ORF7 DEFICIENT VARICELLA VIRUS, VACCINE COMPRISING THE VIRUS AND USE THEREOF

20200277577 ยท 2020-09-03

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided are an ORF7 deficient varicella virus, an vaccine comprising the virus and use thereof, as well as a method for the production the virus.

Claims

1. A vaccine varicella and/or herpes zoster, comprising a varicella virus, and an excipient or carrier acceptable in vaccines, wherein the ORF7 of said varicella virus is entirely or partially deleted so that the resulting virus is unable to infect human skin or sensory ganglion.

2. The vaccine according to claim 1, wherein said ORF7 is entirely or partially replaced by antibiotic resistance genes.

3. The vaccine according to claim 2, wherein said antibiotic resistance genes are selected from penicillin, streptomycin and kanamycin resistance genes.

4. (canceled)

5. The vaccine according to claim 1, wherein the varicella virus is the varicella virus deposited in China General Microbiological Culture Collection Center, Institute of Microbiology Chinese Academy of Sciences, NO. 1 West Beichen Road, Chaoyang District, Beijing 100101, China on Jul. 28, 2009 with deposit number CGMCC No. 3207.

6. A method of inducing an immune response against varicella and/or herpes zoster, comprising administering a prophylactic effective amount of the vaccine according to claim 1.

7. An immunogenic composition comprising a prophylactic effective amount of the vaccine according to claim 1.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0034] FIG. 1: Construction of P-Oka BAC (VZV BAC) vector.

[0035] FIG. 2: Preparation of ORF7 deleted VZV BAC strain (VZV-7D BAC).

[0036] FIG. 3: Electrophoresis of ORF7 deleted VZV.

[0037] FIG. 4A: Culture of VZV-7D in dorsal root ganglion the growth curve of wild type virus (WT), reverse mutant virus (7R), deficient virus (7D) cultured in MeMo cell.

[0038] FIG. 4B: Culture of VZV-7D in dorsal root ganglion the growth curve of wild type virus (WT), reverse mutant virus (7R), deficient virus (7D) cultured in the dorsal root ganglion (DRG).

[0039] FIG. 5: Preparation of ORF-7 reverse mutant VZV (VZV-7R).

[0040] FIG. 6: the growth curve of VZV-7DRM with a fluorescent tag (luc) cultured in human MeWo cells.

[0041] FIG. 7: the growth curve of VZV-7DRM with a fluorescent tag (luc) cultured in human thymus tissue culture (TOC).

[0042] FIG. 8: the growth curve of VZV-7DRM with a fluorescent tag (luc) in human skin tissue culture (SOC).

[0043] FIG. 9A: MeWo cells and neuroblastoma (SH-SY5Y) cells transfected with DNA from WT, VZV-7DRM and VZV-7R. VZV-7DRM cannot grow in neuroblastoma cells.

[0044] FIG. 9B: dorsal root ganglion (DRG) isolated from the spinal cord of human embryos.

[0045] FIG. 9C: DRG was transplanted into the renal capsule of severe combined immunodeficiency mouse model (SCID-hu) and then infected by WT or VZV-7DRM. The virus growth is measured by IVIS instrument. VZV-7DRM cannot grow in severe combined immunodeficiency mouse transplanted with human tissues (SCID-hu).

[0046] FIG. 9D: After infection, increase of GFP intensity showed that WT VZV can grow in the DRG cultures.

DETAILED DESCRIPTION OF THE INVENTION

[0047] The embodiments of the invention will be described in details by referring to the following examples. One skilled in the art will recognize that these examples are intend to illustrate the implementation of the present invention, but not to limited the scope of the present invention. For those techniques or conditions not specifically illustrated, the procedures are carried out in accordance with the technology and conditions described in the art (for example, J. Sambrook, et al., Molecular Cloning: A Laboratory Manual, third edition, Science Press; translated by Peitang Huang) or in accordance with the manufacture's instruction. Reagents or equipment are commercially available, unless otherwise specified.

Example 1. Construction of p-Oka BAC (VZV BAC)

[0048] (1) A BAC vector: A BAC vector, pUSF-6, contains the prokaryotic replication origin (ori), the replication and partition gene (repE, parA, and parB), the Cam.sup.r gene, a green fluorescent protein (gfp) gene, two 500-bp VZV fragments a and b (gray), and two loxP sites (white). pUSF-6 was digested with BamHI, resulting in a linear fragment; and was inserted in a VZV-containing cosmid, pvSpe23, by homologous recombination.

[0049] (2) Schematic diagram of the pOka genome shows that VZV contains a 125-kb nucleotide sequences with unique long (UL) and unique short (US) segments. The whole genome was digested into four VZV segments with overlapping region, and cloned into cosmid, resulting in four recombinant clones, namely pvFsp73, pvSpe14, pvPme19 and pvSpe23. pUSF-6 was inserted between ORF60 and ORF61 in a VZV cosmid, pvSpe23, by homologous recombination.

