USE OF COMPOSITION COMPRISING STEM CELL-DERIVED EXOSOME AS EFFECTIVE INGREDIENT IN STRENGTHENING SKIN BARRIER AND IMPROVING SKIN BARRIER FUNCTION
20200276233 ยท 2020-09-03
Assignee
Inventors
Cpc classification
A61K36/28
HUMAN NECESSITIES
A61K9/06
HUMAN NECESSITIES
A61K36/53
HUMAN NECESSITIES
A61K35/12
HUMAN NECESSITIES
A61K9/0019
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K36/28
HUMAN NECESSITIES
A61K36/53
HUMAN NECESSITIES
International classification
A61K35/12
HUMAN NECESSITIES
Abstract
A composition for strengthening skin barrier or improving skin barrier function is able to improve objective indicators related to the protection of skin barrier, the strengthening of skin barrier, and/or the improvement of skin barrier function. The composition exhibits the effects of increasing the amount of ceramides, dihydroceramides and sphingoid bases, increasing the activities of enzymes that are involved in the synthesis thereof, and decreasing the activities of enzymes that are involved in the degradation thereof. In addition, the composition is able to restore skin barrier function by reducing TSLP, IL-4, and IL-13 which are closely associated with skin barrier damage, and thus interrupting a vicious circle in which the lipids and proteins contributing to skin barrier decrease.
Claims
1. A method for strengthening skin barrier of stratum corneum or improving skin barrier function of stratum corneum, the method comprising: administering a composition comprising exosomes derived from stem cells as an active ingredient to a subject; and increasing the production of at least one selected from the group consisting of ceramides, dihydroceramides and sphingoid bases in the skin of the subject.
2. The method of claim 1, wherein the composition increases the production of at least one selected from the group consisting of C16 ceramide, C18 ceramide, C20 ceramide, C22 ceramide, C24 ceramide and C24:1 ceramide, and the amount of total ceramides in the skin.
3. The method of claim 1, wherein the composition increases the production of at least one selected from the group consisting of C16 dihydroceramide, C18 dihydroceramide, C22 dihydroceramide, C24 dihydroceramide and C24:1 dihydroceramide, and the amount of total dihydroceramides in the skin.
4. The method of claim 1, wherein the composition increases the production of at least one of sphingosine-1-phosphate (S1P) or sphingosine in the skin.
5. The method of claim 1, wherein the composition increases the activity of sphingosine kinase 1 (SPHK1) in the skin, and decrease the activity of sphingosine-1-phosphate (S1P) lyase in the skin.
6. The method of claim 1, wherein the composition decreases the production or expression of thymic stromal lymphopoietin (TSLP), IL-4 and IL-13 in the skin.
7. The method of claim 1, wherein the composition is a pharmaceutical composition.
8. The method of claim 7, wherein the pharmaceutical composition is prepared in an injectable formulation.
9. The method of claim 1, wherein the subject is at least one selected from the group consisting of humans, dogs, cats, rodents, horses, cattle, monkeys and pigs.
10. A method for strengthening skin barrier of stratum corneum or improving skin barrier function of stratum corneum, the method comprising: (a) (a1) applying a composition comprising exosomes derived from stem cells as an active ingredient to a skin of a subject; or (a2) contacting or attaching a patch, a mask pack or a mask sheet, which has the composition applied thereto or soaked therein, to the skin; or (a3) sequentially performing (a1) and (a2); and (b) leaving the composition on the skin for a period of time sufficient to increase the production of at least one selected from the group consisting of ceramides, dihydroceramides and sphingoid bases in the skin.
11. The method of claim 10, wherein the composition is lotion or cream in step (a).
12. The method of claim 10, further comprising (c) removing the patch, mask pack or mask sheet from the skin after step (b), and applying the composition to the skin.
13. The method of claim 12, wherein the composition is lotion or cream in step (c).
14. The method of claim 10, wherein the composition is used in at least one form selected from the group consisting of patches, mask packs, mask sheets, creams, tonics, ointments, suspensions, emulsions, pastes, lotions, gels, oils, packs, sprays, aerosols, mists, foundations, powders, and oilpapers.
