GENERATION AND CORRECTION OF A HUMANIZED MOUSE MODEL WITH A DELETION OF DYSTROPHIN EXON 44
20200275641 ยท 2020-09-03
Assignee
Inventors
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12N2750/14143
CHEMISTRY; METALLURGY
A61K38/465
HUMAN NECESSITIES
C12N2800/80
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
A61K48/005
HUMAN NECESSITIES
C12N9/96
CHEMISTRY; METALLURGY
A01K2207/12
HUMAN NECESSITIES
A61P21/00
HUMAN NECESSITIES
A61K31/7105
HUMAN NECESSITIES
C12N15/8509
CHEMISTRY; METALLURGY
A01K2217/056
HUMAN NECESSITIES
International classification
C12N9/96
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
A61P21/00
HUMAN NECESSITIES
A61K31/7105
HUMAN NECESSITIES
Abstract
Duchenne muscular dystrophy (DMD), which affects 1 in 5,000 male births, is one of the most common genetic disorders of children. This disease is caused by an absence or deficiency of dystrophin protein in striated muscle. The major DMD deletion hot spots are found between exon 6 to 8, and exons 45 to 53. Here, a humanized mouse model is provided that can be used to test a variety of DMD exon skipping strategies. Among these are, CRISPR/Cas9 oligonucleotides, small molecules or other therapeutic modalities that promote exon skipping or micro dystrophin mini genes or cell based therapies. Methods for restoring the reading frame of exon 44 deletion via CRISPR-mediated exon skipping in the humanized mouse model, in patient-derived iPS cells and ultimately, in patients using various delivery systems are also contemplated. The impact of CRISPR technology on DMD is that gene editing can permanently correct mutations.
Claims
1. A mouse whose genome comprises a deletion of exon 44 of the dystrophin gene resulting in an out of frame shift and a premature stop codon in exon 45.
2. The mouse of claim 1, further comprising a reporter gene located downstream of and in frame with exon 79 of the dystrophin gene, and upstream of a dystrophin 3-UTR, wherein the reporter gene is expressed when exon 79 is translated in frame with exon 43.
3. The mouse of claim 2, wherein the reporter gene is luciferase.
4.-6. (canceled)
7. The mouse of claim 1, wherein the mouse is heterozygous for the deletion.
8. The mouse of claim 1, wherein the mouse is homozygous for the deletion.
9. The mouse of claim 1, wherein the mouse exhibits increased creatine kinase levels.
10. The mouse of claim 1, wherein the mouse does not exhibit detectable dystrophin protein in heart or skeletal muscle.
11.-20. (canceled)
21. An isolated cell obtained from the mouse of claim 1.
22.-28. (canceled)
29. A mouse produced by a method comprising the steps of: (a) contacting a fertilized oocyte with CRISPR/Cas9 elements and two single guide RNA (sgRNA) targeting sequences flanking exon 44, thereby creating a modified oocyte, wherein deletion of exon 44 by CRISPR/Cas9 results in an out of frame shift and a premature stop codon in exon 45; (b) transferring the modified oocyte into a recipient female.
30. A method of screening a candidate substance for DMD exon-skipping activity comprising: (a) contacting a mouse according to claim 1 with a candidate substance; and (b) assessing in frame transcription and/or translation of exon 79, wherein the presence of in frame transcription and/or translation of exon 79 indicates the candidate substance exhibits exon-skipping activity.
31. The method of claim 30, wherein the mouse does not exhibit detectable dystrophin protein in heart or skeletal muscle.
32.-39. (canceled)
40. An isolated nucleic acid encoding a DMD guide RNA and comprising the sequence as set forth in any one of SEQ ID NO. 1-8 or 27-38.
41-44. (canceled)
45. A method of correcting a dystrophin gene defect in Exon 45 of the DMD gene in a subject comprising contacting a cell in the subject with Cpf1 or Cas9 and a DMD guide RNA as defined in claim R421140, resulting in selective skipping of a mutant DMD exon.
46. The method of claim 45, wherein the cell is a muscle cell, a satellite cell, or an iPSC/iCM.
47. The method of claim 45, wherein Cpf1 and/or DMD guide RNA are provided to the cell through expression from one or more expression vectors coding therefor.
48. The method of claim 47, wherein the expression vector is a viral vector.
49. The method of claim 48, wherein the viral vector is an adeno-associated viral vector.
50. The method of claim 47, wherein the expression vector is a non-viral vector.
51. The method of claim 45, wherein Cpf1 or Cas9 is provided to the cell as naked plasmid DNA or chemically-modified mRNA.
52-59. (canceled)
60. The method of claim 45, wherein the correction is permanent skipping of the mutant DMD exon.
61.-62. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0018] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure. The disclosure may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
[0019] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
DETAILED DESCRIPTION
[0027] DMD is a new mutation syndrome with more than 4,000 independent mutations that have been identified in humans (world-wide web at dmd.nl). The majority of patient's mutations carry deletions that cluster in a hotspot, and thus a therapeutic approach for skipping certain exon applies to large group of patients. The rationale of the exon skipping approach is based on the genetic difference between DMD and Becker muscular dystrophy (BMD) patients. In DMD patients, the reading frame of dystrophin mRNA is disrupted resulting in prematurely truncated, non-functional dystrophin proteins. BMD patients have mutations in the DMD gene that maintain the reading frame allowing the production of internally deleted, but partially functional dystrophins leading to much milder disease symptoms compared to DMD patients.
[0028] One the most common hot spots in DMD is the genetic region between exons 44 and 51, where skipping of exon 45 would apply to 12% of the DMD population. The instant disclosure demonstrates the efficiency of CRISPR/Cas9 mediated correction of DMD mutations in patient-derived iPS cells. To further assess the efficiency and optimize CRISPR/Cas9-mediated exon skipping in vivo, a mimic of the human hot spot region was generated in a mouse model by deleting the exon 44 using CRISPR/Cas9 system directed by two single guide RNAs (sgRNAs). The Ex44 mouse model exhibits dystrophic myofibers and increased serum creatine kinase level, thus providing a representative model of DMD. These and other aspects of the disclosure are reproduced below.
I. DUCHENNE MUSCULAR DYSTROPHY
[0029] A. Background
[0030] Duchenne muscular dystrophy (DMD) is a recessive X-linked form of muscular dystrophy, affecting around 1 in 5000 boys, which results in muscle degeneration and premature death. The disorder is caused by a mutation in the gene dystrophin, located on the human X chromosome, which codes for the protein dystrophin. Dystrophin is an important component within muscle tissue that provides structural stability to the dystroglycan complex (DGC) of the cell membrane. While both sexes can carry the mutation, females are rarely affected with the skeletal muscle form of the disease.
[0031] Mutations vary in nature and frequency. Large genetic deletions are found in about 60-70% of cases, large duplications are found in about 10% of cases, and point mutants or other small changes account for about 15-30% of cases. Bladen et al. (2015), who examined some 7000 mutations, catalogued a total of 5,682 large mutations (80% of total mutations), of which 4,894 (86%) were deletions (1 exon or larger) and 784 (14%) were duplications (1 exon or larger). There were 1,445 small mutations (smaller than 1 exon, 20% of all mutations), of which 358 (25%) were small deletions and 132 (9%) small insertions, while 199 (14%) affected the splice sites. Point mutations totaled 756 (52% of small mutations) with 726 (50%) nonsense mutations and 30 (2%) missense mutations. Finally, 22 (0.3%) mid-intronic mutations were observed. In addition, mutations were identified within the database that would potentially benefit from novel genetic therapies for DMD including stop codon read-through therapies (10% of total mutations) and exon skipping therapy (80% of deletions and 55% of total mutations).
[0032] B. Symptoms
[0033] Symptoms usually appear in boys between the ages of 2 and 3 and may be visible in early infancy. Even though symptoms do not appear until early infancy, laboratory testing can identify children who carry the active mutation at birth. Progressive proximal muscle weakness of the legs and pelvis associated with loss of muscle mass is observed first. Eventually this weakness spreads to the arms, neck, and other areas. Early signs may include pseudohypertrophy (enlargement of calf and deltoid muscles), low endurance, and difficulties in standing unaided or inability to ascend staircases. As the condition progresses, muscle tissue experiences wasting and is eventually replaced by fat and fibrotic tissue (fibrosis). By age 10, braces may be required to aid in walking but most patients are wheelchair dependent by age 12. Later symptoms may include abnormal bone development that lead to skeletal deformities, including curvature of the spine. Due to progressive deterioration of muscle, loss of movement occurs, eventually leading to paralysis. Intellectual impairment may or may not be present but if present, does not progressively worsen as the child ages. The average life expectancy for males afflicted with DMD is around 25.
[0034] The main symptom of Duchenne muscular dystrophy, a progressive neuromuscular disorder, is muscle weakness associated with muscle wasting with the voluntary muscles being first affected, especially those of the hips, pelvic area, thighs, shoulders, and calves. Muscle weakness also occurs later, in the arms, neck, and other areas. Calves are often enlarged. Symptoms usually appear before age 6 and may appear in early infancy. Other physical symptoms are: [0035] Awkward manner of walking, stepping, or running(patients tend to walk on their forefeet, because of an increased calf muscle tone. Also, toe walking is a compensatory adaptation to knee extensor weakness.) [0036] Frequent falls [0037] Fatigue [0038] Difficulty with motor skills (running, hopping, jumping) [0039] Lumbar hyperlordosis, possibly leading to shortening of the hip-flexor muscles. This has an effect on overall posture and a manner of walking, stepping, or running. [0040] Muscle contractures of Achilles tendon and hamstrings impair functionality because the muscle fibers shorten and fibrose in connective tissue [0041] Progressive difficulty walking [0042] Muscle fiber deformities [0043] Pseudohypertrophy (enlarging) of tongue and calf muscles. The muscle tissue is eventually replaced by fat and connective tissue, hence the term pseudohypertrophy. [0044] Higher risk of neurobehavioral disorders (e.g., ADHD), learning disorders (dyslexia), and non-progressive weaknesses in specific cognitive skills (in particular short-term verbal memory), which are believed to be the result of absent or dysfunctional dystrophin in the brain. [0045] Eventual loss of ability to walk (usually by the age of 12) [0046] Skeletal deformities (including scoliosis in some cases) [0047] Trouble getting up from lying or sitting position
The condition can often be observed clinically from the moment the patient takes his first steps, and the ability to walk usually completely disintegrates between the time the boy is 9 to 12 years of age. Most men affected with DMD become essentially paralyzed from the neck down by the age of 21. Muscle wasting begins in the legs and pelvis, then progresses to the muscles of the shoulders and neck, followed by loss of arm muscles and respiratory muscles. Calf muscle enlargement (pseudohypertrophy) is quite obvious. Cardiomyopathy particularly (dilated cardiomyopathy) is common, but the development of congestive heart failure or arrhythmia (irregular heartbeat) is only occasional.
[0048] A positive Gowers' sign reflects the more severe impairment of the lower extremities muscles. The child helps himself to get up with upper extremities: first by rising to stand on his arms and knees, and then walking his hands up his legs to stand upright. Affected children usually tire more easily and have less overall strength than their peers. Creatine kinase (CPK-MM) levels in the bloodstream are extremely high. An electromyography (EMG) shows that weakness is caused by destruction of muscle tissue rather than by damage to nerves. Genetic testing can reveal genetic errors in the Xp21 gene. A muscle biopsy (immunohistochemistry or immunoblotting) or genetic test (blood test) confirms the absence of dystrophin, although improvements in genetic testing often make this unnecessary. [0049] Abnormal heart muscle (cardiomyopathy) [0050] Congestive heart failure or irregular heart rhythm (arrhythmia) [0051] Deformities of the chest and back (scoliosis) [0052] Enlarged muscles of the calves, buttocks, and shoulders (around age 4 or 5). These muscles are eventually replaced by fat and connective tissue (pseudohypertrophy). [0053] Loss of muscle mass (atrophy) [0054] Muscle contractures in the heels, legs [0055] Muscle deformities [0056] Respiratory disorders, including pneumonia and swallowing with food or fluid passing into the lungs (in late stages of the disease)
[0057] C. Causes
[0058] Duchenne muscular dystrophy (DMD) is caused by a mutation of the dystrophin gene at locus Xp21, located on the short arm of the X chromosome. Dystrophin is responsible for connecting the cytoskeleton of each muscle fiber to the underlying basal lamina (extracellular matrix), through a protein complex containing many subunits. The absence of dystrophin permits excess calcium to penetrate the sarcolemma (the cell membrane). Alterations in calcium and signaling pathways cause water to enter into the mitochondria, which then burst.
