FUSION PROTEIN AND TRANSGENIC PLANT EXPRESSING SAID PROTEIN

Abstract

The present invention concerns a nucleic acid molecule capable of expressing, in at least one plant tissue, a chimeric protein comprising a polygalacturonase (PG) of fungal, bacterial or insect origin and a plant polygalacturonase inhibitor protein (PGIP) plant capable of inhibiting said PG. The present invention also relates to transgenic plants that express said chimeric protein.

Claims

1. A nucleic acid molecule coding for a chimeric protein comprising: an amino acid sequence with a polygalacturonase inhibitor (PGIP) activity of plant origin; and an amino acid sequence with a polygalacturonase (PG) activity of fungal, bacterial or insect origin.

2. The nucleic acid molecule according to claim 1, wherein said chimeric protein comprises the amino acid sequence with a polygalacturonase inhibitor (PGIP) activity of plant origin at an N-terminal portion, and the amino acid sequence with a polygalacturonase (PG) activity of fungal, bacterial or insect origin at a C-terminal portion.

3. The nucleic acid molecule coding for a chimeric protein according to claim 1, wherein the amino acid sequence with the PGIP activity comprises a sequence selected from the group consisting of: the sequence of PGIP2 of Phaseolus vulgari (Pv PGIP2) comprising the sequence SEQ ID NO:4; the sequence of PGIP1 of Phaseolus vulgari (Pv PGIP1) comprising the sequence SEQ ID NO:23; the sequence of PGIP3 of Phaseolus vulgari (Pv PGIP3) comprising the sequence SEQ ID NO:25; the sequence of the PGIP of Malus domestica comprising the sequence SEQ ID NO: 26; the sequence of PGIP1 of Vitis vinifera comprising the sequence SEQ ID NO: 28; the sequence of PGIP1 of Arabidopsis thaliana comprising the sequence SEQ ID NO:30; the sequence of PGIP2 of Arabidopsis thaliana comprising the sequence SEQ ID NO:31; or a functional fragment, isoform, or a functional equivalent, variant, mutant, derivative, synthetic, or recombinant functional analogue thereof.

4. The nucleic acid molecule coding for a chimeric protein according claim 1, wherein the amino acid sequence with the PG activity comprises a sequence selected from the group consisting of: the sequence of PG of Fusarium phyllophilum (FpPG) comprising the sequence SEQ ID NO:2 or SEQ ID NO:22; the sequence of PG2 of Aspergillus niger comprising the sequence SEQ ID NO:24; the sequence of the PG of Colletotrichum lupini comprising the sequence SEQ ID NO:27; the sequence of BcPG2 of Botrytis cinerea comprising the sequence SEQ ID NO:29; or a functional fragment, isoform, or a functional equivalent, variant, mutant, derivative, synthetic, or recombinant functional analogue thereof.

5. (canceled)

6. (canceled)

7. (canceled)

8. (canceled)

9. (canceled)

10. (canceled)

11. (canceled)

12. The nucleic acid molecule according to claim 1, further comprising a region coding for a linker.

13. The nucleic acid molecule according to claim 1 wherein the linker comprises the sequence Ala, Ala, Ala.

14. The nucleic acid molecule according to claim 1, comprising a region coding for a signal peptide.

15. The nucleic acid molecule according to claim 1, comprising the nucleotide sequence having essentially the SEQ ID NO: 5, SEQ ID NO: 7 or SEQ ID NO: 9.

16. The nucleic acid molecule according to claim 1, further comprising a promoter which is active in plants.

17. The nucleic acid molecule according to claim 16, wherein the promoter regulates the expression of PR-1 gene of Arabidopsis (PPR-1).

18. The nucleic acid molecule of claim 1, incorporated in an expression vector.

19. The expression vector according to claim 18, wherein the nucleic acid molecule is under the control of a promoter which is active in plants.

20. The expression vector according to claim 19, wherein the promoter is pathogen inducible.

21. A method for producing at least one transgenic plant cell, comprising: exposing at least one plant cell to the expression vector of claim 18.

22. (canceled)

23. (canceled)

24. A chimeric protein comprising an amino acid sequence with a polygalacturonase inhibitor (PGIP) activity of plant origin; and an amino acid sequence with a polygalacturonase (PG) activity of fungal, bacterial or insect origin.

25. The chimeric protein according to claim 24, comprising the amino acid sequence having essentially the SEQ ID NO: 6 or the SEQ ID NO: 8 or functional fragment, equivalent, variant, mutant, derivative, synthetic or recombinant functional analogue thereof.

26. A host cell comprising an expression vector, the expression vector comprising: a nucleic acid molecule coding for a chimeric protein comprising: an amino acid sequence with a polygalacturonase inhibitor (PGIP) activity of plant origin; and an amino acid sequence with a polygalacturonase (PG) activity of fungal, bacterial or insect origin.

27. The nucleic acid molecule according to claim 16, wherein is the promoter is pathogen inducible.

28. The nucleic acid of claim 1 incorporated in at least one host cell.

29. The host cell of claim 27, wherein the host cell is a plant cell.

Description

[0095] The present invention will be illustrated with non-limiting examples in reference to the following figures.

[0096] FIGS. 1A-1G (collectively referred to as FIG. 1). Characterisation of the transgenic plants expressing OGM inducible by chemical treatment. (A) Schematic representation of two OGM molecules that interact. PvPGIP2 and FpPG are linked by three alanines and correspond to the N and C terminals of the fusion protein, respectively. (B) Four-week-old plants of a representative transgenic line which express the OGM after one week of induction with β-estradiol. (C) The total protein extracts from the leaves of the rosette (3 μng) of 4-week-old plants of a representative transgenic line which express the OGM after induction with β-estradiol at the times indicated were separated by SDS-PAGE and analysed by means of an immunodecoration assay using the antibody directed against FpPG as the primary one. The purified OGM (+, 80 kDa) and FpPG (PG, 37 kDa) were used as reference proteins. (D) Determination of polygalacturone activity in the protein extracts (3 μg) obtained from leaves of transgenic plants treated, for the times indicated, with DMSO (−) or β-estradiol (+) by means of an agar diffusion assay. (E) Visualisation of callose deposits in the leaves of the rosette of the transgenic plants treated with DMSO (non-induced) or β-estradiol for 170 h by staining with aniline blue. (F) The expression of the genes WRKY40 and RetOx was determined in the transgenic plants treated with β-estradiol for the times indicated by semi-quantitative RT-PCR, using the expression of the gene UBQ5 as reference. (G) Wild plants (WT) and transgenic plants were treated for 170 h with β-estradiol and subsequently inoculated with a suspension of spores of B. cinerea. After two days, the area of the lesion generated by the fungus was measured. The bars indicate the mean lesion area produced by the fungus (n>10). The asterisk indicates a statistically significant difference, in accordance with the Student t-test (P<0.05). This experiment was repeated three times with comparable results.