15. The method of claim 14, wherein the composition is applied to or soaked in at least one surface of the patch, mask pack or mask sheet.
16. The method of claim 10, wherein the composition is a skin external preparation or a cosmetic composition.
17. The method of claim 10, wherein the subject is at least one selected from the group consisting of humans, dogs, cats, rodents, horses, cattle, monkeys and pigs.
18. A method for preventing, suppressing, alleviating, ameliorating or treating a skin disease caused by impaired skin barrier function of stratum corneum, the method comprising: administering a therapeutically effective amount of a pharmaceutical composition comprising exosomes derived from stem cells as an active ingredient to a subject; and increasing the production of at least one selected from the group consisting of ceramides, dihydroceramides and sphingoid bases in the skin of the subject.
19. The method of claim 18, wherein the pharmaceutical composition increases the production of at least one selected from the group consisting of C16 ceramide, C18 ceramide, C20 ceramide, C22 ceramide, C24 ceramide and C24:1 ceramide, and the amount of total ceramides in the skin.
20. The method of claim 18, wherein the pharmaceutical composition increases the production of at least one selected from the group consisting of C16 dihydroceramide, C18 dihydroceramide, C22 dihydroceramide, C24 dihydroceramide and C24:1 dihydroceramide, and the amount of total dihydroceramides in the skin.
21. The method of claim 18, wherein the pharmaceutical composition increases the production of at least one of sphingosine-1-phosphate (S1P) or sphingosine in the skin.
22. The method of claim 18, wherein the pharmaceutical composition increases the activity of sphingosine kinase 1 (SPHK1) in the skin, and decrease the activity of sphingosine-1-phosphate (S1P) lyase in the skin.
23. The method of claim 18, wherein the pharmaceutical composition decreases the production or expression of thymic stromal lymphopoietin (TSLP), IL-4 and IL-13 in the skin.
24. The method of claim 18, wherein the pharmaceutical composition is prepared in an injectable formulation.
25. The method of claim 18, wherein the subject is at least one selected from the group consisting of humans, dogs, cats, rodents, horses, cattle, monkeys and pigs.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0058] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
EXAMPLES
[0079] Hereinafter, the present invention will be described in more detail with reference to the following examples. However, the following examples are only to illustrate the present invention and are not intended to limit or restrict the scope of the present invention. Those that can be easily inferred by those skilled in the art from the detailed description and examples of the present invention are interpreted as falling within the scope of the present invention. References referred to in the present invention are incorporated herein by reference.
[0080] Throughout the present specification, it is to be understood that, when any part is referred to as comprising any component, it does not exclude other components, but may further include other components, unless otherwise specified.
Example 1: Cell Culture
[0081] RAW 264.7 cells (mouse macrophage cell line) were purchased from the Korean Cell Line Bank and cultured. For cell culture, cells were subcultured in DMEM (purchased from ThermoFisher Scientific) medium containing 10% fetal bovine serum (FBS; purchased from ThermoFisher Scientific) and 1% antibiotics-antimycotics (purchased from ThermoFisher Scientific) at 37 C. under 5% CO.sub.2.
[0082] Human dermal fibroblast (HDF) HS68 cells purchased from ATCC were subcultured in DMEM (purchased from ThermoFisher Scientific) medium containing 10% fetal bovine serum (FBS; purchased from ThermoFisher Scientific) and 1% antibiotics-antimycotics (purchased from ThermoFisher Scientific) at 37 C. under 5% CO.sub.2.
[0083] According to a cell culture method known in the technical field to which the present invention pertains, adipose-derived stem cells were cultured at 37 C. under 5% CO.sub.2. Next, the cells were washed with phosphate-buffered saline (purchased from ThermoFisher Scientific), and then the medium was replaced with serum-free, phenol red-free medium, and the cells were cultured for 1 to 10 days. The supernatant (hereinafter, referred to as conditioned medium (CM)) was recovered.