[0050] (3) The pvSpe23 containing a BAC vector (pUSF-6) was cotransfected with three other VZV cosmids into MeWo cells, and the resulting recombinant virus (VZVBAC) was able to replicate in MeWo cells and produced a green fluorescent plaque.

[0051] The procedures is also shown in FIG. 1.

[0052] The growth curve of VZV BAC was compared to that of wild-type pOka. Plaque forming unit (PFU) at each dpi was recorded. The results indicates that VZV BAC (green) has no detectable growth defect, which is consistent with in vitro grown of the parental virus.

Example 2. Generation and Validation of ORF7 Deficient VZV BAC (VZV-7D BAC)

[0053] ORF7 deleted mutant was constructed by referring to previously described luc VZV BAC (Zhang et al. Journal of Virology, September, 2007, p 9024-9033). The procedures were described in FIG. 2 and below.

[0054] (1) Two primers were designed to contain 20-bp of homologous nucleotides of the kanamycin resistance gene and 40-bp of homologous nucleotides of the flanking sequences adjacent to either the start or stop codon of the ORF7 being targeted for deletion. The sequences of primer F1 and R1 are given below:

TABLE-US-00003 F1: (SEQIDNO:3) GATTTATCCATAGTTCAATACGTTGGAAAGCCAGTC AATCGCTCTTGTTGGCTAGTGCGTA; R1: (SEQIDNO:4) AAACATACACCAGAAACGTTTTTAGTTTTTATTTCA ATATTCTGCCAGTGTTACAACCAA.

[0055] The Kan.sup.R gene was amplified from the plasmid pGEM-oriV/kan1 (Netterwald, Yang et al. 2005). The PCR products were digested with DpnI and recovered by a gel extraction kit (Qiagen).

[0056] (2) About 200 ng of each PCR product was transformed into DY380 strain carrying the VZVLuc BAC via electroporation at 1.6 kV and 250 uF using BioRad Gene Pulser II equipment.

[0057] (3) The DY380 strain serving as a highly efficient homologous recombination system allows recombination of homologous sequences as short as 40 bp. The homologous recombination between kanamycin resistance gene (kan.sup.r) and ORF7 is realized by the recombinant enzyme, which is activated at 42 C. and suppressed at 32 C. As a result, ORF7 was replaced by Kan.sup.r. The single recombinants were selected on agar plates containing 30 g/ml of kanamycin at 32 C. DNA of VZV mutant (ORF7 deletion) were isolated from E. coli.

[0058] (4) The virus genome's integrity was verified by HindIII digestion and the recombinant DNA was confirmed by PCR analysis. It is confirmed that ORF7 deficient BAC was obtained (VZV-7D BAC), with ORF7 replaced by Kan.sup.r.

Example 3. Generation and Verification of VZV BAC with Flip Reverse Frameshift Mutation (VZV-7DRM BAC)

[0059] Strategy: The ORF7 of wild type virus was replaced by galk gene. The recombinant VZV with galk gene shall produce bright red plaques on MacConkey agar with galactose as the only carbon source. The single clone would be chosen by this method. Then replace the galk gene with flip reverse frameshift mutation sequences and select single clone on complete and minimal media plates to obtain VZV-7DRM BAC.

[0060] Detailed protocol is given below:

[0061] (1) Design amplification primers F2 and R2 to amplify galk gene from pgalk (1-82 bp: promoter; 83-1231 bp: galK open reading frame). The forward and reverse primers each have at 5 60 bp homology sequences flanking ORF7. Galk sequence is given below (SEQ ID NO:5):