[0059] In skeletal muscle dystrophy, mitochondrial dysfunction gives rise to an amplification of stress-induced cytosolic calcium signals and an amplification of stress-induced reactive-oxygen species (ROS) production. In a complex cascading process that involves several pathways and is not clearly understood, increased oxidative stress within the cell damages the sarcolemma and eventually results in the death of the cell. Muscle fibers undergo necrosis and are ultimately replaced with adipose and connective tissue.
[0060] DMD is inherited in an X-linked recessive pattern. Females will typically be carriers for the disease while males will be affected. Typically, a female carrier will be unaware they carry a mutation until they have an affected son. The son of a carrier mother has a 50% chance of inheriting the defective gene from his mother. The daughter of a carrier mother has a 50% chance of being a carrier and a 50% chance of having two normal copies of the gene. In all cases, an unaffected father will either pass a normal Y to his son or a normal X to his daughter. Female carriers of an X-linked recessive condition, such as DMD, can show symptoms depending on their pattern of X-inactivation.
[0061] Duchenne muscular dystrophy has an incidence of 1 in 5000 male infants. Mutations within the dystrophin gene can either be inherited or occur spontaneously during germline transmission. A table of exemplary but non-limiting mutations and corresponding models are set forth below:
TABLE-US-00003 Deletion, small insertion and nonsense mutations Name of Mouse Model Exon 44 Ex44 Exon 52 Ex52 Exon 43 Ex43
[0062] D. Diagnosis
[0063] Genetic counseling is advised for people with a family history of the disorder. Duchenne muscular dystrophy can be detected with about 95% accuracy by genetic studies.
[0064] DNA Test.
[0065] The muscle-specific isoform of the dystrophin gene is composed of 79 exons, and DNA testing and analysis can usually identify the specific type of mutation of the exon or exons that are affected. DNA testing confirms the diagnosis in most cases.
[0066] Muscle Biopsy.
[0067] If DNA testing fails to find the mutation, a muscle biopsy test may be performed. A small sample of muscle tissue is extracted (usually with a scalpel instead of a needle) and a dye is applied that reveals the presence of dystrophin. Complete absence of the protein indicates the condition.
[0068] Over the past several years DNA tests have been developed that detect more of the many mutations that cause the condition, and muscle biopsy is not required as often to confirm the presence of Duchenne's.
[0069] Prenatal Tests.
[0070] DMD is carried by an X-linked recessive gene. Males have only one X chromosome, so one copy of the mutated gene will cause DMD. Fathers cannot pass X-linked traits on to their sons, so the mutation is transmitted by the mother.
[0071] If the mother is a carrier, and therefore one of her two X chromosomes has a DMD mutation, there is a 50% chance that a female child will inherit that mutation as one of her two X chromosomes, and be a carrier. There is a 50% chance that a male child will inherit that mutation as his one X chromosome, and therefore have DMD.
[0072] Prenatal tests can tell whether their unborn child has the most common mutations. There are many mutations responsible for DMD, and some have not been identified, so genetic testing only works when family members with DMD have a mutation that has been identified.
[0073] Prior to invasive testing, determination of the fetal sex is important; while males are sometimes affected by this X-linked disease, female DMD is extremely rare. This can be achieved by ultrasound scan at 16 weeks or more recently by free fetal DNA testing. Chorion villus sampling (CVS) can be done at 11-14 weeks, and has a 1% risk of miscarriage. Amniocentesis can be done after 15 weeks, and has a 0.5% risk of miscarriage. Fetal blood sampling can be done at about 18 weeks. Another option in the case of unclear genetic test results is fetal muscle biopsy.
[0074] E. Treatment
[0075] There is no current cure for DMD, and an ongoing medical need has been recognized by regulatory authorities. Phase 1-2a trials with exon skipping treatment for certain mutations have halted decline and produced clinical improvements in walking. Sarepta's drug Exondys 51 (eteplirsen) has recently received FDA approval. However, treatment is generally aimed at controlling the onset of symptoms to maximize the quality of life, and include the following: [0076] Corticosteroids such as prednisolone and deflazacort increase energy and strength and defer severity of some symptoms. [0077] Randomized control trials have shown that beta-2-agonists increase muscle strength but do not modify disease progression. Follow-up time for most RCTs on beta2-agonists is only around 12 months and hence results cannot be extrapolated beyond that time frame. [0078] Mild, non-jarring physical activity such as swimming is encouraged. Inactivity (such as bed rest) can worsen the muscle disease. [0079] Physical therapy is helpful to maintain muscle strength, flexibility, and function. [0080] Orthopedic appliances (such as braces and wheelchairs) may improve mobility and the ability for self-care. Form-fitting removable leg braces that hold the ankle in place during sleep can defer the onset of contractures. [0081] Appropriate respiratory support as the disease progresses is important.
Comprehensive multi-disciplinary care standards/guidelines for DMD have been developed by the Centers for Disease Control and Prevention (CDC), and were published in two parts in The Lancet Neurology in 2010. To download the two articles in PDF format, go to the TREAT-NMD website.
[0082] 1. Physical Therapy
[0083] Physical therapists are concerned with enabling patients to reach their maximum physical potential. Their aim is to: [0084] minimize the development of contractures and deformity by developing a programme of stretches and exercises where appropriate [0085] anticipate and minimize other secondary complications of a physical nature by recommending bracing and durable medical equipment [0086] monitor respiratory function and advise on techniques to assist with breathing exercises and methods of clearing secretions
[0087] 2. Respiration Assistance
[0088] Modern volume ventilators/respirators, which deliver an adjustable volume (amount) of air to the person with each breath, are valuable in the treatment of people with muscular dystrophy related respiratory problems. The ventilator may require an invasive endotracheal or tracheotomy tube through which air is directly delivered, but, for some people non-invasive delivery through a face mask or mouthpiece is sufficient. Positive airway pressure machines, particularly bi-level ones, are sometimes used in this latter way. The respiratory equipment may easily fit on a ventilator tray on the bottom or back of a power wheelchair with an external battery for portability.
[0089] Ventilator treatment may start in the mid to late teens when the respiratory muscles can begin to collapse. If the vital capacity has dropped below 40% of normal, a volume ventilator/respirator may be used during sleeping hours, a time when the person is most likely to be under ventilating (hypoventilating). Hypoventilation during sleep is determined by a thorough history of sleep disorder with an oximetry study and a capillary blood gas (See Pulmonary Function Testing). A cough assist device can help with excess mucus in lungs by hyperinflation of the lungs with positive air pressure, then negative pressure to get the mucus up. If the vital capacity continues to decline to less than 30 percent of normal, a volume ventilator/respirator may also be needed during the day for more assistance. The person gradually will increase the amount of time using the ventilator/respirator during the day as needed.
[0090] F. Prognosis
[0091] Duchenne muscular dystrophy is a progressive disease which eventually affects all voluntary muscles and involves the heart and breathing muscles in later stages. The life expectancy is currently estimated to be around 25, but this varies from patient to patient. Recent advancements in medicine are extending the lives of those afflicted. The Muscular Dystrophy Campaign, which is a leading UK charity focusing on all muscle disease, states that with high standards of medical care young men with Duchenne muscular dystrophy are often living well into their 30s.
[0092] In rare cases, persons with DMD have been seen to survive into the forties or early fifties, with the use of proper positioning in wheelchairs and beds, ventilator support (via tracheostomy or mouthpiece), airway clearance, and heart medications, if required. Early planning of the required supports for later-life care has shown greater longevity in people living with DMD.
[0093] Curiously, in the mdx mouse model of Duchenne muscular dystrophy, the lack of dystrophin is associated with increased calcium levels and skeletal muscle myonecrosis. The intrinsic laryngeal muscles (ILM) are protected and do not undergo myonecrosis. ILM have a calcium regulation system profile suggestive of a better ability to handle calcium changes in comparison to other muscles, and this may provide a mechanistic insight for their unique pathophysiological properties. The ILM may facilitate the development of novel strategies for the prevention and treatment of muscle wasting in a variety of clinical scenarios.
II. CRISPR SYSTEMS
[0094] A. CRISPR and Nucleases
[0095] CRISPRs (clustered regularly interspaced short palindromic repeats) are DNA loci containing short repetitions of base sequences. Each repetition is followed by short segments of spacer DNA from previous exposures to a virus. CRISPRs are found in approximately 40% of sequenced eubacteria genomes and 90% of sequenced archaea. CRISPRs are often associated with Cas genes that code for proteins related to CRISPRs. The CRISPR/Cas system is a prokaryotic immune system that confers resistance to foreign genetic elements such as plasmids and phages and provides a form of acquired immunity. CRISPR spacers recognize and silence these exogenous genetic elements like RNAi in eukaryotic organisms.
[0096] Repeats were first described in 1987 for the bacterium Escherichia coli. In 2000, similar clustered repeats were identified in additional bacteria and archaea and were termed Short Regularly Spaced Repeats (SRSR). SRSR were renamed CRISPR in 2002. A set of genes, some encoding putative nuclease or helicase proteins, were found to be associated with CRISPR repeats (the cas, or CRISPR-associated genes).
[0097] In 2005, three independent researchers showed that CRISPR spacers showed homology to several phage DNA and extrachromosomal DNA such as plasmids. This was an indication that the CRISPR/cas system could have a role in adaptive immunity in bacteria. Koonin and colleagues proposed that spacers serve as a template for RNA molecules, analogously to eukaryotic cells that use a system called RNA interference.
[0098] In 2007 Barrangou, Horvath (food industry scientists at Danisco) and others showed that they could alter the resistance of Streptococcus thermophilus to phage attack with spacer DNA. Doudna and Charpentier had independently been exploring CRISPR-associated proteins to learn how bacteria deploy spacers in their immune defenses. They jointly studied a simpler CRISPR system that relies on a protein called Cas9. They found that bacteria respond to an invading phage by transcribing spacers and palindromic DNA into a long RNA molecule that the cell then uses tracrRNA and Cas9 to cut it into pieces called crRNAs.
[0099] CRISPR was first shown to work as a genome engineering/editing tool in human cell culture by 2012 It has since been used in a wide range of organisms including baker's yeast (S. cerevisiae), zebra fish, nematodes (C. elegans), plants, mice, and several other organisms. Additionally CRISPR has been modified to make programmable transcription factors that allow scientists to target and activate or silence specific genes. Libraries of tens of thousands of guide RNAs are now available.
[0100] The first evidence that CRISPR can reverse disease symptoms in living animals was demonstrated in March 2014, when MIT researchers cured mice of a rare liver disorder. Since 2012, the CRISPR/Cas system has been used for gene editing (silencing, enhancing or changing specific genes) that even works in eukaryotes like mice and primates. By inserting a plasmid containing cas genes and specifically designed CRISPRs, an organism's genome can be cut at any desired location.
[0101] CRISPR repeats range in size from 24 to 48 base pairs. They usually show some dyad symmetry, implying the formation of a secondary structure such as a hairpin, but are not truly palindromic. Repeats are separated by spacers of similar length. Some CRISPR spacer sequences exactly match sequences from plasmids and phages, although some spacers match the prokaryote's genome (self-targeting spacers). New spacers can be added rapidly in response to phage infection.
[0102] CRISPR-associated (cas) genes are often associated with CRISPR repeat-spacer arrays. As of 2013, more than forty different Cas protein families had been described. Of these protein families, Cas1 appears to be ubiquitous among different CRISPR/Cas systems. Particular combinations of cas genes and repeat structures have been used to define 8 CRISPR subtypes (Ecoli, Ypest, Nmeni, Dvulg, Tneap, Hmari, Apern, and Mtube), some of which are associated with an additional gene module encoding repeat-associated mysterious proteins (RAMPs). More than one CRISPR subtype may occur in a single genome. The sporadic distribution of the CRISPR/Cas subtypes suggests that the system is subject to horizontal gene transfer during microbial evolution.
[0103] Exogenous DNA is apparently processed by proteins encoded by Cas genes into small elements (30 base pairs in length), which are then somehow inserted into the CRISPR locus near the leader sequence. RNAs from the CRISPR loci are constitutively expressed and are processed by Cas proteins to small RNAs composed of individual, exogenously-derived sequence elements with a flanking repeat sequence. The RNAs guide other Cas proteins to silence exogenous genetic elements at the RNA or DNA level. Evidence suggests functional diversity among CRISPR subtypes. The Cse (Cas subtype Ecoli) proteins (called CasA-E in E. coli) form a functional complex, Cascade, that processes CRISPR RNA transcripts into spacer-repeat units that Cascade retains. In other prokaryotes, Cas6 processes the CRISPR transcripts. Interestingly, CRISPR-based phage inactivation in E. coli requires Cascade and Cas3, but not Cas1 and Cas2. The Cmr (Cas RAMP module) proteins found in Pyrococcus furiosus and other prokaryotes form a functional complex with small CRISPR RNAs that recognizes and cleaves complementary target RNAs. RNA-guided CRISPR enzymes are classified as type V restriction enzymes.