[0084] In order to obtain exosomes having a uniform particle size distribution and high purity in an exosome isolation process, 2 wt % of trehalose was added to the conditioned medium. After addition of trehalose, the conditioned medium was filtered through 0.22 m filter to remove impurities, such as cell debris, waste, macroparticles and the like. From the filtered conditioned medium, exosomes were immediately isolated. In addition, the filtered conditioned medium was stored in a refrigerator (10 C. or below), and then used for exosome isolation. Furthermore, the filtered conditioned medium was freeze-stored in an ultra-low temperature freezer at 60 C. or below, thawed, and then subjected to exosome isolation. Thereafter, exosomes were isolated from the conditioned medium by TFF.
Example 2: Isolation and Purification of Exosomes by TFF Method
[0085] For isolating, concentrating and diafiltrating exosomes from the conditioned medium filtered through 0.22 m filter in Example 1, TFF method was used. As a filter for TFF method, a cartridge filter (also known as a hollow fiber filter; purchased from GE Healthcare) or a cassette filter (purchased from Pall, Sartorius or Merck Millipore) was used. The TFF filter may be selected with various molecular weight cutoffs (MWCOs). Using the filter having selected MWCO, exosomes were isolated and concentrated, and particles, proteins, lipids, nucleic acids, low-molecular-weight compounds, etc., were removed, which are smaller than the MWCO.
[0086] To isolate and concentrate exosomes, a TFF filter having MWCO of 100,000 Da (Dalton), 300,000 Da or 500,000 Da was used. Exosomes were isolated from the conditioned medium by removing substances smaller than the MWCO and concentrating the conditioned medium to a volume of about 1/100 to 1/25 by the TFF method.
[0087] The isolated and concentrated solution of exosomes was additionally subjected to diafiltration. The diafiltration was performed continuously (continuous diafiltration) or discontinuously (discontinuous diafiltration), using a buffer having at least 4 times, preferably at least 6 to 10 times, more preferably at least 12 times volume of the isolated exosomes. To obtain exosomes having a uniform particle size distribution and high purity, 2 wt % trehalose in PBS was added to the buffer.
Example 3: Analysis of Characteristics of Isolated Exosomes
[0088] The particle size and concentration of the isolated exosomes were measured by nanoparticle tracking analysis (NTA; purchased from Malvern) or tunable resistive pulse sensing (TRPS; purchased form Izon Science). The uniformity and size of the isolated exosomes were analyzed using transmitted electron microscopy (TEM). The results of TRPS, NTA and TEM analyses of the exosomes isolated according to one embodiment of the present invention are shown in
[0089]
[0090]
[0091] Meanwhile, it is to be understood that the stem cell-derived exosomes that are used in the present invention are not limited to the exosomes of the Examples as described above, it is possible to use exosomes derived from a variety of stem cells that are being used in the art or can be used in the future. In addition, it should be noted that the stem cell-derived exosomes isolated according to the above Examples should be understood as an example of stem cell-derived exosomes that may be used in the present invention, and the scope of the present invention is not limited thereto.
Example 4: Measurement of Cytotoxicity Following Exosome Treatment
[0092] In order to evaluate the cytotoxicity of exosomes, isolated by the isolation method according to one embodiment of the present invention, in human dermal fibroblast HS68 cells, the cells were treated with various concentrations of the exosomes, and the proliferation rate of the cells was examined. HS68 cells were suspended in 10% FBS-containing DMEM, and then seeded resulting in 80 to 90% confluency and cultured in an incubator at 37 C. under 5% CO.sub.2 for 24 hours. After 24 hours, the medium was removed, and the cells were treated with various concentrations of the exosomes prepared in Example 2. Then, the viability of the cells was evaluated while the cells were cultured for 24 to 72 hours. The cell viability was measured using WST-1 reagent (purchased from Takara), MTT reagent (purchased from Sigma), CellTiter-Glo reagent (purchased from Promega) or alamarBlue reagent (purchased from ThermoFisher Scientific) with a microplate reader (purchased from Molecular Devices).