TABLE-US-00004 (SEQIDNO:5) CCTGTTGACAATTAATCATCGGCATAGTATATCGGCATAGTATAATACGA CAAGGTGAGGAACTAAACCCAGGAGGCAGATCATGAGTCTGAAAGAAAAA ACACAATCTCTGTTTGCCAACGCATTTGGCTACCCTGCCACTCACACCAT TCAGGCGCCTGGCCGCGTGAATTTGATTGGTGAACACACCGACTACAACG ACGGTTTCGTTCTGCCCTGCGCGATTGATTATCAAACCGTGATCAGTTGT GCACCACGCGATGACCGTAAAGTTCGCGTGATGGCAGCCGATTATGAAAA TCAGCTCGACGAGTTTTCCCTCGATGCGCCCATTGTCGCACATGAAAACT ATCAATGGGCTAACTACGTTCGTGGCGTGGTGAAACATCTGCAACTGCGT AACAACAGCTTCGGCGGCGTGGACATGGTGATCAGCGGCAATGTGCCGCA GGGTGCCGGGTTAAGTTCTTCCGCTTCACTGGAAGTCGCGGTCGGAACCG TATTGCAGCAGCTTTATCATCTGCCGCTGGACGGCGCACAAATCGCGCTT AACGGTCAGGAAGCAGAAAACCAGTTTGTAGGCTGTAACTGCGGGATCAT GGATCAGCTAATTTCCGCGCTCGGCAAGAAAGATCATGCCTTGCTGATCG ATTGCCGCTCACTGGGGACCAAAGCAGTTTCCATGCCCAAAGGTGTGGCT GTCGTCATCATCAACAGTAACTTCAAACGTACCCTGGTTGGCAGCGAATA CAACACCCGTCGTGAACAGTGCGAAACCGGTGCGCGTTTCTTCCAGCAGC CAGCCCTGCGTGATGTCACCATTGAAGAGTTCAACGCTGTTGCGCATGAA CTGGACCCGATCGTGGCAAAACGCGTGCGTCATATACTGACTGAAAACGC CCGCACCGTTGAAGCTGCCAGCGCGCTGGAGCAAGGCGACCTGAAACGTA TGGGCGAGTTGATGGCGGAGTCTCATGCCTCTATGCGCGATGATTTCGAA ATCACCGTGCCGCAAATTGACACTCTGGTAGAAATCGTCAAAGCTGTGAT TGGCGACAAAGGTGGCGTACGCATGACCGGCGGCGGATTTGGCGGCTGTA TCGTCGCGCTGATCCCGGAAGAGCTGGTGCCTGCCGTACAGCAAGCTGTC GCTGAACAATATGAAGCAAAAACAGGTATTAAAGAGACTTTTTACGTTTG TAAACCATCACAAGGAGCAGGACAGTGCTGA

[0062] The sequences of Primer F2 and R2 are given below:

TABLE-US-00005 F2 (SEQIDNO:6) ACCGAATCGTCGGTTTGGAGGATTTATCCATAGTTCAATACGTTGGAAAG CCAGTCAATCATGCCTGTTGACAATTAATCATCGGCA R2 (SEQIDNO:7) TAATTTTATATACAAAATAAAAACATACACCAGAAACGTTTTTAGTTTTT ATTTCAATATTCAGCACTGTCCTGCTCCTT

[0063] (2). Use those primers to amplify the galk cassette. Digesting the product with DpnI overnight and purify it;

[0064] (3). Transform the VZV BAC into SW102 strain of E. coli;

[0065] (4). Inoculate a single colony onto 5 ml of LB-CM (LB with chloramphenicol) and grow overnight at 32 C.;

[0066] (5). Inoculate the overnight culture into 250 ml of LB-CMol and grow at 32 C. with shaking till an O.D. of 0.4-0.6;

[0067] (6). Prepare the electrocompetent cells (SW102 transformed with VZV BAC);

[0068] (7). Transform the electrocompetent cells (SW102 transformed with VZV BAC) prepared in step (6) with 1-2 l (200 ng) of the purified PCR product from step (2), with the electroporation parameters described in example 2.

[0069] (8). Recover the transformants for one hour in 1 ml of LB at 32 C.

[0070] (9). After the recovery period, wash the bacteria 3 in 1M9 salts as follows: centrifuge the culture at 13,200 RPM for 15 sec, and remove the supernatant with a pipette. Resuspend the pellet in 1M9 salts, and centrifuge it again as above. Repeat the washing step once more. After three washes, remove the supernatant and resuspend the pellet in 1 ml of 1M9 salts. Then plate the suspension of the pellet, 10 serial dilutions and 100 serial dilutions onto M63 minimal media plates with galactose, leucine, biotin, and chloramphenicol;

[0071] (10). Incubate the plates for 3 days at 32 C.;

[0072] (11). Streak a few colonies onto MacConkey agar with galactose+chloramphenicol plates to obtain single colonies. The colonies appearing after 3 days of incubation should be Gal+, but in order to get rid of any Gal contaminants, it is important to obtain single, bright red colonies before proceeding to the next step.

[0073] (12). Pick a single, bright red (Gal+) colony and inoculate into a 5 ml LB-CM medium and culture overnight 32 C.; Prepare the BAC DNA from the overnight culture and verify the galk gene by PCR; the primers used are:

TABLE-US-00006 F3: (SEQIDNO:8) CCTGTTGACAATTAATCATCGGCA R3: (SEQIDNO:9) TCAGCACTGTCCTGCTCCTT

[0074] (13). Using primers F4 (SEQ ID NO: 10) and R4 (SEQ ID NO:11) to amplify the 457 bp sequence adjacent to 3 of ORF7 stop codon (the sequence of 457 bp ORF is set forth in SEQ ID NO:12). Since the primers F4 and R4 are designed to introduce 1 base's frameshift, the PCR product are produced with frameshift mutation.

