THERAPEUTIC USES OF FLAP OF GENETICALLY MODIFIED CELLS
20200276246 ยท 2020-09-03
Assignee
Inventors
Cpc classification
C07K14/78
CHEMISTRY; METALLURGY
C12N5/0625
CHEMISTRY; METALLURGY
A61P17/02
HUMAN NECESSITIES
International classification
A61K35/36
HUMAN NECESSITIES
Abstract
The present invention refers to a flap of genetically modified cells on fibrin substrate for use in the treatment of Epidermolysis Bullosa (EB) and/or for use in a method to promote in vivo cell adhesion and/or in vivo cell growth and/or cell regeneration and/or for use in a surgical method, preferably for use in the repair or replacement of living tissue, in an EB patient.
Claims
1. A method for the treatment of Epidermolysis Bullosa (EB) comprising administering to a subject in need thereof a flap of genetically modified cells on a fibrin substrate, wherein said genetically modified cells are genetically modified with at least one heterologous nucleic acid comprising a nucleotide sequence encoding: a) at least one chain selected from the group consisting of: 3, 3 and 2 chain of laminin-332, and/or b) collagen XVII and/or c) at least one 64 integrin and/or d) collagen VII and/or e) keratin 5 and/or Keratin 14 and/or f) Plectin.
2. A The method of claim 1, wherein the treatment promotes in vivo cell adhesion and/or in vivo cell growth and/or cell regeneration optionally in the repair or replacement of living tissue, in an EB patient.
3. The method according to claim 1, wherein the EB is Junctional Epidermolysis Bullosa (JEB).
4. The method according to claim 3, wherein the heterologous nucleic acid comprises a nucleotide sequence encoding laminin-332 3 chain and/or collagen XVII.
5. The method according to claim 1, wherein: a) the laminin-332 3 chain comprises an amino acid sequence having at least 75% amino acid sequence identity to the amino acid sequence SEQ ID NO: 6 and/or b) the collagen XVII comprises an amino acid sequence having at least 75% amino acid sequence identity to the amino acid sequence SEQ ID NO:4 and/or c) the collagen VII comprises an amino acid sequence having at least 75% amino acid sequence identity to the amino acid sequence SEQ ID NO: 2.
6. The method according to claim 1, wherein said heterologous nucleic acid further comprises a promoter that is operably linked to the promoter, and/or wherein the promoter is heterologous to the encoding nucleotide sequence and/or said heterologous nucleic acid is under the control of virus long terminal repeat (LTR), optionally of retrovirus LTR, or of Moloney Leukaemia virus (MLV) LTR.
7. The method according to claim 1, wherein the genetically modified cells have been transduced with the at least one heterologous nucleic acid.
8. The method according to claim 7, wherein the transduction was carried out with a viral vector, optionally with a retroviral vector, said retroviral vector optionally selected from the group consisting of alpharetroviral vector, a gammaretroviral vector, a lentiviral vector and a spumaretroviral vector.
9. The method according to claim 1, wherein the flap is obtainable by an in vitro method, characterized by: a) plating feeder cells on the upper surface of a fibrin substrate so as to obtain a fibrin substrate on which said feeder cells are adhered; b) plating and cultivating to subconfluence said genetically modified cells on said fibrin substrate onto which feeder cells are adhered, said fibrin substrate being positioned on a solid support so that the cells do not interact with the surface of said support so as to obtain a flap of genetically modified cells adhered to said fibrin substrate; and c) detaching the flap of genetically modified cells adhered to said fibrin substrate from the support in a form similar to a sheet to obtain a flap of genetically modified cells on fibrin substrate.
10. The method according to claim 9, wherein the feeder cells are plated on the fibrin substrate from 2 to 24 hours before plating the genetically modified cells.
11. The method according to claim 9, wherein the method further comprises: before step c), the steps: b) removing the culture medium and/or b) washing the flap of genetically modified cells adhered to said fibrin substrate with a washing solution and/or after step c), the step of: d) placing the obtained flap of genetically modified cells on fibrin substrate in a transport container and/or wherein the fibrin substrate has dimensions of from 0.32 cm.sup.2 to 300 cm.sup.2.
12. The flap of genetically modified cells on fibrin substrate for use according to claim 9, wherein the fibrin substrate comprises from about 20 to about 100 mg/ml of fibrinogen and from about 1 to about 10 IU/ml of thrombin.
13. The method according to claim 12, wherein the fibrin substrate comprises from about 20 to about 50 mg/ml of fibrinogen, optionally from about 20 to about 40 mg/ml of fibrinogen, and from about 3 to about 8 IU/ml of thrombin.
14. The method according to claim 13, wherein the fibrin substrate comprises from about 20 to about 25 mg/ml of fibrinogen and from about 2 to about 4 IU/ml of thrombin
15. The method according to claim 14, wherein the fibrin substrate comprises about 23.1 mg/ml of fibrinogen and about 3.1 IU/ml of thrombin.
16. The method flap according to claim 9 wherein said cells are epithelial cells, optionally primary epithelial cells deriving from stratified epithelia.
17. The method according to claim 16, wherein said cells are epidermal cells.
18. The method according to claim 16 wherein said cells are keratinocytes, optionally human primary keratinocytes isolated from biopsies.
19. The method according to claim 18, wherein the biopsy is a cutaneous biopsy isolated from a EB patient, optionally a JEB, simple EB (EBS), dystrophic EB (DAB) and Kindler syndrome patient, said EB patient optionally being the same patient subject to the treatment.
Description
[0167] The invention will be now illustrated by means of non-limiting examples referring to the following figures.
[0168]
[0169] a, Schematic representation of the clinical picture. The denuded skin is indicated in red, while blistering areas are indicated in green. Flesh-colored areas indicate non-blistering skin. Transgenic grafts were applied on both red and green areas. Restoration of H's entire epidermis was obtained, with the exception of very few areas on the right thigh, buttocks, upper shoulders/neck and left axilla (altogether 2% of TBSA). b, Normal skin functionality and elasticity. c, Absence of blister formation at sites where some of post-graft biopsies were taken (arrow).
[0170]
[0171] Skin sections were prepared from normal skin, H affected (admission) and transgenic skin at 4, 8 and 21 months follow-up. a, In situ hybridization was performed using a transgene-specific probe (t-LAMB3) on 10-m-thick sections. E-cadherin-specific probe (Cdh1) was used as a control. Scale bars, 40 m. b, Immunofluorescence of laminin 332-3 was performed with 6F12 moAbs on 7-m-thick sections. DAPI (blue) marks nuclei. Dotted line marks the epidermal-dermal junction. Scale bars, 20 m. c, Electron-microscopy was performed on 70-nm-thick skin sections. A regular basement membrane (arrows) and normal hemidesmosomes (arrowheads, higher magnification in the inset) are evident in H transgenic skin. Scale bars, 1 m.
[0172]
[0173] a, Integrations were identified in libraries obtained using two LTR-primers (3pIN, light grey bars; 3pOUT, dark grey bars) and in the merged set (black bars). Lines (secondary axis) depict the average integration coverage, calculated after removal of PCR duplicates. b, Venn diagram of the number of shared integrations across samples. c, percentage of integrations mapped to: promoters, exons, introns, and intergenic regions (left); epigenetically defined active and weak promoters and enhancers, or genomic regions with no histone marks (right); (p-value>0.05; Pearson's Chi-squared test). d, Dot plot of the top 5 enriched GO Biological Process terms for each sample. Dot colour indicates statistical significance of the enrichment (q-value); dot size represents the fraction of genes annotated to each term.
[0174]
[0175] a, Clonogenic progenitors (blue cells) contained the original skin biopsy and in 8,742 cm.sup.2 of transgenic epidermis are indicated. Stem cells, detected as holoclones (pink cells), were identified by clonal analysis (Methods and
[0176]
[0177] The scheme shows the entire procedure, from skin biopsy to transplantation and follow up. Total number ofkeratinocytes, the corresponding clonogenic fraction and days of cultivation are shown for each passage. All analyses performed at each follow-up are indicated. Immunofluorescence (IF), in situ hybridization (ISH) and transmission electron microscopy (TEM) were performed on randomly taken 0.2-0.4 mm2 punch biopsies. Genome-wide analysis (NGS) was performed on Pre-Graft cultures (PGc) and on primary cultures initiated from 0.5 cm2 biopsies taken from the left leg (4Mc and 8Mc2) and the right arm (8Mc1). Clonal analysis and tracing were performed on PGc, 4Mc and 8Mc1
[0178]
[0179] a, Preparation of a dermal wound bed at the time of transplantation. b, Transplantation on the left arm of plastic-cultured epidermal grafts, mounted on a non-adhering gauze (asterisks). c, The engrafted epidermis (asterisks) is evident upon removal of the gauze (arrows), 10 days after grafting. d, Regenerated epidermis on the left arm at 1 month. e,f, Transplantation (e) and engraftment (f) of both plastic-cultured (asterisk) and fibrin-cultured (arrow and inset in e) grafts on the left leg. f (inset), Complete epidermal regeneration is evident at 1 month. g, The back of H was covered by fibrincultured grafts (inset). h, Complete epidermal regeneration was observed at 1 month, with the exception of some areas marked by the asterisks. Islands of epidermis were observed inside those denuded areas (arrows). i, Within 4 months, the regenerated epidermis surrounding the open lesions and the epidermal islands detected within those open lesions spread and covered the denuded areas.