[0097] FIGS. 2A-2F (collectively referred to as FIG. 2). Inducible release of oligogalacturonides from plants expressing the OGM. (A-E) HPAEC-PAD analysis on pectin-enriched fractions of cell walls extracted from plants belonging to a representative transgenic line expressing the OGM under the control of a β-estradiol-inducible promoter. Four-week-old plants were treated with the inducer for 0 (A), 24 (B), 70 (C) and 170 hours (D) prior to extraction. A preparation of OGs purified with a degree of polymerisation (DP) of between 6 and 16 was used as a reference (E). The chromatograms show the signal intensity (nC, y axis) as a function of the retention time (minutes, X axis). (F) MALDI-TOF analysis of the same pectin fraction indicated in (D). The numbers indicate the DP of the oligogalacturonides identified as sodium adducts of the same mass as the corresponding peak. The graph shows the intensity of the signals (expressed as a percentage, Y axis) as a function of the mass of the ion (m/z, X axis).

[0098] FIGS. 3A-3F (collectively referred to as FIG. 3). Pathogen-inducible expression of the OGM imparts an increased resistance to microbial infections. (A) Four-week-old plants belonging to two independent lines expressing the OGM under the control of the pathogen-inducible promoter which regulates the expression of PR1 (P.sub.PR1::OGM 1 and 2) were inoculated with a suspension of spores of B. cinerea and the levels of expression of the transgene were quantified before (grey bars) and two days after infection (black bars) by quantitative PCR, using the expression of the gene UBQ5 as reference. The bars indicate the mean level of expression (in arbitrary units)±SD (n=3). (B) The accumulation of the OGM in leaves of wild type plants (WT) and transgenic plants before (−) and two days after inoculation with B. cinerea (+). The total protein extract (30 μg) was separated by SDS-PAGE and subjected to an immunodecoration assay, using a primary antibody directed against FpPG (C-D) The leaves of the rosette of wild type plants (WT), P.sub.PR1::OGM line 1 and line 2 were inoculated with B. cinerea and—after 72 h—a determination was made both of the percentage of infections that took hold, measured as a percentage of inocula that developed grey rot lesions (C) and the mean area of the lesions (D). The bars indicate (C) the mean of three independent experiments (n>12 in each experiment); the bars in (D) indicate the mean area±SE (n>12). (E) The leaves of the rosette of wild type plants (WT), P.sub.PR1::OGM line 1 and line 2 were inoculated with P. carototovorum and the area of the lesions was measured after 16 hours. The bars indicate the mean area of the lesions±SE (n>12). (f) The leaves of the rosette of untransformed plants (WT), P.sub.PR1::OGM line 1 and line 2 were inoculated with P. syringae pv tomato DC3000 and the bacterial growth within the inoculated tissue was determined at the times indicated. The bars indicate the colony-forming units (cfu) per cm.sup.2 of leaf tissue (n=6). The asterisks in (D-F) indicate the statistically significant differences between the control plant and the transgenic plants, in accordance with Fischer's exact test (C) or the Student t-test (D-F). *, P<0.05; ***, P<0.01. The experiments in (D-F) were repeated three times with comparable results.

[0099] The transgenic plants belonging to both lines were significantly more resistant to infection, showing a 75% reduction in the bacterial load detected in the tissues compared to that observed in wild type plants (WT).

[0100] FIGS. 4A-4C (collectively referred to as FIG. 4). Biochemical characterisation of the OGM expressed in P. pastoris. (A) SDS-PAGE analysis (7.5% acrylamide) on the purified fusion protein (OGM) and the one subjected to crosslinking (OGM-cl), where it is possible to detect the formation of multimers ranging from the dimer to the tetramer and the disappearance of the monomer. (B) Top panel, evaluation by agar diffusion assay of the polygalacturone activity carried out by 220 ng of purified OGM and by 1 ng of purified FpPG; bottom panel, immunodecoration analysis of the same protein samples using an antibody directed against the FpPG The expected molecular weights of the OGM (80 kDa) and FpPG (35 kDa) are shown. In the culture filtrate of the untransformed (mock) P. pastoris neither the activity nor the presence of the protein were detected. (C) The fractions eluted by affinity chromatography AnPGII were subjected to SDS-PAGE analysis (10% acrylamide) and visualised by Ag staining. The OGM (80 KDa) was eluted in the fractions. Ft represents the fraction containing the proteins not bound to the column.

[0101] FIG. 5. The OGs released by plants expressing the OGM are hydrolysed by polygalacturonase. A fraction of the cell wall of leaves of the rosette enriched in pectin was extracted from the transgenic plant expressing the OGM under the control of the β-estradiol-inducible promoter 170 hours after the time of induction. The pectic fractions were analysed by HPAEC-PAD before (−) and after treatment with 5 μg of pure FpPG (+). The chromatogram shows the intensity of the signals (nC, Y axis) as a function of the retention times (minutes, X axis).

