Human type 55 replication defective adenovirus vector, method for preparing same and uses thereof

10760096 ยท 2020-09-01

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided are a human type 55 replication defective adenovirus vector, a method for preparing the same and uses thereof. The human type 55 replication defective adenovirus vector is prepared by the following method: knocking out E1 and E3 genes from Ad55, substituting the open reading frame 6 or the open reading frames 2, 3, 4, 6, and 6/7 of E4 gene in Ad55 genome with the corresponding open reading frames of Ad5 genome. In addition, an exogenous gene expression cassette may also be integrated into the E1 gene region of Ad55.

Claims

1. A human type 55 replication defective adenovirus vector, comprising type 55 adenovirus (Ad55) genome, wherein: E1 and E3 genes of Ad55 are knocked out from the Ad55 genome, and open reading frames 2, 3, 4, 5 and 6 of E4 gene in the Ad55 genome are substituted with corresponding open reading frames of type 5 adenovirus (Ad5) genome.

2. The human type 55 replication defective adenovirus vector of claim 1, wherein the vector further comprises an exogenous gene expression cassette which is integrated into a region of Ad55, wherein E1 gene is knocked out from the region.

3. The human type 55 replication defective adenovirus vector of claim 2, wherein the exogenous gene expression cassette is engineered to transcribe genes in a reverse direction relative to the E1 gene of said Ad55 genome.

4. The human type 55 replication defective adenovirus vector of claim 2, wherein the exogenous gene expression cassette comprises nucleotide sequences encoding peptides for inducing immunological responses in human, generating biological reporters and/or tracking molecules.

5. A pharmaceutical composition comprising the human type 55 replication defective adenovirus vector of claim 1 for the preparation of prophylactic or therapeutic reagents against human Ad55 infections.

6. A pharmaceutical composition comprising the human type 55 replication defective adenovirus vector of claim 2 for the preparation of prophylactic or therapeutic reagents against human Ad55 infections.

7. A method for preparing the human type 55 replication defective adenovirus vector of claim 1, comprising the following steps: S1. amplifying homologous recombination arms of the E1 gene region of Ad55 by PCR, ligating the arms backward into a vector with Kana.sup.R gene, linearizing the vector, obtaining a genomic plasmid pAd55E1E3-Kana through homologous recombination of the linearized vector with pAd55E3 which is linearized by partial digestion; S2. amplifying homologous recombination arms of the E1 gene region of Ad55 by PCR, ligating the arms forward into a vector with Kana.sup.R gene, linearizing the vector, obtaining a genomic plasmid pAd55E1E3 through homologous recombination of the linearized vector with the linearized pAd55E1E3-Kana; S3. amplifying Ad5 E4 Orf2-6 and Ad55 E4 genes by PCR, substituting the corresponding E4 gene region of Ad55 with Ad5 E4Orf2-6 to obtain p55E4(5E4), linearizing the p55E4(5E4), obtaining a genomic plasmid pAd55E1E3(5E4) through homologous recombination of the linearized p55E4(5E4) with the linearized pAd55E1E3; and S4. amplifying Ad5 E4Orf6 by PCR, substituting the corresponding E4 gene region of Ad55 with the Ad5 E4Orf6 to obtain p55E4(5Orf6), linearizing the p55E4(5Orf6), obtaining a genomic plasmid pAd55E1E3(5Orf6) through homologous recombination of the linearized p55E4(5Orf6) with the linearized pAd55E1E3.

8. The method of claim 7, wherein the step S1 comprises amplifying homologous recombination arms L-delE1 and R-delE1 of the E1 gene by PCR using the Ad55 genome as a template, ligating the arms into a pVax vector after digestion to obtain pVax-delE1(L+R), linearizing the pVax-delE1(L+R), obtaining the genomic plasmid pAd55E1E3-Kana with the E1 and E3 genes knocked out and a unique restriction site PmeI introduced through homologous recombination of the linearized pVax-delE1(L+R) with pAd55E1E3 linearized by partial digestion and ampicillin and kanamycin dual-resistance screening.

9. The method of claim 7, wherein the step S2 comprises: amplifying homologous recombination arms L-delK(E1) and R-delK(E1) of the E1 gene by PCR using the Ad55 genome as a template, ligating the arms into a pVax vector after digestion to obtain pVax-delK(E1), linearizing the pVax-delK(E1), obtaining the genomic plasmid pAd55E1E3 with the E1, E3 and kanamycin genes knocked out and a unique restriction site PmeI introduced through homologous recombination of the linearized pVax-delK(E1) with the linearized pAd55E1E3-Kana.