[0075] The sequences of F4 and R4 are given below:

TABLE-US-00007 F4 (SEQIDNO:10) CGAATCGTCGGTTTGGAGGATTTATCCATAGTTCAATACGTTGGAAAGCC AGTCAATTTAATGGGATTTCTTGATCGCGGGG R4: (SEQIDNO:11) AATTTTATATACAAAATAAAAACATACACCAGAAACGTTTTTAGTTTTTA TTTCAATATGTGGTCCGTTCACACATGGAAAAC

[0076] 457 bp open read frame:

TABLE-US-00008 (SEQIDNO:12) CAGACGGTGTGTGCCAGCTTATGTGGATATGCTCGAATACCAACTGAAGA GCCATCTTATGAAGAGGTGCGTGTAAACACGCACCCCCAAGGAGCCGCCC TGCTCCGCCTCCAAGAGGCTTTAACCGCTGTGAATGGATTATTGCCTGCA CCTCTAACGTTAGAAGACGTAGTCGCTTCTGCAGATAATACCCGTCGTTT GGTCCGCGCCCAGGCTTTGGCGCGAACTTACGCTGCATGTTCTCGTAACA TTGAATGTTTAAAACAGCACCATTTTACTGAAGATAACCCCGGTCTTAAC GCCGTGGTCCGTTCACACATGGAAAACTCAAAACGGCTTGCTGATATGTG TTTAGCTGCAATTACCCATTTGTATTTATCGGTTGGCGCGGTGGATGTTA CT.

[0077] Repeat steps 4 through 10 above to obtain electrocompetent SW102 cells.

[0078] (14). Transform 50 l of heat-shocked bacteria of step (13) with 200 ng PCR product with homology to the area flanking the galK gene of step (2). Recover in 10 ml LB in a 50 ml baffled conical flask by incubating with shaking in a 32 C. waterbath for 4.5 hours. This long recovery period serves to obtain recombined VZV BAC that only contains the sequences of interest (and thus remove VZV BAC containing the galK cassette). As primer F4 is composed of 60 bp homologous sequence flanking the 5 of the ORF7 and 457 bp reverse sequences adjacent to 3 of ORF7, and primer R4 is composed of 60 bp homologous sequence flanking 3 of the ORF7 and 457 bp forward sequence adjacent to 3 of ORF7, homologus recombination between the amplified PCR product and galk gene in ORF7 locus leads to flip reverse link of 3 457 bp, resulting in flip reverse frameshift mutation (SEQ ID NO:13), without expressing function. The flip reverse framshift mutation sequence is given below:

TABLE-US-00009 (SEQIDNO:13) CATGGGATTTCTTGATCGCGGGGGTTGTGCGTTGTACATCTTGCGTCTGT TTTGGGGTCAACACGGGCTGAAGAGTTTCTGTCGGATACGTTTTTTTTGT TAGGTTAGATGTGTTATTATCCGATACTTCTATAAGTGGGGGTTTAATTT CAGATAATTGTGTCGCCTCCGATTTAATAGGTGATGTTTTTAAACCCACA TTTTCCCCTTTAGCTATAGATAATTCATGGTTGTGGGAAACATCAAACGA TGCCTGAGGTTTAGCAACGACCCCAAGAGTTTTCTCCAAAAGAACAACAT CAGACATGACCACTTCACTTTCAGCGGTCATTCTCAGGGTTTGATCGACA ATATCATCCGTAGTAACATCCACCGCGCCAACCGATAAATACAAATGGGT AATTGCAGCTAAACACATATCAGCAAGCCGTTTTGAGTTTTCCATGTGTG AACGGAC;

[0079] (15). As in step 9, spin 1 ml culture and wash 3 in 1M9 salts, and resuspend in 1 ml 1M9 salts. Plate the suspension of the pellet and 10dilution (each 1041) on M63 minimal media plates with glycerol, leucine, biotin, 2-deoxy-galactose, and chloramphenicol;

[0080] (16), Incubate at 32 C. for three to four days;

[0081] (17). Pick colonies and streak them onto an LB-CM plate and a Galk-M63 CM minimal media plate. Select single colonies that grow on the LB-CM but not on the minimal media plate. Extract virus DNA and verity integrity by HindIII digestion and confirm recombinant DNA by PCR. It is confirmed that VZV BAC with ORF7 flip reverse framshift mutation (VZV-7DRM BAC).

[0082] The reagents used in the above procedures are prepared as in Table 1:

TABLE-US-00010 TABLE 1 the reagents used in this example and there formulation Reagents formulation M63 galactose Autoclave 15 g agar in 800 mL dH.sub.2O minimal plates (1 L) After slight cooling, add 200 mL autoclaved 5X M63 medium and 1 mL 1M MgSO.sub.47H.sub.2O; Let cool to 50 C. Add 10 mL of 20% galactose, 5 mL fresh biotin, 4.5 mL leucine, and 1 mL 1000X chloramphenicol Mix the medium with magnetic stirrer, then pour plates 5X M63 medium 10 g (NH.sub.4).sub.2SO.sub.4 68 g KH.sub.2PO.sub.4 2.5 mg FeSO.sub.47H.sub.2O to 1 L with dH.sub.2O adjust to pH 7.0 with KOH autoclave 1M MgSO.sub.47H.sub.2O 24.65 g MgSO.sub.47H.sub.2O dissolved in 100 mL dH.sub.2O autoclave 20% galactose 20 g galactose dissolved in 100 mL dH.sub.2O autoclave 0.2 mg/mL d-biotin 20 mg d-biotin dissolved in 100 mL dH.sub.2O then sterilization by filtering 10 mg/mL L-leucine 1.0 g L-leucine dissolved in 100 mL dH.sub.2O by heating, then sterilization by filtering.