EXAMPLE

Materials and Methods

Strains

[0102] E. coli DH5α [genotype: F-φ80lacZΔM15 Δ(lacZYA-argF)U169 deoR recA1 endA1 hsdR17(rk, mk+) phoA supE44 thi-1 gyrA96 relA1 λ-(Invitrogen)

[0103] A. tumefaciens LBA4404 (INVITROGEN, catalogue number: 18313-015)

[0104] P. pastoris X33 (wild type) (Invitrogen)

[0105] A. thaliana Col-0 (wild type) (purchased from Lehle Seeds)

Construction of the Gene Cassette for the Expression of the Chimeric Fusion Protein PG-PGIP (OGM) in P. pastoris (Corresponding to the Amino Acid Sequence of the OGM Expressed in Pichia (SEQ ID NO:8))

[0106] For the expression of the fusion protein in P. pastoris, the 5′ end of the gene coding for PvPGIP2 was fused to the sequence coding for the alpha factor of yeast present in the integrative vector pGAPZ alpha which enables the constitutive expression of the transgene; the construct pGAPZα-PGIP2 was thus obtained. The gene coding for the mature protein PvPGIP2 was amplified by means of specific primers (EcoRIPGIP2Fw (SEQ ID NO: 10) and NotIPGIP2Rv (SEQ ID NO: 11)) which introduced the “EcoRI” and “NotI” restriction sites at the 5′ and 3′ ends, respectively; the gene was then cloned at the multiple cloning site of the vector by exploiting the aforesaid restriction sites. In parallel, “NotI” and “XbaI” restriction sites were introduced at the 5′ and 3′ ends, respectively, of the sequence coding for FpPG using specific primers (NotIFpPGFw (SEQ ID NO: 12) and XbaIFpPGRv (SEQ ID NO: 13)) via PCR. The primer which readapted the SI end of the FpPG gene by inserting the restriction site NotI maintained the correct reading frame between the PvPGIP2 and FpPG and introduced 9 further nucleotide bases, which would code the peptide linker composed of 3 alanines. The fragment coding for FpPG was thus cloned in the multiple cloning site using the “NotI” and “XbaI” restriction sites. The gene fusion (called OG-machine; abbreviated as OGM) was sequenced to exclude the presence of undesirable mutations. The recombinant plasmid was linearised by means of the AvrII restriction enzyme, necessary for site-specific recombination in P. pastoris. The transformation, selection and growth of Pichia took place according to the instructions given in the Invitrogen manual. The filtrates of cultures grown for 3 days were tested both by means of an agar diffusion assay and an immunodecoration assay. The OGM was purified using the same procedure as used to purify PvPGIP2 from a culture filtrate of P. pastoris as described in (29).

[0107] Primers used for the construction of gene cassettes coding the OGM for expression in P. pastoris and β-estradiol-inducible expression in A. thaliana:

TABLE-US-00007 EcoRIPGIP2Fw: (SEQ ID NO: 10) 5′ ATCGATGAATTCGAGCTATGCAACCCACA 3′ NotIPGIP2Rv: (SEQ ID NO: 11) 5′-TCTTCTAAGTGCGGCCGCAGTGCAGGCAGGAAGAG-3′ NotIFpPGFw: (SEQ ID NO: 12) 5′-TCAACACTATGCGGCCGCACCCTGCTCCGTGACTGAG-3′ XbaIFpPGRv: (SEQ ID NO: 13) 5′-ATCGATTCTAGACTAGCTGGGGCAAGTGTTG-3′ AvrIISP1Fw: (SEQ ID NO: 14) 5′-ACTAAGCCTAGGACTATCTAGAATGACTCAATTCAATATCCCAG-3′ EheIPGIP2Rv: (SEQ ID NO: 15) 5′-GGGGATGGCGCCGGAG-3′ XhoISP1Fw: (SEQ ID NO: 16) 5′-ACTAAGCTCGAGATGACTCAATTCAATATCCCAG-3′ PacIFpPGRv: (SEQ ID NO: 17) 5′-CCTAAGTTAATTAACTAGCTGGGGCAAGTGTTG-3′

[0108] The underlined sequences indicate the restriction sites introduced.

Molecular Crosslinking Experiment Conducted on the OGM

[0109] 1 μg of pure OGM was subjected to auto-crosslinking in a volume of 50 μL of a solution containing 50 mM sodium acetate pH 4.6, to which methanol-free formaldehyde was added at the final concentration of 1% (Thermo-Fisher Scientific, U.S.A). The reaction was incubated at a temperature of 28° C. for 16 hours. 2 μL of the reaction was analysed via SDS-PAGE.

Preparation of the Construct for β-Estradiol-Inducible Expression in A. thaliana

[0110] The cDNA coding for the signal peptide of PvPGIP2 (SP), available already fused to PvPGIP2 (27), was amplified up to the EheI restriction site located in the sequence of PvPGIP2 a+550 pairs of bases from the first ATG using the primers called AvrIISP1Fw and EheIPGIP2Rv (SEQ ID NO:14 and SEQ ID NO: 15, respectively). The amplified fragment was cloned in the construct used for expression in P. pastoris using the restriction sites of the AvrII and EheI enzymes. The new construct obtained, which consisted in a fusion between the cDNA coding for the OGM and the sequence coding for the signal peptide for the secretion of PvPGIP2 into the apoplast was thus introduced by means of electroporation in E. coli DH5α for amplification of the plasmid.

[0111] The cDNA coding for the fusion protein fused to the signal peptide for the secretion of PvPGIP2 was amplified by PCR using the specific XhoISP1Fw and PacIFpPGRv primers (SEQ ID NO:16 and SEQ ID NO: 17, respectively) which introduced the XhoI and PacI restriction sites at the 5.sup.I and 3.sup.I ends of the transgene, respectively. The gene readapted to the ends was then cloned in the vector pMDC7 for β-estradiol-inducible expression in plants (31) using the same restriction sites.

[0112] The final construct pMDC7.SP-OGM was amplified in E. coli DH5α, and then plasmid extraction took place; the purified plasmid was introduced in A. tumefaciens LBA4404 by electroporation.

Stable Transformation of A. thaliana

[0113] The transgenic plants of Arabidopsis thaliana ecotype Col-0 were generated by infection of the flower primordia mediated by A. tumefaciens according to the procedure described in (41). Following the transformation, the transgenic lines were selected in generation T1 by seeding on a plate containing MS solid medium and hygromycin (23 mg L-1) as a positive selection marker. The transgenic lines of the hygromycin-resistant T2 generation were selected for subsequent analyses; in particular, the lines of the T2 generation that showed a segregation of the transgene in a 3:1 ratio were isolated for selection of the transforming homozygote in the T3 generation.

Induction of Expression in the Transgenic Lines of the T3 Generation Using β-Estradiol

[0114] XVE is a transcriptional chimeric factor constitutionally expressed in the nucleus of the plant cell transformed with the T-DNA deriving from the vector pMDC7. XVE is capable of transcribing the transgene regulated by the inducible promoter OlexA-46 only in the presence of β-estradiol (31). The induction of expression was achieved by spraying 1.5 mL of a solution containing 50 μM β-estradiol per transgenic plant.