10. The method of claim 7, wherein the step S3 comprises: amplifying Ad5 E4Orf2-6 and Ad55 E4 by PCR using the Ad5 and Ad55 genomes as templates respectively, ligating the Ad55 E4 into a T vector to obtain p55E4, further removing Ad55 E4Orf2-6 by PCR using the p55E4 as a template, then ligating the PCR product with the Ad5 E4Orf2-6 to obtain p55E4(5E4), linearizing the p55E4(5E4), and obtaining pAd55E1E3(5E4) through homologous recombination of the linearized p55E4(5E4) with the linearized pAd55E1E3.

11. The method of claim 7, wherein the step S4 comprises: amplifying Ad5 E4Orf6 by PCR using the Ad5 genome as a template, removing Ad55 E4Orf6 from p55E4 by PCR, ligating the two PCR products to obtain p55E4(5Orf6), linearizing the p55E4(5Orf6), obtaining pAd55E1E3 (5Orf6) through homologous recombination of the linearized p55E4(5Orf6) with the linearized pAd55E1E3.

12. A method for preparing the human type 55 replication defective adenovirus vector of claim 2, comprising the following steps: S1. amplifying homologous recombination arms of the E1 gene region of Ad55 by PCR, ligating the arms backward into a vector with Kana.sup.R gene, linearizing the vector, obtaining the genomic plasmid pAd55E1E3-Kana through homologous recombination of the linearized vector with pAd55E3 which is linearized by partial digestion; S2. amplifying homologous recombination arms of the E1 gene region of Ad55 by PCR, ligating the arms forward into a vector with Kana.sup.R gene, linearizing the vector, obtaining the genomic plasmid pAd55E1E3 through homologous recombination of the linearized vector with the linearized pAd55E1E3-Kana; S3. amplifying Ad5 E4 Orf2-6 and Ad55 E4 genes by PCR, substituting the corresponding E4 gene region of Ad55 with Ad5 E4Orf2-6 to obtain p55E4(5E4), linearizing the p55E4(5E4), obtaining a genomic plasmid pAd55E1E3(5E4) through homologous recombination of the linearized p55E4(5E4) with the linearized pAd55E1E3; and S4. amplifying Ad5 E4Orf6 by PCR, substituting the corresponding E4 gene region of Ad55 with the Ad5 E4Orf6 to obtain p55E4(5Orf6), linearizing the p55E4(5Orf6), obtaining a genomic plasmid pAd55E1E3(5Orf6) through homologous recombination of the linearized p55E4(5Orf6) with the linearized pAd55E1E3; S5. amplifying homologous recombination arms SE1L and SE1R of the E1 gene region by PCR using the Ad55 genome as a template, digesting the arms and ligating the digested products into a pVax vector to obtain pSE1LR; producing an exogenous gene expression cassette CMV-EGFP-BGH by PCR using pGA1-EGFP as a template, digesting pSE1LR and CMV-EGFP-BGH, ligating the two digested products to obtain pGK551-EGFP, linearizing pGK551-EGFP, obtaining pAd55E1E3(5E4)-EGFP and pAd55E1E3(5Orf6)-EGFP through homologous recombination of the linearized pGK551-EGFP with the linearized pAd55E1E3(5E4) and pAd55E1E3(5Orf6), respectively, then transfecting the pAd55E1E3(5E4)-EGFP and pAd55E1E3(5Orf6)-EGFP into 293 cells after further linearization, culturing the transfected cells and obtaining human type 55 replication defective adenovirus vectors by centrifugal purification afterwards.

13. The method of claim 12, wherein the step S1 comprises amplifying homologous recombination arms L-delE1 and R-delE1 of the E1 gene by PCR using the Ad55 genome as a template, ligating the arms into a pVax vector after digestion to obtain pVax-delE1(L+R), linearizing the pVax-delE1(L+R), obtaining the genomic plasmid pAd55E1E3-Kana with the E1 and E3 genes knocked out and a unique restriction site PmeI introduced through homologous recombination of the linearized pVax-delE1(L+R) with pAd55E1E3 linearized by partial digestion and ampicillin and kanamycin dual-resistance screening.

14. The method of claim 12, wherein the step S2 comprises: amplifying homologous recombination arms L-delK(E1) and R-delK(E1) of the E1 gene region by PCR using the Ad55 genome as a template, ligating the arms into a pVax vector after digestion to obtain pVax-delK(E1), linearizing the pVax-delK(E1), obtaining the genomic plasmid pAd55E1E3 with the E1, E3 and kanamycin genes knocked out and a unique restriction site PmeI introduced through homologous recombination of the linearized pVax-delK(E1) with the linearized pAd55E1E3-Kana.

