristics include, but are not limited to, genetic markers, biochemical markers, metabolites, morphological characteristics, and agronomic characteristics.
[0052] As used herein, the term phenotype means the detectable characteristics of a cell or organism that can be influenced by gene expression.
[0053] As used herein, the term genotype means the specific allelic makeup of a plant.
[0054] As used herein, elite line or cultivated line means any line that has resulted from breeding and selection for superior agronomic performance. An elite plant refers to a plant belonging to an elite line. Numerous elite lines are available and known to those of skill in the art of Capsicum annuum breeding. An elite population is an assortment of elite individuals or lines that can be used to represent the state of the art in terms of agronomically superior genotypes of a given crop species, such as a Capsicum annuum line. Similarly, an elite germplasm or elite strain of germplasm is an agronomically superior germplasm.
[0055] As used herein, the term introgressed, when used in reference to a genetic locus, refers to a genetic locus that has been introduced into a new genetic background, such as through backcrossing. Introgression of a genetic locus can be achieved through plant breeding methods and/or by molecular genetic methods. Such molecular genetic methods include, but are not limited to, marker assisted selection, various plant transformation techniques and/or methods that provide for homologous recombination, non-homologous recombination, site-specific recombination, and/or genomic modifications that provide for locus substitution or locus conversion.
[0056] As used herein, the term linked, when used in the context of nucleic acid markers and/or genomic regions, means that the markers and/or genomic regions are located on the same linkage group or chromosome such that they tend to segregate together at meiosis.
[0057] As used herein, resistance locus means a locus associated with resistance or tolerance to disease. For instance, a resistance locus according to the present invention may, in one embodiment, control resistance or susceptibility to rbCMV and regular non-breaking CMV isolates.
[0058] As used herein, resistance allele means the nucleic acid sequence associated with resistance or tolerance to disease.
[0059] As used herein resistance or improved resistance in a plant to disease conditions is an indication that the plant is less affected by disease conditions with respect to yield, survivability and/or other relevant agronomic measures, compared to a less resistant, more susceptible plant. Resistance is a relative term, indicating that a resistant plant survives and/or produces better yields in disease conditions compared to a different (less resistant) plant grown in similar disease conditions. As used in the art, disease tolerance is sometimes used interchangeably with disease resistance. One of skill will appreciate that plant resistance to disease conditions varies widely, and can represent a spectrum of more-resistant or less-resistant phenotypes. However, by simple observation, one of skill can generally determine the relative resistance or susceptibility of different plants, plant lines or plant families under disease conditions, and furthermore, will also recognize the phenotypic gradations of resistant.
[0060] The term about is used to indicate that a value includes the standard deviation of error for the device or method being employed to determine the value. The use of the term or in the claims is used to mean and/or unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and to and/or. When used in conjunction with the word comprising or other open language in the claims, the words a and an denote one or more, unless specifically noted. The terms comprise, have and include are open-ended linking verbs. Any forms or tenses of one or more of these verbs, such as comprises, comprising, has, having, includes and including, are also open-ended. For example, any method that comprises, has or includes one or more steps is not limited to possessing only those one or more steps and also covers other unlisted steps. Similarly, any plant that comprises, has or includes one or more traits is not limited to possessing only those one or more traits and covers other unlisted traits.
V. Deposit Information
[0061] A deposit was made of at least 2500 seeds of HAS-ZF17-4448, which comprises the increased disease resistance loci on chromosome 8 from the internal resistant breeding line, as described herein. The deposit was made with the American Type Culture Collection (ATCC), 10801 University Boulevard, Manassas, Va. 20110-2209 USA. The deposit is assigned ATCC Accession No. PTA-124434, and the date of deposit was Aug. 30, 2017. Access to the deposit will be available during the pendency of the application to persons entitled thereto upon request. The deposit will be maintained in the ATCC Depository, which is a public depository, for a period of 30 years, or 5 years after the most recent request, or for the enforceable life of the patent, whichever is longer, and will be replaced if nonviable during that period. Applicant does not waive any infringement of their rights granted under this patent or any other form of variety protection, including the Plant Variety Protection Act (7 U.S.C. 2321 et seq.).
