Cellulase gene

Abstract

An object is to identify endoglucanase and -glucosidase genes by isolating genomic DNA containing cellulase genes, which are classified into endoglucanases or -glucosidases, from Acremonium cellulolyticus, and sequencing the nucleotide sequences thereof. The inventors intensively compared the amino acid sequences of known endoglucanases and -glucosidases with each other to find conserved region of amino acid sequences in Acremonium cellulolyticus, and various primers were designed based on the information. PCR was carried out using the various primers thus designed and genomic DNA or cDNA as a template. As a result, gene fragments of endoglucanases and -glucosidases were obtained. Primers were designed based on the gene fragments, and PCR was carried out to amplify nine genes of endoglucanases and -glucosidases. The nucleotide sequences thereof were sequenced, and the present invention was completed.

Claims

1. A protein having endoglucanase activity and having at least 98% sequence identity to amino acids 1-376 of SEQ ID NO: 8, and containing at least one substitution modification relative to amino acids 1-376 of SEQ ID NO: 8.

2. A cellulase preparation comprising: a) a protein having endoglucanase activity and having at least 98% sequence identity to amino acids 1-376 of SEQ ID NO: 8, and containing at least one substitution modification relative to amino acids 1-376 of SEQ ID NO: 8, or b) a protein comprising amino acids 1-376 of SEQ ID NO: 8, wherein said cellulase preparation comprises an effective amount of an added preservative.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is a restriction map of plasmid pACC3.

(2) FIG. 2 is a restriction map of plasmid pACC5.

(3) FIG. 3 is a restriction map of plasmid pACC6.

(4) FIG. 4 is a restriction map of plasmid pACC7.

(5) FIG. 5 is a restriction map of plasmid pACC8.

(6) FIG. 6 is a restriction map of plasmid pACC9.

(7) FIG. 7 is a restriction map of plasmid pACC10.

(8) FIG. 8 is a restriction map of plasmid pBGLC.

(9) FIG. 9 is a restriction map of plasmid pBGLD.

DESCRIPTION OF EMBODIMENTS

(10) Endoglucanase and -Glucosidase

(11) The protein of the present invention, endoglucanases and -glucosidases, may comprise a sequence corresponding to the mature protein portion of an amino acid sequence selected from SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, and 18, or an amino acid sequence substantially equivalent to the amino acid sequence.

(12) The term amino acid sequence substantially equivalent as used herein means, for example, an amino acid sequence in which there is a modification by the substitution, deletion, and/or addition of one or plural (preferably several) amino acids but the polypeptide activity is not affected, or an amino acid sequence in which it has a 70% identity or more but the polypeptide activity is not affected.

(13) The number of amino acid residues modified is preferably 1 to 40, more preferably 1 to several, still more preferably 1 to 8, and most preferably 1 to 4. Examples of modification which does not affect the activity as used herein include conservative substitution. The term conservative substitution means one or plural amino acid residues are replaced with different amino acids having similar chemical properties without substantial change in the activity of a polypeptide. Examples of the conservative substitution include a substitution of a hydrophobic residue for another hydrophobic residue, and a substitution of a polar residue for another polar residue having the same charge. Amino acids which have similar chemical properties and can be conservatively substituted with each other are known to those skilled in the art. More particularly, examples of nonpolar (hydrophobic) amino acids include alanine, valine, isoleucine, leucine, proline, tryptophan, phenylalanine, and methionine. Examples of polar (neutral) amino acids include glycine, serine, threonine, tyrosine, glutamine, asparagine, and cysteine. Examples of basic amino acids having a positive charge include arginine, histidine, and lysine. Examples of acidic amino acids having a negative charge include aspartic acid and glutamic acid.

(14) The term identity as used herein means a value calculated by FASTA3 [Science, 227, 1435-1441 (1985); Proc. Natl. Acad. Sci. USA, 85, 2444-2448 (1988); http://www.ddbj.nig.ac.jp/E-mail/homology-j.html], a homology search program known to those skilled in the art, using default parameters. It may be an identity of, preferably 80% or more, more preferably 90% or more, still more preferably 95% or more, still more preferably 98% or more, and most preferably 99% or more.

(15) In the protein of the present invention, a polypeptide sequence which does not affect the enzymatic activity of the protein may be added to the N-terminus and/or the C-terminus of the amino acid corresponding to its mature portion or an amino acid substantially equivalent thereto. Examples of the polypeptide sequence include a signal sequence, a detection marker (for example, a FLAG tag), and a polypeptide for purification [for example, glutathione S-transferase (GST)].

(16) Endoglucanase and -Glucosidase Genes

(17) The polynucleotide of the present invention, endoglucanase and -glucosidase genes, may comprise a nucleotide sequence encoding the protein of the present invention; a nucleotide sequence selected from the sequences of nucleotides 136-1437 of SEQ ID NO: 1, nucleotides 128-1615 of SEQ ID NO: 3, nucleotides 169-1598 of SEQ ID NO: 5, nucleotides 70-1376 of SEQ ID NO: 7, nucleotides 141-974 of SEQ ID NO: 9, nucleotides 114-1230 of SEQ ID NO: 11, nucleotides 124-1143 of SEQ ID NO: 13, nucleotides 238-1887 of SEQ ID NO: 15, and nucleotides 66-1765 of SEQ ID NO: 17; or a nucleotide sequence which can hybridize to these nucleotides under stringent conditions.

(18) The term under stringent conditions as used herein means that a membrane after hybridization is washed at a high temperature in a solution of low salt concentration, for example, at 60 C. for 20 minutes in a solution of 2SSC (1SSC: 15 mmol/L trisodium citrate and 150 mmol/L sodium chloride) containing 0.5% SDS.

(19) Cloning of Endoglucanase and -Glucosidase Genes

(20) The endoglucanase and -glucosidase genes of the present invention may be isolated from Acremonium cellulolyticus or its mutant strain, for example, by the following method. Since the nucleotide sequences are disclosed in the present specification, they may be chemically-synthesized artificially.

(21) Genomic DNA is extracted from Acremonium cellulolyticus mycelia by a conventional method. The genomic DNA is digested with an appropriate restriction enzyme, and ligated with an appropriate vector to prepare a genomic DNA library of Acremonium cellulolyticus. Various vectors, for example, a plasmid vector, a phage vector, a cosmid vector, or a BAC vector, may be used as the vector.

(22) Next, appropriate probes may be prepared based on the nucleotide sequences of the endoglucanase and -glucosidase genes disclosed in the present specification, and DNA fragments containing desired endoglucanase and -glucosidase genes may be isolated from the genomic DNA library by hybridization. Alternatively, a desired gene may be isolated by preparing primers capable of amplifying the desired gene, based on the nucleotide sequences of the endoglucanase and -glucosidase genes disclosed in the present specification, performing PCR using the genomic DNA of Acremonium cellulolyticus as a template, and ligating the amplified DNA fragment with an appropriate vector. Since the endoglucanase and -glucosidase genes of the present invention are contained in plasmids pACC3, pACC5, pACC6, pACC7, pACC8, pACC9, pACC10, pBGLC, and pBGLD, these plasmids may be used as a template DNA for PCR. Further, desired DNA fragments may be prepared by digesting the plasmids with appropriate restriction enzymes.

(23) Deposit of Microorganisms

(24) Escherichia coli transformed with pACC3 (Escherichia coli TOP10/pACC3) was internationally deposited in the International Patent Organism Depositary National Institute of Advanced Industrial Science and Technology (Address: AIST Tsukuba Central 6, 1-1, Higashi 1-chome Tukuba-shi, Ibaraki-ken 305-8566 Japan) on Oct. 9, 2008. The international deposit number is FERM BP-11029.

(25) Escherichia coli transformed with pACC5 (Escherichia coli TOP10/pACC5) was internationally deposited in the International Patent Organism Depositary National Institute of Advanced Industrial Science and Technology (Address: AIST Tsukuba Central 6, 1-1, Higashi 1-chome Tukuba-shi, Ibaraki-ken 305-8566 Japan) on Oct. 9, 2008. The international deposit number is FERM BP-11030.