15. The method of claim 12, wherein the step S3 comprises: amplifying Ad5 E4Orf2-6 and Ad55 E4 by PCR using the Ad5 and Ad55 genomes as templates respectively, ligating the Ad55 E4 into a T vector to obtain p55E4, further removing Ad55 E4Orf2-6 by PCR using the p55E4 as a template, then ligating the PCR product with the Ad5 E4Orf2-6 to obtain p55E4(5E4), linearizing the p55E4(5E4), and obtaining pAd55E1E3(5E4) through homologous recombination of the linearized p55E4(5E4) with the linearized pAd55E1E3.

16. The method of claim 12, wherein the step S4 comprising of: amplifying Ad5 E4Orf6 by PCR using the Ad5 genome as a template, removing Ad55 E4Orf6 from p55E4 by PCR, ligating the two PCR products to obtain p55E4(5Orf6), linearizing the p55E4(5Orf6), obtaining pAd55E1E3 (5Orf6) through homologous recombination of the linearized p55E4(5Orf6) with the linearized pAd55E1E3.

Description

DESCRIPTION OF THE DRAWINGS

(1) FIG. 1A shows the principle of knocking out E1 gene from pAd55E3 using dual-resistance screening technology. FIG. 1B shows the detection of R-delE1 fragments in pVAX-delE1(L+R) by PCR assay (M2: DNA Ladder 2000; 1# to 8#: different pVAX-delE1(L+R) clones; 9#: positive control). FIG. 1C shows the endonuclease digestion analysis of pAd55E1E3-Kana with HindIII and BamHI (M1: DNA Ladder 15000; 1# to 6#: different pAd55E1E3-Kana clones; M2: DNA Ladder 2000).

(2) FIG. 2A shows the principle of knocking out kana.sup.R gene from pAd55E1E3-Kana. FIG. 2B shows the detection of R-delK fragments in pVAX-delK(E1) by PCR assay (M2: DNA Ladder 2000; 1# to 5#: different pVAX-delK(E1) clones; 6#: positive control). FIG. 2C shows the endonuclease digestion analysis of pAd55E1E3 whereof kana.sup.R gene is knocked out (M1: DNA Ladder 15000; 1# to 8#: different pAd55E1E3-Kana clones, the correct clones are marked by arrows; M2: DNA Ladder 2000).

(3) FIG. 3A shows the principle of replacement of E4 Orf6 and E4 Orf2-6 of pAd55E1E3 with Ad5 E4 Orf6 and Ad5 E4 Orf2-6 respectively. FIG. 3B shows the endonuclease digestion analysis of p55E4(5Orf6) with EcoRV and MluI, and the endonuclease digestion analysis of p55E4(5E4) with EcoRV and HindIII (DL15000: DNA Ladder 15000; 1# to 6#: different p55E4(5Orf6) clones and p55E4(5E4) clones). FIG. 3C shows the endonuclease digestion analysis of the pAd55E1E3(5Orf6) and pAd55E1E3(5E4) with HindIII (DL2000: DNA Ladder 2000; pAd55E3 and pAd55E1E3 are used as controls; 1#, 2#: different pAd55E1E3(5Orf6) clones and pAd55E1E3(5E4) clones; DL15000: DNA Ladder 15000.

(4) FIG. 4A shows the process of constructing pAd55E1E3(5Orf6)-EGFP and pAd55E1E3(5E4)-EGFP with exogenous gene expression cassettes. FIG. 4B shows the detection of EGFP in pGK551-EGFP by PCR assay (DL2000: DNA Ladder 2000; 1# to 4#: different pGK551-EGFP clones). FIG. 4C shows the endonuclease digestion analysis of pAd55E1E3(5Orf6)-EGFP and pAd55E1E3(5E4)-EGFP with HindIII (DL15000: DNA Ladder 15000; pAd55E1E3-EGFP and pAd55E3-EGFP are used as controls).

(5) FIG. 5A shows the purification of Ad55E1E3(5E4), Ad55E1E3 (5 Orf6), Ad55E1E3(5E4)-EGFP, and Ad55E1E3(5Orf6)-EGFP by cesium chloride density gradient centrifugation. FIG. 5B shows the results of titration of these viruses.