[0104] Cas9 is a nuclease, an enzyme specialized for cutting DNA, with two active cutting sites, one for each strand of the double helix. The team demonstrated that they could disable one or both sites while preserving Cas9's ability to home located its target DNA. Jinek et al. (2012) combined tracrRNA and spacer RNA into a single-guide RNA molecule that, mixed with Cas9, could find and cut the correct DNA targets. Jinek et al. (2012) proposed that such synthetic guide RNAs might be able to be used for gene editing.
[0105] Cas9 proteins are highly enriched in pathogenic and commensal bacteria. CRISPR/Cas-mediated gene regulation may contribute to the regulation of endogenous bacterial genes, particularly during bacterial interaction with eukaryotic hosts. For example, Cas protein Cas9 of Francisella novicida uses a unique, small, CRISPR/Cas-associated RNA (scaRNA) to repress an endogenous transcript encoding a bacterial lipoprotein that is critical for F. novicida to dampen host response and promote virulence. Wang et al. (2013) showed that coinjection of Cas9 mRNA and sgRNAs into the germline (zygotes) generated nice with mutations. Delivery of Cas9 DNA sequences also is contemplated.
[0106] See also U.S. Patent Publication 2014/0068797, which is incorporated by reference in its entirety.
[0107] Clustered Regularly Interspaced Short Palindromic Repeats from Prevotella and Francisella 1 or CRISPR/Cpf1 is a DNA-editing technology analogous to the CRISPR/Cas9 system. Cpf1 is an RNA-guided endonuclease of a class II CRISPR/Cas system. This acquired immune mechanism is found in Prevotella and Francisella bacteria. It prevents genetic damage from viruses. Cpf1 genes are associated with the CRISPR locus, coding for an endonuclease that use a guide RNA to find and cleave viral DNA. Cpf1 is a smaller and simpler endonuclease than Cas9, overcoming some of the CRISPR/Cas9 system limitations. CRISPR/Cpf1 could have multiple applications, including treatment of genetic illnesses and degenerative conditions.
[0108] CRISPR/Cpf1 was found by searching a published database of bacterial genetic sequences for promising bits of DNA. Its identification through bioinformatics as a CRISPR system protein, its naming, and a hidden Markov model (HMM) for its detection were provided in 2012 in a release of the TIGRFAMs database of protein families. Cpf1 appears in many bacterial species. The ultimate Cpf1 endonuclease that was developed into a tool for genome editing was taken from one of the first 16 species known to harbor it. Two candidate enzymes from Acidaminococcus and Lachnospiraceae display efficient genome-editing activity in human cells.
[0109] A smaller version of Cas9 from the bacterium Staphylococcus aureus is a potential alternative to Cpf1.
[0110] The systems CRISPR/Cas are separated into three classes. Class 1 uses several Cas proteins together with the CRISPR RNAs (crRNA) to build a functional endonuclease. Class 2 CRISPR systems use a single Cas protein with a crRNA. Cpf1 has been recently identified as a Class II, Type V CRISPR/Cas systems containing a 1,300 amino acid protein.
[0111] The Cpf1 locus contains a mixed alpha/beta domain, a RuvC-I followed by a helical region, a RuvC-II and a zinc finger-like domain. The Cpf1 protein has a RuvC-like endonuclease domain that is similar to the RuvC domain of Cas9. Furthermore, Cpf1 does not have a HNH endonuclease domain, and the N-terminal of Cpf1 does not have the alpha-helical recognition lobe of Cas9.
[0112] Cpf1 CRISPR-Cas domain architecture shows that Cpf1 is functionally unique, being classified as Class 2, type V CRISPR system. The Cpf1 loci encode Cas1, Cas2 and Cas4 proteins more similar to types I and III than from type II systems. Database searches suggest the abundance of Cpf1-family proteins in many bacterial species.
[0113] Functional Cpf1 doesn't need the tracrRNA, therefore, only crRNA is required. This benefits genome editing because Cpf1 is not only smaller than Cas9, but also it has a smaller sgRNA molecule (proximately half as many nucleotides as Cas9).
[0114] The Cpf1-crRNA complex cleaves target DNA or RNA by identification of a protospacer adjacent motif 5-YTN-3 (where Y is a pyrimidine and N is any nucleobase) or 5-TTN-3, in contrast to the G-rich PAM targeted by Cas9. After identification of PAM, Cpf1 introduces a sticky-end-like DNA double-stranded break of 4 or 5 nucleotides overhang.
[0115] The CRISPR/Cpf1 system consist of a Cpf1 enzyme and a guide RNA that finds and positions the complex at the correct spot on the double helix to cleave target DNA. CRISPR/Cpf1 systems activity has three stages: [0116] Adaptation, during which Cas1 and Cas2 proteins facilitate the adaptation of small fragments of DNA into the CRISPR array; [0117] Formation of crRNAs: processing of pre-cr-RNAs producing of mature crRNAs to guide the Cas protein; and [0118] Interference, in which the Cpf1 is bound to a crRNA to form a binary complex to identify and cleave a target DNA sequence.
[0119] B. sgRNA
[0120] As an RNA guided protein, Cas9 requires a short RNA to direct the recognition of DNA targets (Mali et al., 2013a). Though Cas9 preferentially interrogates DNA sequences containing a PAM sequence NGG it can bind here without a protospacer target. However, the Cas9-sgRNA complex requires a close match to the sgRNA to create a double strand break (Cho et al., 2013; Hsu et al., 2013). CRISPR sequences in bacteria are expressed in multiple RNAs and then processed to create guide strands for RNA (Bikard et al., 2013). Because Eukaryotic systems lack some of the proteins required to process CRISPR RNAs the synthetic construct sgRNA was created to combine the essential pieces of RNA for Cas9 targeting into a single RNA expressed with the RNA polymerase type III promoter U6 (Mali et al., 2013b,c). Synthetic sgRNAs are slightly over 100 bp at the minimum length and contain a portion which is targets the 20 protospacer nucleotides immediately preceding the PAM sequence NGG; sgRNAs do not contain a PAM sequence.
III. NUCLEIC ACID DELIVERY
[0121] As discussed above, in certain embodiments, expression cassettes are employed to express a transcription factor product, either for subsequent purification and delivery to a cell/subject, or for use directly in a genetic-based delivery approach. Expression requires that appropriate signals be provided in the vectors, and include various regulatory elements such as enhancers/promoters from both viral and mammalian sources that drive expression of the genes of interest in cells. Elements designed to optimize messenger RNA stability and translatability in host cells also are defined. The conditions for the use of a number of dominant drug selection markers for establishing permanent, stable cell clones expressing the products are also provided, as is an element that links expression of the drug selection markers to expression of the polypeptide.
[0122] A. Regulatory Elements
[0123] Throughout this application, the term expression cassette is meant to include any type of genetic construct containing a nucleic acid coding for a gene product in which part or all of the nucleic acid encoding sequence is capable of being transcribed and translated, i.e., is under the control of a promoter. A promoter refers to a DNA sequence recognized by the synthetic machinery of the cell, or introduced synthetic machinery, required to initiate the specific transcription of a gene. The phrase under transcriptional control means that the promoter is in the correct location and orientation in relation to the nucleic acid to control RNA polymerase initiation and expression of the gene. An expression vector is meant to include expression cassettes comprised in a genetic construct that is capable of replication, and thus including one or more of origins of replication, transcription termination signals, poly-A regions, selectable markers, and multipurpose cloning sites.
[0124] The term promoter will be used here to refer to a group of transcriptional control modules that are clustered around the initiation site for RNA polymerase II. Much of the thinking about how promoters are organized derives from analyses of several viral promoters, including those for the HSV thymidine kinase (tk) and SV40 early transcription units. These studies, augmented by more recent work, have shown that promoters are composed of discrete functional modules, each consisting of approximately 7-20 bp of DNA, and containing one or more recognition sites for transcriptional activator or repressor proteins.
[0125] At least one module in each promoter functions to position the start site for RNA synthesis. The best known example of this is the TATA box, but in some promoters lacking a TATA box, such as the promoter for the mammalian terminal deoxynucleotidyl transferase gene and the promoter for the SV40 late genes, a discrete element overlying the start site itself helps to fix the place of initiation.
[0126] Additional promoter elements regulate the frequency of transcriptional initiation. Typically, these are located in the region 30-110 bp upstream of the start site, although a number of promoters have recently been shown to contain functional elements downstream of the start site as well. The spacing between promoter elements frequently is flexible, so that promoter function is preserved when elements are inverted or moved relative to one another. In the tk promoter, the spacing between promoter elements can be increased to 50 bp apart before activity begins to decline. Depending on the promoter, it appears that individual elements can function either co-operatively or independently to activate transcription.
[0127] In certain embodiments, viral promoters such as the human cytomegalovirus (CMV) immediate early gene promoter, the SV40 early promoter, the Rous sarcoma virus long terminal repeat, rat insulin promoter and glyceraldehyde-3-phosphate dehydrogenase can be used to obtain high-level expression of the coding sequence of interest. The use of other viral or mammalian cellular or bacterial phage promoters which are well-known in the art to achieve expression of a coding sequence of interest is contemplated as well, provided that the levels of expression are sufficient for a given purpose. By employing a promoter with well-known properties, the level and pattern of expression of the protein of interest following transfection or transformation can be optimized. Further, selection of a promoter that is regulated in response to specific physiologic signals can permit inducible expression of the gene product.
[0128] Enhancers are genetic elements that increase transcription from a promoter located at a distant position on the same molecule of DNA. Enhancers are organized much like promoters. That is, they are composed of many individual elements, each of which binds to one or more transcriptional proteins. The basic distinction between enhancers and promoters is operational. An enhancer region as a whole must be able to stimulate transcription at a distance; this need not be true of a promoter region or its component elements. On the other hand, a promoter must have one or more elements that direct initiation of RNA synthesis at a particular site and in a particular orientation, whereas enhancers lack these specificities. Promoters and enhancers are often overlapping and contiguous, often seeming to have a very similar modular organization.
[0129] Below is a list of promoters/enhancers and inducible promoters/enhancers that could be used in combination with the nucleic acid encoding a gene of interest in an expression construct. Additionally, any promoter/enhancer combination (as per the Eukaryotic Promoter Data Base EPDB) could also be used to drive expression of the gene. Eukaryotic cells can support cytoplasmic transcription from certain bacterial promoters if the appropriate bacterial polymerase is provided, either as part of the delivery complex or as an additional genetic expression construct.