Analysis of Gene Expression by Semiquantitative RT-PCR

[0115] The removed leaf tissues were frozen in liquid nitrogen, homogenised by means of an MM301 Ball Mill (Retsch), and the total RNA was extracted using Isol-RNA Lysis Reagent (5 Prime), following the instructions provided in the manufacturer's manual. The RNA was treated with RQ1 DNase (PROMEGA) and the first strand of the cDNA was synthesized using the reverse transcript ImProm-II (PROMEGA), in accordance with the manufacturer's instructions. The expression levels of each gene relative to the expression of the gene UBQ5 were determined using a modification of the Pfaffl method (42) as previously described in (43). The (RT)-PCR reaction was conducted in a 50-μL reaction mixture containing 2 μL of cDNA, 1× buffer (RBCBioscience), 3 mm MgCl2, 100 μm of each dNTP, 0.5 μm of each primer (primers EcoRIPGIP2Fw (SEQ ID NO:10) and EheIPGIP2Rv (SEQ ID NO:15)) and 1 unit of Taq polymerase. 25, 30, and 35 amplification cycles were carried out by PCR for every pair of primers in order to verify the linearity of the amplification reaction. The PCR products were separated by agarose gel electrophoresis and visualised by means of ethidium bromide.

Immunodecoration Assay

[0116] The extraction of total proteins from leaf tissue was carried out using a buffer consisting of 20 mM sodium acetate pH 4.6 and 1M NaCl, in which the leaves previously homogenised by means of an MM301 Ball Mill (Retsch) were incubated for 20 minutes. The same quantities of total proteins were separated by SDS-PAGE analysis and then transferred onto a nitrocellulose membrane using, as the transfer buffer, a solution containing 25 Mm TRIS, 192 mM glycine, pH 8.3, and 20% methanol at the temperature of 4° C. for 1 h. Following the transfer, the filter was stained with Ponceau S in order to verify equal loading for all samples; then the filter was saturated by incubating it for 2 h in a solution consisting of 50 mM phosphate buffer, 150 mM NaCl and 3% bovine serum albumin (BSA, SIGMA ALDRICH); subsequently, the filter was incubated for 12 h with a primary antibody directed toward the FpPG (40). After suitable washing, the membrane was incubated with a secondary antibody conjugated to horseradish peroxidase (Amersham, UK) for approximately 2 h. The membrane was washed again and treated with ECL reagents (Amersham, UK) in order to promote the detection of the transgenic protein.

Determination of Callose Deposition

[0117] Leaves of 5-week-old plants were sprayed with a solution containing 50 μM β-estradiol. After 170 h, about 4 leaves were collected from 3 independents plants and dehydrated in a solution consisting of 100% ethanol for about 2 hours. The leaves were then incubated for 15 minutes in 75% ethanol and, finally, in 50% ethanol. Following this pretreatment the leaves were washed in 150 mM phosphate buffer pH 8.0 and then stained for 1 h at 25° C. in 150 mM phosphate buffer, pH 8.0, containing 0.01% (w/v) aniline blue. After staining, the leaves were incubated in 50% glycerol and examined by epifluorescence UV using an Axioskop 2 plus microscope (Zeiss). Pictures were taken with a ProgRes C10 3.3 Megapixel colour digital camera (Jenoptik).

Infection Assays

[0118] Botrytis cinerea was propagated in a solid medium consisting of 20 g l-1 malt extract, 10 g l-1 peptone (Difco, Detroit, USA), and 15 g l-1 agar for 7-10 days at +24° C. with a photoperiod of 12 h prior to collection of the spores. The rosette leaves of Arabidopsis plants were placed on Petri plates containing 0.8% agar, with the petiole inserted into the solid medium to act as a support. Inoculation was carried out by placing on each side of the central vein of each leaf 5 microlitres of a solution consisting of PDB liquid medium (PDB; Difco, Detroit, USA) containing a suspension of 5×105 conidiospores mL-1. The plates were incubated at 22° C. under constant light for 2 days. A high level of humidity was maintained by covering the plates with transparent film. Under the experimental conditions, the majority of the infections produced a rapid expansion of rot lesions of comparable diameter. The size of the lesion was determined by measuring the diameter or, in the case of oval lesions, the major axis of the necrotic area.

[0119] P. carotovorum subsp. carotovorum (formerly E. carotovora subsp. carotovora) was obtained from DSMZ GmbH Germany (strain DSMZ 30169). Following growth in Luria-Bertani (LB) liquid medium, the bacteria were suspended in 50 mM potassium phosphate buffer (pH 7.0) and inoculated at a concentration of 5×10.sup.7 cells mL-1. In each experiment, 12 mature leaves were collected (3 leaves per plant) and placed on damp filter paper in Petri capsules; they were then inoculated with 5 microlitres of the bacterial suspension and maintained at 22° C. and with a photoperiod of 12 hours. The area of the lesions was obtained by measuring the surface of the macerated tissue 16 hours after infection. The areas were measured with ImageJ software (WS Rasband, ImageJ; National Institutes of Health, Bethesda, Md., USA). The experiment was repeated three times with different lots of plants, and a statistical analysis of the results was conducted by unidirectional analysis of variance (ANOVA), followed by the Student-Tukey range test.

[0120] Pseudomonas syringae pv tabaci DC3000 was propagated in LB liquid medium at 28° C. for 1 day; the bacterial suspension was resuspended in 10 mM MgCl.sub.2 (1×10.sup.6 cell/ml). The inoculations were carried out by infiltrating the bacterial suspension using a 1 ml needleless syringe.