[0093] As a control, the cells cultured in conventional cell culture medium not treated with the exosomes was used. It was confirmed that the exosomes of the present invention showed no cytotoxicity in the concentration range used in the test (
Example 5: Measurement of Inflammatory Response Using Microphage Cell Line
[0094] RAW 264.7 cells were suspended in 10% FBS-containing DMEM medium, and seeded into each well of a multiwell plate resulting in 80 to 90% confluency. Next day, the cells were treated and cultured with a suitable concentration of the exosomes of the present invention (exosomes prepared in Example 2) diluted in fresh serum-free medium containing LPS for 1 to 24 hours. After completion of the culture, the culture supernatant was collected, and NO and inflammatory cytokines present in the culture medium were measured to examine inflammatory response. Inflammatory response in the culture medium was measured using an NO detection kit (purchased from Intronbio or Promega). The amounts of the inflammatory cytokine TNF- in the group treated with LPS alone and the group treated with LPS together with the exosomes of the present invention were measured using an ELISA kit (purchased from R&D system) according to the manufacturer's manual. As a positive control, cells were treated with dexamethasone (purchased from Sigma). In addition, cDNA was prepared from the total RNA obtained from RAW 264.7 cells treated as described above, and changes in the mRNA expression levels of iNOS, TNF-, IL-6 and IL-1 were measured using a real-time PCR method. As a reference gene for normalizing the above genes, GAPDH gene was used. The sequences of primers used in the real-time PCR are shown in Table 1 below.
TABLE-US-00001 TABLE1 Nucleotidesequencesofprimersusedinreal-timePCR Sequences Genes Forwardprimer(5.fwdarw.3) ReversePrimer(5.fwdarw.3) TNF- TCTCATCAGTTCTATGGC GGCACCACTAGTTGGTTGTCT CCAGAC(SEQIDNO:1) TTG(SEQIDNO:2) iNOS GCTACCACATTGAAGAA CCATAGGAAAAGACTGCACC GCTGGTG(SEQIDNO:3) GAAG(SEQIDNO:4) GAPDH GACATCAAGAAGGTGGT CCCTGTTGCTGTAGCCGTATT GAAGCAG(SEQIDNO:5) CAT(SEQIDNO:6) IL-6 GCCAGAGTCCTTCAGAG ATTGGATGGTCTTGGTCCTTA AGATACA(SEQIDNO:7) GCC(SEQIDNO:8) IL-1 GCAACGACAAAATACCT AGTTGGGGAACTCTGCAGACT GTGGCCT(SEQIDNO:9) CAA(SEQIDNO:10)
[0095] First, as shown in
[0096] These results suggest that the exosomes of the present invention can prevent, suppress, alleviate or repair impaired skin barrier function caused by inflammatory response. Accordingly, it is considered that the composition for strengthening skin barrier or improving skin barrier function according to the present invention is useful for the protection of skin barrier, the strengthening of skin barrier, or the improvement of skin barrier function.
Example 6: Comparison of NO Formation-Reducing Effect Between Isolation Methods
[0097] To compare NO formation-reducing effect of exosomes between isolation methods, exosomes isolated by a conventional precipitation method were prepared besides the exosomes obtained by the TFF isolation and purification according to one embodiment of the present invention. The precipitation method was performed according to the protocol of the manufacturer (System Biosciences). It was confirmed that the exosomes isolated by the conventional precipitation method (see
[0098] Accordingly, it is considered that the exosomes obtained according to the isolation method of one embodiment of the present invention have excellent performance or functional activities (for example, uniformity of particle size distribution, inhibition of NO production, reduction of inflammatory response, etc.) as compared with exosomes obtained according to a conventional isolation method, and the composition for strengthening skin barrier or improving skin barrier function according to the present invention, which contains, as an active ingredient, the stem-cell derived exosomes having excellent functional activities as described above, is much superior to the conventional art in terms of the effect of preventing, suppressing, alleviating or repairing impaired skin barrier function caused by inflammatory response.