TABLE-US-00004 TABLE A Promoter and/or Enhancer Promoter/ Enhancer References Immunoglobulin Banerji et al., 1983; Gilles et al., 1983; Grosschedl Heavy Chain et al., 1985; Atchinson et al., 1986, 1987; Imler et al., 1987; Weinberger et al., 1984; Kiledjian et al., 1988; Porton et al.; 1990 Immunoglobulin Queen and Baltimore, 1983; Picard et al., 1984 Light Chain T-Cell Receptor Luria et al., 1987; Winoto et al., 1989; Redondo et al.; 1990 HLA DQ a and/or Sullivan et al., 1987 DQ -Interferon Goodbourn et al., 1986; Fujita et al., 1987; Goodbourn and Maniatis et al., 1988 Interleukin-2 Greene et al., 1989 Interleukin-2 Greene et al., 1989; Lin et al., 1990 Receptor MHC Class II 5 Koch et al., 1989 MHC Class II Sherman et al., 1989 HLA-DRa -Actin Kawamoto et al., 1988; Ng et al.; 1989 Muscle Creatine Jaynes et al., 1988; Horlick et al., 1989; Johnson Kinase (MCK) et al., 1989 Prealbumin Costa et al., 1988 (Transthyretin) Elastase I Ornitz et al., 1987 Metallothionein Karin et al., 1987; Culotta et al., 1989 (MTII) Collagenase Pinkert et al., 1987; Angel et al., 1987a Albumin Pinkert et al., 1987; Tronche et al., 1989, 1990 -Fetoprotein Godbout et al., 1988; Campere and Tilghman et al., 1989 t-Globin Bodine and Ley et al., 1987; Perez-Stable et al., 1990 -Globin Trudel et al., 1987 c-fos Cohen et al., 1987 c-HA-ras Triesman, 1986; Deschamps et al., 1985 Insulin Edlund et al., 1985 Neural Cell Hirsh et al., 1990 Adhesion Molecule (NCAM) .sub.1-Antitrypain Latimer et al., 1990 H2B (TH2B) Hwang et al., 1990 Histone Mouse and/or Ripe et al., 1989 Type I Collagen Glucose-Regulated Chang et al., 1989 Proteins (GRP94 and GRP78) Rat Growth Larsen et al., 1986 Hormone Human Serum Edbrooke et al., 1989 Amyloid A (SAA) Troponin I (TN I) Yutzey et al., 1989 Platelet-Derived Pech et al., 1989 Growth Factor (PDGF) Duchenne Muscular Klamut et al., 1990 Dystrophy SV40 Banerji et al., 1981; Moreau et al., 1981; Sleigh et al., 1985; Firak et al., 1986; Herr and Clarke et al., 1986; Imbra and Karin et al., 1986; Kadesch and Berg, 1986; Wang et al., 1986; Ondek et al., 1987; Kuhl et al., 1987; Schaffner et al., 1988 Polyoma Swartzendruber et al., 1975; Vasseur et al., 1980; Katinka et al., 1980, 1981; Tyndell et al., 1981; Dandolo et al., 1983; de Villiers et al., 1984; Hen et al., 1986; Satake et al., 1988; Campbell and Villarreal, 1988 Retroviruses Kriegler et al., 1982, 1983; Levinson et al., 1982; Kriegler et al., 1983, 1984a, b, 1988; Bosze et al., 1986; Miksicek et al., 1986; Celander and Haseltine, 1987; Thiesen et al., 1988; Celander et al., 1988; Choi et al., 1988; Reisman et al., 1989 Papilloma Virus Campo et al., 1983; Lusky et al., 1983; Spandidos and/or Wilkie, 1983; Spalholz et al., 1985; Lusky et al., 1986; Cripe et al., 1987; Gloss et al., 1987; Hirochika et al., 1987; Stephens et al., 1987 Hepatitis B Virus Bulla and Siddiqui et al., 1986; Jameel and Siddiqui, 1986; Shaul and Ben-Levy, 1987; Spandau et al., 1988; Vannice et al., 1988 Human Muesing et al., 1987; Hauber and Cullen et al., Immunodeficiency 1988; Jakobovits et al., 1988; Feng et al., 1988; Virus Takebe et al., 1988; Rosen et al., 1988; Berkhout et al., 1989; Laspia et al., 1989; Sharp et al., 1989; Braddock et al., 1989 Cytomegalovirus Weber et al., 1984; Boshart et al., 1985; Foecking (CMV) et al., 1986 Gibbon Ape Holbrook et al., 1987; Quinn et al., 1989 Leukemia Virus
TABLE-US-00005 TABLE B Inducible Elements Element Inducer References MT II Phorbol Ester (TFA) Palmiter et al., 1982a, b; Heavy metals Haslinger et al., 1985; Searle et al., 1985; Stuart et al., 1985; Imagawa et al., 1987, Karin et al., 1987; Angel et al., 1987b; McNeall et al., 1989 MMTV (mouse Glucocorticoids Huang et al., 1981; Lee mammary et al., 1981; Majors and tumor virus) Varmas et al., 1983; Chandler et al., 1983; Ponta et al., 1985; Sakai et al., 1988 -Interferon poly(rI)x Tavernier et al., 1983 poly(rc) Adenovirus 5 E2 ElA Imperiale et al., 1984 Collagenase Phorbol Ester (TPA) Angel et al., 1987a Stromelysin Phorbol Ester (TPA) Angel et al., 1987b SV40 Phorbol Ester (TPA) Angel et al., 1987b Murine MX Gene Interferon, Hug et al., 1988 Newcastle Disease Virus GRP78 Gene A23187 Resendez et al., 1988 -2-Macroglobulin IL-6 Kunz et al., 1989 Vimentin Serum Rittling et al., 1989 MHC Class I Gene Interferon Blanar et al., 1989 H-2b HSP70 ElA, SV40 Large Taylor et al., 1989, 1990a, T Antigen 1990b Proliferin Phorbol Ester-TPA Mordacq and Linzer, 1989 Tumor Necrosis PMA Hensel et al., 1989 Factor Thyroid Thyroid Hormone Chatterjee et al., 1989 Stimulating Hormone Gene
[0130] Of particular interest are muscle specific promoters. These include the myosin light chain-2 promoter (Franz et al., 1994; Kelly et al., 1995), the muscle creatine kinase enhancer (Jaynes et al., 1988; Horlick et al., 1989; Johnson et al., 1989), the -actin promoter (Moss et al., 1996), the troponin 1 promoter (Bhaysar et al., 1996); the Na.sup.+/Ca.sup.2+ exchanger promoter (Barnes et al., 1997), the dystrophin promoter (Kimura et al., 1997), the 7 integrin promoter (Ziober and Kramer, 1996), the brain natriuretic peptide promoter (LaPointe et al., 1996) and the B-crystallin/small heat shock protein promoter (Gopal-Srivastava, 1995), -myosin heavy chain promoter (Yamauchi-Takihara et al., 1989) and the ANF promoter (LaPointe et al., 1988).
[0131] Where a cDNA insert is employed, one will typically desire to include a polyadenylation signal to effect proper polyadenylation of the gene transcript. The nature of the polyadenylation signal is not believed to be crucial to the successful practice of the invention, and any such sequence may be employed such as human growth hormone and SV40 polyadenylation signals. Also contemplated as an element of the expression cassette is a terminator. These elements can serve to enhance message levels and to minimize read through from the cassette into other sequences.
[0132] B. 2A Protease
[0133] In some embodiments, a 2A-like self-cleaving domain from the insect virus Thosea asigna (TaV 2A peptide) (Chang et al., 2009) is used. These 2A-like domains have been shown to function across eukaryotes and cause cleavage of amino acids to occur co-translationally within the 2A-like peptide domain. Therefore, inclusion of TaV 2A peptide allows the expression of multiple proteins from a single mRNA transcript. Importantly, the domain of TaV when tested in eukaryotic systems have shown greater than 99% cleavage activity (Donnelly et al., 2001).
[0134] C. Delivery of Expression Vectors
[0135] There are a number of ways in which expression vectors may introduced into cells. In certain embodiments of the invention, the expression construct comprises a virus or engineered construct derived from a viral genome. The ability of certain viruses to enter cells via receptor-mediated endocytosis, to integrate into host cell genome and express viral genes stably and efficiently have made them attractive candidates for the transfer of foreign genes into mammalian cells (Ridgeway, 1988; Nicolas and Rubenstein, 1988; Baichwal and Sugden, 1986; Temin, 1986). The first viruses used as gene vectors were DNA viruses including the papovaviruses (simian virus 40, bovine papilloma virus, and polyoma) (Ridgeway, 1988; Baichwal and Sugden, 1986) and adenoviruses (Ridgeway, 1988; Baichwal and Sugden, 1986). These have a relatively low capacity for foreign DNA sequences and have a restricted host spectrum. Furthermore, their oncogenic potential and cytopathic effects in permissive cells raise safety concerns. They can accommodate only up to 8 kB of foreign genetic material but can be readily introduced in a variety of cell lines and laboratory animals (Nicolas and Rubenstein, 1988; Temin, 1986).
[0136] One of the preferred methods for in vivo delivery involves the use of an adenovirus expression vector. Adenovirus expression vector is meant to include those constructs containing adenovirus sequences sufficient to (a) support packaging of the construct and (b) to express an antisense polynucleotide that has been cloned therein. In this context, expression does not require that the gene product be synthesized.
[0137] The expression vector comprises a genetically engineered form of adenovirus. Knowledge of the genetic organization of adenovirus, a 36 kB, linear, double-stranded DNA virus, allows substitution of large pieces of adenoviral DNA with foreign sequences up to 7 kB (Grunhaus and Horwitz, 1992). In contrast to retrovirus, the adenoviral infection of host cells does not result in chromosomal integration because adenoviral DNA can replicate in an episomal manner without potential genotoxicity. Also, adenoviruses are structurally stable, and no genome rearrangement has been detected after extensive amplification. Adenovirus can infect virtually all epithelial cells regardless of their cell cycle stage. So far, adenoviral infection appears to be linked only to mild disease such as acute respiratory disease in humans.
[0138] Adenovirus is particularly suitable for use as a gene transfer vector because of its mid-sized genome, ease of manipulation, high titer, wide target cell range and high infectivity. Both ends of the viral genome contain 100-200 base pair inverted repeats (ITRs), which are cis elements necessary for viral DNA replication and packaging. The early (E) and late (L) regions of the genome contain different transcription units that are divided by the onset of viral DNA replication. The E1 region (E1A and E1B) encodes proteins responsible for the regulation of transcription of the viral genome and a few cellular genes. The expression of the E2 region (E2A and E2B) results in the synthesis of the proteins for viral DNA replication. These proteins are involved in DNA replication, late gene expression and host cell shut-off (Renan, 1990). The products of the late genes, including the majority of the viral capsid proteins, are expressed only after significant processing of a single primary transcript issued by the major late promoter (MLP). The MLP, (located at 16.8 m.u.) is particularly efficient during the late phase of infection, and all the mRNAs issued from this promoter possess a 5-tripartite leader (TPL) sequence which makes them preferred mRNA's for translation.
[0139] In one system, recombinant adenovirus is generated from homologous recombination between shuttle vector and provirus vector. Due to the possible recombination between two proviral vectors, wild-type adenovirus may be generated from this process. Therefore, it is critical to isolate a single clone of virus from an individual plaque and examine its genomic structure.
[0140] Generation and propagation of the current adenovirus vectors, which are replication deficient, depend on a unique helper cell line, designated 293, which was transformed from human embryonic kidney cells by Ad5 DNA fragments and constitutively expresses E1 proteins (Graham et al., 1977). Since the E3 region is dispensable from the adenovirus genome (Jones and Shenk, 1978), the current adenovirus vectors, with the help of 293 cells, carry foreign DNA in either the E1, the D3 or both regions (Graham and Prevec, 1991). In nature, adenovirus can package approximately 105% of the wild-type genome (Ghosh-Choudhury et al., 1987), providing capacity for about 2 extra kb of DNA. Combined with the approximately 5.5 kb of DNA that is replaceable in the E1 and E3 regions, the maximum capacity of the current adenovirus vector is under 7.5 kb, or about 15% of the total length of the vector. More than 80% of the adenovirus viral genome remains in the vector backbone and is the source of vector-borne cytotoxicity. Also, the replication deficiency of the E1-deleted virus is incomplete.
[0141] Helper cell lines may be derived from human cells such as human embryonic kidney cells, muscle cells, hematopoietic cells or other human embryonic mesenchymal or epithelial cells. Alternatively, the helper cells may be derived from the cells of other mammalian species that are permissive for human adenovirus. Such cells include, e.g., Vero cells or other monkey embryonic mesenchymal or epithelial cells. As stated above, the preferred helper cell line is 293.
[0142] Racher et al. (1995) disclosed improved methods for culturing 293 cells and propagating adenovirus. In one format, natural cell aggregates are grown by inoculating individual cells into 1 liter siliconized spinner flasks (Techne, Cambridge, UK) containing 100-200 ml of medium. Following stirring at 40 rpm, the cell viability is estimated with trypan blue. In another format, Fibra-Cel microcarriers (Bibby Sterlin, Stone, UK) (5 g/l) is employed as follows. A cell inoculum, resuspended in 5 ml of medium, is added to the carrier (50 ml) in a 250 ml Erlenmeyer flask and left stationary, with occasional agitation, for 1 to 4 h. The medium is then replaced with 50 ml of fresh medium and shaking initiated. For virus production, cells are allowed to grow to about 80% confluence, after which time the medium is replaced (to 25% of the final volume) and adenovirus added at an MOI of 0.05. Cultures are left stationary overnight, following which the volume is increased to 100% and shaking commenced for another 72 h.
[0143] Other than the requirement that the adenovirus vector be replication defective, or at least conditionally defective, the nature of the adenovirus vector is not believed to be crucial to the successful practice of the invention. The adenovirus may be of any of the 42 different known serotypes or subgroups A-F. Adenovirus type 5 of subgroup C is the preferred starting material in order to obtain the conditional replication-defective adenovirus vector for use in the present invention. This is because Adenovirus type 5 is a human adenovirus about which a great deal of biochemical and genetic information is known, and it has historically been used for most constructions employing adenovirus as a vector.
[0144] As stated above, the typical vector according to the present invention is replication defective and will not have an adenovirus E1 region. Thus, it will be most convenient to introduce the polynucleotide encoding the gene of interest at the position from which the E1-coding sequences have been removed. However, the position of insertion of the construct within the adenovirus sequences is not critical to the invention. The polynucleotide encoding the gene of interest may also be inserted in lieu of the deleted E3 region in E3 replacement vectors, as described by Karlsson et al. (1986), or in the E4 region where a helper cell line or helper virus complements the E4 defect.
