DNA aptamer that binds to vWF

10760083 ยท 2020-09-01

Assignee

Inventors

Cpc classification

International classification

Abstract

The purpose of the present invention is to provide an aptamer for vWF, which is superior in a binding ability, a dissociation rate, and/or stability to the conventional nucleic acid aptamers. The present invention can solve the problem by a DNA aptamer which contains artificial nucleotides and binds to vWF.

Claims

1. A DNA aptamer that binds to a vWF protein comprising the nucleotide sequence (i) or (ii) below: (i) the nucleotide sequence as shown in SEQ ID NO: 18 or 21; or (ii) a nucleotide sequence with 75% or more sequence identity to the nucleotide sequence as shown in SEQ ID NO: 18 or 21, wherein an addition, deletion, and/or substitution occurs in the nucleotide sequence as shown in SEQ ID NO: 18 or 21 at position(s) other than that of 7-(2-thienyl)-3H-imidazo[4,5-b]pyridin-3-yl.

Description

BRIEF DESCRIPTION OF DRAWINGS

(1) FIG. 1-1 shows the putative secondary structures of the DNA aptamers prepared in Example 3. On the basis of vWF1-DsDsDs (SEQ ID NO: 1) shown as a, 3-terminal Ds was substituted with A to prepare vWF1-DsDsA (SEQ ID NO: 2) shown as b, internal Ds was substituted with A to prepare vWF1-DsADs (SEQ ID NO: 3) shown as c, 5-terminal Ds was substituted with A to prepare vWF1-ADsDs (SEQ ID NO: 4) shown as d, and internal Ds and 3-terminal Ds were each substituted with A to prepare vWF1-DsAA (SEQ ID NO: 5) shown as e. An artificial base (Ds) is boxed and a site at which Ds is substituted with A is shown by an arrow head. In the figure, bold lines indicate bases capable of forming Watson-Crick base pairs, and solid lines indicate base linkage via phosphodiester bond. Bold lines and solid lines are used in the same manner in FIGS. 1-2, 3, 6-1, and 6-2 below.

(2) FIG. 1-2 shows the putative secondary structures of the DNA aptamers prepared in Example 3. On the basis of vWF1-DsDsDs (SEQ ID NO: 1), 5-terminal Ds and 3-terminal Ds were both substituted with A to prepare vWF1-ADsA (SEQ ID NO: 6) shown as f, 5-terminal Ds and internal Ds were each substituted with A to prepare vWF1-AADs (SEQ ID NO: 7) shown as g, all Ds bases were each substituted with A to prepare vWF1-AAA (SEQ ID NO: 8) shown as h, and 3-terminal Ds was substituted with A and the AT pair was removed from the terminal stem region to prepare vWF1-R1Ds (SEQ ID NO: 9) shown as i. As a positive control, an existing vWF-binding DNA aptamer (i.e., ARC1172; SEQ ID NO: 10) shown as j was also prepared. An artificial base (Ds) is boxed and a site at which Ds is substituted with A is shown by an arrow head.

(3) FIG. 2 shows the results of gel shift assays of the DNA aptamers prepared in Example 3 for binding to the A1 domain of vWF protein. In FIG. 2A, DNA bands were detected with electrophoresis by SYBR Gold. In FIG. 2B, the shifting ratio (binding ratio) of each oligonucleotide is graphed as a relative shifting ratio, when the gel shifting ratio of ARC1172 is designated as 1.0 (i.e., shifting ratio means that the ratio of the complex band when the signal of all bands in a particular lane is designated as 100%). The binding reaction was carried out at 37 C. and electrophoresis was carried out at 4 C. The complex refers to the DNA aptamer bound to the vWF A1 domain, and the free refers to a free DNA aptamer. a to j show the results obtained with the use of the aptamers a to j, respectively, shown in FIG. 1-1 and FIG. 1-2.

(4) FIG. 3 shows the secondary structures of the DNA aptamers used for binding activity assay via SPR in Example 4. On the basis of vWF1-DsDsDs (SEQ ID NO: 1) shown as a, 3 Ds bases were each substituted with A to prepare vWF1-AAA (SEQ ID NO: 8) shown as h, a part of the AT pairs in the stem region was substituted with GC pairs to prepare vWF1-DsDsDs-GC (SEQ ID NO: 11) shown as k, and a mini-hairpin structure was added to the 3 terminus of vWF1-DsDsDs-GC to prepare vWF1-DsDsDs-mhGC (SEQ ID NO: 12) shown as l. Ds is boxed, a site at which Ds is substituted with A and a site at which the AT pairs are substituted with the GC pairs are each shown by an arrow head, and a site to which a mini-hairpin structure is added is boxed with an arrow head.

(5) FIG. 4 shows the results of SPR analysis of the DNA aptamers for binding to the A1 domain of the vWF protein. A shows the results of vWF1-DsDsDs, B shows the results of vWF1-DsDsDs-GC, C shows the results of vWF1-DsDsDs-mhGC, D shows the results of vWF1-AAA, and E shows the results of ARC1172.