Example 7: Animal Model Having Skin Barrier Damage
[0099] In order to establish an animal model to be used to confirm the strengthening of skin barrier or the improvement of skin barrier function, oxazolone was used. When oxazolone is applied to the skin, it can cause damage to skin barrier function, resulting in an increase in transepidermal water loss (TEWL) and a decrease in hydration of stratum corneum, a decrease in the expression of loricrin, involucrin and filaggrin which are structural proteins of the skin barrier, and an increase in the pH of stratum corneum, thereby providing an animal model in which skin barrier function was damaged (see Journal of Investigative Dermatology (2008) 128(1), 79-86).
[0100] Female SKH-1 mouse (5-week-old; purchased from Central Laboratory Animal Inc.) were purchased, adapted for 7 days, and then used in this experiment. The adapted mice were divided into six groups as follows after skin barrier damage was induced in the mice.
[0101] (1) Normal: a normal control group (indicated by N in
[0102] (2) Control (skin barrier damage-induced group): a negative control group in which skin barrier damage was induced by oxazolone (indicated by C in
[0103] (3) Exosome low dose: a test group in which the exosomes prepared in Example 2 were subcutaneously (SC) injected at a dose of 1 g/head three times a week for four weeks, after skin barrier damage was induced by oxazolone (indicated by L in
[0104] (4) Exosome medium dose: a test group in which the exosomes prepared in Example 2 were subcutaneously (SC) injected at a dose of 3 g/head three times a week for four weeks, after skin barrier damage was induced by oxazolone (indicated by M in
[0105] (5) Exosome high dose: a test group in which the exosomes prepared in Example 2 were subcutaneously (SC) injected at a dose of 10 g/head three times a week for four weeks, after skin barrier damage was induced by oxazolone (indicated by H in
[0106] (6) Dexamethasone: a test group (positive control group) in which 0.03% dexamethasone (purchased from Sigma) dissolved in ethanol was subcutaneously (SC) injected at a dose of 100 g/head three times a week for four weeks, after skin barrier damage was induced by oxazolone (indicated by D in
[0107] The mice of each of test groups (2) to (6) were sensitized by applying 200 L of 2% oxazolone (purchased from Sigma) to the mouse back skin. After sensitization, the mice were subjected to skin barrier recovery for 5 to 7 days, and then skin barrier damage was induced by applying 100 L of 0.025% to 0.05% oxazolone to the mouse back skin of each of test groups (2) to (6) every other day for about 15 days. In addition, in order to maintain the skin barrier damage, 100 L of 0.025% to 0.05% oxazolone was applied to the mouse back skin of each of test groups (2) to (6) every other day during the exosome treatment period.
[0108] Before and after treatment with the exosomes of the present invention, the average water evaporation from the skin was measured using a TEWL measurement system, and the hydration of the skin was measured using a hydration measurement device (Corneometer CM825; Courage-Khazaka Electronic GmbH, Germany). The number of mice measured was 12 for each test group (n=12).
[0109] As a result, it was confirmed that TEWL (transepidermal water loss), that is, water evaporation from stratum corneum in test groups (3) to (5) treated with the exosomes according to one embodiment of the present invention decreased as compared with that in the disease control group (skin barrier damage-induced group) in a manner of depending on the dose of the exosomes (
[0110] Meanwhile, the results of measuring the body weight of each test group (n=12) indicated that in test group (6) treated with dexamethasone, there was body weight loss due to side effects, but in test groups (3) to (5) treated with the exosomes according to one embodiment of the present invention, the body weight did not substantially decrease compared to the normal control group (
Example 8: Confirmation of Improvement of Skin Barrier Indicators
[0111] The mice of Example 7 were euthanized and their skin samples were collected. Then, for each test group, the amounts of ceramides, dihydroceramides, sphingosine and sphingosine-1-phosphate (S1P), the activity of sphingosine kinase 1 (SPHK1), and the activity of S1P lyase which is an enzyme that degrades sphingosine 1-phosphate (S1P) were measured. The number of the mice used in the measurement was 8 for each test group (n=8).