[0145] Adenovirus is easy to grow and manipulate and exhibits broad host range in vitro and in vivo. This group of viruses can be obtained in high titers, e.g., 10.sup.9-10.sup.12 plaque-forming units per ml, and they are highly infective. The life cycle of adenovirus does not require integration into the host cell genome. The foreign genes delivered by adenovirus vectors are episomal and, therefore, have low genotoxicity to host cells. No side effects have been reported in studies of vaccination with wild-type adenovirus (Couch et al., 1963; Top et al., 1971), demonstrating their safety and therapeutic potential as in vivo gene transfer vectors.
[0146] Adenovirus vectors have been used in eukaryotic gene expression (Levrero et al., 1991; Gomez-Foix et al., 1992) and vaccine development (Grunhaus and Horwitz, 1992; Graham and Prevec, 1991). Animal studies suggested that recombinant adenovirus could be used for gene therapy (Stratford-Perricaudet and Perricaudet, 1991; Stratford-Perricaudet et al., 1990; Rich et al., 1993). Studies in administering recombinant adenovirus to different tissues include trachea instillation (Rosenfeld et al., 1991; Rosenfeld et al., 1992), muscle injection (Ragot et al., 1993), peripheral intravenous injections (Herz and Gerard, 1993) and stereotactic inoculation into the brain (Le Gal La Salle et al., 1993).
[0147] The retroviruses are a group of single-stranded RNA viruses characterized by an ability to convert their RNA to double-stranded DNA in infected cells by a process of reverse-transcription (Coffin, 1990). The resulting DNA then stably integrates into cellular chromosomes as a provirus and directs synthesis of viral proteins. The integration results in the retention of the viral gene sequences in the recipient cell and its descendants. The retroviral genome contains three genes, gag, pol, and env that code for capsid proteins, polymerase enzyme, and envelope components, respectively. A sequence found upstream from the gag gene contains a signal for packaging of the genome into virions. Two long terminal repeat (LTR) sequences are present at the 5 and 3 ends of the viral genome. These contain strong promoter and enhancer sequences and are also required for integration in the host cell genome (Coffin, 1990).
[0148] In order to construct a retroviral vector, a nucleic acid encoding a gene of interest is inserted into the viral genome in the place of certain viral sequences to produce a virus that is replication-defective. In order to produce virions, a packaging cell line containing the gag, pol, and env genes but without the LTR and packaging components is constructed (Mann et al., 1983). When a recombinant plasmid containing a cDNA, together with the retroviral LTR and packaging sequences is introduced into this cell line (by calcium phosphate precipitation for example), the packaging sequence allows the RNA transcript of the recombinant plasmid to be packaged into viral particles, which are then secreted into the culture media (Nicolas and Rubenstein, 1988; Temin, 1986; Mann et al., 1983). The media containing the recombinant retroviruses is then collected, optionally concentrated, and used for gene transfer. Retroviral vectors are able to infect a broad variety of cell types. However, integration and stable expression require the division of host cells (Paskind et al., 1975).
[0149] A novel approach designed to allow specific targeting of retrovirus vectors was recently developed based on the chemical modification of a retrovirus by the chemical addition of lactose residues to the viral envelope. This modification could permit the specific infection of hepatocytes via sialoglycoprotein receptors.
[0150] A different approach to targeting of recombinant retroviruses was designed in which biotinylated antibodies against a retroviral envelope protein and against a specific cell receptor were used. The antibodies were coupled via the biotin components by using streptavidin (Roux et al., 1989). Using antibodies against major histocompatibility complex class I and class II antigens, they demonstrated the infection of a variety of human cells that bore those surface antigens with an ecotropic virus in vitro (Roux et al., 1989).
[0151] There are certain limitations to the use of retrovirus vectors in all aspects of the present invention. For example, retrovirus vectors usually integrate into random sites in the cell genome. This can lead to insertional mutagenesis through the interruption of host genes or through the insertion of viral regulatory sequences that can interfere with the function of flanking genes (Varmus et al., 1981). Another concern with the use of defective retrovirus vectors is the potential appearance of wild-type replication-competent virus in the packaging cells. This can result from recombination events in which the intact sequence from the recombinant virus inserts upstream from the gag, pol, env sequence integrated in the host cell genome. However, new packaging cell lines are now available that should greatly decrease the likelihood of recombination (Markowitz et al., 1988; Hersdorffer et al., 1990).
[0152] Other viral vectors may be employed as expression constructs in the present invention. Vectors derived from viruses such as vaccinia virus (Ridgeway, 1988; Baichwal and Sugden, 1986; Coupar et al., 1988) adeno-associated virus (AAV) (Ridgeway, 1988; Baichwal and Sugden, 1986; Hermonat and Muzycska, 1984) and herpesviruses may be employed. They offer several attractive features for various mammalian cells (Friedmann, 1989; Ridgeway, 1988; Baichwal and Sugden, 1986; Coupar et al., 1988; Horwich et al., 1990).
[0153] In order to effect expression of sense or antisense gene constructs, the expression construct must be delivered into a cell. This delivery may be accomplished in vitro, as in laboratory procedures for transforming cells lines, or in vivo or ex vivo, as in the treatment of certain disease states. One mechanism for delivery is via viral infection where the expression construct is encapsidated in an infectious viral particle.
[0154] Several non-viral methods for the transfer of expression constructs into cultured mammalian cells also are contemplated by the present invention. These include calcium phosphate precipitation (Graham and Van Der Eb, 1973; Chen and Okayama, 1987; Rippe et al., 1990) DEAE-dextran (Gopal, 1985), electroporation (Tur-Kaspa et al., 1986; Potter et al., 1984), direct microinjection (Harland and Weintraub, 1985), DNA-loaded liposomes (Nicolau and Sene, 1982; Fraley et al., 1979) and lipofectamine-DNA complexes, cell sonication (Fechheimer et al., 1987), gene bombardment using high velocity microprojectiles (Yang et al., 1990), and receptor-mediated transfection (Wu and Wu, 1987; Wu and Wu, 1988). Some of these techniques may be successfully adapted for in vivo or ex vivo use.
[0155] Once the expression construct has been delivered into the cell the nucleic acid encoding the gene of interest may be positioned and expressed at different sites. In certain embodiments, the nucleic acid encoding the gene may be stably integrated into the genome of the cell. This integration may be in the cognate location and orientation via homologous recombination (gene replacement) or it may be integrated in a random, non-specific location (gene augmentation). In yet further embodiments, the nucleic acid may be stably maintained in the cell as a separate, episomal segment of DNA. Such nucleic acid segments or episomes encode sequences sufficient to permit maintenance and replication independent of or in synchronization with the host cell cycle. How the expression construct is delivered to a cell and where in the cell the nucleic acid remains is dependent on the type of expression construct employed.
[0156] In yet another embodiment of the invention, the expression construct may simply consist of naked recombinant DNA or plasmids. Transfer of the construct may be performed by any of the methods mentioned above which physically or chemically permeabilize the cell membrane. This is particularly applicable for transfer in vitro but it may be applied to in vivo use as well. Dubensky et al. (1984) successfully injected polyomavirus DNA in the form of calcium phosphate precipitates into liver and spleen of adult and newborn mice demonstrating active viral replication and acute infection. Benvenisty and Neshif (1986) also demonstrated that direct intraperitoneal injection of calcium phosphate-precipitated plasmids results in expression of the transfected genes. It is envisioned that DNA encoding a gene of interest may also be transferred in a similar manner in vivo and express the gene product.
[0157] In still another embodiment of the invention for transferring a naked DNA expression construct into cells may involve particle bombardment. This method depends on the ability to accelerate DNA-coated microprojectiles to a high velocity allowing them to pierce cell membranes and enter cells without killing them (Klein et al., 1987). Several devices for accelerating small particles have been developed. One such device relies on a high voltage discharge to generate an electrical current, which in turn provides the motive force (Yang et al., 1990). The microprojectiles used have consisted of biologically inert substances such as tungsten or gold beads.
[0158] Selected organs including the liver, skin, and muscle tissue of rats and mice have been bombarded in vivo (Yang et al., 1990; Zelenin et al., 1991). This may require surgical exposure of the tissue or cells, to eliminate any intervening tissue between the gun and the target organ, i.e., ex vivo treatment. Again, DNA encoding a particular gene may be delivered via this method and still be incorporated by the present invention.
[0159] In a further embodiment of the invention, the expression construct may be entrapped in a liposome. Liposomes are vesicular structures characterized by a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers (Ghosh and Bachhawat, 1991). Also contemplated are lipofectamine-DNA complexes.
[0160] Liposome-mediated nucleic acid delivery and expression of foreign DNA in vitro has been very successful. Wong et al., (1980) demonstrated the feasibility of liposome-mediated delivery and expression of foreign DNA in cultured chick embryo, HeLa and hepatoma cells. Nicolau et al., (1987) accomplished successful liposome-mediated gene transfer in rats after intravenous injection. A reagent known as Lipofectamine 2000 is widely used and commercially available.
[0161] In certain embodiments of the invention, the liposome may be complexed with a hemagglutinating virus (HVJ). This has been shown to facilitate fusion with the cell membrane and promote cell entry of liposome-encapsulated DNA (Kaneda et al., 1989). In other embodiments, the liposome may be complexed or employed in conjunction with nuclear non-histone chromosomal proteins (HMG-1) (Kato et al., 1991). In yet further embodiments, the liposome may be complexed or employed in conjunction with both HVJ and HMG-1. In that such expression constructs have been successfully employed in transfer and expression of nucleic acid in vitro and in vivo, then they are applicable for the present invention. Where a bacterial promoter is employed in the DNA construct, it also will be desirable to include within the liposome an appropriate bacterial polymerase.
[0162] Other expression constructs which can be employed to deliver a nucleic acid encoding a particular gene into cells are receptor-mediated delivery vehicles. These take advantage of the selective uptake of macromolecules by receptor-mediated endocytosis in almost all eukaryotic cells. Because of the cell type-specific distribution of various receptors, the delivery can be highly specific (Wu and Wu, 1993).
[0163] Receptor-mediated gene targeting vehicles generally consist of two components: a cell receptor-specific ligand and a DNA-binding agent. Several ligands have been used for receptor-mediated gene transfer. The most extensively characterized ligands are asialoorosomucoid (ASOR) (Wu and Wu, 1987) and transferrin (Wagner et al., 1990). A synthetic neoglycoprotein, which recognizes the same receptor as ASOR, has been used as a gene delivery vehicle (Ferkol et al., 1993; Perales et al., 1994) and epidermal growth factor (EGF) has also been used to deliver genes to squamous carcinoma cells (Myers, EP 0273085).
IV. METHODS OF MAKING TRANSGENIC MICE
[0164] A particular embodiment of the present invention provides transgenic animals that contain mutations in the dystrophin gene. Also, transgenic animals may express a marker that reflects the production of mutant or normal dystrophin gene product.
[0165] In a general aspect, a transgenic animal is produced by the integration of a given construct into the genome in a manner that permits the expression of the transgene using methods discussed above. Methods for producing transgenic animals are generally described by Wagner and Hoppe (U.S. Pat. No. 4,873,191; incorporated herein by reference), and Brinster et al. (1985; incorporated herein by reference).
[0166] Typically, the construct is transferred by microinjection into a fertilized egg. The microinjected eggs are implanted into a host female, and the progeny are screened for the expression of the transgene. Transgenic animals may be produced from the fertilized eggs from a number of animals including, but not limited to reptiles, amphibians, birds, mammals, and fish.
[0167] RNA for microinjection can be prepared by any means known in the art. For example, RNA for microinjection can be cleaved with enzymes appropriate for removing the bacterial plasmid sequences, and the RNA fragments electrophoresed on 1% agarose gels in TBE buffer, using standard techniques. The RNA bands are visualized by staining with ethidium bromide, and the band containing the expression sequences is excised. The excised band is then placed in dialysis bags containing 0.3 M sodium acetate, pH 7.0. RNA is electroeluted into the dialysis bags, extracted with a 1:1 phenol:chloroform solution and precipitated by two volumes of ethanol. The RNA is redissolved in 1 ml of low salt buffer (0.2 M NaCl, 20 mM Tris, pH 7.4, and 1 mM EDTA) and purified on an Elutip-D column. The column is first primed with 3 ml of high salt buffer (1 M NaCl, 20 mM Tris, pH 7.4, and 1 mM EDTA) followed by washing with 5 ml of low salt buffer. The DNA solutions are passed through the column three times to bind RNA to the column matrix. After one wash with 3 ml of low salt buffer, the RNA is eluted with 0.4 ml high salt buffer and precipitated by two volumes of ethanol. RNA concentrations are measured by absorption at 260 nm in a UV spectrophotometer. For microinjection, DNA concentrations are adjusted to 3 g/ml in 5 mM Tris, pH 7.4 and 0.1 mM EDTA. Other methods for purification of RNA for microinjection are described in Palmiter et al. (1982a,b); and in Sambrook and Russell (2001).