[0180]
[0181] a, Hematoxylin/Eosin staining of skin sections (7 m thick) prepared from normal skin and from H at admission and at 4, 8 and 21-months follow-up. Black arrows show ruptures at the epidermal-dermal junction. Scale bar, 20 m. b, Sections (7 m thick) from normal skin, H's skin at admission and 21 months after transplantation were immunostained using laminin 332-3, laminin 332-2, 6 integrin and 4 integrin antibodies. c, Adhesion of cohesive cultured epidermal sheets. Left panel: spontaneous detachment (arrows) of confluent laminin 332-3 null H's keratinocyte cultures. Right panel: genetically corrected H's cultures remained firmly attached to the substrate. As with normal control cells, their detachment would require prolonged enzymatic treatment.
[0182]
[0183] To verify the absence of a humoral immune response to the transgene product, indirect immunofluorescence was performed by staining for antibasement membrane IgG auto-antibodies on monkey esophagus sections a, and normal human split skin (NH-SS) sections b, using H's plasma taken 21 months after transplantation. c, Positive control NH-SS sections (C+) were immunostained with an anti-human laminin-332 antibody (anti-GB3). Arrows denote the expected localization of the laminin 332 labelling. d and e, A healthy donor's plasma was used as negative control (C ()) both in monkey esophagus (d) and normal skin sections (e). White arrows denote the expected localization of the laminin 332 labelling. To verify the absence of a humoral immune response to the transgene product, indirect immunofluorescence was performed by staining for antibasement membrane IgG auto-antibodies on monkey esophagus sections a, and normal human split skin (NH-SS) sections b, using H's plasma taken 21 months after transplantation. c, Positive control NH-SS sections (C+) were immunostained with an anti-human laminin-332 antibody (anti-GB3). Arrows denote the expected localization of the laminin 332 labelling. d and e, A healthy donor's plasma was used as negative control (C ()) both in monkey esophagus (d) and normal skin sections (e). White arrows denote the expected localization of the laminin 332 labelling.
[0184]
[0185] Sub-confluent cultures were trypsinized, serially diluted and inoculated (0.5 cell/well) onto 96-multiwell plates containing irradiated 3T3-J2 cells. After 7 d of cultivation, single clones were identified under an inverted microscope, trypsinized, transferred to 2 dishes and cultivated. One dish ( of the clone) was fixed 12 d later and stained with Rhodamine B for the classification of clonal type. The clonal type was determined by the percentage of aborted colonies formed by the progeny of the founding cell. The clone was scored as holoclone when 0-5% of colonies were terminal. When 95-100% of colonies were terminal (or when no colonies formed), the clone was classified as paraclone. When the amount of terminal colonies was between 5% and 95%, the clone was classified as meroclone. The second dish ( of the clone) was used for integration PGanalysis after 7 d of cultivation.
[0186]
[0187] Quantitative PCR (qPCR) was performed on genomic DNA of pre-graft cultures (PGc), primary cultures generated at 4 months (4Mc) and 8 months (8Mc1, 8Mc2) follow-up and selected holoclones (PRE.G_H1, PRE.G_H10, FU4m_H1-11, PRE.G_H7). All values are represented as the mean of 2 independent qPCR+SEM.
[0188]
[0189] Transgenic epidermal cultures (PGc) contain of a mixed population of clonogenic basal stem cells (blue) and TA progenitors (grey). Upon engraftment and initial epidermal regeneration, both stem and TA cells can proliferate and eventually generate suprabasal terminally differentiated cells. Upon epidermal renewal (4 and 8 months), the short-lived TA progenitors (grey) are progressively lost. The long-lived stem cells then generate new pools of TA progenitors (now blue basal cells), which will produce terminally differentiated cells (suprabasal blue cells).
[0190]
[0191] During hospitalization, H's inflammatory and nutritional status was documented by blood concentration of a, C-reactive protein (CRP) and b, albumin. The time course of biopsy sampling (marked by B) and epidermal culture transplantation is given by the arrows. The linear regressions visualize the trend of pre graft (dotted) and post graft (black line) progressions. The red line within the CRP time course demonstrates the CRP-limit, which is considered as a criterion for severe inflammation. These data demonstrate the critical situation ofH at admission and before transplantation and the improvement of his general status upon epidermal regeneration.
[0192]
[0193]
[0194]
[0195]
EXAMPLES
Materials and Methods
Patient, Clinical Course, Surgical, and Post-Operative Procedures.
[0196] Since birth, H repeatedly developed blisters, upon minor trauma, on the back, the limbs and the flanks, which occasionally caused chronic wounds persisting up to one year. Six weeks before the actual exacerbation, his condition deteriorated with the development of massive skin lesions. One day prior to admission, he developed fever followed by massive epidermal loss. He was admitted to a tertiary care hospital where topical wound care was performed using absorbable foam dressings (Mepilex, Mlnlycke Healthcare, Erkrath, Germany). As the patient appeared septic with elevated infection parameters, he initiated systemic antibiotic treatment with meropenem and vancomycin. Severe electrolyte imbalances required parenteral substitution of sodium, potassium, and magnesium. Swabs revealed Staphylococcus aureus and Pseudomonas aeruginosa. Due to the large wound area and further deterioration of his clinical condition, H was transferred to the paediatric burn centre of the Ruhr-University 4 days later. At admission, he suffered complete epidermal loss on 60% of total body surface area (TBSA), affecting all limbs, the back and the flanks. H was febrile, cachectic, with a total body weight of 17 kg (below 3.sup.rd percentile), had signs of poor perfusion and C-reactive protein (CRP) was 150 mg/L. Antibiotic treatment was continued according to microbiologic assessment with flucloxacilline and ceftazidime. Retrospectively, the diagnosis of staphylococcal scalded skin syndrome was suspected due to flaky desquamations appearing 10 d after the symptoms began and Staphylococcus aureus was found on swabs. The iscorEB clinician score.sup.29 was rated at 47. We initiated aggressive nutritional therapy by nasogastric tube (1100-1300 kcal/d) and additional parenteral nutrition (700 kcal/d kcal/kg/d, glucose 4 g/kg/d, amino acids 3 g/kg/d, fat 1.5 g/kg/d) according to his nutritional demands calculated using the Galveston formula. A necessary intake of about 1800 kcal/d was determined. Vitamins and trace elements were substituted as needed since zinc, selenium, and other trace elements were below the detection threshold. Beta-adrenergic blockade with propranolol was also started, as with severe burns.sup.30. Due to bleeding during dressing changes and on-going loss of body fluids from the widespread skin erosions, the transfusion of 300 ml packed red blood cells was required every 7 to 12 days to keep the Hb value above 6-7 g/dl, and 20 g albumin were substituted once per week to keep albumin levels above 2.0 g/dl. Patient care was performed in accordance with the epidermolysis bullosa treatment guidelines.sup.31. H was bathed in povidone-iodine (PVP) solution or rinsed with polyhexanide-biguanide solution (PHMB) under general anaesthesia, first on a daily basis and subsequently every other day. We also employed several topical wound dressings and topic antimicrobials, including PHMB-gel and PVP ointment, without any significant impact on wound healing. However, wounds became cleaner and Staphylococcus aureus were no longer detectable for several weeks. H had persistent systemic inflammatory response syndrome (SIRS) with spiking fevers, wasting, and high values of acute-phase proteins (CRP, ferritin). He had chronic pain necessitating comprehensive drug management using fentanyl, dronabinol, gabapentin, amitryptiline and NSAIDs. Antibiotic treatment was continued according to swabs taken once weekly; swabs revealed intermittent wound infection with Pseudomonas aeruginosa and in the course Enterobacter cloacae, Enterococcusfaecalis and again Staphylococcus aureus. Treatment was changed biweekly omitting glycopeptides, carbapenemes and other drugs of last resort using mainly ceftazidime, cefepime, ampicilline, flucloxacilline, and tobramycin. Due to his life-threatening condition, we performed an unsuccessful allotransplantation of split-thickness skin grafts taken from his father. Despite an initial engraftment, complete graft loss occurred 14 days post-transplantation. Treatment attempts with Suprathel (Polymedics Innovation GmbH, Denkendorf, Germany), amnion, and glycerol preserved donor skin (Glyaderm, Euro Tissue Bank, Beverwijk, Netherlands) were unsuccessful as well. Further treatment attempts were judged to be futile by several experts in this field. After 5 weeks at the intensive care unit, H no longer tolerated nutrition via nasogastric or duodenal tube and began to vomit after small amounts of food. Due to massive hepatosplenomegaly, a PEG or PEJ was not feasible. A Broviac catheter was implanted and total parenteral nutrition was begun (1500 kcal/d, glucose 14 g/kg/d, amino acids 4 g/kg/d, fat 2 g/kg/d). Following an attempt of increased fat administration via parenteral nutrition, H developed a pancreatitis that resolved after omitting fat from the parenteral nutrition for a few days. With this nutritional regimen H's weight remained stable and blood glucose below 150 mg/dl was obtained without insulin administration. At this point, palliative care seemed the only remaining option. Because of the very poor short-term prognosis, we decided to start an experimental therapy approach using autologous epidermal stem cell-mediated combined ex-vivo cell and gene therapy (see Ethics Statement). Transgenic grafts were prepared, free of charge, under Good Manufacturing Practices (GMP) standards by Holostem Terapie Avanzate S.r.l. at the the Centre for Regenerative