[0112] The amounts of ceramides having different carbon lengths, total ceramides, sphingosine and sphingosine-1-phosphate (S1P) were analyzed using LC-MS/MS (API 3200 Triple quadruple mass, AB/SCIEX) as follows. Total lipids were extracted according to the literature known in the art (J Invest Dermatol. 2010 October, 130(10):2472-80). Ceramides, sphingosine, and sphingosine-1-phosphate were derivatized with OPA (o-phthalaldehyde) reagent and quantified using a LC-MS/MS system equipped with a fluorescence detector (J Invest Dermatol. 2010 October, 130(10):2472-80; Arch Pharm Res. 2009 December, 32(12):1795-801; Proc Natl Acad Sci USA. 2016 Mar. 8, 113(10): E1334-E1342). The amount of sphingolipids was expressed as pmol/g of protein, and the quantification of proteins was performed according to a conventional BCA method.
[0113] As shown in
[0114] Meanwhile, the activity of sphingosine kinase 1 (SPHK1) was analyzed using LC-MS/MS as follows. Lysates of skin tissues in 20 mM Tris buffer (pH 7.4) containing 5 mM EDTA, 5 mM EGTA, 3 mM -mercaptoethanol, 5% glycerol, protease inhibitors (Sigma-Aldrich) and phosphatase inhibitors (Roche), were incubated with 10 L of 200 M C17-sphingosine (SPHK1 substrate) (Avanti Polar Lipids). To evaluate the activity of SPHK1, 0.5% Triton X-100 was added to the assay buffer and incubated at 37 C. for 30 minutes. The enzymatic reaction was terminated by addition of CHCl.sub.3:MeOH:HCl (8:4:3, v/v/v). C17-sphinganine-1-phosphate (100 pmol; Avanti Polar Lipids) was added as an internal standard. The organic phase separated by addition of CHCl.sub.3 was dried under vacuum, and the dried product was re-dissolved in methanol, and then analyzed by LC-ESI-MS/MS (API 3200 Triple quadruple mass, AB/SCIEX). The activity of SPHK1 was expressed as C17-S1P pmol/mg of protein/min, and the quantification of proteins was performed according to a conventional BCA method.
[0115] In addition, the activity of S1P lyase was analyzed using LC-MS/MS as follows. Lysates of skin tissues were incubated with 10 nmol of S1P (Avanti Polar Lipids) for 20 minutes. 100 pmol of (2E)-d5-hexadecenal (Avanti Polar Lipids) was added as an internal standard, and the reaction was terminated by lipid extraction. The total lipid extract was derivatized with 5-mM semicarbazide hydrochloride (Avanti Polar Lipids) in methanol containing 5% formic acid at 40 C. for 2 hours, and analyzed by LC-ESI-MS/MS. The activity of S1P lyase was expressed as pentadecanal pmol/mg of protein/min, and the quantification of proteins was performed according to a conventional BCA method.
[0116] As shown in
[0117] From the above-described results, it can be seen that the composition comprising, as an active ingredient, the exosomes according to one embodiment of the present invention, improves objective indicators related to the protection of skin barrier, the strengthening of skin barrier, and/or the improvement of skin barrier function, and shows, for example, an increase in production of ceramides, dihydroceramides and sphingoid bases, an increase in the activity of enzymes involved in the synthesis thereof, and a decrease in the activity of enzymes involved in the degradation thereof. Therefore, the composition comprising, as an active ingredient, the exosomes according to one embodiment of the present invention, is useful as a pharmaceutical composition, a skin external preparation and a cosmetic composition for strengthening skin barrier or improving skin barrier function.