Isolation and Detection of Oligogalacturonides in the Transgenic Plants

[0121] Leaves (approximately 100 mg per sample) belonging to transgenic and wild type plants about 4 weeks old were frozen in liquid nitrogen following induction with beta-estradiol and homogenised using a Retschmill machine (model MM200; Retsch) at 25 Hz for 1 min. The pulverised tissue was washed twice using 1 mL of a solution consisting of 70% ethanol and precipitated by centrifugation at 20,000×g for 10 min. The precipitate was then washed twice with a chloroform:methanol mixture (1:1, v/v) and centrifuged at 20000×g for 10 minutes. After centrifugation, the precipitate was suspended twice with acetone and again precipitated by centrifugation at 20000×g for 10 min. The pellet obtained was incubated overnight under the air flow of a chemical fume hood in order to favour evaporation of the solvent, and then resuspended using 200 μL of Ch buffer (composition of the Ch buffer: 50 mM ammonium acetate pH 5, 50 mM CDTA and 50 mM ammonium oxalate) for two hours under stirring at room temperature. The supernatant was recovered after centrifugation at 20000×g for 10 minutes.

Analysis by High-Performance Anion Exchange Chromatography (HPAEC) Coupled to a Pulsed Amperometric Detector (PAD)

[0122] Analysis of the oligogalacturonides was carried out by HPAEC-PAD. The HPAEC system (ICS-3000, Dionex Corporation, Sunnyvale, Calif., USA) was equipped with a CarboPac PA-200 separation column (2 mm ID×250 mm; Dionex Corporation) and a Carbopac PA-200 guard column (2 mm ID×50 mm; Dionex Corporation). A flow of 0.4 mL min-1 was used at a constant temperature of 25° C. The samples, with an injection volume of 25 μL, were separated using a gradient consisting of 0.05 M KOH (A) and 1 M KOAc in 0.05 M KOH (B) according to the following elution program: 0-30 min from 20% B to 80% B, 30-32 min to 100% B. Prior to the injection of each sample, the column was balanced with 90% A and 10% B for 10 min.

Treatment of Pectin-Enriched Fractions by Means of Exogenous PG

[0123] The pectin-enriched fraction extracted from 20 mg of leaf tissue was treated with 5 μg of pure FpPG for 1 hour at a temperature of 37° C. Subsequently, the reaction mixture was subjected to HPAEC-PAD analysis.

Preparation of the Construct for the Expression of the OGM Under the Control of the Inducible Promoter PR-1 in A. thaliana

[0124] The primers for preparing the construct for the pathogen-inducible expression of the OGM under the control of the promoter that regulates the expression of the gene PR-1 (AT2G14610, Accession No. UNIPROT Q39187) in A. thaliana are the following (the underlined sequence indicates the restriction site introduced):

TABLE-US-00008 XbaISP1Fw: A: (SEQ ID NO: 18) 5′-GACTATCTAGAATGACTCAATTCAATATCCC-3′; HindIIIPR1Fw: B: (SEQ ID NO: 19) 5′-GTTAGCA CAAGCTTGTT TTAAC-3′; XbaIPacIFpPGRv: C: (SEQ ID NO: 20) 5′-CCTAAGTCTAGAGGTCTTAATTAACTAGCTGGGG-3′; HindIIIPGIP2Rv D: (SEQ ID NO: 21) 5′-TGCTTAAGCTTGAAGACATGGTTACTGGGATATTGAATTGAGTCA TTTTTCTAAGTTGATAATGG-3′.

[0125] As the starting plasmid, the cloning procedure used the vector pBI121 (Chen P Y, Wang C K, Soong S C, To K Y: Complete sequence of the binary vector pBI121 and its application in cloning T-DNA insertion from transgenic plants. Mol Breeding 2003 11(4): 287-293), in which the PacI restriction site was introduced upstream (−6) of the SacI restriction site, located at the 3′ end of the gene coding for beta-glucuronidase. The gene coding for beta-glucuronidase was then excised via the restriction sites XbaI and PacI. Subsequently, the OGM fused to the signal peptide of PGIP2 was amplified via the primers XbaISP1Fw (SEQ ID NO: 18) and XbaIPacIFpPGRv (SEQ ID NO: 20) which introduced XbaI and PacI at the 5′ and 3′ ends, respectively, of the transgene and cloned in the vector pBI121 from which the gene coding for beta-glucuronidase were previously removed. As a second step, the terminal portion of the promoter which regulates the expression of the gene PR-1 (1300 base pairs of AT2G14610), including the 5′ UTR sequence was amplified from the gDNA of A. thaliana Col-0 using specific primers (HindIIIPR1Fw (SEQ ID NO: 19) and D (SEQ ID NO: 21)) which introduce the restriction sites HindIII at both ends of the amplified product. As a result, the primer of the antisense strand HindIIIPGIP2Rv readapted the 3′ end of the amplicon, introducing a nucleotide tail consisting of the first 39 bases coding for the signal peptide of PGIP2, which is characterised by the HindIII restriction site in its native sequence. The final product obtained was a transcriptional fusion between the last 1300 pairs of bases of the promoter PR-1, the 5′ UTR region of the gene PR-1 and the sequence of the signal peptide of PvPGIP2 coding for the first 13 amino acids downstream of the first methionine. The fragment was cloned using the restriction site HindIII of the plasmid pBI121 (containing the gene OGM), previously digested with HindIII and dephosphorylated by alkaline phosphatase. It is worth noting that the digestion of pBI121 via the enzyme HindIII provokes the excision of a DNA fragment of 900 pairs of bases corresponding to the promoter 35S. The cassette was sequenced both to exclude the presence of undesirable mutations and to verify the correct orientation of the truncated version of the promoter PR-1.