[0168] In an exemplary microinjection procedure, female mice six weeks of age are induced to superovulate with a 5 IU injection (0.1 cc, ip) of pregnant mare serum gonadotropin (PMSG; Sigma) followed 48 hours later by a 5 IU injection (0.1 cc, ip) of human chorionic gonadotropin (hCG; Sigma). Females are placed with males immediately after hCG injection. Twenty-one hours after hCG injection, the mated females are sacrificed by CO.sub.2 asphyxiation or cervical dislocation and embryos are recovered from excised oviducts and placed in Dulbecco's phosphate buffered saline with 0.5% bovine serum albumin (BSA; Sigma). Surrounding cumulus cells are removed with hyaluronidase (1 mg/ml). Pronuclear embryos are then washed and placed in Earle's balanced salt solution containing 0.5% BSA (EBSS) in a 37.5 C. incubator with a humidified atmosphere at 5% CO.sub.2, 95% air until the time of injection. Embryos can be implanted at the two-cell stage.
[0169] Randomly cycling adult female mice are paired with vasectomized males. C57BL/6 or Swiss mice or other comparable strains can be used for this purpose. Recipient females are mated at the same time as donor females. At the time of embryo transfer, the recipient females are anesthetized with an intraperitoneal injection of 0.015 ml of 2.5% avertin per gram of body weight. The oviducts are exposed by a single midline dorsal incision. An incision is then made through the body wall directly over the oviduct. The ovarian bursa is then torn with watchmakers forceps. Embryos to be transferred are placed in DPBS (Dulbecco's phosphate buffered saline) and in the tip of a transfer pipet (about 10 to 12 embryos). The pipet tip is inserted into the infundibulum and the embryos transferred. After the transfer, the incision is closed by two sutures.
V. PHARMACEUTICAL COMPOSITIONS AND DELIVERY METHODS
[0170] Where clinical applications are contemplated, pharmaceutical compositions will be prepared in a form appropriate for the intended application. Generally, this will entail preparing compositions that are essentially free of pyrogens, as well as other impurities that could be harmful to humans or animals.
[0171] One will generally desire to employ appropriate salts and buffers to render drugs, proteins or delivery vectors stable and allow for uptake by target cells. Aqueous compositions of the present invention comprise an effective amount of the drug, vector or proteins, dissolved or dispersed in a pharmaceutically acceptable carrier or aqueous medium. The phrase pharmaceutically or pharmacologically acceptable refer to molecular entities and compositions that do not produce adverse, allergic, or other untoward reactions when administered to an animal or a human. As used herein, pharmaceutically acceptable carrier includes solvents, buffers, solutions, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like acceptable for use in formulating pharmaceuticals, such as pharmaceuticals suitable for administration to humans. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredients of the present invention, its use in therapeutic compositions is contemplated. Supplementary active ingredients also can be incorporated into the compositions, provided they do not inactivate the vectors or cells of the compositions.
[0172] The active compositions of the present invention may include classic pharmaceutical preparations. Administration of these compositions according to the present invention may be via any common route so long as the target tissue is available via that route, but generally including systemic administration. This includes oral, nasal, or buccal. Alternatively, administration may be by intradermal, subcutaneous, intramuscular, intraperitoneal or intravenous injection, or by direct injection into muscle tissue. Such compositions would normally be administered as pharmaceutically acceptable compositions, as described supra.
[0173] The active compounds may also be administered parenterally or intraperitoneally. By way of illustration, solutions of the active compounds as free base or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations generally contain a preservative to prevent the growth of microorganisms.
[0174] The pharmaceutical forms suitable for injectable use include, for example, sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. Generally, these preparations are sterile and fluid to the extent that easy injectability exists. Preparations should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms, such as bacteria and fungi. Appropriate solvents or dispersion media may contain, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
[0175] Sterile injectable solutions may be prepared by incorporating the active compounds in an appropriate amount into a solvent along with any other ingredients (for example as enumerated above) as desired, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the desired other ingredients, e.g., as enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation include vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient(s) plus any additional desired ingredient from a previously sterile-filtered solution thereof.
[0176] The compositions of the present invention generally may be formulated in a neutral or salt form. Pharmaceutically-acceptable salts include, for example, acid addition salts (formed with the free amino groups of the protein) derived from inorganic acids (e.g., hydrochloric or phosphoric acids, or from organic acids (e.g., acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups of the protein can also be derived from inorganic bases (e.g., sodium, potassium, ammonium, calcium, or ferric hydroxides) or from organic bases (e.g., isopropylamine, trimethylamine, histidine, procaine and the like.
[0177] Upon formulation, solutions are preferably administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The formulations may easily be administered in a variety of dosage forms such as injectable solutions, drug release capsules and the like. For parenteral administration in an aqueous solution, for example, the solution generally is suitably buffered and the liquid diluent first rendered isotonic for example with sufficient saline or glucose. Such aqueous solutions may be used, for example, for intravenous, intramuscular, subcutaneous and intraperitoneal administration. Preferably, sterile aqueous media are employed as is known to those of skill in the art, particularly in light of the present disclosure. By way of illustration, a single dose may be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example, Remington's Pharmaceutical Sciences 15th Edition, pages 1035-1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject. Moreover, for human administration, preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of Biologics standards.
VI. SEQUENCE TABLES
[0178]
TABLE-US-00006 TABLE1 SequenceofprimersforsgRNAtargetingDMD andDmdexon45splicingacceptorsite SEQ ID ID Sequence(5-3) NO. Ex45-gRNA#3-Top CACCGCGCTGCCCAATGCCATCCTG 1 Ex45-gRNA#3-Bot AAACCAGGATGGCATTGGGCAGCGC 2 Ex45-gRNA#4-Top CACCGCTTACAGGAACTCCAGGA 3 Ex45-gRNA#4-Bot AAACTCCTGGAGTTCCTGTAAGC 4 Ex45-gRNA#5-Top CACCGAGGAACTCCAGGATGGCATT 5 Ex45-gRNA#5-Bot AAACAATGCCATCCTGGAGTTCCTC 6 Ex45-gRNA#6-Top CACCGCGCTGCCCAATGCCATCC 7 Ex45-gRNA#6-Bot AAACGGATGGCATTGGGCAGCGC 8 mDmd-T7E1-Ex45-F CTAACATAAAAGGTGTCTTTCTATC 9 mDmd-T7E1-Ex45-R GGCAATCCCTCATGATTTTTAGCAC 10 DMD-T7E1-Ex45-F GTCTTTCTGTCTTGTATCCTTTGG 11 DMD-T7E1-Ex45-R AATGTTAGTGCCTTTCACCC 12
TABLE-US-00007 TABLE2 SequenceofprimersforsgRNAtargetingDmd exon44togeneratethemousemodel SEQ Mouse NO. ID Model Sequence(5-3) ID mDmd-In44-2-Top ex44 CACCGGTAGTTCTGAATCAG 13 GAGGA mDmd-In44-2-Bot ex44 AAACTCCTCCTGATTCAGAA 14 CTACC mDmd-In44-6-Top ex44 CACCGTATGTTGGAACCAGT 15 CCAGA mDmd-In44-6-Bot ex44 AAACTCTGGACTGGTTCCAA 16 CATAC
TABLE-US-00008 TABLE3 Sequenceofprimersforinvitrotranscription ofsgRNA SEQ Mouse ID ID Model Sequence(5-3) NO exon44_T7-In44-2-F ex44 GAATTGTAATACGACTC 17 ACTATAGGGGTAGTTCT GAATCAGGAGGA exon44_T7-In44-6-F ex44 GAATTGTAATACGACTC 18 ACTATAGGGTATGTTGG AACCAGTCCAGA exon44_T7-Rv ex44 AAAAGCACCGACTCGGT 19 GCCAC
TABLE-US-00009 TABLE4 Sequenceofprimersforgenotyping SEQ Mouse ID ID Model Sequence(5-3) NO. Geno44-F ex44 GCTGAGGGGGAGACAGTAGA 20 Geno44-R ex44 TCAGAAGGCATTTTGTCAAT 21
TABLE-US-00010 TABLE5 gRNAgenomictargetsequences SEQ ID sgRNAID Sequence(5-3) NO. Ex45-gRNA#3 CGCTGCCCAATGCCATCCTG 39 Ex45-gRNA#4 ATCTTACAGGAACTCCAGGA 40 Ex45-gRNA#5 AGGAACTCCAGGATGGCATT 41 Ex45-gRNA#6 CGCTGCCCAATGCCATCC 42 Ex43-gRNA#1 GTTTTAAAATTTTTATATTA 43 Ex43-gRNA#2 TTTTATATTACAGAATATAA 44 Ex43-gRNA#4 TATGTGTTACCTACCCTTGT 45 Ex43-gRNA#6 GTACAAGGACCGACAAGGGT 46
TABLE-US-00011 TABLE6 gRNAsequences SEQ ID sgRNAID Sequence(5-3) NO. Ex45-gRNA#3 CAGGAUGGCAUUGGGCAGCG 47 Ex45-gRNA#4 UCCUGGAGUUCCUGUAAGAU 48 Ex45-gRNA#5 AAUGCCAUCCUGGAGUUCCU 49 Ex45-gRNA#6 GGAUGGCAUUGGGCAGCG 50 Ex43-gRNA#1 UAAUAUAAAAAUUUUAAAAC 51 Ex43-gRNA#2 UUAUAUUCUGUAAUAUAAAA 52 Ex43-gRNA#4 ACAAGGGUAGGUAACACAUA 53 Ex43-gRNA#6 ACCCUUGUCGGUCCUUGUAC 54
VII. EXAMPLES
[0179] The following examples are included to demonstrate preferred embodiments of the disclosure. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques which function well in the practice of the disclosure, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the disclosure.
Example 1Materials and Methods
[0180] Study Approval.
[0181] All experimental procedures involving animals in this study were reviewed and approved by the University of Texas Southwestern Medical Center's Institutional Animal Care and Use Committee.
[0182] Plasmids.
[0183] The pSpCas9(BB)-2A-GFP (PX458) plasmid containing the human codon optimized SpCas9 gene with 2A-EGFP and the backbone of sgRNA was purchased from Addgene (Plasmid #48138). Cloning of sgRNA was done using Bbs I sites. The AAV TRISPR-CK8-GFP plasmid containing three sgRNAs driven by U6, H1 or 7SK promoter and GFP driven by CK8 promoter.
[0184] Human iPSCs Maintenance and Nucleofection.
[0185] Human iPSCs were cultured in mTeSR1 media (STEMCELL Technologies) and passaged approximately every 4 days (1:18 split ratio). One hour before nucleofection, iPSCs were treated with 10 M ROCK inhibitor (Y-27632) and dissociated into single cells using Accutase (Innovative Cell Technologies, Inc.). 110.sup.6 iPS cells were mixed with 5 g of pLbCpf1-2A-GFP or pAsCpf1-2A-GFP plasmid and nucleofected using the P3 Primary Cell 4D-Nucleofector X kit (Lonza) according to manufacturer's protocol. After nucleofection, iPSCs were cultured in mTeSR 1 media supplemented with 10 M ROCK inhibitor, penicillin-streptomycin (1:100) (ThermoFisher Scientific) and 100 g/ml Primosin (InvivoGen). Three days post-nucleofection, GFP(+) and () cells were sorted by FACS and subjected to T7E1 assay. Single clones derived from GFP(+) iPSCs were picked and sequenced.
[0186] Genomic DNA Isolation.
[0187] Genomic DNA of mouse 10T1/2 fibroblasts, mouse C2C12, human 293 and human iPSCs was isolated using DirectPCR (cell) lysis reagent (VIAGEN) according to manufacturer's protocol.
[0188] PCR Amplification of Genomic DNA.
[0189] Genomic DNA was PCR-amplified using GoTaq DNA polymerase (Promega) with primers. PCR products were gel purified and subcloned into pCRII-TOPO vector (Invitrogen) according to the manufacturer's protocol. Individual clones were picked and the DNA was sequenced. Primer sequences are listed in supplemental material.
[0190] T7E1 Analysis of PCR Products.
[0191] Mismatched duplex DNA was obtained by denaturing/renaturing of 25 l of the genomic PCR product using the following conditions: 95 C. for 5 mins, 95 C. to 85 C. (2.0 C./seconds), 85 C. to 25 C. (0.1 C./seconds), hold at 4 C. Then 25 l of the mismatched duplex DNA was incubated with 2.7 l of 10NEB buffer 2 and 0.3 l of T7E1 (New England BioLabs) at 37 C. for 90 minutes. The T7E1 digested PCR product was analyzed by 2% agarose gel electrophoresis.