Medicine Stefano Ferrari, University of Modena and Reggio Emilia, Modena, Italy. On Oct. 19, 2015, we performed the first transplantation of transgenic cultures on the 4 limbs (and part of the flanks). At that time, H suffered complete epidermal loss on 80% of his body and still needed transfusion of 300 ml packed red blood cells every 7 to 12 days and 20 g albumin once per week to keep the albumin level above 2.0 g/dl. He continued suffering from spiking fevers, wasting, and high values for acute-phase proteins (CRP, Ferritin). Wounds were colonized with Staphylococcus aureus and Escherichia coli. Perioperative antibiotic therapy was performed with flucloxacilline, ceftazidime and ciprofloxacine. Under general anaesthesia, a careful and thorough disinfection with octenidine dihydrochloride (Schuelke & Mayr, Norderstedt, Germany) and surgical debridement of all limbs and flanks was performed, both with copper sponges and surgical knife. The debrided areas demonstrated a good perfusion with intact dermis. After achieving haemostasis using epinephrine soaked gauze, all debrided areas were washed thoroughly with saline to prevent epinephrine contact with cultured grafts. Grafts were carefully transplanted on the denuded, debrided areas and covered with Adaptic, a non-adhering dressing (Systagenix Wound Management, Gargrave, UK) and sterile dressing. Post-operatively, as total immobilization was recommended after the transplantation, H was maintained under continuous isoflurane sedation for 12 days using the AnaConDa system (SedanaMedical, Uppsala, Sweden). A catheter related blood-stream infection was successfully treated with vancomycin and meropeneme. Despite the use of clonidine and propofol, H developed a severe delirium after the isoflurane sedation, which was solved by levomepromazine. Engraftment was evaluated at 8-14 days. Epidermal regeneration was evaluated at 1 month (see text). Following the first transplantation, regular weekly transfusion of red blood cells and infusion of albumin was no longer necessary. The general condition improved and enteral nutrition became feasible again with the patient tolerating up to 400 kcal/d via nasogastric tube complementing the parenteral nutrition (1500 kcal/d, glucose 14 g/kg/d, amino acids 4 g/kg/d, fat 2 g/kg/d).sup.32. On Nov. 23, 2015, a second transplantation was performed on the dorsum, the buttocks (and small areas on the shoulders and the left hand). These wounds were colonized with Staphyloccus epidermidis and Enterococcus faecium at the time of transplantation. Antibiotic treatment was done with vancomycin and ceftazidime due to suspected infection of the Broviac catheter. However, due to the high risk and severe side effects of long-term sedation, H was not sedated after the second transplantation. All dressings at the back and the buttocks had to be removed due to infection with Enterococcus faecium four days after transplantation. Topical antimicrobial therapy using polihexanide was started. On the dorsum, the graft healed in the following four weeks despite the early infection, and a stable skin without blister formation appeared (see text). Four weeks after the second transplantation, the CRP values remained below 100 mg/L and the patient was no longer febrile (
[0197] Cell lines. 3T3-J2 cells and Aml2-LAMB3 amphotropic packaging cells were grown as described below.sup.33,34. A retroviral vector expressing the 3.6-kb full-length laminin 332 LAMB3 cDNA under the control of the MLV LTR was constructed in the MFG backbone.sup.34 and integrated by transinfection in the amphotropic Gp+envAml2 packaging cell line.sup.35 (additional details below). A master cell bank of a high-titre packaging clone Aml2-LAMB3 was made under GMP/GLP standards by a qualified contractor (Molmed S.p.A, Milan, Italy) according to the ICH guidelines.
3T3J2 Cell Line
[0198] Mouse 3T3-J2 cells were a gift from Prof. Howard Green, Harvard Medical School (Boston, Mass., USA). A clinical grade 3T3-J2 cell bank was established under GMP standards by a qualified contractor (EUFETS, GmbH, Idar-Oberstein, Germany), according to the ICH guidelines. GMP-certified 3T3-J2 cells have been authorized for clinical use by national and European regulatory authorities and cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% irradiated calf serum, glutamine (4 mM) and penicillin-streptomycin (50 IU/ml).
MFG-LAMB3-Packaging Cell Line
[0199] A retroviral vector expressing the full-length 3.6-kb LAMB3 cDNA under the control of the MLV LTR was constructed by cloning a 3.6-kb of LAMB3 cDNA (Gene Bank Accession # Q13751) into MFG-backbone.sup.13. A 5 fragment of LAMB3 cDNA (563 bp) from the ATG to Stul site was obtained by PCR using as template the LB3SN plasmid.sup.33. The PCR product was cloned into NcoI and BamHI sites of MFG-vector. The second fragment of LAMB3 cDNA (3050 bp) was obtained from LB3SN by enzyme digestion from Stul to XmnI and cloned into MGF-vector into Stul site. The entire cDNA of LAMB3 was fully sequenced. The Aml2-MGFLAMB3 producer cell lines were generated by transinfection in the amphotropic Gp+envAml2 packaging cell line.sup.35. Briefly, plasmid DNA was introduced into the GP+E86 ecotropic packaging cell line.sup.35 by standard calcium phosphate transfection. Forty-eighth ours after transfection, supernatant was harvested and used to infect the amphotropic packaging cell line GP+envAml2 ATCC n.sup.o CRL 9641.sup.13 for 16 h in the presence of 8 ug/ml Polybrene. Infected Aml2 cells were clonally selected in HXM medium supplemented with 10% FCS, and containing 0.8 mg/ml G418 and 0.2 mg/mlhygromycin B (Sigma). Single colonies were screened for human LAMB3 production by immunofluorescence using an antibody specific for LAMB3 6F12 monoclonal antibody (from Dr. Patricia Rousselle, CNRS, Lyon) and for viral titer. The resulting producer cell lines showed a viral titer of 2106 colony-forming units (cfu). A master cell bank of a high-titer packaging clone (Aml2-LAMB3 2/8) was made under GMP standards by a qualified contractor (Molmed S.p.A, Milan, Italy) according to the ICH guidelines and cultured in DMEM supplemented with 10% irradiated fetal bovine serum, glutamine (2 mM), and penicillin-streptomycin (50 IU/ml). All certifications, quality and safety tests (including detection on viruses and other micro-organisms both in vitro and in vivo) were performed under GMP standards for both cell lines.
[0200] Generation of Genetically Corrected Epidermal Sheets and Graft Preparation.
[0201] Primary cultures were initiated from a 4-cm.sup.2 skin biopsy taken from a non-blistering area of inguinal region (informed consent was obtained). The entire cultivation and graft preparation procedures are detailed below. Briefly, sub confluent primary cells were plated (1 0.3310.sup.4 cells/cm.sup.2) onto a feeder-layer (810.sup.4 cells/cm.sup.2) composed of lethally irradiated 3T3-J2 cells and producer GP+envAml2-LAMB3 cells.sup.36 (a 1:2 mixture) in keratinocytes growth medium (KGM).sup.33. Sub-confluent transduced cultures were pooled, re-suspended in KGM supplemented with 10% glycerol, aliquoted, and frozen in liquid nitrogen (36 vials, 5.110.sup.6 cells/vial). At each step, efficiency of colony formation (CFE) by keratinocytes was determined, fixing colonies with 3.7% formaldehyde 12 days later and staining them with 1% Rhodamine B.sup.36.
[0202] For the preparation of plastic-cultured grafts, transduced keratinocytes were thawed and plated (110.sup.4 cells/cm.sup.2) on 100 mm culture dishes containing lethally irradiated 3T3-J2 cells and grown to confluence in KGM with no penicillin-streptomycin. Grafts were then detached with Dispase II, 2.5 mg/ml (Roche Diagnostics S.p.a.) and mounted basal side up on sterile non-adhering gauze (Adaptic, Systagenix Wound Management, Gargrave, UK). For fibrin-cultured grafts, fibrin gels were prepared in 144 cm.sup.2 plates (Greiner, Stuttgart, Germany) as described.sup.36-38. Fibrin gels consisted of fibrinogen (23.1 mg/ml) and thrombin (3.1 IU/ml) in NaCl (1%), CaCl.sub.2 (1 mM) and Aprotinin (1786 KIU/ml).
[0203] Fibrin is produced by the inventor consists of two fibrinogen reagents (23.1 mg/ml) and thrombin (3.1 IU/ml) produced by Kedrion (commercial name Kolfib). The production process preferably involves three phases:
[0204] 1. Preparation of fibrinogen solution and thrombin
[0205] 2. Preparation of fibrin support
[0206] 3. Fibrin compliance test
[0207] 1. A thrombin (kedrion) vial containing 625 IU or 1250 IU of thrombin is reconstituted in 10 ml of buffer consisting of NaCl (1.1%) and CaCl.sub.2 (1 mM). The entire content is then transferred to a 50 ML tube to which other 10ML buffers will be added. If the starting vial contained 625 UI of thrombin, a 1:5 dilution of the reconstituted solution was made. If the starting vial contained 1250 UI of thrombin, a dilution of 1:10 of the reconstituted solution was made. The solution is prepared at room temperature and examined to ensure that there are no solubilized thrombin solutions. A 120 mg or 240 mg fibrinogen was solubilized in 2.59 ML or 5.184 ML buffer containing NaCl (1%) and CaCl.sub.2 (1 mM) and aprotinin (1786 KIU/ml). The reconstituted solution is incubated at 36.5 C. for 30 to 60 minutes to complete the solubilization.
2. The fibrin gel is prepared in a 144 cm.sup.2 support in untreated plates for cell culture. To obtain a 100 mm thick gel, 6 ML of thrombin solution and 6 ML of fibrinogen solution are mixed to obtain a homogeneous mixture. The plates thus prepared are left at room temperature for 10-15 min until full polymerization and then stored at 4 C. for up to one month.
[0208] 3. Before releasing the fibrin gel are subjected to compliance checks.
[0209] Transduced keratinocytes were thawed and plated (110.sup.4 cells/cm.sup.2) on lethally irradiated 3T3-J2 cells onto the fibrin gels and grown as above. Grafts were washed twice in DMEM containing 4 mM glutamine, and placed in sterile, biocompatible, non-gas-permeable polyethylene boxes containing DMEM and 4 mM glutamine. Boxes were closed, thermo-sealed and packaged into a sealed, sterile transparent plastic bag for transportation to the hospital.