Example 4. Generation of VZV-7D and VZV-7DRM Viruses

[0083] (1). Extract DNA from the VZV 7D BAC obtained in Example 2;

[0084] (2). The purified DNA was separately transfected into MRC-5 cell (Marchini, Liu et al., 2001) via electroporation (the proliferation of the virus can be monitored by GFP carried on BAC); or, the purified DNA was co-transfected with a Cre expression vector into MRC-5 cell (Marchini, Liu et al., 2001). The BAC is accurately excised at loxP sites flanking BAC by Cre, and VZV 7D virus was obtained.

[0085] Similarly, VZV-7DRM virus with ORF7 flip reverse framshift mutation was also obtained. Since the VZV7DRM contains only partial ORF7 which is the flip reverse sequences, it cannot be expressed and have no ORF7 function. Both VZV-7DRM and VZV-7D have the same function.

Example 5. Verification of VZV 7D

[0086] The monolayer MRC-5 cells were infected with VZV-7D prepared in Example 4 and cultured in MEM medium supplemented with 2% bovine serum. When nearly 80% of the cells exhibit cytopathic effect, discard the culture medium, harvest the cells and extract DNA. P-Oka serves as control. ORF-10 and ORF-7 genes were amplified by PCR. DNA of VZV-7D and P-Oka was digested by HindIII. PCR products and HindIII digestion products were subjected to electrophoreses in 0.5% agarose gel. The result was shown in FIG. 3. PCR products of ORF-10 in VZV-7D is the same as in P-Oka, but ORF-7 band in VZV-7D is absent. This confirmed that ORF-7 in VZV-7D has been deleted. The difference of the profiles of virus DNA digested by HindIII between VZV-7D and P-Oka is not visible.

Example 6. Culture of VZV-7D in Human Dorsal Root Ganglia

[0087] Cervical and thoracic Dorsal Root Ganglia (DRG) were isolated from human fetal spine (20-week-gestational). The DRG were washed briefly in ice-cold 1PBS with 1% Penicillin/Streptomycin and then transferred to ice-cold tissue culture medium (DEM with 15% heat-inactivated bovine fetal serum and 1% Penicillin/Streptomycin). Each DRG was placed separate on a collagen coated coverslip in 6 well-plates, covered with 0.5 ml medium and cultured for 5 days with one change of medium. 50% MeWo cells were prepared in 6-well plates for titrating and for generation of growth curve (FIG. 4A). On the sixth day, Mewo cells freshly infected by P-Oka, VZV-7D and VZV-7R were harvested and resuspended in medium to a final volume of 1 ml. Each DRG grows separately on collagen coated coverslip in 6 well plates. 10 l suspension was used for determining virus titers, 2 l for generating growth curve of infected MeWo cells. The rest of the cell suspension was passed through a 27 gauge needle 20 times and the cell debris was pelleted by centrifugation at 4000 rpm for 10 minutes. The supernatant was divided into equal amounts and used to infect DRGs (120 l/sample); in addition, 2 drops (20 l) of cell suspensition were used to infect another set of DRG. After 3 hours incubation in 37 C./5% CO.sub.2, the DRG were washed with 1PBS and fresh media were added. Measurements of luciferase activity were taken at 24 h intervals. The samples were incubated with 150 g/ml D-luciferin at 37 C. for 10 minutes. The photons were counted by IVIS instrument and analyzed by a software. The results were shown in FIG. 4B.

[0088] Results shown that VZV-7D grow well in MeWo cells, but it hardly grows in DRG. The fact that VZV-7D do not infect DRG provides a basis for developing safe attenuated live vaccine.

Example 7. Construction and Validation of VZV-7D Reverse Mutant (VZV-7R)

[0089] ORF7 deletion mutation can be identified not only by the HindIII digestion, but also by complete VZV virus obtained by homologous recombination. That is to say, the complete VZV is rescued by the mechanism of homologous recombination, see FIG. 5). ORF7 fragment was amplified by PCR using invitrogen high fidelity platinum Taq DNA polymerase kit and cloned into the plasmid pGEM-lox-zeo between the NotI and BglII sites to form pGEM-zeo-ORF7 plasmid. The cloned fragment was verified by sequencing analysis and it is shown that no incorrect condons were introduced into ORF7 by PCR amplification. Then the zeoR-ORF7 cassette was amplified by PCR from pGEM-zeo-ORF7 using two primers.