(26) Escherichia coli transformed with pACC6 (Escherichia coli TOP10/pACC6) was internationally deposited in the International Patent Organism Depositary National Institute of Advanced Industrial Science and Technology (Address: AIST Tsukuba Central 6, 1-1, Higashi 1-chome Tukuba-shi, Ibaraki-ken 305-8566 Japan) on Oct. 9, 2008. The international deposit number is FERM BP-11031.

(27) Escherichia coli transformed with pACC7 (Escherichia coli TOP10/pACC7) was internationally deposited in the International Patent Organism Depositary National Institute of Advanced Industrial Science and Technology (Address: AIST Tsukuba Central 6, 1-1, Higashi 1-chome Tukuba-shi, Ibaraki-ken 305-8566 Japan) on Oct. 9, 2008. The international deposit number is FERM BP-11032.

(28) Escherichia coli transformed with pACC8 (Escherichia coli TOP10/pACC8) was internationally deposited in the International Patent Organism Depositary National Institute of Advanced Industrial Science and Technology (Address: AIST Tsukuba Central 6, 1-1, Higashi 1-chome Tukuba-shi, Ibaraki-ken 305-8566 Japan) on Oct. 9, 2008. The international deposit number is FERM BP-11033.

(29) Escherichia coli transformed with pACC9 (Escherichia coli TOP10/pACC9) was internationally deposited in the International Patent Organism Depositary National Institute of Advanced Industrial Science and Technology (Address: AIST Tsukuba Central 6, 1-1, Higashi 1-chome Tukuba-shi, Ibaraki-ken 305-8566 Japan) on Oct. 9, 2008. The international deposit number is FERM BP-11034.

(30) Escherichia coli transformed with pACC10 (Escherichia coli TOP10/pACC10) was internationally deposited in the International Patent Organism Depositary National Institute of Advanced Industrial Science and Technology (Address: AIST Tsukuba Central 6, 1-1, Higashi 1-chome Tukuba-shi, Ibaraki-ken 305-8566 Japan) on Oct. 9, 2008. The international deposit number is FERM BP-11035.

(31) Escherichia coli transformed with pBGLC (Escherichia coli TOP10/pBGLC) was internationally deposited in the International Patent Organism Depositary National Institute of Advanced Industrial Science and Technology (Address: AIST Tsukuba Central 6, 1-1, Higashi 1-chome Tukuba-shi, Ibaraki-ken 305-8566 Japan) on Oct. 9, 2008. The international deposit number is FERM BP-11036.

(32) Escherichia coli transformed with pBGLD (Escherichia coli TOP10/pBGLD) was internationally deposited in the International Patent Organism Depositary National Institute of Advanced Industrial Science and Technology (Address: AIST Tsukuba Central 6, 1-1, Higashi 1-chome Tukuba-shi, Ibaraki-ken 305-8566 Japan) on Oct. 9, 2008. The international deposit number is FERM BP-11037.

(33) Expression Vector and Transformed Microorganism

(34) According to the present invention, an expression vector comprising a DNA comprising a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, or 18, or its modified amino acid sequence (hereinafter simply referred to the DNA sequence of the present invention), in which the DNA can be replicated in a host microorganism and a protein encoded by the DNA can be expressed, is provided. The expression vector may be constructed based on a self-replicating vector such as plasmid, which exists as an extra-chromosomal independent body and does not depend on the replication of the chromosome. The expression vector may be one which may be incorporated into the genome of a host microorganism, when it is transformed with the expression vector, and which may be replicated together with the replication of the chromosome. The expression vector of the present invention may be constructed in accordance with procedures and methods widely used in the field of genetic engineering.

(35) The expression vector of the present invention preferably includes not only the DNA of the present invention, but also a DNA sequence capable of regulating the expression of the DNA, a genetic marker to select a transformant, or the like, to express a protein having a desired activity by incorporating the expression vector into a host microorganism. Examples of the DNA sequence capable of regulating the expression include a promoter, a terminator, and a DNA sequence encoding a signal peptide. The promoter is not limited, so long as it shows a transcriptional activity in a host microorganism, and may be obtained as a DNA sequence which regulates the expression of a gene encoding a protein from a species the same as or different from the microorganism. The signal peptide is not limited, so long as it contributes to the secretion of a protein in a host microorganism, and may be obtained as a DNA sequence which is derived from a gene encoding a protein from a species the same as or different from the microorganism. The genetic marker in the present invention may be appropriately selected in accordance with a method for selecting transformants, and examples thereof include a gene encoding a drug resistance, and a gene which complements auxotrophy.

(36) According to the present invention, a microorganism transformed with the expression vector is provided. The host-vector system is not limited, and for example, a system using Escherichia coli, actinomycetes, yeast, filamentous fungi, or the like, or a system using the same to express a protein fused with other protein, may be used.

(37) Transformation of a microorganism with the expression vector may be carried out in accordance with techniques widely used in this field.

(38) Further, the protein of the present invention may be obtained by cultivating the resulting transformant in an appropriate medium, and isolating it from the culture. Therefore, according to another embodiment of the present invention, a process of producing the novel protein of the present invention is provided. The cultivation of the transformant and its conditions may be essentially the same as those of the microorganism used. After the cultivation of the transformant, the protein of interest can be recovered by a method widely used in this field.

(39) According to a preferred embodiment of the present invention, a yeast cell capable of expressing endoglucanase or -glucosidase enzyme encoded by the DNA sequence of the present invention is provided. Examples of the yeast cell in the present invention include a microorganism belonging to genus Saccharomyces, Hansenula, or Pichia, such as Saccharomyces cerevisiae.

(40) The host filamentous fungus in the present invention may be a microorganism belonging to genus Humicola, Aspergillus, Trichoderma, Fusarium, or Acremonium. Preferred examples thereof include Humicola insolens, Aspergillus niger, Aspergillus oryzae, Trichoderma viride, Fusarium oxysporum, or Acremonium cellulolyticus.

(41) Expression of specific endoglucanase or -glucosidase may be suppressed by incorporating the gene of the present invention, which ligates with an appropriate vector, into Acremonium cellulolyticus to suppress the expression, or by disrupting the gene using homologous recombination to disrupt its function. The gene disruption utilizing homologous recombination may be carried out in accordance with a widely used method, and the construction of vector for gene disruption and the incorporation thereof into a host are obvious to those skilled in the art.

(42) Preparation of Cellulase

(43) The protein of the present invention may be obtained by cultivating the resulting transformant in an appropriate medium, and isolating it from the culture. The cultivation of the transformant and its conditions may be appropriately selected in accordance with the microorganism used. The collection and purification of the protein of interest from the culture may be carried out in accordance with a conventional method.

(44) Cellulase Preparation

(45) According to another embodiment of the present invention, a cellulase preparation containing the protein (cellulase) of the present invention is provided. The cellulase preparation of the present invention may be produced by mixing the cellulase of the present invention with a generally-contained component, for example, an excipient (for example, lactose, sodium chloride, or sorbitol), a surfactant, or a preservative. The cellulase preparation of the present invention may be prepared in an appropriate form, such as powder or liquid.

(46) Use of Cellulase

(47) According to the present invention, it is considered that biomass saccharification may be efficiently improved by treating biomass with the cellulase enzyme (group) or cellulase preparation of the present invention. According to the present invention, a method of improving biomass saccharification, comprising the step of treating biomass with the cellulase enzyme (group) or cellulase preparation of the present invention, is provided. Examples of the biomass which may be treated with the present invention include rice straw, bagasse, corn stover, pomace of fruit such as coconut, and wood waste, and materials obtained by appropriately pretreating the same.