[0210] Cell Culture and Medium.
[0211] Transgenic cultured epidermal grafts were prepared under GMP standards by Holostem Terapie Avanzate S.r.l. at the Centre for Regenerative Medicine Stefano Ferrari, University of Modena and Reggio Emilia, Modena, Italy. Briefly, a 4-cm2 skin biopsy was minced and trypsinized (0.05% trypsin and 0.01% EDTA) at 37 C. for 3 h. Cells were collected every 30 min, plated (2.7104 cells/cm2) on lethally irradiated 3T3-J2 cells (2.66104 cells/cm2) and cultured in 5% CO2 and humidified atmosphere in keratinocyte growth medium (KGM):DMEM and Ham's F12 media (2:1 mixture) containing irradiated fetal bovine serum (10%), insulin (5 g/ml), adenine (0.18 mM), hydrocortisone (0.4 g/ml), cholera toxin (0.1 nM), triiodothyronine (2 nM), glutamine (4 mM), epidermal growth factor (10 ng/ml), and penicillin-streptomycin (50 IU/ml). Sub-confluent primary cultures were trypsinized (0.05% trypsin and 0.01% EDTA) at 37 C. for 15-20 minutes and seeded (1.33104 cells/cm.sup.2) onto a feeder-layer (8104 cells/cm.sup.2) composed of lethally irradiated 3T3-J2 cells and producer GP+envAml2-LAMB3 cells.sup.12 (a 1:2 mixture) in KGM. After 3 days of cultivation, cells were collected and cultured in KGM onto a regular 3T3-J2 feeder-layer. Sub-confluent transduced cultures were pooled, re-suspended in KGM supplemented with 10% glycerol, aliquoted, and frozen in liquid nitrogen (36 vials, 5106 cells/vial). At each step, efficiency of colony formation (CFE) by keratinocytes was determined by plating 1000 cells, fixing colonies with 3.7% formaldehyde 12 days later and staining them with 1% Rhodamine B.
[0212] Clonal Analysis and DNA Analysis.
[0213] Clonal analysis was performed as described.sup.7 and shown in
[0214] Library Preparation and Sequencing.
[0215] Illumina barcoded libraries were obtained from 3 independent pre-graft cultures (PGc, generated by 3 vials, each containing 220,000 clonogenic keratinocytes) and 3 post-graft cultures (4Mc, 8Mc.sub.1, and 8Mc.sub.2). For each sample, 2 tubes with 500 ng of genomic DNA were sheared in 100 l of water applying 3 sonication cycles of 15 sec/each in a Bioruptor (Diagenode) to obtain fragments of 300-500 bp. Fragmented DNA was recovered through purification with 0.8 volumes of Agencourt AMPure XP beads, two washing steps with 80% ethanol, and elution in Tris-HCl 10 mM. Repair of DNA ends and A-tailing of blunt ends were both performed using Agilent SureSelectx.sup.T reagents (Agilent Technologies), according to manual specifications, followed by purification with 1.2 volumes of AMPure XP beads. A custom universal adapter was generated by annealing <Phos-TAGTCCCTTAAGCGGAG-C3> (SEQ ID NO:11) oligo and <GTAATACGACTCACTATAGGGCNNNNNNCTCCGCTTAAGGGACTAT> (SEQ ID NO:12) oligo on a thermocycler from 95 C. to 21 C., with decrease of 1 C./min in a 10 mM Tris-HCl, 50 mM NaCl buffer. Ligation of universal adapter to A-tailed DNA was carried out in a reaction volume of 30 l with 400 U of T4 DNA ligase (New England Biolabs) with respective T4 DNA ligase buffer 1 and 35 pmol of dsDNA universal adapter and incubated at 23 C. for 1 h, at 20 C. for 1 h, and finally heat inactivated at 65 C. for 20 min. Each ligation product was purified with 1.2 volumes of AMPure XP beads as described above. Eluate of each reaction was split in 3 different tubes to perform independent PCR reaction in order to mitigate reaction-specific complexity reduction. Each tube was amplified by PCR with a combination of I7-index primers (701/702/703), to multiplex samples on the same Illumina sequencing lane, and of two 15 LTR-primers (501/502) to barcode specific enrichments of MLV-LTR sequences (Table 7).
TABLE-US-00015 TABLE7 ListofI7-indexprimersand I5LTR-primersusedforlibrarypreparation. Primer set Primername Primersequence I7 Linker_primer_701_N CAAGCAGAAGACGGCATACGAGATCGAGTA ATGTGACTGGAGTTCAGACGTGTGCTCTTC CGATCTGTAATACGACTCACTATAGGGC (SEQIDNO:13) Linker_primer_702_N CAAGCAGAAGACGGCATACGAGATTCTCCG GAGTGACTGGAGTTCAGACGTGTGCTCTTC CGATCTGTAATACGACTCACTATAGGGC (SEQIDNO:14) Linker_primer_703_N CAAGCAGAAGACGGCATACGAGATAATGAG CGGTGACTGGAGTTCAGACGTGTGCTCTTC CGATCTGTAATACGACTCACTATAGGGC (SEQIDNO:15) I5 MuLV_LTR-3pIN_501_N AATGATACGGCGACCACCGAGATCTACACT ATAGCCTACACTCTTTCCCTACACGACGCT CTTCCGATCTGACTTGTGGTCTCGCTGTTC CTTGG (SEQIDNO:16) MuLV_LTR-3pOUT_502_N AATGATACGGCGACCACCGAGATCTACACA TAGAGGCACACTCTTTCCCTACACGACGCT CTTCCGATCTGGGTCTCCTCTGAGTGATTG ACTACC (SEQIDNO:17)
[0216] PCR reaction was carried out in a final volume of 25 L, with 20 pmoles of each primer and Phusion High-Fidelity master mix 1 (New England Biolabs). PCR products were purified with 0.8 AMPure XP beads and all amplification products from the same sample (2 fragmentations, 3 PCR reactions) were pooled and quantified on Bioanalyzer 2100 high sensitivity chip. Paired-end 125 bp sequencing was performed on Illumina HiSeq2500 (V4 chemistry). Illumina barcodes on the whole Illumina lanes were combined to maintain a minimum hamming-distance of at least 3 nucleotides. Extraction and de-multiplexing of reads was obtained using CASAVA software (v. 1.8.2) applying a maximum barcode mismatch of 1 nucleotide and considering the dual indexing of 17-15 sequences. Reads were processed using the bioinformatics pipeline described in details below. Briefly, reads were first inspected with cutadapt.sup.40 to verify specific enrichments, then trimmed using FASTX-Toolkit (http://hannonlab.cshl.edu/fastx_toolkit/) and bbduk2 (http://jgi.doe.gov/data-and-tools/bbtools/) to remove adaptors and primers, and mapped to the human genome reference sequence GRCh37/hgl9 using BWA MEM.sup.41 with default parameters and the M flag. Finally, the start coordinate of the alignment was used as the putative integration site.
Bioinformatics Analysis of Sequencing Data.
[0217] To process the sequencing reads we assembled a custom bioinformatics pipeline composed of standard tools for NGS data analysis. In particular, we first used cutadapt (v1.14; https://cutadapt.readthedocs.io/en/stable/).sup.40 to verify the presence, in read pairs, of specific sequences indicative of a successful enrichment. Specifically, in the read harboring the 15 LTR-primer sequence (read 1), we searched for the primer sequence and, at its 3-end, for the remainder LTR sequence. Instead, in the read harboring the 17 indexing primer (read 2), we searched for the presence of the common adapter sequence preceding the 6 indexing bases. Pairs containing both sequences were retained for analysis after trimming the 15 primer and the remainder LTR sequence in read 1 and the common adapter sequence in read 2. Then, we used FASTX-Toolkit (http://hannonlab.cshl.edu/fastx_toolkit/) to remove from read 2 the first 6 indexing bases, utilized as de-duplicator component during de-multiplexing. Since half of the amplification products are expected to be non-informative in the detection of the insertion site, given the identity of the two LTRs of the MLV genome, we applied bbduk2 (http://jgi.doe.gov/data-and-tools/bbtools/) to identify and remove read pairs representing inward-facing LTR primer enrichment events. In bbduk2 we set the kmer length to 27 (k=27) and the edit distance and the maxbadkmers parameters both to 1. Reads were aligned on the human genome reference sequence GRCh37/hgl9 using BWA MEM.sup.41 with default parameters and the M flag (to include multiple-mapping signature in the BAM file). Read pairs sharing the same mapping coordinates and the same de-duplicator component were labeled as PCR duplicates and removed. Aligned read pairs were further filtered to retain only those mapping at a distance comprised between 150 and 600 bp (corresponding to the expected library insert size), allowing a maximum of 1 bp soft-clip (unaligned) on all ends, with the exception of the 5 end of read 2 where we allowed 20 bp soft clip since it contains the 18 bp untrimmed common adapter sequence. Finally, we retained read 1 sequences with a minimum mapping quality of 40 and extracted and counted the alignment coordinates of their first base, representing the putative insertion site. Insertion sites within 10 bp from one another were treated as a single insertion, their counts summed using BEDTools (v2.15; http://bedtools.readthedocs.io/en/latest/content/bedtools-suite.html).sup.42, and the summed count assigned to left coordinate. When intersecting insertion sites across samples, we considered overlapping those insertion events closer than 30 bp.
[0218] Genomic and Functional Annotation of Integration Events.
