IMPROVED DROPLET SEQUENCING APPARATUS AND METHOD

Abstract

A first apparatus for sequencing a polynucleotide analyte is provided an apparatus for sequencing a polynucleotide analyte comprising: (a) a first zone for generating a flowing stream of single nucleotides by progressive pyrophosphorolysis of a molecule of the analyte attached to a particle and exposed to a flowing aqueous medium; (b) a second zone for generating a corresponding stream of aqueous droplets from the aqueous medium and the nucleotide stream and wherein at least some of the droplets contain a single nucleotide; and (c) a third zone for storing and/or for interrogating each droplet to reveal a property characteristic of the single nucleotide it may contain; wherein in that the first zone includes at least one chemically-modified substrate adapted to bind temporarily to a particle having at least two different regions adapted to bind respectively to the substrate and to the analyte.

Claims

1. An apparatus for sequencing a polynucleotide analyte comprising; (a) a first zone for generating a flowing stream of single nucleotides progressive pyrophosphorolysis of a molecule of the polynucleotide analyte attached to a particle and exposed to a flowing aqueous medium; (b) a second zone for generating a corresponding stream of aqueous droplets from the flowing aqueous medium and the flowing stream of single nucleotides, and wherein at least some of the aqueous droplets contain a single nucleotide; and (c) a third zone for storing and/or for interrogating each aqueous droplet to reveal a property characteristic of the single nucleotide it may contain; wherein the first zone includes at least one chemically-modified substrate that binds temporarily to a particle having at least two different regions that bind respectively to the substrate and to the analyte.

2. The apparatus of claim 1 wherein the first zone comprises a microfluidic chamber through which the aqueous medium flows and the substrate is located within the microfluidic chamber.

3. The apparatus of claim 1, wherein the substrate is provided with first moieties that bind to corresponding second moieties on the particle.

4. The apparatus of claim 3 wherein the first and second moieties are selected from a group of corresponding pairs selected from the group consisting of avidin/biotin; streptavidin/biotin polyhistidine/chelated metal ion, boronic acid/carbohydrate and maleimido/selenol.

5. The apparatus of claim 4 wherein the pair of first and second moieties comprises a polyhistidine moiety comprised of a least six histidine residues that may be on the first or the second moiety and a chelator moiety selected from a nitrotriacetate or iminodiacetate salt derivative of cobalt, copper or nickel that may be on the first or the second moiety.

6. The apparatus of claim 1, wherein the aqueous droplets in the third zone contain at least one single-nucleotide probe selective for one nucleobase type from which the analyte is constituted; wherein said probe(s) fluoresces substantially only after probe(s) has captured a single nucleotide and undergone subsequent exonucleolysis.

7. The apparatus of claim 6 wherein the probe comprises (a) a first single-stranded oligonucleotide labelled with characteristic fluorophores in an undetectable state and (b) second and third single-stranded oligonucleotides that hybridize to complementary regions on the first oligonucleotide.

8. The apparatus of claim 6, further comprising a means to introduce the probe(s) into the aqueous medium before, as or after each droplet is created.

9. The apparatus of claim 1, wherein the second zone includes a printer nozzle that prints each droplet into a third zone including a surface comprised of an array of droplet-receiving locations.

10. The apparatus of claim 9 wherein the droplet-receiving locations are moveable relative to the printer nozzle.

11. The apparatus of claim 9, wherein each droplet-receiving location is a well having a volume greater than that of the droplet printed thereinto thereby enabling further reactant-containing droplets to be added either after or beforehand.

12. The apparatus of claim 1, wherein the third zone includes an interrogation means for detecting fluorescence radiation emitted from each droplet.

13. The apparatus of claim 1, wherein the first zone is a microfluidic channel and that wherein the second zone sits at or near to the centre of the microfluidic channel in a region of laminar flow.

14. An apparatus for sequencing a polynucleotide analyte comprising: (a) at least one microfluidic chamber containing a substrate chemically-modified to bind reversibly to a complementary particle bearing a molecule of the analyte; (b) a means for delivering and retrieving the particle to and from the microfluidic chamber; (c) microfluidic channels for passing an aqueous pyrophosphorolysing medium through the microfluidic chamber and across the substrate; (d) at least one first printer nozzle that receives a nucleotide-containing aqueous medium from the microfluidic chamber and creates nucleotide-containing microdroplets therefrom; (e) at least one sheet moveable relative to the first printer nozzle patterned with an array of wells for receiving the nucleotide-containing microdroplets from the printer nozzle; (f) at least one additional printer nozzle moveable relative to the sheet each additional printer nozzle delivers a microdroplet containing a different reagent into the wells either before or after the nucleotide-containing microdroplet has been received; (g) a means for moving the first and additional printer nozzles relative to the sheet; and (h) a means for coating the sheet with a liquid immiscible with the nucleotide-containing aqueous medium.

15. The apparatus of claim 14 further comprising at least one laser for interrogating the nucleotide-containing microdroplet of the wells and at least one photodetector for detecting electromagnetic radiation originating therefrom; wherein each of the laser and the photodetector is moveable relative to the sheet.