(6) FIG. 6 shows the plaques formed by replication defective Ad55 vectors in 293 and A549 cells. Replication competent Ad55E3-EGFP is used as control. For each type of cells, the upper panel shows the graphs taken under fluorescence field, and the bottom panel shows the graphs taken under bright field.

(7) FIG. 7A shows the immunization schedules for assessing the immunogenicity of replication defective Ad55 vectors. FIG. 7B shows the neutralizing antibody responses elicited by inactive Ad55, replication competent Ad55 and replication defective Ad55 in mice at 3 weeks after the first immunization. FIG. 7C shows the neutralizing antibody responses elicited by inactive Ad55, replication competent Ad55 and replication defective Ad55 in mice at 2 weeks after the second immunization.

(8) FIG. 8A shows the genomic structure of replication defective Ad55 vectors harboring GP gene of Ebola virus. FIG. 8B shows the detection of Ad55-GP(ZG) and Ad55-GP(ZM) by PCR assay. FIG. 8C shows the Western-blot analysis of GP expression in 293 cells infected with Ad55-GP(ZG) and Ad55-GP(ZM). FIG. 8D shows the results of production and purification of replication defective Ad55 expressing GP derived from ebola virus.

DETAILED DESCRIPTION OF THE INVENTION

(9) The present invention discloses a method for preparing a human type 55 replication defective adenovirus vector. The preparation method and construction idea of the adenovirus vector of the invention can be applied to developing vaccines against adenovirus and other pathogenic viruses, screening anti-adenovirus drugs and neutralizing antibodies, and developing biological reporter-tracer systems.

(10) The term human type 55 adenovirus in the present invention refers to type 55 adenovirus known to one skilled in the art, and the Ad55 genome used in the embodiments is also derived from these known human type 55 adenoviruses. The human type 55 replication defective adenovirus vector of the present invention is not limited to the particular clinical isolates employed in the embodiments.

(11) The term exogenous sequence of the present invention refers to any DNA sequence not derived from Ad55. One skilled in the art should recognize that the exogenous sequence may be an exogenous gene expression cassette, or a shRNA or miRNA expression cassette.

(12) In the following embodiments, the exogenous gene expression cassette may comprise a eukaryotic promoter, an exogenous gene coding sequence and a transcription terminator, as understood by one skilled in the art. The exogenous gene coding sequence may be, but is not limited to, a coding sequence of green fluorescent protein, other viral antigens, or shRNA etc.

(13) In order to provide a clearer understanding of the technical solution of the present invention, the following embodiments are given in detail with reference to drawings. It is to be understood that the embodiments are merely illustration of the invention and are not intended to limit the scope of the invention. Experimental methods not specified in the following embodiments are generally carried out according to conventional conditions, such as those described in Molecular Cloning: Laboratory Manual (Sambrook, et al, 1989, New York, Cold Spring Harbor Laboratory Press), or suggested by the manufacturers. Chemical agents used in the embodiments are commercially available.

(14) Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly understood by one skilled in the art. The terminology used in the specification of the present invention is for the purpose of describing particular embodiments only and is not intended to limit the invention.

Example 1

Knockout of E1 Gene and Construction of Plasmid pAd55E1E3-Kana

(15) 1. Construction of Shuttle Plasmid pVax-delE1(L+R) with the E1 Gene Knocked Out

(16) The Ad55 genome was used as the PCR template to amplify and obtain the recombinant arms L-delE1 and R-delE1.

(17) L-delE1 primer sequence:

(18) TABLE-US-00001 L-delE1F, (SEQIDNO.1) ATAGAATTCGGGGTGGAGTGTTTTTGCAAG; L-delE1R, (SEQIDNO.2) TTTACTAGTGTTTAAACGTAATCGAAACCTC CACGTAATGG.

(19) PCR program: 95 C., 30 s; 62 C., 30 s; 72 C., 20 s; 25 circles.

(20) R-arm primer sequence:

(21) TABLE-US-00002 R-delE1F, (SEQIDNO.3) ATTTCTAGAGTTTAAACGAGACCGGATCATT TGGTTATTG; R-delE1R, (SEQIDNO.4) AAAGAATTCGGGAAATGCAAATCTGTGAGGG.

(22) PCR program: 95 C., 30 s; 60 C., 30 s; 72 C., 80 s; 25 circles.

(23) The L-delE1 was digested with SpeI and EcoRI and then ligated to pVax vector (Invitrogen) which was digested with the same endonucleases to obtain pVax-L-delE1; R-delE1 was digested with EcoRI and XbaI and then ligated to the pVax-L-delE1 digested with the same endonucleases to obtain shuttle plasmid pVax-delE1(L+R) with the E1 gene knocked out. Detection of R-delE1 in pVAX-delE1(L+R) by PCR assay were shown in FIG. 1B.