[0219] Annotation of integration sites to gene features was performed using the ChlPseeker R package.sup.40. Insertion sites were mapped to promoters (defined as 5 kb regions upstream of the transcription start site), exons, and introns of RefSeq genes, and intergenic regions. Functional enrichment in GO Biological Processes of genes harboring an integration site was performed using the clusterProfiler R package.sup.40, setting a q-value threshold of 0.05 for statistical significance. Annotation of integration sites to epigenetically defined transcriptional regulatory elements was performed with the BEDTools suite.sup.42 using publicly available ChIP-seq data of histone modifications (H3K4me3, H3K4mel, and H3K27ac) in human keratinocyte progenitors (GSE64328).sup.40.
[0220] Linear Amplification-Mediated (LAM) PCR, NGS on Holoclones, PCR on Mero/Paraclones and Integration Site Analysis.
[0221] 100 ng of DNA of transduced keratinocytes was used as template for LAM-PCR. LAM-PCR product was initiated with a 50-cycle linear PCR and digested with 2 enzymes simultaneously without splitting the DNA amount using 1 l MseI (5 U/l) and 1 l PstI (5U/l) (Thermo Fisher, Waltham, US) and ligation of a MseI restriction site-complementary linker cassette. LAM-PCR was digested with 2 enzymes simultaneously without splitting the DNA amount. The second enzyme PstI was introduced to eliminate the undesired 5LTR-LAMB3 sequences. The first exponential biotinylated PCR product was captured via magnetic beads and reamplified by a nested second PCR. LAM-PCR primers for MLV-LAMB3 used are in table 8. For the initial LAM-PCR, the 5-biotinylated oligonucleotide complementary to the 3-LTR sequence (5-GGTACCCGTGTATCCAATAA-3) (SEQ ID NO:18) was used for the linear amplification step. The 2 sequential exponential amplification steps were performed with nested oligonucleotides complementary to the 3-LTR sequence (5-GACTTGTGGTCTCGCTGTTCCTTGG-3) (SEQ ID NO:19); (5-GGTCTCCTCTGAGTGATTGACTACC-3) (SEQ ID NO:20), each coupled with the oligonucleotides complementary to the linker cassette (Table 8).
TABLE-US-00016 TABLE8 ListofprimersusedforLAM-PCRonholoclones. Primername Primersequence MLV3LTRIin_biotin GGTACCCGTGTATCCAATAA (SEQIDNO:21) MLV3LTR_biotin GACTTGTGGTCTCGCTGTTCCTTGG (SEQIDNO:22) LCrv GTAATACGACTCACTATAGGGC (SEQIDNO:23) MLV3LTRnested GGTCTCCTCTGAGTGATTGACTACC (SEQIDNO:24) LCrv AGGGCTCCGCTTAAGGGAC (SEQIDNO:25) LC1TAlinkerMse(+) GTAATACGACTCACTATAGGGCTCC GCTTAAGGGAC (SEQIDNO:26) LC2TAlinkerMse() TAGTCCCTTAAGCGGAG (SEQIDNO:27)
[0222] LAM-PCR amplicons were either separated on 2% standard agarose gels (Biozym, Hessisch Oldendorf, Germany) and the excised bands cloned into the StrataClone PCR Cloning Kit (Agilent Technologies, Santa Clara), PCR-purified using High Pure PCR Product Purification Kit (Roche, Basel, Switzerland), shotgun cloned, and sequenced by Sanger, or used as unpurified PCR product as template for NGS library preparation. The fragments were end-repaired, adaptor-ligated, nick-repaired and purified by using the Ion Plus Fragment Library Kit (Life Technologies, Carlsbad, US). The template preparation and the sequencing run on the machine were also performed according to the protocols of Life Technologies. A mean vertical coverage was planned to reach at least 2000 reads. Data were analyzed as described below.
[0223] Screening of the integration sites of the meroclones and paraclones was done by PCR using a combination of the FW primer MLV 3LTR control F (5-GGACCTGAAATGACCCTGTG-3) (SEQ ID NO:28) of the LTR and a specific reverse primer (Table 9)
TABLE-US-00017 TABLE9 ListofprimersusedforPCRon meroclonesandparaclonesinPGc,4Mc,and8Mc.sub.1. Culture Primername Primersequence PGc MLV3LTR GGACCTGAAATGACCCTGTG controlF (SEQIDNO:29) Chr.5a ACCCACAGCTCCTGTCTCAT (SEQIDNO:30) Chr.2a TTCTTTCAGTCTGGTGGGGTG (SEQIDNO:31) Chr.4a TGGTGGTGGAGTATCTGGAG (SEQIDNO:32) Chr.4b GTGGTGGTGGAGTATCTGGAG (SEQIDNO:33) Chr.19a CTCACCATCATGAGGAGCAA (SEQIDNO:34) Chr.19b CTCACCATCATGAGGAGCAA (SEQIDNO:35) Chr.5b GAGCAATTTGAGGGTCAGAGA (SEQIDNO:36) Chr.17c GAAATCAAGATTGTATCACGTTCC (SEQIDNO:37) Chr.16 CTGCACACATGCCCTCTTT (SEQIDNO:38) Chr.2b TCCCAGGAACTTTGTTCAGA (SEQIDNO:39) Chr.3 CCCTAAGGAGCTCCAACTGA (SEQIDNO:40) Chr.Y CTGAGGATGGTGGCAGAAAT (SEQIDNO:41) Chr.6 GCCAATTAACACTCGTTCACC (SEQIDNO:42) Chr.14b GGCTCCCAGGTATGTTCTCA (SEQIDNO:43) 4Mc Chr.1 CCTGATGTTCTGTCCCCCTA (SEQIDNO:44) Chr.9a GCATGCACAACAGCTCAAAC (SEQIDNO:45) Chr.14a GCCTCCATTTGGAGAGAAAAT (SEQIDNO:46) Chr.15a CCTCCTCCTCTTCCCTTGAT (SEQIDNO:47) 8Mc.sub.1 Chr.8 CGGCAACCACTTTAAAGGAC (SEQIDNO:48) Chr.9b GCCTCACTTTCTTTCTCTGTAAATG (SEQIDNO:49) Chr.17a GGCTCACTGCAACCTTCATC (SEQIDNO:50) Chr.X CTGGAGCTGGGTGAGATAAAG (SEQIDNO:51) Chr.5c GGAATGGGGCATAAGAGACA (SEQIDNO:52) Chr.17d TTGAGATAGTCTTACGCTGTCACC (SEQIDNO:53)
in the proximity of the integration site. Genomic DNA from the holoclones was used as positive controls.
[0224] Calculation of the Expected Number of Integrations.
[0225] The expected number of integrations (i.e., the expected population size) in PGc, 4Mc, 8Mc1, and 8Mc2 samples was calculated in R applying a capture-recapture model based on the Chapman's estimate and its confidence intervals.sup.15 (Chapman, D. G. & University of California, B. Some properties of the hypergeometric distribution with applications to zoological sample censuses. (University of California Press, 1951)).
[0226] where
[0227] {circumflex over (N)}
[0228] is the estimated number of integrations, n.sub.1 is the number of integrations found in the 3pIN library, n.sub.2 those found in the 3pOUT library, n.sub.11 the number of overlapping integrations, n.sub.12 and n.sub.21 the insertion respectively exclusive of 3pIN and 3pOUT, respectively, and Z.sub.1-/2=2.56
for =0.01.
[0229] Provirus Copy Number (PCN)
[0230] TaqMan PCR analysis was performed with TaqMan Universal PCR Master Mix and vector-specific LAMB3 and GAPDH probes (LAMB3: Hs00165078_m1; GAPDH: Hs03929097_g1, Applied Biosystems). The amplicon for LAMB3 was located between adjacent exons to recognize only provirus LAMB3. Reactions were performed with ABI Prism 7900 Sequence Detection System (Applied Biosystems), using 10 ng of genomic DNA. The relative quantity that relates the PCR signal of the target provirus was normalized to the level of GAPDH (internal control gene) in the same genomic DNA by using the 2.sup.CT quantification.
[0231] Immunofluorescence (IF), Transmission Electron Microscopy (TEM) and Hematoxylin/Eosin Staining.
[0232] These procedures are detailed below. H's skin biopsies were taken after the parent's informed consent at 4, 8, and 21 months follow-up. The following antibodies were used for IF: mouse 6F12 monoclonal antibody to laminin 332-3, laminin 332-3 BM165 mAb (both from Dr. Patricia Rousselle, CNRS, Lyon), laminin 332-2 D4B5 mAb (Chemicon), 6 integrin 450-30A mAb and 4 integrin 450-9D mAb (Thermo Fisher Scientific). Alexa Fluor 488 goat anti-mouse (Life Technologies) conjugated secondary antibodies were used for detection. Cell nuclei were stained with DAPI. The following vector-specific primers were used for ISH: 5-Sp6-AGTAACGCCATTTTGCAAGG-3 (Tm 60 C.) (SEQ ID NO:54) and 5-T7-AACAGAAGCGAGAAGCGAAC-3 (SEQ ID NO:55) (Tm 58 C.).sup.36,43
Immunofluorescence on Skin Section and Cells.