Example 9: Comparison of the Ear Thickness and Spleen Size of Animal Model
[0118] The ear thicknesses of the mice of Example 7 were measured using a caliper, and the mice were euthanized. Then, for each test group, the back skin tissue was stained by an H&E staining method known in the art. The number of the mice was 8 for each test group (n=8).
[0119]
[0120] Meanwhile, the skin tissues of the euthanized mice were stained with toluidine blue, and then the infiltration of mast cells, a type of inflammatory cells, was measured.
[0121] The results show that the exosomes according to one embodiment of the present invention are able to inhibit or prevent the increase in epidermal thickness caused by inflammatory response and the infiltration of mast cells.
[0122] In addition, it was confirmed that the spleen size of each of test groups (3) to (5) treated with the exosomes according to one embodiment of the present invention decreased as compared with that of the disease control group in a manner of depending on the dose of the exosomes (
[0123] The test results show that the composition comprising the exosomes according to one embodiment of the present invention is able to prevent, suppress, alleviate or repair inflammatory response or impaired skin barrier function caused by the inflammatory response. Therefore, the composition for strengthening skin barrier or improving skin barrier function according to the present invention is useful for the protection of skin barrier, the strengthening of skin barrier, or the improvement of skin barrier function.
Example 10: Decrease in Cytokines Closely Associated with Skin Barrier Damage
[0124] The mice of Example 7 were euthanized and their skin samples were collected. Then, for each test group, the levels of thymic stromal lymphopoietin (TSLP), IL-4, IL-13 and the like in the skin tissue were measured by ELISA. The number of the mice used in the measurement was 8 for each test group (n=8). Each skin tissue sample was placed in 5 mL of RIPA buffer (containing 1 protease inhibitors) on ice and finely chopped, and then centrifuged at 2,000 rpm for 5 minutes at 4 C. to remove impurities. The quantification of proteins was performed using a BCA kit, and the protein concentration was adjusted to 100 g/mL with RIPA buffer containing protease inhibitors. Then, 100 L (10 g of protein) was used in ELISA assay. The experiment was performed using a TSLP ELISA kit, an IL-4 ELISA kit and an IL-13 ELISA kit (purchased from ThermoFisher), and the absorbance was measured at 450 nm to quantify the levels of TSLP, IL-4 and IL-13 in the tissue.
[0125] Meanwhile, when the skin barrier is damaged, the secretion of TSLP from keratinocytes and mast cells is promoted, and the secreted TSLP is involved in the maturation of antigen-presenting cells (e.g., dendritic cells, Langerhans cells and the like). The matured antigen-presenting cells activate Th cells, and the activated Th cells increase Th2-type cytokines such as IL-4, IL-13 and the like. In this case, a vicious circle is repeated in which IL-4 and IL-13 further damage the skin barrier by reducing the lipids (e.g., ceramides) and proteins (e.g., filaggrin, involucrin and loricrin) that contribute to the skin barrier (see
[0126] As shown in
Example 11: Preparation of Cosmetic Composition Containing Exosomes of the Present Invention
[0127] (Preparation of Lotion)
[0128] 1704 g/mL of the undiluted exosomes prepared in Example 2 above were diluted, mixed with and suspended in the components shown in Table 2 below, thereby preparing a cosmetic composition (lotion). The final cosmetic composition was prepared to contain the exosomes at a concentration of 210.sup.4 particles/mL. The content of each component is shown in Table 2 below.