(24) 2. Construction of Plasmid pAd55E1E3-Kana

(25) The pVax-delE1(L+R) was linearized by EcoRI and the pAd55E3 was linearized by PacI, then the two linearized plasmids were co-transformed into BJ5183 competent cells (Stratagene); after screening with ampicillin and kanamycin, the plasmids were extracted, and further transformed into XL-Blue competent cells (Peking Baihui Biotechnology Co., Ltd.); the plasmids were extracted to obtain plasmid pAd55E1E3-Kana. Restriction maps were constructed using multiple groups of restriction endonuclease. Two PmeI restriction sites were introduced in original E1 gene region of adenovirus genome of the achieved plasmid pAd55E1E3-Kana in order to facilitate subsequent cloning. See a schematic of plasmid construction in FIG. 1A and endonuclease digestion results of pAd55E1E3-Kana with HindIII and BamHI in FIG. 1C.

Example 2

Knockout of Kana.SUP.R .Gene and Construction of Plasmid pAd55E1E3

(26) 1. Construction of shuttle plasmid pVax-delK(L+R) with Kana.sup.R-gene knocked out.

(27) The Ad55 genome was used as the PCR template to amplify and obtain recombinant aims L-delK and R-delK.

(28) L-delK primer sequence:

(29) TABLE-US-00003 L-delKF, (SEQIDNO.5) ATAACTAGTGGGGTGGAGTGTTTTTGCAAG; L-delKR, (SEQIDNO.6) TTTGAATTCGTTTAAACGTAATCGAAACCTCC ACGTAATGG.

(30) PCR program: 95 C., 30 s; 61 C., 30 s; 72 C., 20 s; 25 circles.

(31) R-delK primer sequence:

(32) TABLE-US-00004 R-delKF, (SEQIDNO.7) ATCGTTTAAACGAGACCGGATCATTTGGTTATTG; R-delKR, (SEQIDNO.8) ATCTCTAGAGGGAAATGCAAATCTGTGAGGG.

(33) PCR program: 95 C., 30 s; 60 C., 30 s; 72 C., 80 s; 25 circles.

(34) The L-delK was digested with SpeI and EcoRI and then ligated to pVax vectors (Invitrogen) digested with the same endonucleases to obtain pVax-L-delK; R-delK was digested with EcoRI and XbaI and then ligated to the pVax-L-delE3 digested with the same endonucleases to obtain shuttle plasmid pVax-delK(L+R) of which the Kana.sup.R gene was knocked out. Detection of R-delK in pVAX-delK(E1) by PCR assay were shown in FIG. 2B.

(35) 2. Construction of Plasmid pAd55E1E3

(36) The pVax-delK(L+R) was linearized with SpeI and XbaI, and the pAd55E1E3-Kana was linearized with PmeI, the two linearized plasmids were then co-transformed into BJ5183 competent cells (Stratagene), then the plasmids were extracted and transformed into XL-Blue competent cells (Peking Baihui Biotechnology Co., Ltd.), then the plasmids were extracted and indentified by restriction analysis. The genomic plasmid pAd55E1E3 was obtained, wherein the Kana.sup.R gene was removed and unique restriction site PmeI was introduced in the E1 region. See a schematic of plasmid construction in FIG. 2A and endonuclease digestion results of pAd55E1E3 in FIG. 2C.

Example 3

Modification of Ad55E4 Gene and Construction of pAd55E1E3(5Orf6) and pAd55E1E3 (5E4)

(37) 1. Construction of Shuttle Plasmid with Ad55E4 Gene Modified

(38) 1) The Ad55 genome was used as the PCR template to amplify and obtain Ad55E4 gene, and the primers used were as follows:

(39) TABLE-US-00005 R-de1E3Mlu, (SEQIDNO.9) GATCACGCGTGGACTAAGAGACCTGCTAC CCATG; L-delKR, (SEQIDNO.10) TGTAGATCTGTTTAAACCTTTAGCCCCATTAC GTCAGTTTAG.

(40) PCR program: 95 C., 30 s; 61 C., 30 s; 72 C., 4 min; 25 circles.

(41) The PCR products were phosphorylated, and were ligated to blunt-ended T vectors (TaKaRa) to obtain p55E4.

(42) 2) The p55E4 plasmid was used as the PCR template to amplify and obtain linearized p55E4 with SapI restriction site introduced at the ends and Ad55 E4 Orf6 gene removed.