(48) According to the present invention, a method of clearing color of a colored cellulose-containing fabric, comprising the step of treating the colored cellulose-containing fabric with the cellulase enzyme (group) or cellulase preparation, and a method of providing a localized variation in color of a colored cellulose-containing fabric, i.e., a method of giving a stone wash appearance to the colored cellulose-containing fabric. This method comprises the step of treating the colored cellulose-containing fabric with the cellulase enzyme (group) or cellulase preparation of the present invention.

(49) According to the present invention, it is considered that a water freeness of paper pulp may be efficiently improved by treating the paper pulp with the endoglucanase enzyme of the present invention without remarkable reduction in strength. Therefore, according to the present invention, a method of improving a water freeness of paper pulp, comprising the step of treating the paper pulp with the endoglucanase enzyme or cellulase preparation of the present invention, is provided. Examples of the pulp which may be treated with the present invention include waste paper pulp, recycled board pulp, kraft pulp, sulfite pulp, and thermo-mechanical treatment and other high yield pulp.

(50) Further, the digestibility of glucan in animal feed may be improved by using the endoglucanase of the present invention in animal feed. Therefore, according to the present invention, a method of improving a digestibility of animal feed, comprising the step of treating the animal feed with the endoglucanase enzyme or cellulase preparation of the present invention, is provided.

EXAMPLES

(51) The present invention now will be further illustrated by, but is by no means limited to, the following Example.

Example 1: Cloning of ACC3 Gene

(52) (1-1) Isolation of Genomic DNA

(53) Acremonium cellulolyticus ACCP-5-1 was cultivated in an (s) medium (2% bouillon, 0.5% yeast extract, and 2% glucose) at 32 C. for 2 days, and centrifuged to collect mycelia. Genomic DNA was isolated from the obtained mycelia in accordance with the method of Horiuchi et al. (H. Horiuchi et al., J. Bacteriol., 170, 272-278, (1988)).

(54) (1-2) Cloning of ACC3 Gene Fragment

(55) The following primers were prepared based on the sequences of known endoglucanases which were classified into Glycoside Hydrolase family 5.

(56) TABLE-US-00001 ACC3-F: (SEQ ID NO: 19) GGGCGTCTGTRTTYGARTGT ACC3-R: (SEQ ID NO: 20) AAAATGTAGTCTCCCCACCA

(57) PCR was carried out using ACC3-F and ACC3-R as primers and genomic DNA as a template, and using LA Taq polymerase (Takara Bio). The PCR was carried out by repeating a cycle consisting of a reaction at 94 C. for 30 seconds, annealing for 30 seconds, and a reaction at 72 C. for 1 minute 40 times. The annealing temperature was lowered stepwisely from 63 C. to 53 C. in the first 20 cycles, and maintained at 53 C. in the subsequent 20 cycles. The amplified DNA fragment of 1 kbp was inserted into a pCR2.1-TOPO plasmid vector using a TOPO TA cloning kit (Invitrogen) in accordance with a protocol attached to the kit to obtain plasmid TOPO-pACC3-partial.

(58) The inserted DNA fragment cloned into plasmid TOPO-pACC3-partial was sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) and an ABI PRISM genetic analyzer (Applied Biosystems) in accordance with protocols attached thereto. The obtained nucleotide sequence was translated into the amino acid sequence, and a homology search was carried out using the amino acid sequence. The sequence showed a 74% identity with that of endoglucanase EG1 (Q8WZD7) derived from Talaromyces emersonii, and thus, it was judged that the DNA fragment was part of an endoglucanase (Glycoside Hydrolase family 5) gene.

(59) (1-3) Cloning of Full-Length of ACC3 Gene by Inverse PCR

(60) Inverse PCR was carried out in accordance with the method of Triglia et al. (T Triglia et al., Nucleic Acids Research, 16, 8186, (1988)). Genomic DNA from Acremonium cellulolyticus was digested with SalI overnight, and circular DNA was prepared using Mighty Mix (Takara Bio). PCR was carried out using the circular DNA as a template and the following sequences contained in the ACC3 gene fragment as primers to obtain the 5 upstream region and the 3 downstream region of the ACC3 gene.

(61) TABLE-US-00002 ACC3-inv-F: (SEQ ID NO: 21) ACTTCCAGACTTTCTGGTCC ACC3-inv-R: (SEQ ID NO: 22) AGGCCGAGAGTAAGTATCTC

(62) The 5 upstream region and the 3 downstream region were sequenced in accordance with the method described in Example 1-2 to determine the complete nucleotide sequence of the ACC3 gene.

(63) The following primers were prepared based on the nucleotide sequence obtained by the inverse PCR, and PCR was carried out using genomic DNA as a template to amplify the ACC3 gene.

(64) TABLE-US-00003 pACC3-F: (SEQ ID NO: 23) GAAGGATGGTAGATTGTCCG pACC3-R: (SEQ ID NO: 24) ACCGAGAAGGATTTCTCGCA

(65) The amplified DNA was inserted into a pCR2.1-TOPO plasmid vector using a TOPO TA cloning kit (Invitrogen) to obtain plasmid pACC3. Escherichia coli TOP10 (Invitrogen) was transformed with the obtained plasmid pACC3 to obtain Escherichia coli TOP10/pACC3.

(66) (1-4) Preparation of cDNA and Intron Analysis of ACC3 Gene

(67) Acremonium cellulolyticus ACCP-5-1 was cultivated in a cellulase induction medium at 32 C. for 2 days, and centrifuged to collect mycelia. The obtained mycelia were frozen in liquid nitrogen, and ground with a mortar and pestle. Total RNA was isolated from the ground mycelia using ISOGEN (Nippon Gene) in accordance with a protocol attached thereto. Further, mRNA was purified from the total RNA using a mRNA Purification kit (Pharmacia) in accordance with a protocol attached thereto.

(68) cDNA was synthesized from the obtained mRNA using a TimeSaver cDNA Synthesis kit (Pharmacia) in accordance with a protocol attached thereto. The following primers containing the initiation codon and the stop codon were prepared based on the ACC3 gene sequence, and PCR was carried out using the cDNA as a template to amplify the ACC3 cDNA gene.

(69) TABLE-US-00004 (SEQ ID NO: 25) ACC3-N: ATGAAGACCAGCATCATTTCTATC (SEQ ID NO: 26) ACC3-C: TCATGGGAAATAACTCTCCAGAAT

(70) The ACC3 cDNA gene was sequenced in accordance with the method described in Example 1-2, and compared with the pACC3 gene to determine the location of introns.

(71) (1-5) Deduction of Amino Acid Sequence of ACC3

(72) The endoglucanase ACC3 gene isolated from Acremonium cellulolyticus by the method described above consisted of 1302 bp nucleotides corresponding to nucleotides 136-1437 of SEQ ID NO: 1. It was found that the ACC3 gene contained five introns at positions 233-291, 351-425, 579-631, 697-754, and 853-907 of SEQ ID NO: 1. The amino acid sequence of ACC3 deduced from the open reading frame (ORF) was that of SEQ ID NO: 2. It was assumed using a signal sequence prediction software SignalP 3.0 that the amino acid sequence at position 27 to 1 of ACC3 was a signal sequence.

Example 2: Cloning of ACC5 Gene

(73) (2-1) Isolation of Genomic DNA and mRNA and Preparation of cDNA

(74) Genomic DNA of Acremonium cellulolyticus ACCP-5-1 was isolated in accordance with the method described in Example 1-1. cDNA of Acremonium cellulolyticus ACCP-5-1 was prepared in accordance with the method described in Example 1-4.

(75) (2-2) Cloning of ACC5 Gene Fragment

(76) The following primers were prepared based on the N-terminal amino acid sequences of known endoglucanases which were classified into Glycoside Hydrolase family 7 and the poly A nucleotide sequence.