TABLE-US-00002 TABLE 2 Components and their contents of lotion Components Contents (wt %) Exosomes prepared in Example 2 1 Glycerin 7.375 Caprylic/capric triglyceride 6 Cetyl ethylhexanoate 5 Propanediol 5 Phenyl trimethicone 3.5 Stearic acid 3 1,2-hexanediol 2 Panthenol 2 Cetearyl olivate 1.8 Sorbitan olivate 1.2 Diisostearyl malate 1 Fructan 1 Ammonium acryloyldimethyl 0.3 taurate/VP copolymer Arachidyl alcohol 0.25 Behenyl alcohol 0.15 Arachidyl glucoside 0.1 Hydrogenated lecithin 0.1 Shea butter 0.09 Xanthan gum 0.05 Lavender oil 0.02 Bergamot oil 0.02 Ceramide NP 0.02 Orange peel oil 0.02 Phytospingosine 0.015 Palmitoyl tetrapeptide-7 0.01 Palmitoyl tripeptide-1 0.01 Purified water Balance
[0129] (Preparation of Cream)
[0130] 1704 g/mL of the undiluted exosomes prepared in Example 2 above were diluted, mixed with and suspended in the components shown in Table 3 below, thereby preparing a cosmetic composition (cream). The final cosmetic composition was prepared to contain the exosomes at a concentration of 210.sup.4 particles/mL. The content of each component is shown in Table 3 below.
TABLE-US-00003 TABLE 3 Components and their contents of cream Components Contents (wt %) Exosomes prepared in Example 2 1 Caprylic/capric triglyceride 12 Glycerin 9.75 Butylene glycol 7 Cetearyl alcohol 3.5 Hydrogenated vegetable oil 3.5 1,2-hexanediol 2 Stearic acid 2 Phenyl trimethicone 2 Jojoba seed oil 2 Bees wax 1.7 Glyceryl stearate 1.5 Stearyl alcohol 1.45 Glyceryl stearate SE 1 Cetyl alcohol 1 Panthenol 1 Shea butter 0.88 Sorbitan sesquioleate 0.5 Polyglyceryl-2 stearate 0.45 Ammonium acryloyldimethyl 0.3 taurate/VP copolymer Hydrogenated lecithin 0.1 Bergamot oil 0.04 Ceramide NP 0.04 Phytospingosine 0.03 Coccinia Indica fruit extract 0.0225 Eclipta Prostrata extract 0.0225 Lavender oil 0.02 Orange peel oil 0.02 Copper tripeptide-1 0.01 Palmitoyl tetrapeptide-7 0.01 Palmitoyl tripeptide-1 0.01 Calamine 0.001 Purified water Balance
[0131] (Preparation of Mask Pack)
[0132] 1704 g/mL of the undiluted exosomes prepared in Example 2 above were diluted, mixed with and suspended in the components shown in Table 4 below. Then, the obtained cosmetic composition was applied to or soaked in a mask pack. The exosomes were applied to or soaked in the mask pack at a concentration of 410.sup.3 particles/mL. The content of each component is shown in Table 4 below.
TABLE-US-00004 TABLE 4 Components and their contents of mask pack Components Contents (wt %) Exosomes prepared in Example 2 0.1 Glycerin 3.070045 Dipropylene glycol 3.03 Methyl propanediol 2 Caprylic/capric triglyceride 1.500025 Olive oil 0.8 1,2-hexanediol 0.7235 Polysorbate 60 0.7 Sorbitan stearate 0.6475 Arginine 0.13 Carbomer 0.13 Hydroxyl ethyl cellulose 0.13 Allantoin 0.1 Trehalose 0.1 Green tea extract 0.07 Butylene glycol 0.07 Ginger extract 0.07 Glycyrrhiza Glabra (Licorice) 0.07 root extract Coptis Chinensis root extract 0.07 Sucrose cocoate 0.0525 Ethylhexylglycerin 0.05 Dipotassium glycyrrhizate 0.03 Disodium EDTA 0.02 Tocopheryl acetate 0.02 Panthenol 0.02 Ceramide NP 0.000001 Sodium hyaluronate 0.01 Xylitylglucoside 0.004 Anhydroxylitol 0.0028 Xylitol 0.0012 Glucose 0.0004 Hydrogenated lecithin 0.000005 Fragrance 0.012 Cholesterol 0.000001 Purified water Balance
[0133] Although the present invention has been described with reference to the embodiments, the scope of the present invention is not limited to these embodiments. Any person skilled in the art will appreciate that various modifications and changes are possible without departing from the spirit and scope of the present invention and these modifications and changes also fall within the scope of the present invention.