TABLE-US-00011 F5: (SEQIDNO:14) GATTTATCCATAGTTCAATACGTTGGAAAGCCAGTC AATCATGCAGACGGTGTGTGCCAG; R5: (SEQIDNO:15) AAACATACACCAGAAACGTTTTTAGTTTTTATTTCA ATATGGATGGATCCATAACTTCGT.

[0090] The resultant PCR product contains 40-bp homologous VZV segments at each end, said segments are adjacent to the kan.sup.R gene and are located in the deleted ORF7 gene. The resultant chimeric PCR product was transformed into DY380 strain carrying ORF7D BAC clones via electroporation as described above. The recombinants were selected on agar plates containing 50 g/ml of zeocin (Invitrogen) and 12.5 g/ml chloramphenicol at 32 C. The correct VZV clones were confirmed by their antibiotic sensitivities. The correct clones should be resistant to chloramphenicol, hygromycin, zeocin, and sensitive to kanamycin and ampicillin. These clones were further validated by restriction digestion and PCR analysis.

[0091] The verified clones (E. coli DY380 with ORF7 deletion or rescuer luc VZV BAC) were inoculated in 500 ml LB with 12.5 g/ml chloramphenicol at 32 C. for 20 hours. VZVBAC DNAs were isolated using the Nucleobond Maxiprep BAC DNA isolation kit (BD Biosciences, Palo Alto, Calif.), and used to tranfect MRC-5 cells using the FuGene6 transfection reagent (Roche, Indianapolis, Ind.) according to the manufacturer's instruction. For each well (35-mm) of the 6-well plates, the ratio of DNA to transfection reagent was 1.5 g:6 l. VZV plaques were normally visible at 3 days post transfection. To remove the BAC vector (flanked by two loxP sites) from the VZV genome, a Cre expression vector was co-transfected with VZV BAC DNA into MRC-5 cells (Marchini, Liu et al. 2001). BAC was accurately deleted by Cre enzyme to produce the whole VZV.

[0092] ORF-7 rescue virus has the same growth and proliferation characteristics with that of the P-Oka strain. These result showed that the function of ORF-7 can be restored by reverse mutation.

Example 8. Culture of VZV-7DRM in Mewo Cells

[0093] The monolayer MeWo cells in 6-well plates were either mock infected or infected with lucVZV-7DRM (VZV-7DRM with Luc), luc7VZV-7R (VZ-7R with Luc) and lucVZV (P-Oka strain with Luc). Mewo cells were cultured in MEM medium with 2% bovine serum at 37 C. 24 hours post infection, D-luciferin was added to the cultured wells to a final concentration of 150 g/ml. After 10 minutes incubation at 37 C., the luminescence in the different wells was recorded simultaneously using the IVIS Imaging System (50 Series, Xenogen Corporation, Alameda, Calif.) in triplicate. After measurement, the luciferin-containing media were replaced by regular cell culture media. This measurement was repeated every 24 hours for 7 days. The growth curves were generated by plotting the average data against time (FIG. 6).

[0094] Human MeWo cells were either mock infected or infected by wild type VZV (lucVZV) or VZV-7DRM or VZV-7D rescue strain (luc7R) and cultured for 7 days. The photon count were recorded by IVIS system every day post infection in triplicate. A growth curve was generated by plotting the average photon counts against time. An error bar was indicated in the figures. The results of this experiment showed that VZV-7DRM and VZV-7R grow as well as wild type virus in MeWo cells. Meanwhile, it was shown that VZV-7DRM is able to proliferate normally after insertion of BAC. The genes carried by BAC is also able to be expressed. That is, VZV-7DRM can be used as expression vector of heterogenous genes.

Example 9. Culture of VZV-7DRM in Human Thymus Tissues

[0095] Human thymus-liver tissue were co-transplanted as xenograft into male CB-17SCID/beige mice. The combined transplant of human thymus-live tissues are constructed according to methods described in the literature (Jennifer F. M., Journal of Virology, September 1995, p 5236-5242). 3 months post transplantation, the human thymus-live xenografts were exposed by surgery, and were either mock infected or infected with 210.sup.3-410.sup.3 PFU of lucVZV-7DRM (VZV-7DRM with luciferase) and lucVZV (P-Oka with luciferase) cultured from 10-20 l of MeWo cells in triplicate. Fluorescence intensity was measured each day post infection. 250 l of substrates of luciferase, D-luciferin, was added by i.p. injection. After 10 minutes, the fluorescence in xenograft was recorded in triplicates using the IVIS Imaging System according to the methods described in Example 8. The results were shown in FIG. 7.

[0096] Cultured human thymus tissues were either mock infected or infected with wild type VZV, or VZV-7DRM for 7 days. Photon counts were measured using IVIS system each day post infection (DPI), and growth curves were generated by plotting average photon counts against time. Error bar from three data measurements are indicated in the figures. This experiment showed that VZV-7DRM mutant can grow in thymus tissues (T-cells) like wild type VZV.