(77) TABLE-US-00005 (SEQ ID NO: 27) ACC5-F: CAGCAGGCCCCCACCCCNGAYAAYYTNGC (SEQ ID NO: 28) ACC5-R: AATTCGCGGCCGCTAAAAAAAAA

(78) PCR was carried out using ACC5-F and ACC5-R as primers and cDNA as a template, and using LA Taq polymerase (Takara Bio). The PCR was carried out by repeating a cycle consisting of a reaction at 94 C. for 30 seconds, annealing for 30 seconds, and a reaction at 72 C. for 1 minute 40 times. The annealing temperature was lowered stepwisely from 63 C. to 53 C. in the first 20 cycles, and maintained at 53 C. in the subsequent 20 cycles. The amplified DNA fragment of 1.5 kbp was inserted into a pCR2.1-TOPO plasmid vector using a TOPO TA cloning kit (Invitrogen) in accordance with a protocol attached to the kit to obtain plasmid TOPO-pACC5-partial.

(79) The inserted DNA fragment cloned into plasmid TOPO-pACC5-partial was sequenced, and the obtained nucleotide sequence was translated into the amino acid sequence, and a homology search was carried out using the amino acid sequence. The sequence showed a 60% identity with that of endoglucanase (Q4WCM9) derived from Aspergillus fumigatus, and thus, it was judged that the DNA fragment was part of an endoglucanase (Glycoside Hydrolase family 7) gene.

(80) (2-3) Cloning of Full-Length of ACC5 Gene by Inverse PCR

(81) In accordance with the method described in Example 1-3, PCR was carried out using circular DNA (obtained by digestion with HindIII) as a template and the following sequences contained in the ACC5 gene fragment as primers to obtain the 5 upstream region and the 3 downstream region of the ACC5 gene.

(82) TABLE-US-00006 (SEQ ID NO: 29) ACC5-inv-F: ATCTCACCTGCAACCTACGA (SEQ ID NO: 30) ACC5-inv-R: CCTCTTCCGTTCCACATAAA

(83) The 5 upstream region and the 3 downstream region were sequenced to determine the complete nucleotide sequence of the ACC5 gene.

(84) The following primers were prepared based on the nucleotide sequence obtained by the inverse PCR, and PCR was carried out using genomic DNA as a template to amplify the ACC5 gene.

(85) TABLE-US-00007 (SEQ ID NO: 31) pACC5-F: ATTGCTCCGCATAGGTTCAA (SEQ ID NO: 32) pACC5-R: TTCAGAGTTAGTGCCTCCAG

(86) The amplified DNA was inserted into a pCR2.1-TOPO plasmid vector using a TOPO TA cloning kit (Invitrogen) to obtain plasmid pACC5. Escherichia coli TOP10 (Invitrogen) was transformed with the obtained plasmid pACC5 to obtain Escherichia coli TOP10/pACC5.

(87) (2-4) Intron Analysis of ACC5 Gene

(88) The following primers containing the initiation codon and the stop codon were prepared based on the ACC5 gene sequence, and PCR was carried out using cDNA as a template to amplify the ACC5 cDNA gene.

(89) TABLE-US-00008 (SEQ ID NO: 33) ACC5-N: ATGGCGACTAGACCATTGGCTTTTG (SEQ ID NO: 34) ACC5-C: CTAAAGGCACTGTGAATAGTACGGA

(90) The nucleotide sequence of the ACC5 cDNA gene was sequenced, and compared with the pACC5 gene to determine the location of introns.

(91) (2-5) Deduction of Amino Acid Sequence of ACC5

(92) The endoglucanase ACC5 gene isolated from Acremonium cellulolyticus by the method described above consisted of 1488 bp nucleotides corresponding to nucleotides 128-1615 of SEQ ID NO: 3. The amino acid sequence of ACC5 deduced from the open reading frame (ORF) was that of SEQ ID NO: 4. It was assumed using a signal sequence prediction software SignalP 3.0 that the amino acid sequence at position 20 to 1 of ACC5 was a signal sequence.

Example 3: Cloning of ACC6 Gene

(93) (3-1) Isolation of Genomic DNA and Preparation of Genomic Library

(94) Genomic DNA of Acremonium cellulolyticus ACCP-5-1 was isolated in accordance with the method described in Example 1-1. The isolated genomic DNA was partially digested with Sau3AI. The resulting product was ligated with BamHI arms of a phage vector dMBL3 cloning kit (Stratagene) using a ligation kit Ver. 2 (Takara Shuzo). The ligation mixture was subjected to ethanol precipitation, and the resulting precipitate was dissolved in a TE buffer. Phage particles were formed using the ligation mixture solution and a MaxPlax packaging kit (Epicenter Technologies), and Escherichia coli XL1-blue MRA(P2) was infected with the phage particles. A genomic DNA library of 1.1104 phages was obtained by this method.

(95) (3-2) Cloning of ACC6 Gene Fragment

(96) The following primers were prepared based on the sequences of known endoglucanases which were classified into Glycoside Hydrolase family 5.

(97) TABLE-US-00009 (SEQ ID NO: 35) ACC6-F: GTGAACATCGCCGGCTTYGAYTTYGG (SEQ ID NO: 36) ACC6-R: CCGTTCCACCGGGCRTARTTRTG

(98) PCR was carried out using ACC6-F and ACC6-R as primers and genomic DNA as a template, and using LA Taq polymerase (Takara Bio). The PCR was carried out by repeating a cycle consisting of a reaction at 94 C. for 30 seconds, annealing for 30 seconds, and a reaction at 72 C. for 1 minute 40 times. The annealing temperature was lowered stepwisely from 63 C. to 53 C. in the first 20 cycles, and maintained at 53 C. in the subsequent 20 cycles. The amplified DNA fragment of 300 bp was inserted into a pCR2.1-TOPO plasmid vector using a TOPO TA cloning kit (Invitrogen) in accordance with a protocol attached to the kit to obtain plasmid TOPO-pACC6-partial.

(99) The inserted DNA fragment cloned into plasmid TOPO-pACC6-partial was sequenced, and the obtained nucleotide sequence was translated into the amino acid sequence, and a homology search was carried out using the amino acid sequence. The sequence showed a 61% identity with that of endoglucanase EG3 (Q7Z7X2) derived from Trichoderma viride, and thus, it was judged that the DNA fragment was part of an endoglucanase (Glycoside Hydrolase family 5) gene. This DNA fragment was amplified by PCR using plasmid TOPO-pACC6-partial as a template in a similar fashion, and the obtained PCR product was labeled using an ECL Direct System (Amersham Pharmacia Biotech) to obtain a probe.

(100) (3-3) Screening by Plaque Hybridization

(101) The phage plaques prepared in Example 3-1 were transferred to a Hybond N+ nylon transfer membrane (Amersham). The membrane was subjected to alkaline denaturation, washed with 5SSC (SSC: 15 mmol/L trisodium citrate and 150 mmol/L sodium chloride), and dried to immobilize the DNA on the membrane. After prehybridization (42 C.) for 1 hour, the HRP-labeled probe was added, and hybridization (42 C.) was carried out for 4 hours. The probe was removed by washing with 0.5SSC supplemented with 6 M urea and 0.4% SDS twice, and with 2SSC twice.

(102) The nylon membrane after washing the probe was immersed in a detection solution for 1 minute, and exposed to Hyperfilm ECL (the same manufacturer) to obtain a positive clone. DNA was prepared from the positive clone in accordance with the method of Maniatis et al. (J. Sambrook, E. F. Fritsch and T. Maniatls, Molecular Cloning, Cold Spring Harbor Laboratory Press. 1989) using LE392 as host Escherichia coli. LE392 was cultivated in an LB-MM medium (1% peptone, 0.5% yeast extract, 0.5% sodium chloride, 10 mmol/L magnesium sulfate, and 0.2% maltose) overnight. LE392 was infected with a phage solution derived from the single plaque, and cultivated in the LB-MM medium overnight. Sodium chloride and chloroform were added to the culture to final concentrations of 1 M and 0.8%, respectively, to promote the lysis of Escherichia coli. The culture was centrifuged to remove the bacterial residue, and phage particles were collected from a precipitate generated by 10% PEG 6000. The phage particles were digested with proteinase K in the presence of SDS, and subjected to phenol treatment followed by ethanol precipitation to collect phage DNA.

