High-temperature neutral cellulase as well as coding gene and application thereof
10767170 ยท 2020-09-08
Assignee
Inventors
- Bin YAO (Beijing, CN)
- Pengjun Shi (Beijing, CN)
- Hong Yang (Beijing, CN)
- Huoqing Huang (Beijing, CN)
- Huiying Luo (Beijing, CN)
- Peilong Yang (Beijing, CN)
- Yaru Wang (Beijing, CN)
- Xiaoyun Su (Beijing, CN)
- Yingguo Bai (Beijing, CN)
- Xia SHI (Beijing, CN)
- Rui MA (Beijing, CN)
- Kun Meng (Beijing, CN)
Cpc classification
C12Y302/01004
CHEMISTRY; METALLURGY
C12N15/63
CHEMISTRY; METALLURGY
International classification
C12N15/63
CHEMISTRY; METALLURGY
Abstract
Provided are a fungus-sourced high-temperature neutral Family-45 cullulase as well as a coding gene and application thereof. The cullulase has optimal pH value of 5.5, and optimal temperature of 60 C., has certain enzyme activity in alkaline condition, and has good alkali resistance, maintains about 70% enzyme activity in optimal condition after being processed at 90 C. for 1 hour, maintains about 50% enzyme activity in optimal condition after being processed in boiling water for 1 hour, and can be well applied in c and other fields.
Claims
1. A method of degrading cellulose contained in a raw textile fiber, comprising applying a cellulase to said raw textile fiber, wherein said cellulase has the amino acid as shown in SEQ ID NO: 1 or SEQ ID NO: 2.
2. The method of claim 1, wherein said cellulase is produced by transcribing an isolated polynucleotide encoding said cellulase.
3. The method of claim 2, wherein said isolated polynucleotide has a nucleotide sequence as set in forth in SEQ ID NO.4 or SEQ ID NO.5.
4. The method of claim 3, wherein said isolated polynucleotide is in a recombinant vector.
5. The method of claim 3, wherein said isolated polynucleotide is introduced into the genome of a recombinant yeast host cell.
6. The method of claim 5, wherein said recombinant host cell is a Pichia cell.
7. The method of claim 1, wherein said cellulase has an optimal pH value of 5.5, the optimal temperature of 60 C., maintains about 70% of its optimal activity after incubation at 60 C. for 1 hour, and maintains 50% of its optimal activity condition after incubation in 100 C. water for 1 hour.
8. A method of degrading cellulose contained in paper pulp, comprising applying a cellulase to said paper pulp, wherein said cellulase has the amino acid sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2.
9. The method of claim 8, wherein said cellulase is produced by transcribing an isolated polynucleotide encoding said cellulase.
10. The method of claim 9, wherein said isolated polynucleotide has a nucleotide sequence as set in forth in SEQ ID NO.4 or SEQ ID NO.5.
11. The method of claim 10, wherein said isolated polynucleotide is in a recombinant vector.
12. The method of claim 10, wherein said isolated polynucleotide is introduced into the genome of a recombinant yeast host cell.
13. The method of claim 12, wherein said recombinant host cell is a Pichia cell.
14. The method of claim 8, wherein said cellulase has an optimal pH value of 5.5, the optimal temperature of 60 C., maintains about 70% of its optimal activity after incubation at 60 C. for 1 hour, and maintains 50% of its optimal activity condition after incubation in 100 C. water for 1 hour.
Description
BRIEF DESCRIPTIONS OF THE DRAWINGS
(1)
(2)
(3)
(4)
EXAMPLES
(5) The present invention is further illustrated with reference to the following Examples and the appended drawings, which should by no means be construed as limitations of the present invention.
(6) Test Materials and Reagents
(7) 1. Strains and vectors: Thielavia arenaria XZ7; Pichia pastoris strain GS115 (Invitrogen); and vector pPIC9 (Invitrogen).
(8) 2. Enzymes and other biochemical reagents: restriction endonucleases (TaKaRa); ligase (Invitrogen); and barley dextran and CMC-Na (Sigma)
(9) 3. Medium: (1) taking potato dextrose medium as Thielavia arenaria XZ7 Medium, including 1000 mL of potato juice, 10 g of dextrose, and 25 g of arga, natural pH. (2) E. coli. LB medium: 1% of peptone, 0.5% of yeast extract, and 1% of NaCl, natural pH. (3) BMGY medium: 1% of yeast extract; 2% of peptone; 1.34% of YNB, 0.00004% of Biotin; and 1% of glycerol (V/V). (4) BMMY medium: 1% of yeast extract; 2% of peptone; 1.34% of YNB, 0.00004% of Biotin; and 0.5% of methanol (V/V).
(10) Suitable biology laboratory methods not particularly mentioned in the examples as below can be found in Sambrook, et al. (Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989), and other kit laboratory manuals.
Example 1 Cloning Gene Coding Cellulase from Thielavia arenaria XZ7
(11) Genomic DNA is isolated from Thielavia arenaria XZ7 by adding 2 mL of extract buffer mycelium, and grinding for 5 min, followed by decomposing for 120 min in a water bath at 65 C., and mixing well every 20 min, then centrifugating for 10 min at 13000 rpm at 4 C. The supernatant was extracted in phenol/chloroform to remove the impurities, followed by adding isopropanol in equal volume, settling for 30 min at 20 C., centrifugating for 10 min at 13000 rpm at 4 C. to remove supernatant, washing the precipitate with 70% ethanol twice followed by drying, dissolving in TE solution and storing at 20 C.