[0192] Human Cardiomyocyte Differentiation.
[0193] Human iPSCs were cultured in mTeSR1 media for 3 days until they reached 90% confluence. To differentiate the iPSCs to cardiomyocytes, the iPSCs were cultured in CDM3-C media for 2 days, followed by CDM3-59 media for 2 days, followed by CDM3 media for 6 days, followed by selective media for 10 days and lastly by basal media for 2 days. Then, the cardiomyocytes were dissociated using TrypLE media and re-plated at 210.sup.6 per well in a 6-well dish. Differentiation medium recipe can be found in supplemental materials.
[0194] Dystrophin Western Blot Analysis.
[0195] After 30 days post-differentiation, 210.sup.6 cardiomyocytes were harvested and lysed with lysis buffer (10% SDS, 62.5 mM Tris pH=6.8, 1 mM EDTA, and protease inhibitor). Cell lysates were passed through a 22 G syringe and then a 27 G syringe, 10 times each. Protein concentration was determined by BCA assay and 50 ug of total protein was loaded onto an acrylamide gel. After running at 100V (20 mA) for 5 hours and followed by 1 hour 20 min transfer to PVDF membrane at 35V (200 mA) at 4 C. The blot was incubated with mouse anti-dystrophin antibody (MANDYS8, Sigma-Aldrich, D8168) at 4 C. overnight and with goat anti-mouse HRP antibody (Bio-Rad Laboratories) at RT for 1 hour. The blot was developed using Western Blotting Luminol Reagent (Santa Cruz, sc-2048). The loading control was determined by blotting with mouse anti-vinculin antibody (Sigma-Aldrich, V9131).
[0196] CRISPR/Cas9-Mediated Exon 44 Deletion in Mice.
[0197] Two single-guide RNA (sgRNA) specific intronic regions surrounding exon 44 sequence of the mouse Dmd locus were cloned into vector PX458 using the primers from Table 1. For the in vitro transcription of sgRNA, T7 promoter sequence was added to the sgRNA template by PCR using the primers from Table 2. The gel purified PCR products were used as template for in vitro transcription using the MEGAshortscript T7 Kit (Life Technologies). sgRNA were purified by MEGAclear kit (Life Technologies) and eluted with nuclease-free water (Ambion). The concentration of guide RNA was measured by a NanoDrop instrument (Thermo Scientific).
[0198] Genotyping of Ex44 Mice.
[0199] Ex44 mice were genotyped using primers encompassing the targeted region from Table 3. Tail biopsies were digested in 100 L of 25 mM NaOH, 0.2 mM EDTA (pH 12) for 20 min at 95 C. Tails were briefly centrifuged followed by addition of 100 L of 40 mM Tris.HCl (pH 5) and mixed to homogenize. Two microliters of this reaction was used for subsequent PCR reactions with the primers below, followed by gel electrophoresis.
[0200] Histological Analysis of Muscles.
[0201] Skeletal muscles from WT and Ex44 mice were individually dissected and cryoembedded in a 1:2 volume mixture of Gum Tragacanth powder (Sigma-Aldrich) to Tissue Freezing Medium (TFM) (Triangle Bioscience). All embeds were snap frozen in isopentane heat extractant supercooled to 155 C. Resulting blocks were stored overnight at 80 C. prior to sectioning. Eight-micron transverse sections of skeletal muscle, and frontal sections of heart were prepared on a Leica CM3050 cryostat and air-dried prior to same day staining. H&E staining was performed according to established staining protocols and dystrophin immunohistochemistry was performed using MANDYS8 monoclonal antibody (Sigma-Aldrich) with modifications to manufacturer's instructions. In brief, cryostat sections were thawed and rehydrated/delipidated in 1% triton/phosphate-buffered-saline, pH 7.4 (PBS). Following delipidation, sections were washed free of Triton, incubated with mouse IgG blocking reagent (M.O.M. Kit, Vector Laboratories), washed, and sequentially equilibrated with MOM protein concentrate/PBS, and MANDYS8 diluted 1:1800 in MOM protein concentrate/PBS. Following overnight primary antibody incubation at 4 C., sections were washed, incubated with MOM biotinylated anti-mouse IgG, washed, and detection completed with incubation of Vector fluorescein-avidin DCS. Nuclei were counterstained with propidium iodide (Molecular Probes) prior to cover slipping with Vectashield.
Example 2Results
[0202] Exon 44 Deleted DMD Patient iPSC-Derived Cardiomyocytes Express Dystrophin after CRISPR Cas9 Mediated Genome Editing by Exon Skipping.
[0203] A common hot spot mutation region in DMD patients is the deletion of exon 44, which leads to skipping of exon 45 in approximately 12% of DMD patients. The DMD patient PBMC-derived iPSCs (TX11) used in this study have an exon 44 deletion, which introduces a premature termination codon within exon 45 and subsequently disrupts the open reading frame (ORF) of the DMD gene. To restore the ORF of the TX11 DMD patient iPSCs, a single guide RNA was used to disrupt the splicing acceptor of exon 45, which results in splicing of exons 43 to 46 and restoration of the protein reading frame (
[0204] The sgRNA3 (G3) was then tested on TX11 DMD patient iPSCs and observed genome cleavage at DMD exon 45 locus by T7E1 assay (
[0205] Exon 44 Deleted DMD Patient iPSC-Derived Cardiomyocytes Express Dystrophin after CRISPR/Cas9 Mediated Genome Editing by Exon Skipping.
[0206] iPSCs from DMD patients (TX11 and TX12) that have deletion of exon 44 were then generated by reprogramming PBMCs derived from the patients (
[0207] Humanized DMD Ex44 Mouse Model Recapitulates Muscle Dystrophy Phenotype.
[0208] To investigate CRISPR/Cas9-mediated exon 45 skipping in vivo, a mimic of the human hot spot region was generated in a mouse model by deleting the exon 44 using CRISPR/Cas9 system directed by 2 single guide RNAs (sgRNA) (
[0209] The deletion of Dmd exon 44 was confirmed by DNA genotyping (
[0210] Correction of DMD Exon 44 Deletion in Mice by Intramuscular AAV9 Delivery of Gene Editing Components.
[0211] To further assess the efficiency of the sgRNAs in vivo, exon 45 sgRNA3 (G3) and sgRNA4 (G4) were then cloned into AAV9-TRISPR-CK8 plasmid (
[0212] Systemic AAV9 Delivery of Gene Editing Components to 44 Mice Rescues Dystrophin Expression.
[0213] Rescue of the disease phenotype was then tested by intraperitoneal injection of AAV9-Cas9 and AAV9-exon45-sgRNA4 into 44 mice, which allowed for systemic distribution of the AAV9 vectors. 4 weeks after systemic delivery, the restoration of dystrophin protein expression in the TA, diaphragm, triceps, and cardiac muscles of 44 DMD mice was confirmed by Western blot analysis (
[0214] All of the compositions and/or methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this disclosure have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and/or methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the disclosure. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the disclosure as defined by the appended claims.
VIII. REFERENCES
[0215] The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference. [0216] Amoasii et al., Sci Transl Med. 9(418), 2017. [0217] Angel et al., Mol. Cell. Biol., 7:2256, 1987a. [0218] Angel et al., Cell, 49:729, 1987b. [0219] Baichwal and Sugden, In: Gene Transfer, Kucherlapati (Ed), NY, Plenum Press, 117-148, 1986. [0220] Banerji et al., Cell, 27(2 Pt 1):299-308, 1981. [0221] Banerji et al., Cell, 33(3):729-740, 1983. [0222] Barnes et al., J. Biol. Chem., 272(17):11510-7, 1997. [0223] Benvenisty and Neshif, Proc. Natl. Acad. Sci. USA, 83:9551-9555, 1986. [0224] Berkhout et al., Cell, 59:273-282, 1989. [0225] Bhaysar et al., Genomics, 35(1):11-23, 1996. [0226] Bikard et al., Nucleic Acids Res. 41(15): 7429-7437, 2013. [0227] Blanar et al., EMBO J., 8:1139, 1989. [0228] Bodine and Ley, EMBO J., 6:2997, 1987. [0229] Boshart et al., Cell, 41:521, 1985. [0230] Bosze et al., EMBO J., 5(7):1615-1623, 1986. [0231] Braddock et al., Cell, 58:269, 1989. [0232] Brinster et al., Proc. Natl. Acad. Sci. USA, 82(13):4438-442, 1985. [0233] Bulla and Siddiqui, J. Virol., 62:1437, 1986. [0234] Campbell and Villarreal, Mol. Cell. Biol., 8:1993, 1988. [0235] Campere and Tilghman, Genes and Dev., 3:537, 1989. [0236] Campo et al., Nature, 303:77, 1983. [0237] Celander and Haseltine, J. Virology, 61:269, 1987. [0238] Celander et al., J. Virology, 62:1314, 1988. [0239] Chandler et al., Cell, 33:489, 1983. [0240] Chang et al., Mol. Cell. Biol., 9:2153, 1989. [0241] Chang et al., Stem Cells., 27:1042-1049, 2009. [0242] Chatterjee et al., Proc. Natl. Acad. Sci. USA, 86:9114, 1989. [0243] Chen and Okayama, Mol. Cell Biol., 7:2745-2752, 1987. [0244] Cho et al., Nat. Biotechnol. 31(3): 230-232, 2013. [0245] Choi et al., Cell, 53:519, 1988. [0246] Coffin, In: Virology, Fields et al. (Eds.), Raven Press, NY, 1437-1500, 1990. [0247] Cohen et al., J. Cell. Physiol., 5:75, 1987. [0248] Costa et al., Mol. Cell. Biol., 8:81, 1988. [0249] Couch et al., Am. Rev. Resp. Dis., 88:394-403, 1963. [0250] Coupar et al., Gene, 68:1-10, 1988. [0251] Cripe et al., EMBO J., 6:3745, 1987. [0252] Culotta and Hamer, Mol. Cell. Biol., 9:1376, 1989. [0253] Dandolo et al., J. Virology, 47:55-64, 1983. [0254] De Villiers et al., Nature, 312(5991):242-246, 1984. [0255] Deschamps et al., Science, 230:1174-1177, 1985. [0256] Donnelly et al., J. Gen. Virol. 