[0097] Similar experiments demonstrated that VZV-7D can also grow in thymus tissues (T-cells) like wild type VZV.

Example 10. Culture of VZV-7DRM in Skin

[0098] Human fetal skin was transplanted into SCID mice subcutaneously as integral grafts in accordance with method described in literature (Jennifer F. M. Journal of Virology, September 1995, p 5236-5242). 4 week after transplantation, mice skin were either mock infected or infected with lucVZV-7DRM (VZV-7DRM with Luc), luc7VZV-7R (VZ-7R with Luc) and lucVZV (P-Oka strain with Luc) in triplicate. Fluorescence intensity was measured each day post infection. 250 l of substrates of luciferase, D-luciferin, was added by i.p. injection. After 10 minutes, the fluorescence in xenograft was recorded in triplicates using the IVIS Imaging System according to the methods described in Example 8. The results were shown in FIG. 8.

[0099] Cultured human skin tissues were either mock infected or infected with wild type VZV (P-Oka strain) or ORF7 deficient mutant (VZV-7DRM) or ORF7 reverse mutate (VZV-7R) for 7 days. Photon counts were measured using IVIS system each day post infection (DPI), and growth curves were generated by plotting average photon counts against time. Error bar from three data measurements are indicated in the figures. This experiment showed that VZV-7DRM mutant has great growth defects in skins, which function defects can be restored by reverse mutation in VZV-7DRM

[0100] Similar experiments find VZV-7D mutant also has great growth defects in skins, which function defects can be restored by reverse mutation in VZV-7D.

Example 11. Experiments Confirmed that ORF7 is Essential for VZV to Infect Nerve Cells

[0101] 1. Neurocytoma Cell Infection

[0102] MeWo cell and neurocytoma cell line SH-SY5Y were transfected with DNAs from wild type (WT), ORF7-deleted (VZV-7DRM) and ORF7-reverse mutant (VZV-7R) BAC. The results showed WT, VZV-7R can grow well in MeWo cell and neurocytoma cells; however, VZV-7DRM cannot grow in neurocytoma cells (FIG. 9A). This suggests that ORF7 is most likely essential for VZV's infection of nerve cell.

[0103] 2. DRG Graft Infection

[0104] To further verify the results of test 1 in this example, human fetal DRGs were transplanted into SCID mice, and used as animal model of virus infection. The results showed that wild type virus becomes latent after a short replication cycle (a fluorescent phenomenon), while VZV-7D cannot replicate in DRG graft. These results showed that ORF7 is most likely a neurotropic factor of VZV (FIGS. 9B-D).

[0105] The above two tests demonstrated that ORF7 is essential for VZV's infection of neurons.

Example 12. Preparation of Vaccine and Immunogenicity Assay of VZV-7DRM

[0106] Monolayer ARPE cell or MRC-5 cells were infected with VZV-7DRM at a MOI of 0.1. After virus attaches to cells for 40 minutes, medium were added to the flasks, which were incubated at 35 C. The cells were harvested by digestion with 0.1% EDTA when about 80% of the cells presented cytopathy (generally 3 days). The harvest cells were centrifuged, and protection agents were added; after crashing and clarification, vaccines were obtained.

[0107] Guinea pigs (weighting about 250 g) were vaccine with reconstituted vaccine at 5 guinea pigs per vaccine, 5000 pfu/0.5 ml/dose. 4 weeks after first immunization, one boost immunization was given. P-Oka and V-Oka serves as control.

[0108] 2 weeks after boost immunization, the blood was collected by cardiopuncture. The serum antibody titers were detected by gp-ELISA. The antibody neutralizing ability against virus were determined by immuno-inhibition assay. Ten-fold dilutions of serums before and after vaccination were mixed with virus at 1:1 ratio. After incubation at 37 C. for 60 minutes, the mixtures were used to infect MRC-5 cells. After incubation at 37 C. in 5% CO.sub.2 for 7 days, the medium were removed and the cells were stained with coomassie blue. The virus titers are calculated through plaque forming unit counts. The degree of antibody neutralizating virus is calculated as 100(virus titer neutralized by serum before vaccinationvirus titer neutralized by serum after vaccination)/virus titer neutralized by serum before vaccination. The result is given in table 2.

TABLE-US-00012 TABLE 2 Antibody titer and antibody neutralization degree of guinea pig sera from varicella virus inoculation antibody antibody neutralization degree (%) titer P- V- VZV- sera (GMT) Oka Oka 7DRM Anti-P-Oka 246 39 74 26 Anti-V-Oka 279 47 84 68 Anti-VZV-7DRM 277 65 85 67

[0109] The result showed VZV-7DRM possesses good immunogenicity, whose antibody neutralization degree is comparable with that of V-Oka. Serum after VZV-7DRM vaccination has good neutralizing effect on all three kinds of virus, and shows potential for developing as vaccines.

[0110] Similar experiments showed that VZV-7D has also good immunogenicity and potential for developing as vaccines.