16. A method of pyrophosphorolysing a polynucleotide comprising the steps of (1) binding the polynucleotide to a particle the surface of which (a) binds the polynucleotide and (b) binds a substrate surface reversibly; (2) binding the particle to the substrate surface; (3) performing pyrophosphorolysis on the polynucleotide bound to the particle in a flowing medium and (4) releasing the particle from the substrate surface.

Description

EXAMPLE 1PREPARATION OF A FUNCTIONALISED SUBSTRATE

[0042] A clean, glass plate previously coated with gold by atomic layer deposition was immersed in a mixture of sulphuric acid and hydrogen peroxide at 80 C. for one hour. Thereafter it was washed with distilled water and then dried under a stream of nitrogen gas. The dried plate was then treated with an ethanol solution of HS(CH.sub.2).sub.11-EG.sub.6-NH.sub.2.HCl in an Eppendorf tube for 24-72 hours at room temperature in darkness. The treated plate was then washed with ethanol and again dried under nitrogen gas.

[0043] Poly(L-histidine) was dissolved in a 1:1 mixture of DMF and a saline solution containing 2-(N-morpholino)ethanesulfonic acid (pH5) followed by the addition of (N-hydroxysulfosuccinimide) and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide. The functionalised gold plate was then added and the reaction allowed to proceed for 24 hours. At the end of this time the plate was washed and dried under nitrogen.

EXAMPLE 2PREPARATION AND USE OF A TYPICAL PROBE SYSTEM

[0044] An example of an oligonucleotide probe system that may be used in the system described above is now described in detail.

[0045] A single-stranded first oligonucleotide A is prepared, having the following nucleotide sequence:

TABLE-US-00001 5TCGTGCCTCATCGAACATGACGAGGXXQXXGGTTTGTGGT3
wherein A, C, G, and T represent nucleotides bearing the relevant characteristic nucleotide base of DNA; X represents a deoxythymidine nucleotide (T) labelled with Atto 655 dye using conventional amine attachment chemistry and Q represents a deoxythymidine nucleotide labelled with a BHQ-2 quencher. It further comprises a capture region (A nucleotide) selective for capturing deoxythymidine triphosphate nucleotides (dTTPs).

[0046] Another single-stranded oligonucleotide B, comprising (1) a second oligonucleotide region having a sequence complementary to the 3 end of the first oligonucleotide with a single base mismatch; (2) a third oligonucleotide region having a sequence complementary to the 5 end of the first oligonucleotide and (3) a 76 base-pair single-stranded linker region, is also prepared. It has the following nucleotide sequence:

TABLE-US-00002 5PCATGTTCGATGAGGCACGATAGATGTACGCTTTGACATACGCTTTGAC AATACTTGAGCAGTCGGCAGATATAGGATGTTGCAAGCTCCGTGAGTCCCA CAAACCAAAAACCTCG3
wherein additionally P represents a 5 phosphate group.

[0047] A reaction mixture comprising the probe system is then prepared having a composition corresponding to that derived from the following formulation:

[0048] 56 uL 5 buffer pH 7.5

[0049] 28 uL oligonucleotide A, 100 nM

[0050] 28 uL oligonucleotide B, 10 nM

[0051] 2.8 uL mixture of dNTPs (including dTTP), 10 nM

[0052] 0.4 U Phusion II Hot Start polymerase (exonuclease)

[0053] 1.6 U Bst Large Fragment DNA polymerase

[0054] 20 U E. coli ligase

[0055] 4 U Thermostable Inorganic Pyrophosphatase

[0056] Water to 280 uL

wherein the 5 buffer comprises the following mixture:

[0057] 200 uL Trizma hydrochloride, 1M, pH 7.5

[0058] 13.75 uL aqueous MgCl.sub.2, 1M

[0059] 2.5 uL Dithiothreitol, 1M

[0060] 50 uL Triton X-100 surfactant (10%)

[0061] 20 uL Nicotinamide adenine dinucleotide, 100 uM

[0062] 166.67 uL KCl

[0063] Water to 1 mL

[0064] In the presence of a single dTTP nucleotide, said nucleotide is incorporated onto the 3 end of one of the oligonucleotides B and ligation of oligonucleotide B to form a closed-loop used probe occurs. This process is carried out by incubating the mixture at 37 C. for 50 minutes. The reaction medium is then incubated at 70 C. for a further 50 minutes, activating the Phusion II polymerase. One of the oligonucleotides A can anneal to a circularised oligonucleotide B at this temperature and in this double-stranded form is digested by the polymerase, releasing its fluorophores into a detectable state. A further oligonucleotide B is then able to anneal to the circularised probe, allowing this process to repeat in a continuous cycle and resulting in a growth of fluorescence intensity over time.

[0065] Further sets of similar oligonucleotide probes are also prepared having different capture sites, sequences and fluorophores which, combined with the first probe set, allow the capture, detection and discrimination of the four nucleotide bases to be achieved.