(43) TABLE-US-00006 Sap-p55E4R, (SEQIDNO.11) TTACGCTCTTCCTAGCCGTGATCCAGACT CCGG; Sap-p55E4orf6F, (SEQIDNO.12) AGCTGCTCTTCCCATTCTCGTATTTTGTA TAGCAAAACG.

(44) PCR program: 95 C., 30 s; 63 C., 30 s; 72 C., 5 min; 25 circles.

(45) Ad5 E4 Orf6 gene with SapI site at the ends was obtained by PCR using Ad5 genome as template.

(46) TABLE-US-00007 Sap-5ORF6F, (SEQIDNO.13) AATAGCTCTTCCCTACATGGGGGTAGAGTC ATAATCG Sap-5ORF6R, (SEQIDNO.14) ACTAGCTCTTCCATGACTACGTCCGGCG TTCC.

(47) PCR program: 95 C., 30 s; 61.5 C., 30 s; 72 C., 45 s; 25 circles.

(48) The linearized p55E4 and Ad5 E4Orf6 were digested with SapI and then ligated with each other to obtain p55E4 (5Orf6).

(49) 3) Similarly, the p55E4 plasmid was used as the PCR template to amplify and obtain linearized p55E4 with SapI restriction site and Ad55 E4Orf(2-6) gene knocked out. The primers used were as follows:

(50) TABLE-US-00008 Sap-p55E4R, (SEQIDNO.11) TTACGCTCTTCCTAGCCGTGATCCAGA CTCCGG; Sap-p55E4orf2F, (SEQIDNO.15) ATAGCTCTTCCCATTGTTAGTTTTGAAT GAGTCTGCA;

(51) PCR program: 95 C., 30 s; 61.5 C., 30 s; 72 C., 4 min; 25 circles.

(52) Ad5 E4Orf(2-6) with SapI site at the ends was obtained by PCR using Ad5 genome as template.

(53) TABLE-US-00009 Sap-5ORF6F, (SEQIDNO.13) AATAGCTCTTCCCTACATGGGGGTAGAG TCATAATCG; Sap-5ORF2R, (SEQIDNO.16) ATATGCTCTTCCATGCAGAAACCCGCA GACATG.

(54) PCR program: 95 C., 30 s; 61 C., 30 s; 72 C., 2 min; 25 circles.

(55) The linearized p55E4 and Ad5 E4Orf(2-6) fragments were digested with SapI and then ligated with each other to obtain p55E4(5E4).

(56) 2. Construction of pAd55E1E3(5Orf6) and pAd55E1E3(5E4).

(57) The p5E4(5Orf6) and p55E4(5E4) were linearized with MluI and PmeI, and the pAd55E1E3 was linearized with PsiI, then the linearized fragments were co-transformed into BJ5183 competent cells to obtain genomic plasmids pAd55E1E3(5Orf6) and pAd55E1E3 (5E4) with E1 and E3 genes knocked out and E4 gene modified through recombination. See a schematic of plasmid construction in FIG. 3A and endonuclease digestion results in FIGS. 3B and 3C. FIG. 3B shows the endonuclease digestion analysis of p55E4(5Orf6) with EcoRV and MluI, and p55E4(5E4) with EcoRV and HindIII. FIG. 3C shows the endonuclease digestion analysis of the pAd55E1E3(5Orf6) and pAd55E1E3(5E4) with HindIII.

Example 4

Construction of Shuttle Plasmid with Exogenous Genes, and Replication Defective Ad55 Genomic Plasmids Such as pAd55E1E3(5Orf6)-EGFP and the Like

(58) 1. Construction of Shuttle Plasmid pGK551-EGFP with Exogenous Gene Expression Cassette.

(59) 1) Ad55 genome was used as the PCR template to amplify and obtain homologous recombination aims SE1L and SE1R.

(60) SE1L primer sequences:

(61) TABLE-US-00010 SElLF, (SEQIDNO.17) AATGGTACCGGGGTGGAGTGTTTTTGCAAG; SElLR, (SEQIDNO.18) ATCGTAATCGAAACCTCCACGTAATGG.

(62) PCR program: 95 C., 30 s; 61 C., 30 s; 72 C., 30 s; 25 circles.

(63) SE1R primer sequences:

(64) TABLE-US-00011 SE1RF, (SEQIDNO.19) AACACTAGTGAGACCGGATCATTTGGTTATTG: SE1RR, (SEQIDNO.20) TTAACGCGTGTATACGGGAAATGCAAATCTG TGAGGG.