[0233] Normal skin biopsies were obtained as anonymized surgical waste, typically from abdominoplasties or mammoplasty reduction and used as normal control. Ethical approval for obtaining the tissue, patient information sheets, and consent forms have been obtained and approved by our institutions (Comitato Etico Provinciale, Prot. N.sup.o 2894/C.E.). H's skin biopsies were taken randomly from his body upon agreement patient information sheets and consent forms. Skin biopsies were washed in PBS, embedded in Killik-OCT (Bio-Optica) and frozen. Immunofluorescence was performed on 7 m skin sections (fixed in PFA 3%, permeabilized with PBS/triton 0.2% for 15 min at r.t. and blocked 1 h at r.t with BSA 2% in PBS/triton 0.2%) using antibodies (described into methods section) in BSA 2% in PBS/triton 0.2% and added to skin sections for 30 min at 37 C. Sections were washed 3 times in PBS/triton 0.1% and incubated with Alexa Fluor 488 goat anti-mouse (Life Technologies), diluted 1:2,000 in BSA 2%, PBS/triton 0.2% for 30 min at 37 C. Cell nuclei were stained with DAPI. Glasses were then mounted with Dako Mounting medium and fluorescent signals were monitored under a Zeiss confocal microscope LSM510meta with a Zeiss EC Plan-Neofluar 40/1.3 oil immersion objective.
[0234] To assess the percentage of transduced colonies, 10,000 cells from the sub-confluent transduced PGc pool were plated on a chamber slide and cultivated for 5 days as above. Chamber slides were fixed in methanol 100% for 10 min at 20 C. and immunofluorescence analysis was performed as above. Laminin 332- positive colonies were counted under a Zeiss Microscope AXIO ImagerA1 with EC-Plan Neofluar 20/0.5 objective.
[0235] In Situ Hybridization.
[0236] In situ hybridization (ISH) was performed on 10 m skin sections. DIG-RNA probe synthesis was performed according to the manufacturer's instructions (Roche, DIG Labelling MIX). Primer pairs with Sp6/T7 promoter sequences (MWG Biotech) were used to obtain DNA templates for in vitro transcription. The following vector-specific primers were used: 5-Sp6-AGTAACGCCATTTTGCAAGG-3 (SEQ ID NO:56) (Tm 60 C.) and 5-T7-AACAGAAGCGAGAAGCGAAC-3 (SEQ ID NO:57) (Tm 58 C.).sup.11,12. OCT sections were fixed in PFA 4% and permeabilized with proteinase K 5 g/ml and post-fixed in PFA 4%. Sections were then incubated in hybridization solution (50% formamide, 4SSC, Yeast RNA 500 g/ml, lx Denhard's solution, 2 mM EDTA, 10% dextran sulfate in DEPC treated water) at 37 C. for 1 h. DIG-probes were diluted in pre-heated hybridization solution at 80 C. for 2 min and added to the slice for 20 h at 37 C. Sections were washed, blocked in Antibody buffer (1% blocking reagent from Roche in PBS tween 0.1%) containing 10% sheep serum for 1 h at RT. Anti-DIG antibody 1:200 was diluted in the same blocking solution and added to the slide for 4 h at room temperature. Signals were developed with BM-Purple solution ON at RT until signal reached the desired intensity. Slices were then mounted in 70% glycerol and visualized with Zeiss Cell Observer microscope with EC-Plan Neofluar 20/0.5 objective.
[0237] Statistical Analyses and Data Visualization.
[0238] Statistical analyses were implemented in R (v3.3.1, http://www.r-project.org/).
[0239] Results
[0240] The patient
[0241] In June 2015, a 7-year-old child (referred to as H) was admitted to the Burn Unit of the Children's Hospital, Ruhr-University, Bochum, Germany. He carried a homozygous acceptor splice site mutation (C1977-1G>A, IVS 14-1G>A) within intron 14 of LAMB3. Since birth, H developed blisters all over his body, particularly on limbs, back and flanks. His condition severely deteriorated six weeks before admission, due to infection with Staphylococcus aureus and Pseudomonas aeruginosa. Shortly after admission, H suffered complete epidermal loss on 60% of the total body surface area (TBSA). During the following weeks, all therapeutic approaches failed and H's short-term prognosis was unfavourable (Methods). After the parents' informed consent, the regional regulatory authorities and the ethical review board of the Ruhr-University authorised the compassionate use of combined ex vivo cell and gene therapy. At the time of the first surgery, H had complete epidermal loss on 80% TBSA (
[0242] Regeneration of a Functional Epidermis by Transgenic Epidermal Cultures
[0243] On Sep. 21 2015, a 4-cm.sup.2 biopsy, taken from a non-blistering area of H's left inguinal region, was used to establish primary keratinocyte cultures, which were then transduced with a retroviral vector (RV) expressing the full-length LAMB3 cDNA under the control of the Moloney leukaemia virus (MLV) long terminal repeat.sup.13 (Methods,
[0244] Previously, transgenic epidermal sheets were cultivated on plastic, enzymatically detached from the vessel and mounted on a non-adhering gauze.sup.10-12. Keratinocyte cultivation on a fibrin substratecurrently used to treat massive skin and ocular burns.sup.6,8,9eliminates cumbersome procedures for graft preparation and transplantation and avoids epidermal shrinking, allowing the production of larger grafts using the same number of clonogenic cells needed to produce plastic-cultured grafts. Since degradation of fibrin after transplantation, which is critical to allow cell engraftment, was never assessed in a JEB wound bed, at the first surgery we compared plastic- and fibrin-cultured grafts (Methods).
[0245] The left arm received plastic-cultured grafts (
[0246] Thus, 80% of H's TBSA was restored by the transgenic epidermis. During the 21 months follow-up (over 20 epidermal renewing cycles), the regenerated epidermis firmly adhered to the underlying dermis, even after induced mechanical stress (
[0247] Ten punch biopsies were randomly taken, 4, 8 and 21 months after grafting. The epidermis had normal morphology and we could not detect blisters, erosions or epidermal detachment from the underlying dermis (Data
[0248] In summary, transgenic epidermal cultures generated an entire functional epidermis in a JEB patient. This is consistent with the notion that keratinocyte cultures have been used for decades to successfully treat life-threatened burn victims on up to 98% of TBSA.sup.5,6,9,14. It can be argued that H's clinical picture (massive epidermal loss, critical conditions, poor short-term prognosis) was unusual and our aggressive surgery (mandatory for H) unthinkable for the clinical course of most EB patients. But progressive replacement of diseased epidermis can be attained in multiple, less invasive surgical interventions on more limited body areas. EB has the advantage of a preserved dermis (not available in deep burns), which allows good functional and cosmetic outcomes. This approach would be optimal for newly diagnosed patients early in their childhood. A bank of transduced epidermal stem cells taken at birth could be used to treat skin lesions while they develop, thus preventing, rather than restoring, the devastating clinical manifestations rising through adulthood. Currently, combined ex vivo cell and gene therapy cannot be applied to lesions of the internal mucosae, which, however, are usually more manageable than those on skin, perhaps with the exception of oesophageal strictures.
[0249] Integration Profile of Transgenic Epidermis
[0250] Pre-graft transgenic cultures (PGc) were generated by 8.710.sup.6 primary clonogenic cells and consisted of 2.210.sup.8 keratinocytes (divided in 36 vials), 45% of which were seeded to prepare 0.85 m.sup.2 transgenic epidermal grafts (
[0251] To investigate the genome-wide integration profile, 3 PGc samples were sequenced using two independent LTR-primers (i.e., 3pIN and 3pOUT, for library enrichment (n=12; see Methods).
[0252] High-throughput sequencing recovered a total of 174.9M read pairs and the libraries obtained using the two LTR-primers showed similar number of reads and comparable insertion counts (Pearson R>0.92, p<0.005). After merging all integration sites from the two independent priming systems, we identified 27,303 integrations in PGc (
[0253] Strikingly, we detected only 400, 206, and 413 integrations in 4Mc, 8Mc.sub.1, and 8Mc.sub.2, respectively (
[0254] To exclude that the major difference in the number of integrations found in pre- and post-graft samples could be ascribable to PCR reactions causing unbalanced representation of event-specific amplicons, or to spatiality-effect of punch biopsies, we estimated the expected number of PGc, 4Mc, 8Mc.sub.1, and 8Mc.sub.2 integrations using the Chapman-Wilson capture-recapture model on the data obtained from the independent libraries (Methods).sup.15. In PGc, the model estimated 65,0302,120 integrations, i.e. approximately twice the actual number of detected insertions. The same model estimated 45731, 32350, and 45724, independent integrations in 4Mc, 8Mc.sub.1, and 8Mc.sub.2, respectively (confidence level of 99%, =0.01), which is highly consistent with the number of events actually detected. Of note, 58%, 43% and 37% of 4Mc, 8Mc.sub.1 and 8Mc.sub.2 integrations, respectively, were identified in PGc (
[0255] Integrations were mapped to promoters (defined as 5 kb regions upstream the transcription start site of RefSeq genes), exons, introns, and intergenic regions. In all pre- and post-graft samples, 10% of events were located within promoters. The majority of integrations were either intronic (47%) or intergenic (38%) and less than 5% were found in exons (
[0256] Genes containing an integration were not functionally enriched in Gene Ontology categories related to cancer-associated biological processes.sup.16, with the exception of cell migration and small GTPase mediated signal transduction (
[0257] MLV-RV vectors raised concerns about insertional genotoxicity, which has been reported with hematopoietic stem cells, but in specific disease contexts.sup.17,20-22. Indeed, a RV vector, similar to ours, obtained a marketing authorization for ex vivo gene therapy of adenosine deaminase severe combined immunodeficiency and has been approved for PhaseI/II clinical trials on RDEB (https://clinicaltrials.gov/ct2/show/NCT02984085).sup.23. H's integration profile confirmed absence of clonal selection both in vitro and in vivo. Likewise, we never observed immortalization events related to specific proviral integrations in many serially cultivated MLV-RV-transduced keratinocytes (unpublished data). Two JEB patients, receiving a total of 110.sup.7 clonogenic transgenic keratinocytes in selected body sites (3.5 and 12 years follow-up).sup.10-12, and H, receiving 3.910.sup.8 transgenic clonogenic cells all over his body (
[0258] The Transgenic Epidermis is Sustained by Self-Renewing Stem Cells (Holoclones).