(103) The obtained DNA was analyzed by Southern blotting using an ECL Direct System. As a result of hybridization using the PCR-amplified fragment of Example 3-2 as a probe, an XbaI fragment of 2.9 kbp showed hybridization patterns common to chromosomal DNA. This XbaI fragment was cloned into pUC118 to obtain plasmid pUC-ACC6, and the nucleotide sequence of the plasmid was sequenced.

(104) (3-4) Cloning of Full-Length of ACC6 Gene

(105) The following primers were prepared based on the nucleotide sequence obtained from pUC-ACC6, and PCR was carried out using genomic DNA as a template to amplify the ACC6 gene.

(106) TABLE-US-00010 (SEQ ID NO: 37) pACC6-F: CTCTGCATTGAATCCCGAGA (SEQ ID NO: 38) pACC6-R: GCAACGCTAAAGTGCTCATC

(107) The amplified DNA was inserted into a pCR2.1-TOPO plasmid vector using a TOPO TA cloning kit (Invitrogen) to obtain plasmid pACC6. Escherichia coli TOP10 (Invitrogen) was transformed with the obtained plasmid pACC6 to obtain Escherichia coli TOP10/pACC6.

(108) (3-5) Preparation of cDNA and Intron Analysis of ACC6 Gene

(109) cDNA of Acremonium cellulolyticus ACCP-5-1 was prepared in accordance with the method described in Example 1-4. The following primers containing the initiation codon and the stop codon were prepared based on the ACC6 gene sequence, and PCR was carried out using the cDNA as a template to amplify the ACC6 cDNA gene.

(110) TABLE-US-00011 (SEQ ID NO: 39) ACC6-N: ATGACAATCATCTCAAAATTCGGT (SEQ ID NO: 40) ACC6-C: TCAGGATTTCCACTTTGGAACGAA

(111) The nucleotide sequence of the ACC6 cDNA gene was sequenced, and compared with the pACC6 gene to determine the location of introns.

(112) (3-6) Deduction of Amino Acid Sequence of ACC6

(113) The endoglucanase ACC6 gene isolated from Acremonium cellulolyticus by the method described above consisted of 1430 bp nucleotides corresponding to nucleotides 169-1598 of SEQ ID NO: 5. It was found that the ACC6 gene contained three introns at positions 254-309, 406-461, and 1372-1450 of SEQ ID NO: 5. The amino acid sequence of ACC6 deduced from the open reading frame (ORF) was that of SEQ ID NO: 6. It was assumed using a signal sequence prediction software SignalP 3.0 that the amino acid sequence at position 21 to 1 of ACC6 was a signal sequence.

Example 4: Cloning of ACC7 Gene

(114) (4-1) Isolation of Genomic DNA and Preparation of Genomic Library

(115) A genomic DNA library of Acremonium cellulolyticus ACCP-5-1 was prepared in accordance with the method described in Example 3-1.

(116) (4-2) Cloning of ACC7 Gene Fragment

(117) The following primers were prepared based on the sequences of known endoglucanases which were classified into Glycoside Hydrolase family 5.

(118) TABLE-US-00012 (SEQ ID NO: 41) ACC7-F: CACGCCATGATCGACCCNCAYAAYTAYG (SEQ ID NO: 42) ACC7-R: ACCAGGGGCCGGCNGYCCACCA

(119) PCR was carried out using ACC7-F and ACC7-R as primers and genomic DNA as a template, and using LA Taq polymerase (Takara Bio). The PCR was carried out by repeating a cycle consisting of a reaction at 94 C. for 30 seconds, annealing for 30 seconds, and a reaction at 72 C. for 1 minute 40 times. The annealing temperature was lowered stepwisely from 63 C. to 53 C. in the first 20 cycles, and maintained at 53 C. in the subsequent 20 cycles. The amplified DNA fragment of 670 bp was inserted into a pCR2.1-TOPO plasmid vector using a TOPO TA cloning kit (Invitrogen) in accordance with a protocol attached to the kit to obtain plasmid TOPO-pACC7-partial.

(120) The inserted DNA fragment cloned into plasmid TOPO-pACC7-partial was sequenced, and the obtained nucleotide sequence was translated into the amino acid sequence, and a homology search was carried out using the amino acid sequence. The sequence showed a 63% identity with that of endoglucanase (Q4WM09) derived from Aspergillus fumigatus, and thus, it was judged that the DNA fragment was part of an endoglucanase (Glycoside Hydrolase family 5) gene. This DNA fragment was amplified by PCR using plasmid TOPO-pACC7-partial as a template in a similar fashion, and the obtained PCR product was labeled using an ECL Direct System (Amersham Pharmacia Biotech) to obtain a probe.

(121) (4-3) Screening by Plaque Hybridization

(122) The genomic DNA library was screened in accordance with the method described in Example 3-3 to obtain a positive clone. The obtained positive clone was analyzed by Southern blotting, and an XbaI fragment of 3.7 kbp showed hybridization patterns common to chromosomal DNA. This XbaI fragment was cloned into pUC118 to obtain plasmid pUC-ACC7, and the nucleotide sequence of the plasmid was sequenced.

(123) (4-4) Cloning of Full-Length of ACC7 Gene

(124) The following primers were prepared based on the nucleotide sequence obtained from pUC-ACC7, and PCR was carried out using genomic DNA as a template to amplify the ACC7 gene.

(125) TABLE-US-00013 (SEQ ID NO: 43) pACC7-F: CAGTCAGTTGTGTAGACACG (SEQ ID NO: 44) pACC7-R: ACTCAGCTGGGTCTTCATAG

(126) The amplified DNA was inserted into a pCR2.1-TOPO plasmid vector using a TOPO TA cloning kit (Invitrogen) to obtain plasmid pACC7. Escherichia coli TOP10 (Invitrogen) was transformed with the obtained plasmid pACC7 to obtain Escherichia coli TOP10/pACC7.

(127) (4-5) Preparation of cDNA and Intron Analysis of ACC7 Gene

(128) cDNA of Acremonium cellulolyticus ACCP-5-1 was prepared in accordance with the method described in Example 1-4. The following primers containing the initiation codon and the stop codon were prepared based on the ACC7 gene sequence, and PCR was carried out using the cDNA as a template to amplify the ACC7 cDNA gene.

(129) TABLE-US-00014 (SEQ ID NO: 45) ACC7-N: ATGAGGTCTACATCAACATTTGTA (SEQ ID NO: 46) ACC7-C: CTAAGGGGTGTAGGCCTGCAGGAT

(130) The nucleotide sequence of the ACC7 cDNA gene was sequenced, and compared with the pACC7 gene to determine the location of introns.

(131) (4-6) Deduction of Amino Acid Sequence of ACC7

(132) The endoglucanase ACC7 gene isolated from Acremonium cellulolyticus by the method described above consisted of 1307 bp nucleotides corresponding to nucleotides 70-1376 of SEQ ID NO: 7. It was found that the ACC7 gene contained two introns at positions 451-500 and 765-830 of SEQ ID NO: 7. The amino acid sequence of ACC7 deduced from the open reading frame (ORF) was that of SEQ ID NO: 8. It was assumed using a signal sequence prediction software SignalP 3.0 that the amino acid sequence at position 20 to 1 of ACC7 was a signal sequence.

Example 5: Cloning of ACC8 Gene

(133) (5-1) Isolation of Genomic DNA and Preparation of Genomic Library

(134) A genomic DNA library of Acremonium cellulolyticus ACCP-5-1 was prepared in accordance with the method described in Example 3-1.

(135) (5-2) Cloning of ACC8 Gene Fragment

(136) The following primers were prepared based on the DNA sequences corresponding to the N-terminal and c-terminal amino acid sequences of endoglucanase III derived from Penicillium verruculosum.