(65) PCR program: 95 C., 30 s; 60 C., 30 s; 72 C., 1 min 30 s; 25 circles.

(66) 2) Construction of shuttle plasmids pSE1LR.

(67) pSE3LR and SE1L were digested with KpnI and EcoRV, and then ligated with each other to obtain pSE1L; the pSE1L and SE1R were digested with SpeI and MluI, and then ligated with each other to obtain pSE1LR.

(68) 3) Construction of shuttle plasmids pGK551-EGFP and the like with exogenous gene expression cassette.

(69) CMV-EGFP-BGH expression cassette was obtained using pGA1-EGFP as template and the following primer by PCR.

(70) TABLE-US-00012 CMV, (SEQIDNO.21) AGATATACGCGTTGACATTGATTATTGACTAG; BGH, (SEQIDNO.22) GCTGGTTCTTTCCGCCTCAGAAG.

(71) PCR program: 95 C., 30 s; 66 C., 30 s; 72 C., 1 min 45 s; 25 circles.

(72) pSE1LR was digested with SpeI and EcoRV, and CMV-EGFP-BGH was digested with SpeI, then they were ligated with each other to obtain target shuttle plasmid pGK551-EGFP. Detection of EGFP in pGK551-EGFP by PCR assay were shown in FIG. 4B.

(73) 2. Construction of Genomic Plasmid pAd55E1E3(5Orf6)-EGFP and the Like.

(74) pG551-EGFP was digested with BstZ17I and SgrAI and recovered by ethanol precipitation; and the pAd55E1E3(5Orf6) and pAd55E1E3(5E4) were linearized with PmeI and then recovered by ethanol precipitation; then the linearized fragments were co-transformed into BJ5183 to obtain plasmids pAd55E1E3(5Orf6)-EGFP and pAd55E1E3(5E4)-EGFP with exogenous gene expression cassette through homologous recombination. See a schematic of detailed construction process in FIG. 4A and endonuclease digestion results in FIG. 4C.

Example 5

Rescue and Production of Replication Defective Ad55 Vector

(75) According to a conventional method, the pAd55E1E3(5Orf6)-EGFP and pAd55E1E3(5E4)-EGFP were linearized with AsiSI and recovered by ethanol precipitation, respectively, and then transfected into 293 cells through cationic liposome. 8 hours after transfection, 2 ml DMEM medium containing 5% fetal bovine serum was added and incubated for 7-10 days, the cell pathogenesis was observed. Subsequently, the cells and culture supernatant were collected, repeatedly freezed and thawed for 3 times in the water bath of 37 C. and liquid nitrogen, and then the cellular debris were removed by centrifugation. The supernatants were added into a 10 cm dish cell cultures. 2-3 days later, the cells and culture supernatant were collected, then the cellular debris were removed by repeated freezing and thawing for 3 times and centrifugation, the supernatants were added into 6-10 15 cm dishes; 2-3 days later, the cells were collected, then the cellular debris were removed by repeated freezing and thawing for 3 times and centrifugation, the supernatants were added into a centrifuge tube of cesium chloride density gradient and centrifuged for 4 hours at 4 C., 35000 rpm; the virus band was separated, desalted and packed; the virus titer was determined by OD260 absorbance under the formula i.e. virus concentration=OD260dilution factor36/genome length (kb); the virus solution was stored at 80 C. Purification of the replication defective Ad55 vectors h cesium chloride density gradient centrifugation were shown in FIG. 5A. Values of the virus titer were shown in FIG. 5B.

Example 6

Replication Assay of Replication Defective Ad55 Virus in A549 and 293 Cells

(76) According to a conventional method, the replication capability of replication defective Ad55 vectors in helper cells 293 and non-helper cell A549 was examined by plaque-forming assay. 90% confluent 293 and A549 cells in 6-well plate were infected with Ad55E1E3(5Orf6)-EGFP, Ad55E1E3(5E4)-EGFP or Ad55E3-EGFP at a dose of 110.sup.7Vp per well. 4 hours after infection, the culture medium was removed and the cells were coated with 1% agarose gel (containing 1% agarose, 5% fetal bovine serum, 1MEM medium). After 10-12 days' incubation in an incubator at 37 C., the virus plaques were observed with fluorescence microscope and the graphs were taken. The results were shown in FIG. 6. Because Ad55E3-EGFP retained complete E1 gene, it formed typical plaques in both 293 and A549 cells. However, replication defective Ad55E1E3(5Orf6)-EGFP and Ad55E1E3(5E4)-EGFP formed plaques only in 293 cells, but not in A549 cells. These results suggested that replication defective Ad55 vectors efficiently replicated in 293 cells, but could not replicate in non-helper human cells such as A549 cells, and thus exhibiting an attenuated phenotype. Moreover, the results also showed that human type 55 replication defective adenovirus vectors could carry reporter genes into target cells and thus could be used in reporter-tracer systems.