EXAMPLE 1
Screening for CMV Resistance in Pepper
[0062] Phenotypically, resistance to CMV can be determined using a seedling assay in which CMV is mechanically inoculated. Inoculum can be generated from a susceptible host plant where the CMV infection has been allowed to develop for 2-3 weeks. To make inoculum, one harvests symptomatic leaves and grinds these using for example a cold pestle and mortar, or a chilled blender for larger quantities containing 0.05M phosphate buffer set to pH 7.0. Remaining bits of leaf material are removed by filtering the suspension through four layers of cheesecloth. The inoculum is kept on ice, also during inoculation. 1% diatomaceous earth is added to the inoculum as an abrasive for the mechanical inoculation. For the assay 2-3-week-old seedlings are used. The cotyledons and the second true leaf are inoculated. Before inoculation, the seedlings must be kept in the shade for 6-8 hours (50% sunlight). The seedlings are inoculated by rubbing a cotton swap that has been dipped in the inoculum on the cotyledons and the second true leaf. The leaves are rinsed immediately with water after inoculation. Following the inoculation, the plants are kept in the shade for another day to prevent damage from sunlight and to increase infection frequency. For the rest of the experiment, the seedlings are maintained in a greenhouse with 25-35 C. during the day and 22-28 C. during the night. Fertilizer is applied once a week and the plants can be treated with pesticides if necessary. Symptoms should develop within 10-14 days, which include green vein banding, mosaic or mottle on the leaves, deformation and sometimes dwarfing. The disease reaction is measured 3 weeks after inoculation and should be completed within 1-2 days. Leaf symptoms are scored on a 1-9 scale, where 1 means no symptoms on the plant and a 9 represents a high level of systemic symptoms with dwarfing and/or necrosis. In between scores are 3, which is given to plants with mild symptoms on the lower leaves, 5, which is given to plants with more symptoms on the lower and middle leaves, 7, which is given to plants with systemic symptoms and dwarfing. Plants scoring 1-3 are considered resistant, while plants scoring 7-9 are considered susceptible with the plants scoring in between are considered intermediate resistant. To determine the resistance level of a genotype it is necessary to include at least 20 plants per genotype in the experiment. For the control lines, however, it is sufficient to include 5 plants per control. Each experiment should contain at least a susceptible, ideally one that is susceptible to all CMV and one that contains the chromosome 2 resistance locus, and resistant control to ensure that the infection procedure was successful. A resistant control is for example HAS-ZF17-4448, while, e.g., Bukang or California Wonder can be used as susceptible controls. Note that these are examples of control lines and that other plant lines can be used as controls if they consistently fall within a certain score group.
EXAMPLE 2
Identification of the Resistance Locus on Chromosome 8
[0063] A set of 29 pepper lines were tested for resistance to rbCMV, which resulted in the identification of an internal resistant breeding line. This line was subsequently crossed with CMV sensitive pepper lines to identify the QTL conferring rbCMV resistance and test the efficacy of the resistance in other genetic backgrounds.
[0064] An initial mapping population was created using a cross between the first internal susceptible breeding line and the internal resistant breeding line. The F2:F3 population was used to map resistance QTLs. The F.sub.3 population was exposed to the resistance breaking CMV isolate Bucheon and a major QTL was discovered on chromosome 8. To validate the location of the resistance, a DH population was created by crossing a third internal susceptible breeding line (CMV sensitive) to the internal resistant breeding line. The DH lines were genotyped using a wide range of markers and scored for resistance to the rbCMV Bucheon isolate. Again, a significant QTL (
[0065] Testing of the resistance QTL revealed not only that introgressing the allele results in significantly reduced level of infection by rbCMV isolates (
[0066] Mapping of the resistance locus has been problematic as it was found that the tip of chromosome 8 where the QTL is located has a reduced recombination rate. Physical and genetic analysis revealed that the tip contained a small genetic region, but a very large physical region, suggesting that the locus is near the centromere of chromosome 8. Nevertheless, it was possible to find SNP markers associated with the QTL.