(137) TABLE-US-00015 (SEQ ID NO: 47) MSW-N: CAACAGAGTCTATGCGCTCAATACTCGAGCTACACCAGT (SEQ ID NO: 48) MSW-C: CTAATTGACAGCTGCAGACCAA

(138) PCR was carried out using MSW-N and MSW-C as primers and genomic DNA as a template, and using LA Taq polymerase (Takara Bio). The PCR was carried out by repeating a cycle consisting of a reaction at 94 C. for 30 seconds, annealing for 30 seconds, and a reaction at 72 C. for 1 minute 40 times. The annealing temperature was lowered stepwisely from 63 C. to 53 C. in the first 20 cycles, and maintained at 53 C. in the subsequent 20 cycles. The amplified DNA fragment of 800 bp was inserted into a pCR2.1-TOPO plasmid vector using a TOPO TA cloning kit (Invitrogen) in accordance with a protocol attached to the kit to obtain plasmid TOPO-pACC8-partial.

(139) The inserted DNA fragment cloned into plasmid TOPO-pACC8-partial was sequenced, and the obtained nucleotide sequence was translated into the amino acid sequence, and a homology search was carried out using the amino acid sequence. The sequence showed a 60% identity with that of endoglucanase Cel12A (Q8NJY4) derived from Trichoderma viride, and thus, it was judged that the DNA fragment was part of an endoglucanase (Glycoside Hydrolase family 12) gene. This DNA fragment was amplified by PCR using plasmid TOPO-pACC8-partial as a template in a similar fashion, and the obtained PCR product was labeled using an ECL Direct System (Amersham Pharmacia Biotech) to obtain a probe.

(140) (5-3) Screening by Plaque Hybridization

(141) The genomic DNA library was screened in accordance with the method described in Example 3-3 to obtain a positive clone. The obtained positive clone was analyzed by Southern blotting, and a SalI fragment of about 5 kbp showed hybridization patterns common to chromosomal DNA. This SalI fragment was cloned into pUC118 to obtain plasmid pUC-ACC8, and the nucleotide sequence of the plasmid was sequenced.

(142) (5-4) Cloning of Full-Length of ACC8 Gene

(143) The following primers were prepared based on the nucleotide sequence obtained from pUC-ACC8, and PCR was carried out using genomic DNA as a template to amplify the ACC8 gene.

(144) TABLE-US-00016 (SEQ ID NO: 49) pACC8-F: AAAGACCGCGTGTTAGGATC (SEQ ID NO: 50) pACC8-R: CGCGTAGGAAATAAGACACC

(145) The amplified DNA was inserted into a pCR2.1-TOPO plasmid vector using a TOPO TA cloning kit (Invitrogen) to obtain plasmid pACC8. Escherichia coli TOP10 (Invitrogen) was transformed with the obtained plasmid pACC8 to obtain Escherichia coli TOP10/pACC8.

(146) (5-5) Preparation of cDNA and Intron Analysis of ACC8 Gene

(147) cDNA of Acremonium cellulolyticus ACCP-5-1 was prepared in accordance with the method described in Example 1-4. The following primers containing the initiation codon and the stop codon were prepared based on the ACC8 gene sequence, and PCR was carried out using the cDNA as a template to amplify the ACC8 cDNA gene.

(148) TABLE-US-00017 (SEQ ID NO: 51) ACC8-N: ATGAAGCTAACTTTTCTCCTGAAC (SEQ ID NO: 52) ACC8-C: CTAATTGACAGATGCAGACCAATG

(149) The nucleotide sequence of the ACC8 cDNA gene was sequenced, and compared with the pACC8 gene to determine the location of introns.

(150) (5-6) Deduction of Amino Acid Sequence of ACC8

(151) The endoglucanase ACC8 gene isolated from Acremonium cellulolyticus by the method described above consisted of 834 bp nucleotides corresponding to nucleotides 141-974 of SEQ ID NO: 9. It was found that the ACC8 gene contained two introns at positions 551-609 and 831-894 of SEQ ID NO: 9. The amino acid sequence of ACC8 deduced from the open reading frame (ORF) was that of SEQ ID NO: 10. It was assumed using a signal sequence prediction software SignalP 3.0 that the amino acid sequence at position 15 to 1 of ACC8 was a signal sequence.

Example 6: Cloning of ACC9 Gene

(152) (6-1) Isolation of Genomic DNA and mRNA and Preparation of cDNA

(153) Genomic DNA of Acremonium cellulolyticus ACCP-5-1 was isolated in accordance with the method described in Example 1-1. cDNA of Acremonium cellulolyticus ACCP-5-1 was prepared in accordance with the method described in Example 1-4.

(154) (6-2) Cloning of ACC9 Gene Fragment

(155) The following primers were prepared based on the sequences of known endoglucanases which were classified into Glycoside Hydrolase family 45.

(156) TABLE-US-00018 (SEQ ID NO: 53) ACC9-F: CCGGCTGCGGCAARTGYTAYMA (SEQ ID NO: 54) ACC9-R: AGTACCACTGGTTCTGCACCTTRCANGTNSC

(157) PCR was carried out using ACC9-F and ACC9-R as primers and genomic as a template, and using LA Taq polymerase (Takara Bio). The PCR was carried out by repeating a cycle consisting of a reaction at 94 C. for 30 seconds, annealing for 30 seconds, and a reaction at 72 C. for 1 minute 40 times. The annealing temperature was lowered stepwisely from 63 C. to 53 C. in the first 20 cycles, and maintained at 53 C. in the subsequent 20 cycles. The amplified DNA fragment of 800 bp was inserted into a pCR2.1-TOPO plasmid vector using a TOPO TA cloning kit (Invitrogen) in accordance with a protocol attached to the kit to obtain plasmid TOPO-pACC9-partial.

(158) The inserted DNA fragment cloned into plasmid TOPO-pACC9-partial was sequenced, and the obtained nucleotide sequence was translated into the amino acid sequence, and a homology search was carried out using the amino acid sequence. The sequence showed a 79% identity with that of endoglucanase EGV (Q7Z7X0) derived from Trichoderma viride, and thus, it was judged that the DNA fragment was part of an endoglucanase (Glycoside Hydrolase family 45) gene.

(159) (6-3) Cloning of Full-Length of ACC9 Gene by Inverse PCR

(160) In accordance with the method described in Example 1-3, PCR was carried out using circular DNA (obtained by digestion with SalI or XbaI) as a template and the following sequences contained in the ACC9 gene fragment as primers to obtain the 5 upstream region and the 3 downstream region of the ACC9 gene.

(161) TABLE-US-00019 (SEQ ID NO: 55) ACC9-inv-F: CGAAGTGTTTGGTGACAACG (SEQ ID NO: 56) ACC9-inv-R: GTGGTAGCTGTATCCGTAGT

(162) The 5 upstream region and the 3 downstream region were sequenced to determine the complete nucleotide sequence of the ACC9 gene.

(163) The following primers were prepared based on the nucleotide sequence obtained by the inverse PCR, and PCR was carried out using genomic DNA as a template to amplify the ACC9 gene.

(164) TABLE-US-00020 (SEQ ID NO: 57) pACC9-F: TACATTCCGAAGGCACAGTT (SEQ ID NO: 58) pACC9-R: CTGAGCTGATTATCCTGACC

(165) The amplified DNA was inserted into a pCR2.1-TOPO plasmid vector using a TOPO TA cloning kit (Invitrogen) to obtain plasmid pACC9. Escherichia coli TOP10 (Invitrogen) was transformed with the obtained plasmid pACC9 to obtain Escherichia coli TOP10/pACC9.

(166) (6-4) Intron Analysis of ACC9 Gene

(167) The following primers containing the initiation codon and the stop codon were prepared based on the ACC9 gene sequence, and PCR was carried out using cDNA as a template to amplify the ACC9 cDNA gene.