Results

[0126] In order to exploit the potentialities of OGs as generic plant elicitors during defence responses, we engineered a chimeric fusion protein comprising PvPGIP2 (Uniprot Accession Number: P58822.1; SEQ ID NO:4), an inhibitor originating from the common pea (Phaseolus vulgaris) (27,28), and a PG ligand (FpPG) thereof, originating from the fungus Fusarium phyllophilum (SEQ ID NO:2; corresponding to aa.26-aa.373 of the Uniprot sequence Accession Number: Q07181.1)(29). In this manner, the enzyme and its inhibitor will be simultaneously expressed in a stoichiometric ratio of 1:1, which results in an increase, in vivo, in the production of biologically active OGs. In Pichia pastoris and Arabidopsis thaliana, fusion proteins were expressed with linkers consisting of the module Gly4Ser1 repeated from seven to nine times; their dimensions can permit an intramolecular interaction between enzyme and inhibitor. In both organisms these proteins were subjected to proteolytic cleavage and this caused the release of active FpPG; the high residual polygalacturone activity caused severe growth defects in Arabidopsis. This effect was consistent with the one that had previously been observed in transgenic plants which expressed the PG of Aspergillus niger; such plants were not able to grow as a consequence of the high enzymatic activity present in the tissues (30). Subsequently, a fusion protein with a linker of only three alanine residues was generated; it was short enough not to permit intramolecular interactions, but capable of promoting intermolecular interactions between enzymes and inhibitors belonging to different chimeric molecules (FIG. 1a). When expressed in P. pastoris, the fusion protein was recovered as an intact polypeptide of the expected size, indicating a resistance to proteolysis (FIG. 4a). The protein was purified by affinity chromatography using the PGII of A. niger conjugated to a sepharose matrix, which was capable of binding the PGIP domain of the fusion protein (FIG. 5b, bottom panel). The enzymatic activity of the fusion protein was about 220 times lower than the FpPG (FIG. 4b, top panel). This suggested that the enzymatic activity had decreased markedly in the fusion protein due to the intramolecular interactions between the PG domain of one polypeptide and the PGIP domain of the other (FIG. 1a). Molecular crosslinking experiments confirmed this hypothesis and further revealed the ability of the chimera to bring about chain intermolecular interactions ranging from the dimer (˜160 KDa) to the tetramer (320 KDa) (FIG. 4a), which were not observed when the FpPG or PvPGIP2 underwent crosslinking in the absence of the interaction partner (29). The construct PvPGIP2-FpPG was fused to the signal peptide of the bean PvPGIP2 to enable correct secretion in the cell wall (30) and it was later placed under the control of a β-estradiol-inducible promoter for stable expression in Arabidopsis (31). The presence of the protein in the leaves of the rosette was observed in the transgenic plants after 14 h of treatment with β-estradiol and it reached its maximum accumulation at 170 h after treatment (FIG. 1b). The accumulation was associated with the appearance of slight PG activity, which, as already previously demonstrated, is detected following the formation of the PG-PGIP molecular complex (4,6) (FIG. 1b). Adult transgenic plants did not show any obvious morphological defects when grown under normal conditions. However, following treatment with the inducer, the leaves of the transgenic plants showed discoloration and chlorosis starting from 170 h after the treatment (FIG. 1d). Treating the transgenic plants with an inducer also activated the defence responses typically induced following exogenous treatment with OGs, such as the expression of the marker genes for defence responses (RetOx and WRKY40; FIG. 1e) and the accumulation of callose (FIG. 10. Taken as a whole, these results suggested that an accumulation of OGs might take place in β-estradiol-inducible transgenic plants that can be capable of activating defence responses similar to the ones induced as a result of an exogenous OG treatment. Because of this effect, the fusion protein was called “OG machine” (OGM). In order to verify whether the OGM actually caused the accumulation of OGs in the plant, pectin-enriched fractions were extracted from the leaves of the transgenic plants at 0, 24, 70 and 170 h following treatment with β-estradiol. The fractions were then analysed by high-performance anion exchange chromatography coupled with a pulsed amperometric detector (HPAEC-PAD), which revealed the presence of molecules with retention times comparable to those characterizing a mixture of OGs with a degree of polymerization comprised between 5 and 17; the concentration of these molecules increased with increases in the induction times (FIG. 2a-d). MALDI-TOF mass spectrometry also confirmed that these molecules were characterized by molecular masses corresponding to those of oligomers of unsubstituted polygalacturonic acid with a degree of polymerization of between 6 and 13 (FIG. 2f). Treatment of the fractions with a fully active PG of A. niger caused the molecules to disappear, confirming their OG nature (FIG. 5).

[0127] Subsequently, we placed the transgene coding for the OGMs under the control of the terminal portion (1300 bps) of the promoter which regulates the expression of the gene PR-1 of Arabidopsis (PPR-1), strongly induced by bacterial and fungal infections (32-35). The construct (PPR1::OGM) was introduced in Arabidopsis and two independent transgenic lines were selected for a more thorough characterization. Neither transgenic plant showed any evident morphological difference compared to the wild plant Col-0 despite having, in the absence of the pathogen, a basal expression of the transgene that was greater in line 2 than in line 1. After inoculation with Botrytis cinerea, a significant increase (approximately 3-fold) was observed in the transcript coding for the OGM in both lines (FIG. 3a). The immunodecoration analysis confirmed the presence of a basal level of OGM in the uninfected plants, as well as the accumulation of the protein during infection with B. cinerea (FIG. 3b). Subsequently, we compared the susceptibility of the transgenic plants expressing the OGM and of the wild type plant Col-0 to some pathogenic microorganisms. The inocula of B. cinerea in the transgenic plants produced a reduced number of infections, whose success was indicated by the typical grey rot lesion (FIG. 3c). Moreover, the average area of the lesions in the plants of line 2 was significantly smaller than the one produced in wild type plants. The lesions produced in line 1 were likewise smaller than those of wild type plants, but this difference was not wholly significant (FIG. 3d). The transgenic plants also showed a marked resistance against the infections produced by Pectobacterium carotovorum (FIG. 3e) and Pseudomonas syringae pv. tomato DC3000. (FIG. 30. In conclusion, the expression of the OGM under the control of a pathogen-inducible promoter seems to promote a non-specific resistance towards both fungal and bacterial pathogens, in which the release of OGs acts as a generic elicitor of defence responses. The OGM is characterised by a low residual enzymatic activity, which was optimal for regulating a controlled release of OGs in vivo and a controlled release of OGs in plants can in turn activate a wide range of defence responses, imparting resistance against pathogenic microorganisms to the plants.

[0128] Our research was mainly aimed at investigating the possible biotechnological applications of the OGM. The expression of the OGM under the control of a pathogen-inducible promoter enabled a rapid activation of defences which protected the transgenic plants against three major pathogens of agronomic interest. The present strategy of employing the OGM for the constitution of transgenic plants can be generally effective towards a broad range of pathogens and can represent a technology for protecting farm crops.

[0129] The controlled expression of the OGM following induction can be useful not only for engineering resistance, but also for studying the effects of OGs under physiological conditions. OGs activate defence responses on the one hand, and on the other hand they influence plant development and growth, acting like local auxin antagonists (36-40). The role of OGs as regulators of growth and development is mainly based on experiments that use exogenous OG treatments. To what degree OGs accumulate in intact tissues and in the absence of a pathogen and how they act as endogenous regulators of plant growth and development can now be investigated.