(12) It was possible to design a pair of degenerate primers to amplify part fragment of the cellulase gene based on the conserved fragment of Family 45 of cellulase, GXTTRYWDC and QFDXXIPGG
(13) TABLE-US-00006 Pl:5-GGYAMVACCACYCGYTAYTGGGAYTGYT-3; P2:5-WCCBCCKGGRATSRMSADRTCRAAYTG-3
(14) PCR amplification was performed by optimizing PCR parameters as follows: degenerating at 94 C. for 5 minutes, followed by 30 cycles at: degenerating at 94 C. for 30 seconds/annealing temperature at 45 C. for 30 seconds/extending at 72 C. for 1 minute, and a final extension of 10 minutes at 72 C. PCR product comprising 292 bp was obtained and linked to vector pEASY-T3 for sequencing.
(15) Based on the known fragment, the nested insertion-specific primers for TAIL PCR were designed, and named respectively as shown in table 1, wherein primer sp2 located in the downstream of primer sp1, primer sp3 located in the downstream of primer sp2, the arbitrary distance between two primer, 2230 nt in length, and the annealing temperature at 6065 C.
(16) TABLE-US-00007 TABLE1 SpecificprimersforTAILPCR Length Primer Sequence(5 ---3) (bp) dsp1 CGCGCGACAAGAACGACAACCCGCTCAACGAC 32 dsp2 CTGGGCCGCCGTCAACATTGCGGGCTCCAAC 31 usp1 CAATGTTGACGGCGGCCCAGCCGTAGGC 28 usp2 GTCGTTGAGCGGGTTGTCGTTCTTGTCGCGCG 32
(17) Two flanking sequences were obtained by Reverse TAIL-PCR, sequenced, and assembled into gene coding cellulase with 938 bp in full length including two introns, coding 249 amino acids and one termination codon. Said cellulase comprised a signal peptide of 20 amino acids in N-terminal, and had molecular weight of 24.2 kDa.
Example 2 Preparing Recombinant Cellulase
(18) The coding region of mature protein was amplified. The amplification products were visualized by electrophoresis on agarose gel, and band of expected size was excised and DNA was extracted with Kit. The DNA purified was inserted into pPIC9 (Invitrogen, San Diego, Calif.) at the EcoRI and NotI sites, as described by the manufacturer instruction to obtain DNA construct pPIC-cel45. The construct was transformed into Pichia pastoris strain GS115 to obtain the recombinant cell GS115/cel45.
(19) The transformed Pichia pastoris strain GS115 (Invitrogen) were incubated in 400 mL of BMGY for 48 h at 30 C. and 250 rpm, and then the cells were spun down and suspended in 200 mL of BMMY to induce to express cellulase. 48 hours after induction, the supernatant was recovered by spinning to test the activity of the cellulase. The recombinant -glucosidase was expressed in Pichia pastoris strain GS115 as showed by SDS-PAGE.
(20) The expression vector comprising the full-length gene coding cellulase was constructed and transformed to Pichia pastoris strain GS115 by the same method as above, and the recombinant cellulase was also tested.
Example 3 Measuring Activity of the Recombinant Cellulase
(21) The amount of glucose produced by hydrolyzing substrate, CMC-Na, with cellulase in 540 nm.
(22) 100 L of diluted enzyme was mixed with 900 L of substrate solution (1%, w/v), which was reacted at 60 C. for 10 minutes in 1M of Sodium dihydrogen phosphate-citric acid (pH 6.0). Then, 1.5 mL of DNS was added to stop the reaction. OD.sub.540 was measured. 1 unit of enzyme activity was determined to be the enzyme amount releasing 1 mol of glucose by decomposing substrate, for 1 minute.
Measuring the Properties of the Recombinant Cellulase Obtained in Example 2
(23) 1. Optimum pH Values and pH Stability
(24) The cellulase purified in example 2 was reacted in the different pH to determine optimum pH. The activity of cellulase was measured with CMC-Na in 0.1M of citric acid-sodium dimetallic phosphate buffer with different pH at 60 C. As is shown in
(25) 2. Optimum Temperature and Heat Stability
(26) The cellulase was reacted at the different temperatures in citric acid-sodium dimetallic phosphate buffer (pH 5.5) to determine optimum temperature. The activity of cellulase was measured after being processed at different temperatures for 2, 5, 10, 20, 30, and 60 min. As shown in
(27) 3. Measuring Enzyme Kinetics of Cellulase
(28) Testing the activity of cellulase at 60 C. with the different concentration of substrate, in citric acid-sodium dimetallic phosphate buffer (pH5.5), and calculating K.sub.m as 11.28 mg/mL, and V.sub.max as 11256.44 mol/min.Math.mg when using dextran as substrate; and K.sub.m as 10.79 mg/mL, and V.sub.max as 1177.44 mol/min.Math.mg when using CMC-Na as substrate.
(29) 4. Effect of Metal Ions and Chemistry Agents on Activity of Cellulase
(30) The effect of metal ions on cellulase activity was investigated at the pH optimum (pH 5.5) and 60 C. in a final concentration of 5 mmol/L. The result showed that, among various metal ions, the enzyme activity of cellulase almost wasn't inhibited by many metal ions, but was inhibited by Ag.sup.+ and SDS. Additionally, cellulase was weakly activated by Ca.sup.2+ and Co.sup.2+, and obviously activated by -mercaptoethanol.