(168) TABLE-US-00021 (SEQ ID NO: 59) ACC9-N: ATGAAGGCTTTCTATCTTTCTCTC (SEQ ID NO: 60) ACC9-C: TTAGGACGAGCTGACGCACTGGTA

(169) The nucleotide sequence of the ACC9 cDNA gene was sequenced, and compared with the pACC9 gene to determine the location of introns.

(170) (6-5) Deduction of Amino Acid Sequence of ACC9

(171) The endoglucanase ACC9 gene isolated from Acremonium cellulolyticus by the method described above consisted of 1117 bp nucleotides corresponding to nucleotides 114-1230 of SEQ ID NO: 11. It was found that the ACC9 gene contained two introns at positions 183-232 and 299-357 of SEQ ID NO: 11. The amino acid sequence of ACC9 deduced from the open reading frame (ORF) was that of SEQ ID NO: 12. It was assumed using a signal sequence prediction software SignalP 3.0 that the amino acid sequence at position 16 to 1 of ACC5 was a signal sequence.

Example 7: Cloning of ACC10 Gene

(172) (7-1) Isolation of Genomic DNA and mRNA and Preparation of cDNA

(173) Genomic DNA of Acremonium cellulolyticus ACCP-5-1 was isolated in accordance with the method described in Example 1-1. cDNA of Acremonium cellulolyticus ACCP-5-1 was prepared in accordance with the method described in Example 1-4.

(174) (7-2) Cloning of ACC10 Gene Fragment

(175) The following primers were prepared based on the sequences of known endoglucanases which were classified into Glycoside Hydrolase family 61 and the poly A nucleotide sequence.

(176) TABLE-US-00022 (SEQ ID NO: 61) ACC10-F: GGTGTACGTGGGCACCAAYGGNMGNGG (SEQ ID NO: 62) ACC10-R: AATTCGCGGCCGCTAAAAAAAAA

(177) PCR was carried out using ACC10-F and ACC10-R as primers and cDNA as a template, and using LA Taq polymerase (Takara Bio). The PCR was carried out by repeating a cycle consisting of a reaction at 94 C. for 30 seconds, annealing for 30 seconds, and a reaction at 72 C. for 1 minute 40 times. The annealing temperature was lowered stepwisely from 63 C. to 53 C. in the first 20 cycles, and maintained at 53 C. in the subsequent 20 cycles. The amplified DNA fragment of 300 bp was inserted into a pCR2.1-TOPO plasmid vector using a TOPO TA cloning kit (Invitrogen) in accordance with a protocol attached to the kit to obtain plasmid TOPO-pACC10-partial.

(178) The inserted DNA fragment cloned into plasmid TOPO-pACC10-partial was sequenced, and the obtained nucleotide sequence was translated into the amino acid sequence, and a homology search was carried out using the amino acid sequence. The sequence showed a 65% identity with that of endoglucanase EGIV (Q0D0T6) derived from Aspergillus terreus, and thus, it was judged that the DNA fragment was part of an endoglucanase (Glycoside Hydrolase family 61) gene.

(179) (7-3) Cloning of Full-Length of ACC10 Gene by Inverse PCR

(180) In accordance with the method described in Example 1-3, PCR was carried out using circular DNA (obtained by digestion with HindIII) as a template and the following sequences contained in the ACC10 gene fragment as primers to obtain the 5 upstream region and the 3 downstream region of the ACC10 gene.

(181) TABLE-US-00023 (SEQ ID NO: 63) ACC10-inv-F: TTCTGCTACTGCGGTTGCTA (SEQ ID NO: 64) ACC10-inv-R: GAATAACGTAGGTCGACAAG

(182) The 5 upstream region and the 3 downstream region were sequenced to determine the complete nucleotide sequence of the ACC10 gene.

(183) The following primers were prepared based on the nucleotide sequence obtained by the inverse PCR, and PCR was carried out using genomic DNA as a template to amplify the ACC10 gene.

(184) TABLE-US-00024 (SEQ ID NO: 65) pACC10-F: CGTTGACCGAAAGCCACTT (SEQ ID NO: 66) pACC10-R: TGGCCTAAAGCTAAATGATG

(185) The amplified DNA was inserted into a pCR2.1-TOPO plasmid vector using a TOPO TA cloning kit (Invitrogen) to obtain plasmid pACC10. Escherichia coli TOP10 (Invitrogen) was transformed with the obtained plasmid pACC9 to obtain Escherichia coli TOP10/pACC10.

(186) (7-4) Intron Analysis of ACC10 Gene

(187) The following primers containing the initiation codon and the stop codon were prepared based on the ACC10 gene sequence, and PCR was carried out using cDNA as a template to amplify the ACC10 cDNA gene.

(188) TABLE-US-00025 (SEQ ID NO: 67) ACC10-N: ATGCCTTCTACTAAAGTCGCTGCCC (SEQ ID NO: 68) ACC10-C: TTAAAGGACAGTAGTGGTGATGACG

(189) The nucleotide sequence of the ACC10 cDNA gene was sequenced, and compared with the pACC10 gene to determine the location of introns.

(190) (7-5) Deduction of Amino Acid Sequence of ACC10

(191) The endoglucanase ACC10 gene isolated from Acremonium cellulolyticus by the method described above consisted of 1020 bp nucleotides corresponding to nucleotides 124-1143 of SEQ ID NO: 13. It was found that the ACC10 gene contained an intron at position 225-275 of SEQ ID NO: 13. The amino acid sequence of ACC10 deduced from the open reading frame (ORF) was that of SEQ ID NO: 14. It was assumed using a signal sequence prediction software SignalP 3.0 that the amino acid sequence at position 21 to 1 of ACC10 was a signal sequence.

Example 8: Cloning of BGLC Gene

(192) (8-1) Preparation of Genomic DNA and cDNA

(193) Genomic DNA of Acremonium cellulolyticus ACCP-5-1 was isolated in accordance with the method described in Example 1-1. cDNA of Acremonium cellulolyticus ACCP-5-1 was prepared in accordance with the method described in Example 1-4.

(194) (8-2) Cloning of BGLC Gene Fragment

(195) The following primers were prepared based on the sequences of known -glucosidases which were classified into Glycoside Hydrolase family 1.

(196) TABLE-US-00026 (SEQ ID NO: 69) BGLC-F: CCTGGGTGACCCTGTACCAYTGGGAYYT (SEQ ID NO: 70) BGLC-R: TGGGCAGGAGCAGCCRWWYTCNGT

(197) PCR was carried out using BGLC-F and BGLC-R as primers and genomic DNA as a template, and using LA Taq polymerase (Takara Bio). The PCR was carried out by repeating a cycle consisting of a reaction at 94 C. for 30 seconds, annealing for 30 seconds, and a reaction at 72 C. for 1 minute 40 times. The annealing temperature was lowered stepwisely from 63 C. to 53 C. in the first 20 cycles, and maintained at 53 C. in the subsequent 20 cycles. The amplified DNA fragment of 1.2 kbp was inserted into a pCR2.1-TOPO plasmid vector using a TOPO TA cloning kit (Invitrogen) in accordance with a protocol attached to the kit to obtain plasmid TOPO-pBGLC-partial.

(198) The inserted DNA fragment cloned into plasmid TOPO-pBGLC-partial was sequenced, and the obtained nucleotide sequence was translated into the amino acid sequence, and a homology search was carried out using the amino acid sequence. The sequence showed a 69% identity with that of -glucosidase 1 (Q4WRG4) derived from Aspergillus fumigatus, and thus, it was judged that the DNA fragment was part of a -glucosidase (Glycoside Hydrolase family 1) gene.

(199) (8-3) Cloning of Full-Length of BGLC Gene by Inverse PCR

(200) In accordance with the method described in Example 1-3, PCR was carried out using circular DNA (obtained by digestion with XbaI) as a template and the following sequences contained in the BGLC gene fragment as primers to obtain the 5 upstream region and the 3 downstream region of the BGLC gene.