REFERENCES

[0130] 1. Newman, M. A., Sundelin, T., Nielsen, J. T. & Erbs, G. MAMP (microbe-associated molecular pattern) triggered immunity in plants. Front Plant Sci. 4, 139 (2013). [0131] 2. Hahn, M. G., Darvill, A. G. & Albersheim, P. Host-pathogen interactions. XIX. The endogenous elicitor, a fragment of a plant cell wall polysaccharide that elicits phytoalexin accumulation in soybeans. Plant Physiol. 68, 1161-1169 (1981). [0132] 3. Ferrari, S., Savatin, D. V., Sicilia, F., Gramegna, G, Cervone, F. & De Lorenzo, G. Oligogalacturonides: plant damage-associated molecular patterns and regulators of growth and development Frontiers in Plant Science 4, 1-16 (2013). [0133] 4. Cervone, F., Hahn, M. G., De Lorenzo, G, Darvill, A. & Albersheim, P. Host-pathogen interactions. XXXIII. A plant protein converts a fungal pathogenesis factor into an elicitor of plant defense responses. Plant Physiol. 90, 542-548 (1989). [0134] 5. Nothnagel, E. A., McNeil, M., Albersheim, P. & Dell, A. Host-pathogen interactions. XXII. A galacturonic acid oligosaccharide from plant cell walls elicits phytoalexins. Plant Physiol. 71, 916-926 (1983). [0135] 6. Cervone, F., De Lorenzo, G., Degrà, L., Salvi, G. & Bergami, M. Purification and characterization of a polygalacturonase-inhibiting protein from Phaseolus vulgaris L. Plant Physiol. 85, 631-637 (1987). [0136] 7. Ferrari, S., Vairo, D., Ausubel, F. M., Cervone, F. & De Lorenzo, G. Tandemly duplicated Arabidopsis genes that encode polygalacturonase-inhibiting proteins are regulated coordinately by different signal transduction pathways in response to fungal infection. Plant Cell 15, 93-106 (2003). [0137] 8. Powell, A. L., van Kan, J., ten Have, A., Visser, J., Greve, L. C., Bennett, A. B., Labavitch, J. M. Transgenic expression of pear PGIP in tomato limits fungal colonization. Mol. Plant-Microbe Interact. 13, 942-950 (2000). [0138] 9. Manfredini, C., Sicilia, F., Ferrari, F., Pontiggia, D., Salvi, G., Caprari, C., Lorito, M., De Lorenzo, G. Polygalacturonase-inhibiting protein 2 of Phaseolus vulgaris inhibits BcPG1, a polygalacturonase of Botrytis cinerea important for pathogenicity, and protects transgenic plants from infection. Physiol. Mol. Plant Pathol. 67, 108-115 (2005). [0139] 10. D'Ovidio, R., Raiola, A., Capodicasa, C., Devoto, A., Pontiggia, D., Roberti, S., Galletti, R., Conti, E., O'Sullivan, D., De Lorenzo, G Characterization of the complex locus of bean encoding polygalacturonase-inhibiting proteins reveals subfunctionalization for defense against fungi and insects. Plant Physiol. 135, 2424-2435 (2004). [0140] 11. Casasoli, M., Federici, L., Spinelli, F., of Matteo, A., Vella, N., Scaloni, F., Fernandez-Recio, J., Cervone, F. & De Lorenzo, G. Integration of evolutionary and desolvation energy analysis identifies functional sites in a plant immunity protein Proc. Natl. Acad. Sci. USA 106, 7666-7671(2009). [0141] 12. Davis, K. R., Darvill, A. G., Albersheim, P. & Dell, A. Host-pathogen interactions. XXIX. Oligogalacturonides released from sodium polypectate by endopolygalacturonic acid lyase are elicitors of phytoalexins in soybean. Plant Physiol. 80, 568-577 (1986). [0142] 13. Walker-Simmons, M., Hadwiger, L. & Ryan, C. A. Chitosans and pectic polysaccharides both induce the accumulation of the antifungal phytoalexin pisatin in pea pods and antinutrient proteinse inhibitors in tomato leaves. Biochem. Biophys. Res. Commun. 110, 194-199 (1983). [0143] 14. Jin, D. F. & West, C. A. Characteristics of galacturonic acid oligomers as elicitors of casbene synthetase activity in castor bean seedlings. Plant Physiol. 74, 989-992 (1984). [0144] 15. Davis, K. R. & Hahlbrock, K. Induction of defense responses in cultured parsley cells by plant cell wall fragments. Plant Physiol. 85, 1286-1290 (1987). [0145] 16. Broekaert, W. F. & Peumans, W. J. Pectic polysaccharides elicit chitinase accumulation in tobacco. Physiol. Plant. 74, 740-744 (1988). [0146] 17. Denoux, C., Galletti, R., Mammarella, N., Gopalan, S., Werck, D., De Lorenzo, G., Ferrari, S., Ausubel, F. M. & Dewdney, J. Activation of defense response pathways by OGs and Flg22 elicitors in Arabidopsis seedlings Mol Plant 1, 423-445 (2008). [0147] 18. Galletti, R., De Lorenzo, G. & Ferrari, S. Host-derived signals activate plant innate immunity. Plant Signal. Behav. 4, 33-34 (2009). [0148] 19. Bellincampi, D., Dipierro, N., Salvi, G., Cervone, F. & De Lorenzo, G. Extracellular H.sub.2O.sub.2 induced by oligogalacturonides is not involved in the inhibition of the auxin-regulated rolB gene expression in tobacco leaf explants. Plant Physiol. 122, 1379-1385 (2000). [0149] 20. Galletti, R., Denoux, C., Gambetta, S., Dewdney, J., Ausubel, F. M., De Lorenzo, G. & Ferrari, S. The AtrbohD-mediated oxidative burst elicited by oligogalacturonides in Arabidopsis is dispensable for the activation of defense responses effective against Botrytis cinerea Plant Physiol. 