Example 7

Immunogenicity Evaluation of Replication Defective Ad55 Vectors in Mice

(77) Immunogenicity of replication defective Ad55 was evaluated according to the immunization protocol shown in FIG. 7A.

(78) Balb/c mice at 6-8 weeks of age were divided into 9 groups, each group had 5 mice. On day 0, 8 groups of mice were injected intramuscularly with heat-inactived Ad55E3-EGFP, Ad55E3-EGFP, Ad55E1E3(5Orf6)-EGFP and Ad55E1E3(5E4) at a dose of either 110.sup.8Vp per mice or 110.sup.10Vp per mice, respectively. One group of mice was immunized with Ad5E1E3 as control. On day 21, blood samples were collected from orbit and the serum was separated. Meanwhile, the mice were boosted with respective vaccines according to the above protocol. On day 35, the mice were sacrificed and the serum samples were collected. At last, the level of anti-Ad55 neutralizing antibodies in the serums was measured.

(79) According to a conventional method, Ad55E3-SEAP and Ad5-SEAP were used as reporter viruses to detect the neutralizing antibodies against Ad55 and Ad5 in mice serum, respectively. 293 cells were seeded onto 96-well plates. The mice serum was serially diluted with medium free of phenol and serum. The Ad55E3-SEAP or Ad5-SEAP were co-incubated with serum dilutions at a dose of 110.sup.7Vp per sample at 37 C. for an hour, and added to the cell culture plate. After incubation for 24 hours, 50 l of culture supernatants were transferred to 96-well black plate. The Phospha-Light system (Applied Biosystem) was used to detect the ralative light units (shown on the fluorescence illuminometer), and the neutralizing antibody titer was calculated based on the relative light units. The immunized mice could generate Ad55 neutralizing antibody after the primary immunization the neutralization antibody titer in mice was shown in FIG. 7B, and the antibody level increased significantly after the booster immunization, the neutralization antibody titer in mice was shown in FIG. 7C. The titer of the neutralizing antibody induced by inactivated Ad55 was relatively lower than other groups. The titer of the neutralizing antibodies induced by Ad55E1E3(5Orf6)-EGFP and Ad55E1E3(5E4)-EGFP were slightly higher than that induced by Ad55E3-EGFP. These results suggested that replication defective Ad55 vectors were potentially useful in anti-Ad55 vaccine development.

Example 8

Application of Replication Defective Ad55 Vectors in Anti-Ebola Vaccine Development

(80) According to the methods described in Examples 4 and 5, the coding sequences for glycoprotein (GP) of Ebola virus (two strains of Zaier subtype, Guinea 2014 and Maynia1976, which were designated as GP (ZG) and GP (ZM) respectively) were codon optimized and cloned into shuttle plasmid pGK551 to obtain pGK551-GP(ZG) and pGK551-GP(ZM). The shuttle plasmids were then linearized with BstZ17I and SgrAI, and recombined with pAd55E1E3(5E4) linearized with PmeI to obtain pAd55-GP(ZG) and pAd55-GP(ZM), respectively. The genomic structure of the replication defective Ad55 vectors harboring GP gene of Ebola virus was illuminated by FIG. 8A. pAd55 GP(ZG) and pAd55-GP(ZM) were further linearized with AsiSI and then transfected into 293 cells. The replication defective Ad55 vectors carrying the Ebola envelope antigen could be rescued and propagated. Ad55-GP(ZG) and Ad55-GP(ZM) were detected by PCR assay (see FIG. 8B), concentration and gross of Ad55-GP(ZG) and Ad55-GP(ZM) produced were determined (see FIG. 8D). The vectors could efficiently express Ebola virus envelope antigen in target cells see FIG. 8C). The results suggested that replication defective Ad55 vectors could be used in studying vaccines against other pathogens.

(81) The examples described above are merely illustrations of several embodiments of the present invention, and the specific and detailed description are not intended to limit the scope of the invention. It should be noted that within the scope of the present invention, various modifications and variations are possible in light of the above teachings for those skilled in the art. Accordingly, the scope of the present invention should be determined by the appended claims.