(201) TABLE-US-00027 (SEQ ID NO: 71) BGLC-inv-F: GGAGTTCTTCTACATTTCCC (SEQ ID NO: 72) BGLC-inv-R: AACAAGGACGGCGTGTCAGT

(202) The 5 upstream region and the 3 downstream region were sequenced to determine the complete nucleotide sequence of the BGLC gene.

(203) The following primers were prepared based on the nucleotide sequence obtained by the inverse PCR, and PCR was carried out using genomic DNA as a template to amplify the BGLC gene.

(204) TABLE-US-00028 (SEQ ID NO: 73) pBGLC-F: CTCCGTCAAGTGCGAAGTAT (SEQ ID NO: 74) pBGLC-R: GGCTCGCTAATACTAACTGC

(205) The amplified DNA was inserted into a pCR2.1-TOPO plasmid vector using a TOPO TA cloning kit (Invitrogen) to obtain plasmid pBGLC. Escherichia coli TOP10 (Invitrogen) was transformed with the obtained plasmid pBGLC to obtain Escherichia coli TOP10/pBGLC.

(206) (8-4) Intron Analysis of BGLC Gene

(207) The following primers containing the initiation codon and the stop codon were prepared based on the BGLC gene sequence, and PCR was carried out using cDNA as a template to amplify the BGLC cDNA gene.

(208) TABLE-US-00029 (SEQ ID NO: 75) BGLC-N: ATGGGCTCTACATCTCCTGCCCAA (SEQ ID NO: 76) BGLC-C: CTAGTTCCTCGGCTCTATGTATTT

(209) The nucleotide sequence of the BGLC cDNA gene was sequenced, and compared with the pBGLC gene to determine the location of introns.

(210) (8-5) Deduction of Amino Acid Sequence of BGLC

(211) The -glucosidase BGLC gene isolated from Acremonium cellulolyticus by the method described above consisted of 1650 bp nucleotides corresponding to nucleotides 238-1887 of SEQ ID NO: 15. It was found that the BGLC gene contained three introns at positions 784-850, 1138-1205, and 1703-1756 of SEQ ID NO: 15. The amino acid sequence of BGLC deduced from the open reading frame (ORF) was that of SEQ ID NO: 16. It was assumed using a signal sequence prediction software SignalP 3.0 that the amino acid sequence at position 28 to 1 of BGLC was a signal sequence.

Example 9: Cloning of BGLD Gene

(212) (9-1) Preparation of Genomic DNA and cDNA

(213) Genomic DNA of Acremonium cellulolyticus ACCP-5-1 was isolated in accordance with the method described in Example 1-1. cDNA of Acremonium cellulolyticus ACCP-5-1 was prepared in accordance with the method described in Example 1-4.

(214) (9-2) Cloning of BGLD Gene Fragment

(215) The following primers were prepared based on the sequences of known -glucosidases which were classified into Glycoside Hydrolase family 1.

(216) TABLE-US-00030 (SEQ ID NO: 77) BGLD-F: CACCGCCGCCTACCARRTNGARGG (SEQ ID NO: 78) BGLD-R: TGGCGGTGTAGTGGTTCATGSCRWARWARTC

(217) PCR was carried out using BGLD-F and BGLD-R as primers and genomic DNA as a template, and using LA Taq polymerase (Takara Bio). The PCR was carried out by repeating a cycle consisting of a reaction at 94 C. for 30 seconds, annealing for 30 seconds, and a reaction at 72 C. for 1 minute 40 times. The annealing temperature was lowered stepwisely from 63 C. to 53 C. in the first 20 cycles, and maintained at 53 C. in the subsequent 20 cycles. The amplified DNA fragment of 1 kbp was inserted into a pCR2.1-TOPO plasmid vector using a TOPO TA cloning kit (Invitrogen) in accordance with a protocol attached to the kit to obtain plasmid TOPO-pBGLD-partial.

(218) The inserted DNA fragment cloned into plasmid TOPO-pBGLD-partial was sequenced, and the obtained nucleotide sequence was translated into the amino acid sequence, and a homology search was carried out using the amino acid sequence. The sequence showed a 76% identity with that of -glucosidase 1 (Q8X214) derived from Talaromyces emersonii, and thus, it was judged that the DNA fragment was part of a -glucosidase (Glycoside Hydrolase family 1) gene.

(219) (9-3) Cloning of Full-Length of BGLC Gene by Inverse PCR

(220) In accordance with the method described in Example 1-3, PCR was carried out using circular DNA (obtained by digestion with XhoI) as a template and the following sequences contained in the BGLD gene fragment as primers to obtain the 5 upstream region and the 3 downstream region of the BGLD gene.

(221) TABLE-US-00031 (SEQ ID NO: 79) BGLD-inv-F: CGGTTTCAATATCGGTAAGC (SEQ ID NO: 80) BGLD-inv-R: GTGTCCAAAGCTCTGGAATG

(222) The 5 upstream region and the 3 downstream region were sequenced to determine the complete nucleotide sequence of the BGLD gene.

(223) The following primers were prepared based on the nucleotide sequence obtained by the inverse PCR, and PCR was carried out using genomic DNA as a template to amplify the BGLD gene.

(224) TABLE-US-00032 (SEQ ID NO: 81) pBGLD-F: TTCTCTCACTTTCCCTTTCC (SEQ ID NO: 82) pBGLD-R: AATTGATGCTCCTGATGCGG

(225) The amplified DNA was inserted into a pCR2.1-TOPO plasmid vector using a TOPO TA cloning kit (Invitrogen) to obtain plasmid pBGLD. Escherichia coli TOP10 (Invitrogen) was transformed with the obtained plasmid pBGLD to obtain Escherichia coli TOP10/pBGLD.

(226) (9-4) Intron Analysis of BGLD Gene

(227) The following primers containing the initiation codon and the stop codon were prepared based on the BGLD gene sequence, and PCR was carried out using cDNA as a template to amplify the BGLD cDNA gene.

(228) TABLE-US-00033 (SEQ ID NO: 83) BGLD-N: ATGGGTAGCGTAACTAGTACCAAC (SEQ ID NO: 84) BGLD-C: CTACTCTTTCGAGATGTATTTGTT

(229) The nucleotide sequence of the BGLD cDNA gene was sequenced, and compared with the pBGLD gene to determine the location of introns.

(230) (9-5) Deduction of Amino Acid Sequence of BGLD

(231) The -glucosidase BGLD gene isolated from Acremonium cellulolyticus by the method described above consisted of 1700 bp nucleotides corresponding to nucleotides 66-1765 of SEQ ID NO: 17. It was found that the BGLD gene contained four introns at positions 149-211, 404-460, 934-988, and 1575-1626 of SEQ ID NO: 17. The amino acid sequence of BGLD deduced from the open reading frame (ORF) was that of SEQ ID NO: 18. It was assumed using a signal sequence prediction software SignalP 3.0 that the amino acid sequence at position 33 to 1 of BGLD was a signal sequence.

INDUSTRIAL APPLICABILITY

(232) The protein of the present invention may be used as a cellulase preparation, and may be applied to the use of digestion of a cellulose-based substrate.

(233) Although the present invention has been described with reference to specific embodiments, various changes and modifications obvious to those skilled in the art are possible without departing from the scope of the appended claims.

FREE TEXT IN SEQUENCE LISTING

(234) The nucleotide sequences of SEQ ID NOS.: 19-84 in the sequence listing are artificially synthesized primer sequences. The abbreviations N in SEQ ID NO: 27 (positions 18 and 27), SEQ ID NO: 41 (position 18), SEQ ID NO: 42 (position 14), SEQ ID NO: 54 (positions 26 and 29), SEQ ID NO: 61 (positions 22 and 25), SEQ ID NO: 70 (position 22), and SEQ ID NO: 77 (position 19) stand for an arbitrary nucleotide.