[0259] The percentage of clonogenic cells, including holoclones, remained relatively constant during the massive cell expansion needed to produce the grafts (
[0260] If originally transduced clonogenic cells were all long-lived equipotent progenitors, (i) we would have recovered thousands of integrations per cm.sup.2 of regenerated epidermis; (ii) all clonogenic cells contained in 4Mc, 8Mc.sub.1 and 8Mc.sub.2 cultures would have independent integrations, irrespectively of the clonal type. Instead, if the transgenic epidermis was sustained only by a restricted number of long-lived stem cells (continuously generating pools of TA progenitors), (i) we would have recovered, at most, only few hundreds of integrations per cm.sup.2; (ii) mero- and paraclones contained in 4Mc, 8Mc.sub.1 and 8Mc.sub.2 cultures would have the same integrations found in the corresponding holoclones.
[0261] The number of integrations detected in post-graft cultures (
TABLE-US-00018 TABLE 2 Genomic and functional annotations of integrations in holoclones Annotation to Annotation to regulatory Recovered Sample chr start end ID Holoclone genes Gene symbol elements in PGc PGc chr5 131410002 131410003 PGc_H1 Intron CSF2 no mark no chr2 144859325 144859326 PGc_H2 Intron GTDC1 no mark no chr4 101941589 101941590 PGc_H3 Intergenic weak enhancer no chr4 39355299 39355300 PGc_H4 Intron RFG1 weak enhancer no chr19 17908000 17908001 PGc_H5 Intron B3GNT3 no mark no chr19 42615156 42615157 PGc_H6 Intron POU2F2 no mark no chr5 150977858 150977859 PGc_H7* Intergenic active enhancer yes chr7 80832738 80832739 PGc_H7* Intron TBCD active enhancer yes chr16 56726522 56726523 PGc_H7* Intergenic no mark ye chr2 899619 8999620 PGc_H8 Intron MBOAT2 no mark no chr3 47024025 47024026 PGc_H9 Promoter CCDC12 active promoter yes chrY 18367597 18367598 PGc_H10 Intergenic no mark no chr6 160458524 160458525 PGc_H11 Intron IGF2R no mark no chr14 91711334 91711335 PGc_H12 Promoter GPR68 active promoter yes chr11 13946563 13946564 PGc_H13 Promoter LOC101928132 no mark yes chr14 33789922 33789923 PGc_H14 Intron NPAS3 no mark no chr13 20693331 20693332 PGc_H15 Intergenic weak enhancer no chr6 136930722 136930723 PGc_H16 Intron MAP3K5 weak enhancer yes chr18 65398639 65398640 PGc_H17 Intron LOC643542 no mark no chr4 11625725 11625726 PGc_H18 Intergenic active enhancer no chr20 22743911 22743912 PGc_H19 Intergenic no mark yes chr8 48293010 48293011 PGc_H20 Intron SPIDR active enhancer no 4Mc chr1 183130951 183130952 4Mc_H1-11** Intergenic no mark yes chr9 103188807 103188808 4Mc_H1-11** Promoter MSANTD3 active promoter yes chr14 105213201 105213202 4Mc_H12 Intron ADSSL1 no mark no chr15 39577423 39577424 4Mc_H13 Intergenic no mark yes 8Mc.sub.1 chr8 67025314 67025315 8Mc1_H1-2 Intergenic active enhancer yes chr9 125129763 125129764 8Mc1_H3 Promoter PTGS1 no mark yes chr17 76158277 76158278 8Mc1_H4-5 Intron C17orf99 no mark no chrX 114601642 114601643 8Mc1_H6 Intergenic no mark yes chr5 135342207 135342208 8Mc1_H7 Intergenic no mark yes *holoclone with three different integrations **holoclone with two different integrations
[0262] One holoclone (4Mc) was untransduced, 28, 11 and 1 holoclones contained 1,2 and 3 integrations, respectively. Eleven holoclones in 4Mc shared the same integration pattern. The same happened for two couples of holoclones in 8Mc.sub.1. Holoclones' copy numbers were confirmed by RTq-PCR (
TABLE-US-00019 TABLE 1 Enrichment of cancer-related biological process in genes harboring an insertion. Statistical significant enrichments at a 95% confidence level (q-value 0.05 in a Fisher's exact test) are in bold. GO categories were selected to represent the cancer hallmarks described in Hanahan D, Weinberg R A. Cell. 2011 Mar. 4; 144(5): 646-74. Cancer-related q-value (FDR) biological process GO ID Description PGc 4Mc 8Mc.sub.1 8Mc.sub.2 Cell death GO:0070265 necrotic cell death 0.28 0.58 0.56 0.65 and apoptosis GO:0010939 regulation of necrotic cell death 0.31 0.53 0.53 0.64 GO:0097300 programmed necrotic cell death 0.25 0.54 0.53 0.66 GO:2001233 regulation of apoptotic signaling pathway 0.52 0.67 0.72 DNA repair GO:0006282 regulation of DNA repair 0.06 0.67 GO:0006298 mismatch repair 0.53 0.54 0.66 GO:0006302 double-strand break repair 0.64 0.57 0.72 0.91 GO:0006289 nucleotide-excision repair 0.82 0.75 0.83 GO:0036297 interstrend cross-link repair 0.84 0.58 0.72 Angiogenesis GO:0001525 angiogenesis 9.54E05 0.52 0.59 0.74 GO:0045765 regulation of angiogenesis 0.53 0.73 0.73 0.72 Migration GO:0090130 tissue migration 7.82E08 0.50 0.53 0.04 GO:0090132 epithelium migration 3.64E06 0.50 0.53 0.04 GO:0010631 epithelial cell migration 3.26E06 0.49 0.53 0.04 GO:0010632 regulation of epithelial cell migration 2.43E06 0.44 0.53 0.05 GO:0051546 keratinocyte migration 0.22 0.53 0.65 GO:0001667 ambeboidal-type cell migration 3.19E08 0.52 0.53 0.06 Inflammation GO:0002526 acute inflammatory response 0.85 0.58 0.63 GO:0002544 chronic inflammatory response 0.82 0.45 GO:0050727 regulation of inflammatory response 0.80 0.69 0.61 0.80 GO:0000723 telomere maintenance 0.48 0.77 0.63 0.72 Telomerase activity GO:0007004 telomere maintenance via telomerase 0.38 0.73 GO:0032204 regulation of telomere maintenance 0.69 0.65 GO:0051972 regulation of telomerase activity 0 66 Cell cycle GO 0000075 cell cycle checkpoint 0.14 0.60 0.74 GO:1901976 regulation of cell cycle checkpoint 0.18 GO:1901987 regulation of cell cycle phase transition 0.02 0.48 0.83 GO:0045786 negative regulation of cell cycle 0.01 0.57 0.60 Proliferation GO:0050673 epithelial cell proliferation 4.06E03 0.52 0.65 0.75 GO:0050678 regulation epithelial cell proliferation 0.01 0.52 0.60 0.72 GO:0043616 keratinocyte proliferation 1.24E03 0.56 0.55 GO:0010837 regulation of keratinocyte proliferation 0.01 0.54 0.53 GO:0072089 stem cell proliferation 0.25 0.73 0.60 Glycolysis GO:0006096 glycolytic process 0.15 0.65 0.75 GO:0006110 regulation of glycolytic process 0.22 0.54 0.66
[0263] Clonal tracing was then performed by PCR, using genomic coordinates of holoclone insertions. As expected, the vast majority of PGc meroclones and paraclones (91%) did not contain the same integrations detected in the corresponding holoclones (
[0264] In summary, as depicted in
DISCUSSION
[0265] The entire epidermis of a JEB patient can be replaced by autologous transgenic epidermal cultures harbouring an appropriate number of stem cells. Both stem and TA progenitors are instrumental for proper tissue regeneration in mammals.sup.24. However, the nature and the properties of mammalian epidermal stem cells and TA progenitors are a matter of debate.sup.25,26. Although epidermal cultures have been used for 30 years in the clinic.sup.14, a formal proof of the engraftment of cultured stem cells has been difficult to obtain. Similarly, the identification of holoclones as human epithelial stem cells and mero/paraclones as TA progenitors and their role in long-term human epithelial regeneration have been inferred from compelling, yet indirect evidence.sup.6,8,9, 27. Using integrations as clonal genetic marks, we show that the vast majority of TA progenitors are progressively lost within a few months after grafting and the regenerated epidermis is indeed sustained only by a limited number of long-lasting, self-renewing stem cells. Similar data have been produced with transgenic hematopoietic stem cells.sup.28. This notion argues against a model positing the existence of a population of equipotent epidermal progenitors that directly generate differentiated cells during the lifetime of the animal.sup.25 and fosters a model where specific stem cells persist during the lifetime of the human and contribute to both renewal and repair by giving rise to pools of progenitors that persist for various periods of time, replenish differentiated cells and make short-term contribution to wound healing.sup.26. Hence, the essential feature of any cultured epithelial grafts is the presence (and preservation) of an adequate number of holoclone-forming cells. The notion that the transgenic epidermis is sustained only by engrafted stem cells further decreases the potential risk of insertional oncogenesis.
[0266] In conclusion, transgenic epidermal stem cells can regenerate a fully functional epidermis virtually indistinguishable from a normal epidermis, so far in the absence of related adverse events. The different forms of EB affect approximately 500,000 people worldwide (http://www.debra.org). The successful outcome of this study paves the road to gene therapy of other types of EB and provides a blueprint that can be applied to other stem cell-mediated combined ex vivo cell and gene therapies.