148, 1695-1706 (2008). [0150] 21. Brutus, A., Sicilia, F., Macone, A., Cervone, F. & De Lorenzo, G. A domain swap approach reveals a role of the plant wall-associated kinase 1 (WAK1) as a receptor of oligogalacturonides. Proc. Natl. Acad. Sci. USA 107, 9452-9457 (2010). [0151] 22. De Lorenzo, G., Brutus, A., Savatin, D. V., Sicilia, F. & Cervone, F. Engineering plant resistance by constructing chimeric receptors that recognize damage-associated molecular patterns (DAMPs). FEBS Lett. 585, 1521-1528 (2011). [0152] 23. Ferrari, S., Galletti, R., Denoux, C., De Lorenzo, G, Ausubel, F. M. & Dewdney, J. Resistance to Botrytis cinerea induced in Arabidopsis by elicitors is independent of salicylic acid, ethylene, or jasmonate signaling but requires PHYTOALEXIN DEFICIENT3 Plant Physiol. 144, 367-379 (2007). [0153] 24. Galletti, R., Ferrari, S. & De Lorenzo, G. Arabidopsis MPK3 and MPK6 play different roles in basal and oligogalacturonide- or flagellin-induced resistance against Botrytis cinerea. Plant Physiol 157, 804-814 (2011). [0154] 25. Termeer, C., Benedix, F., Sleeman, J., Fieber, C., Voith, U., Ahrens, T., Miyake, K., Freudenberg, M., Galanos, C. & Simon, J. C. Oligosaccharides of Hyaluronan activate dendritic cells via toll-like receptor 4 J. Exp. Med. 195, 99-111 (2002). [0155] 26. Nurnberger, T., Brunner, F., Kemmerling, B. & Piater, L. Innate immunity in plants and animals: striking similarities and obvious differences. Immunol. Rev. 198, 249-266 (2004). [0156] 27. Leckie, F., Maffei, B., Capodicasa, C., Hemmings, A., Nuss, L., Aracri, B., De Lorenzo, G. & Cervone, F. The specificity of polygalacturonase-inhibiting protein (PGIP): a single amino acid substitution in the solvent-exposed b-strand/b-turn region of the leucine-rich repeats (LRRs) confers a new recognition capability EMBO J. 18, 2352-2363 (1999). [0157] 28. Farina, A., Rocchi, V., Janni, M., Benedettelli, S., De Lorenzo, G., D'Ovidio, R. The bean polygalacturonase inhibiting protein 2 (PvPGIP2) is highly conserved in common bean (Phaseolus vulgaris L.) germplasm and related species. Theor. Appl. Genet. 118, 1371-1379 (2009). [0158] 29. Benedetti, M., Leggio, C., Federici, L., De Lorenzo, G., Pavel, N. V. & Cervone, F. Structural Resolution of the Complex between a Fungal Polygalacturonase and a Plant Polygalacturonase-Inhibiting Protein by Small-Angle X-Ray Scattering Plant Physiol. 157, 599-607 (2011). [0159] 30. Capodicasa, C., Vairo, D., Zabotina, O., McCartney, L., Caprari, C., Maffei, B., Manfredini, C., Aracri, B., Benen, J., Knox, P., De Lorenzo, G., Cervone, F. Targeted modification of homogalacturonan by transgenic expression of a fungal polygalacturonase alters plant growth. Plant Physiol. 135, 1294-1304 (2004). [0160] 31 Zuo, J., Niu, Q. W. & Chua, N. H. Technical advance: An estrogen receptor-based transactivator XVE mediates highly inducible gene expression in transgenic plants. Plant J. 24, 265-273 (2000). [0161] 32. Cao, H., Bowling, S. A., Gordon, A. S. & Dong, X. Characterization of an Arabidopsis mutant that is nonresponsive to inducers of systemic acquired resistance. Plant Cell 6, 1583-1592 (1994). [0162] 33. Zhao, Y, Thilmony, R., Bender, C. L., Schaller, A., He, S. Y. and Howe, G. A. Virulence systems of Pseudomonas syringae pv. tomato promote bacterial speck disease in tomato by targeting the jasmonate signaling pathway. Plant J. 36, 485-499 (2003). [0163] 34. Lee, M. W. & Yang, Y. Transient expression assay by agroinfiltration of leaves. Methods Mol. Biol. 323, 225-229 (2006). [0164] 35. Robert-Seilaniantz, A., Grant, M. & Jones, J. D. G. Hormone Crosstalk in Plant Disease and Defense: More Than Just JASMONATE-SALICYLATE Antagonism. Annual Review of Phytopathology, Vol 49 49, 317-343 (2011). [0165] 36. Branca, C., De Lorenzo, G. & Cervone, F. Competitive inhibition of the auxin-induced elongation by a-D-oligogalacturonides in pea stem segments. Physiol. Plant. 72, 499-504 (1988). [0166] 37. Hayashi, T. & Yoshida, K. Cell expansion and single-cell separation induced by colchicine in suspension-cultured soybean cells. Proc. Natl. Acad. Sci. USA 85, 2618-2622 (1988). [0167] 38. Baldwin, E. A. & Pressey, R. Pectic enzymes in pectolyase. Separation, characterization, and induction of ethylene in fruits. Plant Physiol. 90, 191-196 (1989). [0168] 39. Filippini, F., Terzi, M., Cozzani, F., Vallone, D. & the Schiavo, F. Modulation of auxin-binding proteins in cell suspensions. II. Isolation and initial characterization of carrot cell variants impaired in somatic embryogenesis. Theor. Appl. Genet. 84, 430-434 (1992). [0169] 40. Peretto, R., Favaron, F., Bettini, V., De Lorenzo, G., Marini, S., Alghisi, P., Cervone, F., Bonfante, P. Expression and localization of polygalacturonase during the outgrowth of lateral roots in Allium porrum L. Planta. 188, 164-172 (1992). [0170] 41. Clough, S. J. & Bent, A. F. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16, 735-43 (1998). [0171] 42. Pfaffl, M. W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, e45 (2001). [0172] 43. Ferrari, S., Galletti, R., Vairo, D., Cervone, F. & De Lorenzo, G. Antisense expression of the Arabidopsis thaliana AtPGIP1 gene reduces polygalacturonase-inhibiting protein accumulation and enhances susceptibility to Botrytis cinerea. Mol. Plant Microbe Interact. 19, 931-936 (2006).