[0067] For further fine mapping of the locus, an additional set of markers was developed based on the public genome of pepper (Pepper CM334v.1.55). Five new markers, Marker4, Marker5, Marker6, Marker7, and Marker8, were located between Marker3 and the uncharted distal chromosome end based on the pepper genome sequence. In addition, a BC.sub.4F.sub.2 mapping population segregating for resistance was developed using 154 recombinant families. This population was evaluated based on the level of rbCMV resistance in multiple locations using a complete block design with the recurrent parent as the susceptible control and the resistance donor as resistant control. Simultaneously, the plants were genotyped using the new marker set. Surprisingly, it was found that the expected order of markers, which was based on the public genome sequence, did not correspond to the genetic map generated from the segregating population. This result shows that the current version of the pepper genome is not accurate in this region of chromosome 8, which makes reliable marker development extremely difficult. Nevertheless, it was possible to more accurately define the CMV resistance locus, which is located between Marker1 and Marker4 (
TABLE-US-00001 TABLE 1 Markers for identifying the CMV resistance locus on pepper chromosome 8. Marker Forward Reverse SNP Position Sequence Primer Primer Probe 1 Probe 2 Position SNP on Public (SEQ ID (SEQ ID (SEQ ID (SEQ ID (SEQ ID Marker (cM) Change Genome (bp) NO) NO) NO) NO) NO) Marker4 0.5 [C/T] 2,992,472 16 17 18 19 20 Marker1 19.29999924 [A/G] 32,904,383 5 1 2 3 4 Marker2 29.79999924 [G/A] 123,493,570 10 6 7 8 9 Marker3 47.63867188 [C/T] 130,014,877 15 11 12 13 14
[0068] Forward primer GGTTGGTTTGCTAAATGTTGAGGGTTA (SEQ ID NO:1), reverse primer CCCAGGCTTAATGAAACCTTCTTC (SEQ ID NO:2), probe 1 CTTTGCTTACACTATTTGAC (SEQ ID NO:3) and probe 2 TTGCTTACACTGTTTGAC (SEQ ID NO:4) are used with Marker1. For Marker1, the marker sequence is shown in SEQ ID NO:5. Forward primer TCAGTTGGATCTCATTTAAATGCACTAG (SEQ ID NO:6), reverse primer TTCTGAAGAGCGGTGTTGCT (SEQ ID NO:7), probe 1 AATTGGCAAGTACTACTATTA (SEQ ID NO:8) and probe 2 TGGCAAGTACTGCTATTA (SEQ ID NO:9) are used with Marker2. For Marker2, the marker sequence is shown in SEQ ID NO:10. Forward primer GGAATAGCATCAGAAATTATCAAGGCAAA (SEQ ID NO:11), reverse primer CCGCTGCGCTACTCTGATTT (SEQ ID NO:12), probe 1 AGCCAACATTTGGTATCAGA (SEQ ID NO:13) and probe 2 AGCCAACATTTGATATCAGA (SEQ ID NO:14) are used with Marker3. For Marker3, the marker sequence is shown in SEQ ID NO:15. Forward primer CCTACTTCTTCCACCTTCCCTGAT (SEQ ID NO:17), reverse primer CAGTTAACTAAACCAATCTAGTCACCGA (SEQ ID NO:18), probe 1 TGATTGTTCCTCAATATGTT (SEQ ID NO:19) and probe 2 ATTGTTCCTCGATATGTT (SEQ ID NO:20) are used with Marker4. For Marker4, the marker sequence is shown in SEQ ID NO:16.
[0069] All of the compositions and/or methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and/or methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents that are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.