REFERENCES
[0267] 1 Fine, J. D. et al. Inherited epidermolysis bullosa: updated recommendations on diagnosis and classification. J Am Acad Dermatol 70, 1103-1126, doi:10.1016/j.jaad.2014.01.903 (2014). [0268] 2 Fine, J. D., Johnson, L. B., Weiner, M. & Suchindran, C. Cause-specific risks of childhood death in inherited epidermolysis bullosa. J Pediatr 152, 276-280, doi: 10.1016/j.jpeds.2007.06.039 (2008). [0269] 3 Barrandon, Y. & Green, H. Three clonal types of keratinocyte with different capacities for multiplication. Proceedings of the National Academy of Sciences of the United States of America 84, 2302-2306 (1987). [0270] 4 Pellegrini, G. et al. Location and clonal analysis of stem cells and their differentiated progeny in the human ocular surface. J Cell Biol 145, 769-782 (1999). [0271] Gallico, G. G., 3rd, O'Connor, N. E., Compton, C. C., Kehinde, O. & Green, H. Permanent coverage of large burn wounds with autologous cultured human epithelium. The New England journal of medicine 311, 448-451, doi:10.1056/NEJM198408163110706 (1984). [0272] 6 Pellegrini, G. et al. The control of epidermal stem cells (holoclones) in the treatment of massive full-thickness burns with autologous keratinocytes cultured on fibrin. Transplantation 68, 868-879 (1999). [0273] 7 Pellegrini, G. et al. Long-term restoration of damaged corneal surfaces with autologous cultivated corneal epithelium. Lancet 349, 990-993, doi: 10.1016/S 0140-6736(96)11188-0 (1997). [0274] 8 Rama, P. et al. Limbal stem-cell therapy and long-term corneal regeneration. The New England journal of medicine 363, 147-155, doi:10.1056/NEJMoa0905955 (2010). [0275] 9 Ronfard, V., Rives, J. M., Neveux, Y., Carsin, H. & Barrandon, Y. Long-term regeneration of human epidermis on third degree burns transplanted with autologous cultured epithelium grown on a fibrin matrix. Transplantation 70, 1588-1598 (2000). [0276] 10 Bauer, J. W. et al. Closure of a Large Chronic Wound through Transplantation of Gene-Corrected Epidermal Stem Cells. Journal of Investigative Dermatology 137, 778-781, doi: 10.1016/j.jid.2016.10.038. [0277] 11 De Rosa, L. et al. Long-term stability and safety of transgenic cultured epidermal stem cells in gene therapy of junctional epidermolysis bullosa. Stem Cell Reports 2, 1-8, doi:10.1016/j.stemcr.2013.11.001 (2014). [0278] 12 Mavilio, F. et al. Correction of junctional epidermolysis bullosa by transplantation of genetically modified epidermal stem cells. Nat Med 12, 1397-1402, doi: 10.1038/nm1504 (2006). [0279] 13 Markowitz, D., Goff, S. & Bank, A. Construction and use of a safe and efficient amphotropic packaging cell line. Virology 167, 400-406 (1988). [0280] 14 De Luca, M., Pellegrini, G. & Green, H. Regeneration of squamous epithelia from stem cells of cultured grafts. Regenerative medicine 1, 45-57, doi: 10.2217/17460751.1.1.45 (2006). [0281] 15 Chapman, D. G. & Robbins, H. Minimum Variance Estimation Without Regularity Assumptions. The Annals of Mathematical Statistics 22, 581-586 (1951). [0282] 16 Hanahan, D. & Weinberg, R. A. Hallmarks of cancer: the next generation. Cell 144, 646-674, doi:10.1016/j.cell.2011.02.013 (2011). [0283] 17 Aiuti, A. et al. Gene therapy for immunodeficiency due to adenosine deaminase deficiency. The New England journal of medicine 360, 447-458, doi:10.1056/NEJMoa0805817 (2009). [0284] 18 Biasco, L. et al. Integration profile of retroviral vector in gene therapy treated patients is cell-specific according to gene expression and chromatin conformation of target cell. EMBO Mol Med 3, 89-101, doi:10.1002/emmm.201000108 (2011). [0285] 19 Cavazza, A. et al. Self-inactivating MLV vectors have a reduced genotoxic profile in human epidermal keratinocytes. Gene Ther 20, 949-957, doi:10.1038/gt.2013.18 (2013). [0286] 20 Hacein-Bey-Abina, S. et al. Insertional oncogenesis in 4 patients after retrovirus-mediated gene therapy of SCID-X1. J Clin Invest 118, 3132-3142, doi: 10.1172/JCI35700 (2008). [0287] 21 Hacein-Bey-Abina, S. et al. A serious adverse event after successful gene therapy for X-linked severe combined immunodeficiency. The New England journal of medicine 348, 255-256, doi: 10.1056/NEJM200301163480314 (2003). [0288] 22 Howe, S. J. et al. Insertional mutagenesis combined with acquired somatic mutations causes leukemogenesis following gene therapy of SCID-X1 patients. J Clin Invest 118, 3143-3150, doi: 10.1172/JCI35798 (2008). [0289] 23 Siprashvili, Z. et al. Safety and Wound Outcomes Following Genetically Corrected Autologous Epidermal Grafts in Patients With Recessive Dystrophic Epidermolysis Bullosa. JAMA 316, 1808-1817, doi:10.1001/jama.2016.15588 (2016). [0290] 24 Hsu, Y. C., Li, L. & Fuchs, E. Transit-amplifying cells orchestrate stem cell activity and tissue regeneration. Cell 157, 935-949, doi:10.1016/j.cell.2014.02.057 (2014). [0291] 25 Clayton, E. et al. A single type of progenitor cell maintains normal epidermis. Nature 446, 185-189, doi:10.1038/nature05574 (2007). [0292] 26 Mascre, G. et al. Distinct contribution of stem and progenitor cells to epidermal maintenance. Nature 489, 257-262, doi: 10.1038/nature 1393 (2012). [0293] 27 Pellegrini, G. et al. Biological parameters determining the clinical outcome of autologous cultures of limbal stem cells. Regenerative medicine 8, 553-567, doi:10.2217/rme.13.43 (2013). [0294] 28 Biasco, L. et al. In Vivo Tracking of Human Hematopoiesis Reveals Patterns of Clonal Dynamics during Early and Steady-State Reconstitution Phases. Cell Stem Cell 19, 107-119, doi:10.1016/j.stem.2016.04.016 (2016). [0295] 29 Schwieger-Briel, A. et al. Instrument for scoring clinical outcome of research for epidermolysis bullosa: a consensus-generated clinical research tool. Pediatr Dermatol 32, 41-52, doi:10.1111/pde.12317 (2015). [0296] 30 Hemdon, D. N. et al. Long-term propranolol use in severely burned pediatric patients: a randomized controlled study. Ann Surg 256, 402-411, doi: 10.1097/SLA.0b013e318265427e (2012). [0297] 31 Goldschneider, K. R. et al. Pain care for patients with epidermolysis bullosa: best care practice guidelines. BMC Med 12, 178, doi:10.1186/s12916-014-0178-2 (2014). [0298] 32 Rodriguez, N. A., Jeschke, M. G., Williams, F. N., Kamolz, L. P. & Hemdon, D. N. Nutrition in burns: Galveston contributions. JPEN J Parenter Enteral Nutr 35, 704-714, doi: 10.1177/0148607111417446 (2011). [0299] 33 Dellambra, E. et al. Corrective transduction of human epidermal stem cells in laminin-5-dependent junctional epidermolysis bullosa. Hum Gene Ther 9, 1359-1370, doi: 10.1089/hum.1998.9.9-1359 (1998). [0300] 34 Krall, W. J. et al. Increased levels of spliced RNA account for augmented expression from the MFG retroviral vector in hematopoietic cells. Gene Ther 3, 37-48 (1996). [0301] Mathor, M. B. et al. Clonal analysis of stably transduced human epidermal stem cells in culture. Proceedings of the National Academy of Sciences of the United States of America 93, 10371-10376 (1996). [0302] 36 Mavilio, F. et al. Correction of junctional epidermolysis bullosa by transplantation of genetically modified epidermal stem cells. Nat Med 12, 1397-1402, doi:10.1038/nm1504 (2006). [0303] 37 Bauer, J. W. et al. Closure of a Large Chronic Wound through Transplantation of Gene-Corrected Epidermal Stem Cells. Journal of Investigative Dermatology 137, 778-781, doi:10.1016/j.jid.2016.10.038. [0304] 38 Guerra, L. et al. Treatment of stable vitiligo by Timedsurgery and transplantation of cultured epidermal autografts. Arch Dermatol 136, 1380-1389 (2000). [0305] 39 Barrandon, Y. & Green, H. Three clonal types of keratinocyte with different capacities for multiplication. Proceedings of the National Academy of Sciences of the United States of America 84, 2302-2306 (1987). [0306] 40 Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. 2011 17, doi:10.14806/ej.17.1.200 pp. 10-12 (2011). [0307] 41 Li, H. Aligning sequence reads, clone sequences and assembly contigs with BWA-MEM. Eprint Arxiv (2013). [0308] 42 Quinlan, A. R. BEDTools: The Swiss-Army Tool for Genome Feature Analysis. Curr Protoc Bioinformatics 47, 11 12 11-34, doi:10.1002/0471250953.bi1 112s47 (2014). [0309] 43 De Rosa, L. et al. Long-term stability and safety of transgenic cultured epidermal stem cells in gene therapy of junctional epidermolysis bullosa. Stem Cell Reports 2, 1-8, doi:10.1016/j.stemcr.2013.11.001 (2014).