82, 1027-1041, 2001. [0257] Dubensky et al., Proc. Natl. Acad. Sci. USA, 81:7529-7533, 1984. [0258] Edbrooke et al., Mol. Cell. Biol., 9:1908, 1989. [0259] Edlund et al., Science, 230:912-916, 1985. [0260] EP 0273085 [0261] Fechheimer et al., Proc Natl. Acad. Sci. USA, 84:8463-8467, 1987. [0262] Feng and Holland, Nature, 334:6178, 1988. [0263] Ferkol et al., FASEB J., 7:1081-1091, 1993. [0264] Firak et al., Mol. Cell. Biol., 6:3667, 1986. [0265] Foecking et al., Gene, 45(1):101-105, 1986. [0266] Fraley et al., Proc Natl. Acad. Sci. USA, 76:3348-3352, 1979 [0267] Franz et al., Cardoscience, 5(4):235-43, 1994. [0268] Friedmann, Science, 244:1275-1281, 1989. [0269] Fujita et al., Cell, 49:357, 1987. [0270] Ghosh and Bachhawat, In: Liver Diseases, Targeted Diagnosis and Therapy Using Specific Receptors and Ligands, Wu et al. (Eds.), Marcel Dekker, NY, 87-104, 1991. [0271] Ghosh-Choudhury et al., EMBO J., 6:1733-1739, 1987. [0272] Gilles et al., Cell, 33:717, 1983. [0273] Gloss et al., EMBO J., 6:3735, 1987. [0274] Godbout et al., Mol. Cell. Biol., 8:1169, 1988. [0275] Gomez-Foix et al., J. Biol. Chem., 267:25129-25134, 1992. [0276] Goodbourn and Maniatis, Proc. Natl. Acad. Sci. USA, 85:1447, 1988. [0277] Goodbourn et al., Cell, 45:601, 1986. [0278] Gopal, Mol. Cell Biol., 5:1188-1190, 1985. [0279] Gopal-Srivastava et al., J. Mol. Cell. Biol., 15(12):7081-90, 1995. [0280] Graham and Prevec, In: Methods in Molecular Biology: Gene Transfer and Expression Protocol, Murray (Ed.), Humana Press, Clifton, N.J., 7:109-128, 1991. [0281] Graham and van der Eb, Virology, 52:456-467, 1973. [0282] Graham et al., J. Gen. Virol., 36:59-72, 1977. [0283] Greene et al., Immunology Today, 10:272, 1989 [0284] Grosschedl and Baltimore, Cell, 41:885, 1985. [0285] Grunhaus and Horwitz, Seminar in Virology, 3:237-252, 1992. [0286] Harland and Weintraub, J. Cell Biol., 101:1094-1099, 1985. [0287] Haslinger and Karin, Proc. Natl. Acad. Sci. USA, 82:8572, 1985. [0288] Hauber and Cullen, J. Virology, 62:673, 1988. [0289] Hen et al., Nature, 321:249, 1986. [0290] Hensel et al., Lymphokine Res., 8:347, 1989. [0291] Hermonat and Muzycska, Proc. Nat'l Acad. Sci. USA, 81:6466-6470, 1984. [0292] Herr and Clarke, Cell, 45:461, 1986. [0293] Hersdorffer et al., DNA Cell Biol., 9:713-723, 1990. [0294] Herz and Gerard, Proc. Nat'l. Acad. Sci. USA 90:2812-2816, 1993. [0295] Hirochika et al., J. Virol., 61:2599, 1987. [0296] Holbrook et al., Virology, 157:211, 1987. [0297] Horlick and Benfield, Mol. Cell. Biol., 9:2396, 1989. [0298] Horwich et A, J. Virol., 64:642-650, 1990. [0299] Hsu et al., Natl Biotechnol. 31:827-832, 2013 [0300] Huang et al., Cell, 27:245, 1981. [0301] Hug et al., Mol. Cell. Biol., 8:3065, 1988. [0302] Hwang et al., Mol. Cell. Biol., 10:585, 1990. [0303] Imagawa et al., Cell, 51:251, 1987. [0304] Imbra and Karin, Nature, 323:555, 1986. [0305] Imler et al., Mol. Cell. Biol., 7:2558, 1987. [0306] Imperiale and Nevins, Mol. Cell. Biol., 4:875, 1984. [0307] Jakobovits et al., Mol. Cell. Biol., 8:2555, 1988. [0308] Jameel and Siddiqui, Mol. Cell. Biol., 6:710, 1986. [0309] Jaynes et al., Mol. Cell. Biol., 8:62, 1988. [0310] Jinek et al., Science 337, 816-821, 2012. [0311] Johnson et al., Mol. Cell. Biol., 9:3393, 1989. [0312] Jones and Shenk, Cell, 13:181-188, 1978. [0313] Kadesch and Berg, Mol. Cell. Biol., 6:2593, 1986. [0314] Kaneda et al., Science, 243:375-378, 1989. [0315] Karin et al., Mol. Cell. Biol., 7:606, 1987. [0316] Karlsson et al., EMBO J., 5:2377-2385, 1986. [0317] Katinka et al., Cell, 20:393, 1980. [0318] Kato et al., J Biol Chem., 266(6):3361-3364, 1991. [0319] Kawamoto et al., Mol. Cell. Biol., 8:267, 1988. [0320] Kelly et al., J. Cell Biol., 129(2):383-96, 1995. [0321] Kiledjian et al., Mol. Cell. Biol., 8:145, 1988. [0322] Kimura et al., Dev. Growth Differ., 39(3):257-65, 1997. [0323] Klamut et al., Mol. Cell. Biol., 10:193, 1990. [0324] Klein et al., Nature, 327:70-73, 1987. [0325] Koch et al., Mol. Cell. Biol., 9:303, 1989. [0326] Kriegler and Botchan, In: Eukaryotic Viral Vectors, Gluzman (Ed.), Cold Spring Harbor: Cold Spring Harbor Laboratory, N Y, 1982. [0327] Kriegler and Botchan, Mol. Cell. Biol., 3:325, 1983. [0328] Kriegler et al., Cell, 38:483, 1984. [0329] Kriegler et al., Cell, 53:45, 1988. [0330] Kuhl et al., Cell, 50:1057, 1987. [0331] Kunz et al., Nucl. Acids Res., 17:1121, 1989. [0332] LaPointe et al., Hypertension, 27(3):715-22, 1996 [0333] LaPointe et al., J. Biol. Chem., 263(19):9075-8, 1988. [0334] Larsen et al., Proc. Natl. Acad. Sci. USA., 83:8283, 1986. [0335] Laspia et al., Cell, 59:283, 1989. [0336] Latimer et al., Mol. Cell. Biol., 10:760, 1990. [0337] Le Gal La Salle et al., Science, 259:988-990, 1993. [0338] Lee et al., Nature, 294:228, 1981. [0339] Levinson et al., Nature, 295:79, 1982. [0340] Levrero et al., Gene, 101:195-202, 1991. [0341] Lin et al., Mol. Cell. Biol., 10:850, 1990. [0342] Luria et al., EMBO J., 6:3307, 1987. [0343] Lusky and Botchan, Proc. Natl. Acad. Sci. USA, 83:3609, 1986. [0344] Lusky et al., Mol. Cell. Biol., 3:1108, 1983. [0345] Majors and Varmus, Proc. Natl. Acad. Sci. USA, 80:5866, 1983. [0346] Mali et al., Science 339, 823-826, 2013a. [0347] Mali et al., Nat Methods 10, 957-963, 2013b. [0348] Mali et al., Nat. Biotechnol. 31:833-838, 2013c. [0349] Mann et al., Cell, 33:153-159, 1983. [0350] Markowitz et al., J. Virol., 62:1120-1124, 1988. [0351] McNeall et al., Gene, 76:81, 1989. [0352] Miksicek et al., Cell, 46:203, 1986. [0353] Mordacq and Linzer, Genes and Dev., 3:760, 1989. [0354] Moreau et al., Nucl. Acids Res., 9:6047, 1981. [0355] Moss et al., J. Gen. Physiol., 108(6):473-84, 1996. [0356] Muesing et al., Cell, 48:691, 1987. [0357] Nicolas and Rubinstein, In: Vectors: A survey of molecular cloning vectors and their uses, Rodriguez and Denhardt (Eds.), Stoneham: Butterworth, 494-513, 1988. [0358] Nicolau and Sene, Biochim. Biophys. Acta, 721:185-190, 1982. [0359] Nicolau et al., Methods Enzymol., 149:157-176, 1987. [0360] Ondek et al., EMBO J., 6:1017, 1987. [0361] Ornitz et al., Mol. Cell. Biol., 7:3466, 1987. [0362] Palmiter et al., Cell, 29:701, 1982a. [0363] Palmiter et al., Nature, 300:611, 1982b. [0364] Paskind et al., Virology, 67:242-248, 1975. [0365] Pech et al., Mol. Cell. Biol., 9:396, 1989. [0366] Perales et al., Proc. Natl. Acad. Sci. USA, 91(9):4086-4090, 1994. [0367] Perez-Stable and Constantini, Mol. Cell. Biol., 10:1116, 1990. [0368] Picard et al., Nature, 307:83, 1984. [0369] Pinkert et al., Genes and Dev., 1:268, 1987. [0370] Ponta et al., Proc. Natl. Acad. Sci. USA, 82:1020, 1985. [0371] Porton et al., Mol. Cell. Biol., 10:1076, 1990. [0372] Potter et al., Proc. Natl. Acad. Sci. USA, 81:7161-7165, 1984. [0373] Queen and Baltimore, Cell, 35:741, 1983. [0374] Quinn et al., Mol. Cell. Biol., 9:4713, 1989. [0375] Racher et al., Biotech. Techniques, 9:169-174, 1995. [0376] Ragot et al., Nature, 361:647-650, 1993. [0377] Redondo et al., Science, 247:1225, 1990. [0378] Reisman and Rotter, Mol. Cell. Biol., 9:3571, 1989. [0379] Renan, Radiother. Oncol., 19:197-218, 1990. [0380] Resendez Jr. et al., Mol. Cell. Biol., 8:4579, 1988. [0381] Rich et al., Hum. Gene Ther., 4:461-476, 1993. [0382] Ridgeway, In: Vectors: A survey of molecular cloning vectors and their uses, Stoneham: Butterworth, 467-492, 1988. [0383] Ripe et al., Mol. Cell. Biol., 9:2224, 1989. [0384] Rippe et al., Mol. Cell Biol., 10:689-695, 1990. [0385] Rittling et al., Nuc. Acids Res., 17:1619, 1989. [0386] Rosen et al., Cell, 41:813, 1988. [0387] Rosenfeld et al., Cell, 68:143-155,1992. [0388] Rosenfeld et al., Science, 252:431-434,1991. [0389] Roux et al., Proc. Natl. Acad. Sci. USA, 86:9079-9083, 1989. [0390] Sambrook and Russell, Molecular Cloning: A Laboratory Manual 3.sup.rd Ed., Cold Spring Harbor Laboratory Press, 2001. [0391] Sakai et al., Genes and Dev., 2:1144, 1988. [0392] Satake et al., J. Virology, 62:970, 1988. [0393] Schaffner et al., J. Mol. Biol., 201:81, 1988. [0394] Searle et al., Mol. Cell. Biol., 5:1480, 1985. [0395] Sharp et al., Cell, 59:229, 1989. [0396] Shaul and Ben-Levy, EMBO J., 6:1913, 1987. [0397] Sherman et al., Mol. Cell. Biol., 9:50, 1989. [0398] Sleigh et al., J. EMBO, 4:3831, 1985. [0399] Spalholz et al., Cell, 42:183, 1985. [0400] Spandau and Lee, J. Virology, 62:427, 1988. [0401] Spandidos and Wilkie, EMBO J., 2:1193, 1983. [0402] Stephens and Hentschel, Biochem. J., 248:1, 1987. [0403] Stratford-Perricaudet and Perricaudet, In: Human Gene Transfer, Cohen-Haguenauer and Boiron (Eds.), John Libbey Eurotext, France, 51-61, 1991. [0404] Stratford-Perricaudet et al., Hum. Gene. Ther., 1:241-256, 1990. [0405] Stuart et al., Nature, 317:828, 1985. [0406] Sullivan and Peterlin, Mol. Cell. Biol., 7:3315, 1987. [0407] Swartzendruber and Lehman, J. Cell. Physiology, 85:179, 1975. [0408] Takebe et al., Mol. Cell. Biol., 8:466, 1988. [0409] Tavernier et al., Nature, 301:634, 1983. [0410] Taylor and Kingston, Mol. Cell. Biol., 10:165, 1990a. [0411] Taylor and Kingston, Mol. Cell. Biol., 10:176, 1990b. [0412] Taylor et al., J. Biol. Chem., 264:15160, 1989. [0413] Temin, In: Gene Transfer, Kucherlapati (Ed.), NY, Plenum Press, 149-188, 1986. [0414] Thiesen et al., J. Virology, 62:614, 1988. [0415] Top et al., J. Infect. Dis., 124:155-160, 1971. [0416] Tronche et al., Mol. Biol. Med., 7:173, 1990. [0417] Trudel and Constantini, Genes and Dev. 6:954, 1987. [0418] Tur-Kaspa et al., Mol. Cell Biol., 6:716-718, 1986. [0419] Tyndell et al., Nuc. Acids. Res., 9:6231, 1981. [0420] Vannice and Levinson, J. Virology, 62:1305, 1988. [0421] Varmus et al., Cell, 25:23-36, 1981. [0422] Vasseur et al., Proc Natl. Acad. Sci. U.S.A., 77:1068, 1980. [0423] Wagner et al., Proc. Natl. Acad. Sci. USA, 87(9):3410-3414, 1990. [0424] Wang and Calame, Cell, 47:241, 1986. [0425] Wang et al., Cell, 153:910-910, 2013. [0426] Weber et al., Cell, 36:983, 1984. [0427] Weinberger et al. Mol. Cell. Biol., 8:988, 1984. [0428] Winoto et al., Cell, 59:649, 1989. [0429] Wong et A, Gene, 10:87-94, 1980. [0430] Wu and Wu, Adv. Drug Delivery Rev., 12:159-167, 1993. [0431] Wu and Wu, Biochemistry, 27:887-892, 1988. [0432] Wu and Wu, J. Biol. Chem., 262:4429-4432, 1987. [0433] Wu et al., Cell Stem Cell 13, 659-662, 2013. [0434] Wu et al., Nat Biotechnol 32, 670-676, 2014. [0435] Yamauchi-Takihara et al., Proc. Natl. Acad. Sci. USA, 86(10):3504-3508, 1989. [0436] Yang et al., Proc. Natl. Acad. Sci. USA, 87:9568-9572, 1990. [0437] Yutzey et al. Mol. Cell. Biol., 9:1397, 1989. [0438] Zelenin et al., FEBS Lett., 280:94-96, 1991. [0439] Ziober and Kramer, J. Bio. Chem., 271(37):22915-22922, 1996.