Example 13. Preparation of Biological Active Material Using VZV-7DRM as Vectors

[0111] EV71-VP1 cassette was amplified from pT-VP1 plasmid by PCR with EV71-VP1 primers containing flanking homology to ORF7.

[0112] EV71-VP1 Cassette sequence is given below:

TABLE-US-00013 (SEQIDNO:16) ATGGGAGATAGGGTAGCAGATGTAATTGAAAGCTCCATAGGAGATAGCGT GAGCAGAGCCCTCACTCACGCTCTACCAGCACCCACAGGCCAGAACACAC AGGTGAGCAGTCATCAACTGGATACAGGCAAGGTTCCAGCACTCCAAGCT GCTGAAATTGGAGCATCATCAAATGCTAGTGACGAGAGCATGATTGAGAC ACGCTGTGTTCTTAACTCGCACAGCACAGCTGAGACCACTCTTGATAGTT TCTTCAGCAGAGCGGGATTAGTTGGAGAGATAGATCTCCCTCTTAAAGGC ACAACTAACCCAAATGGTTATGCCAACTGGGACATAGATATAACAGGTTA CGCGCAAATGCGTAGAAAGGTGGAGCTATTCACCTACATGCGCTTTGATG CAGAGTTCACTTTTGTTGCGTGCACACCCACCGGGGAAGTTGTCCCACAA TTGCTCCAATATATGTTTGTGCCACCTGGAGCCCCTAAGCCAGATTCCAG GGAATCCCTCGCATGGCAAACCGCCACCAACCCCTCGGTTTTTGTCAAGC TGTCAGACCCTCCAGCGCAGGTTTCAGTGCCATTCATGTCACCTGCGAGC GCTTACCAATGGTTTTATGACGGATATCCCACATTCGGAGAACACAAACA GGAGAAAGATCTTGAATATGGGGCATGTCCTAATAACATGATGGGCACGT TCTCAGTGCGGACTGTAGGGACCTCCAAGTCCAAGTACCCTTTAGTGGTT AGGATTTACATGAGAATGAAGCACGTTAGGGCGTGGATACCTCGCCCGAT GCGTAACCAGAACTACCTATTCAAAGCCAACCCAAATTATGCTGGCAACT CCATTAAGCCAACTGGTACCAGTCGTACAGCGATCACTACTCTTTAA

PCR Primer Sequence:

[0113] F6 (Homologous sequence to 5 flanking region of ORF7; start codon; Homologous sequence to EV71-VP1):

TABLE-US-00014 (SEQIDNO:17) CGAATCGTCGGTTTGGAGGATTTATCCATAGTTCAATACGTTGGAAAGCC AGTCAATCATGGGAGATAGGGTAGCAGATGTAA
R6 (Homologous sequence to 3 flanking region of ORF7; Homologous sequence to EV71-VP1):

TABLE-US-00015 (SEQIDNO:18) AATTTTATATACAAAATAAAAACATACACCAGAAACGTTTTTAGTTTTTA TTTCAATATTTAAAGAGTAGTGATCGCTGTACGACTGGTA

[0114] Transform the electrocompetent SW102 strain of E. coli containing VZV-7DRM BAC with the purified PCR product. The recombinant SW102 strains were screened and identified according to Example 2. After appropriate culture, VZV-7DRM-VP1 BAC was isolated and then co-transfected into ARPE cell with cre expression vector via electroporation. BAC was entirely excised from loxP sites at both ends of BAC, subsequently, the recombinant VZV-7DRM-VP1 virus was obtained. Monolayer ARPE cells were infected by recombinant virus and were cultured at 35 C. for 3-4 days. Then cells presented cytopathy. The activity of VP1 from was detected by EV71 specific sandwich ELISA in the culture supernatant from recombinant virus and centrifugal supernatant from cell lysis (after repeated frozen-thaw or sonificatoin). EV71 and VZV-7DRM serves as control. The results (table 3) show that the activity of VP1 was detected in ARPE cell infected by VZV-7DRM-VP1 virus. This suggests that VP1 is recombinated into VZV-7DRM virus. This example showed that VZV-7DRM can be used as vector to express foreign genes.

TABLE-US-00016 TABLE 3 Detection of activity of VP1 in recombinant VZV-7DRM-VP1 virus by sandwich ELISA EV71 activity detected by sandwich ELISA (OD) culture supernatant of cell type supernatant lysis after sonification VZV-7DRM 0.049 0.025 VZV-7DRM-P1 0.048 0.692 EV71 2.774 2.537

[0115] Similar experiments demonstrated that VZV-7D can also be used as expression vector for expression of foreign proteins.

[0116] While the embodiments of the present invention have been described in details, one skilled in the art will understand that, according to the teaching of the disclosures, various modifications and substituents may be made to those details, without departing from the scope of the present invention. The whole scope of the invention are defined by the appended claims and any of their equivalents.