(6) FIG. 5 shows the results of measurement of the Tm values of the DNA aptamers. A shows the normal absorbance of the DNA aptamers at each temperature and B shows the first derivatives of the normalized absorbance of the DNA aptamers at each temperature.

(7) FIG. 6-1 shows the putative secondary structures of the DNA aptamers prepared in Example 8. On the basis of vWF2-DsDsDs (SEQ ID NO: 13) shown as m, internal Ds was substituted with A to prepare vWF2-DsADs (SEQ ID NO: 14) shown as n, internal Ds and 3-terminal Ds were each substituted with A to prepare vWF2-DsAA (SEQ ID NO: 15) shown as o, and 5-terminal Ds and internal Ds were each substituted with A to prepare vWF2-AADs (SEQ ID NO: 16) shown as p. Ds is boxed and a site at which Ds is substituted with A is shown by an arrow head.

(8) FIG. 6-2 shows the putative secondary structures of the DNA aptamers prepared in Example 8. On the basis of vWF2-DsDsDs (SEQ ID NO: 13), all Ds bases were each substituted with A to prepare vWF2-AAA (SEQ ID NO: 17) shown as q, the AT pairs in the stem region were substituted with GC pairs and mini-hairpin DNA was added to the 3 terminus to prepare vWF2-DsDsDs-mhGC (SEQ ID NO: 18) shown as r, and the internal loop region of WF2-DsDsDs-mhGC (SEQ ID NO: 18) was substituted with the partial sequence of the loop (5-GAA-3) of mini-hairpin DNA to prepare vWF2-DsDsDs-2mhGC (SEQ ID NO: 21) shown as s. As a positive control, an existing vWF-binding DNA aptamer (i.e., ARC1172; SEQ ID NO: 10) shown as j was also prepared. Ds is boxed, a site at which Ds is substituted with A and a site at which the AT pairs are substituted with GC pairs are each shown by an arrow head, and a site to which a mini-hairpin structure is added and a site which is substituted with the loop region of the mini-hairpin DNA are each boxed with an arrow head.

(9) FIG. 7 shows the results of binding analysis (gel shift assays at different temperatures) of the DNA aptamers to the vWF A1 domain via gel shift assays. A to C show the results of DNA aptamer staining with SYBR GOLD upon electrophoresis at 4 C. and 300 V, 25 C. and 40 W, and 37 C. and 40 W, respectively. The complex refers to the DNA aptamer bound to the vWF A1 domain, and the free refers to a free DNA aptamer. m to s show the results obtained with the use of the aptamers m to s, respectively, shown in FIG. 6-1 and FIG. 6-2. j shows the results obtained with the use of ARC1172.

(10) FIG. 8 shows the results of binding analysis via SPR between the DNA aptamers and the A1 domain of the vWF protein. A shows the results of ARC1172, B shows the results of vWF2-DsDsDs, and C shows the results of vWF2-DsDsDs-2mhGC.

(11) FIG. 9 shows the results of analysis of stability of the DNA aptamers against nucleases in human blood serum. c at the left end of the lane indicates a control showing the results of the serum only without the addition of the DNA aptamer. An undegraded band is shown by an arrow head. A shows the results of vWF2-DsDsDs, B shows the results of vWF2-DsDsDs-mhGC, C shows the results of vWF2-DsDsDs-2mhGC, D shows the results of vWF2-AAA, and E shows the results of ARC1172.

(12) FIG. 10 shows the measurement results of the Tm values of the DNA aptamers. A shows the normal absorbance of the DNA aptamers at each temperature and B shows the first derivatives of the normalized absorbance of the DNA aptamers at each temperature.

DESCRIPTION OF EMBODIMENTS

1. Definition

(13) Definitions of general terms used herein are described below.

(14) The term nucleic acid or nucleic acid molecule used herein refers to, in principle, a biopolymer composing nucleotides as composing units ligated to each other via phosphodiester bond.

(15) The term natural nucleotide used herein refers to a nucleotide that exists in nature. Examples thereof include DNA composed of deoxyribonucleotides comprising any natural bases selected from among adenine, guanine, cytosine, and thymine, RNA composed of ribonucleotides comprising any natural bases selected from among adenine, guanine, cytosine, and thymine, and a combination thereof.

(16) The term unnatural nucleotide used herein refers to a nucleotide composed of artificial bases that does not exist in nature. Phosphoric acid groups and sugars constituting the unnatural nucleotide according to the present invention are structurally identical to the phosphoric acid groups and sugars constituting a natural nucleotide.

(17) The term artificial base or base analog used herein refers to an artificially constructed chemical substance having properties similar to those of a natural base constituting a natural nucleotide. As with a natural base, it has a base analog which can form an artificial base pair therewith (hereafter, referred to as a complementary artificial base). The term artificial base pairing used herein refers to base pairing formed of a pair of complementary artificial bases, in the same way natural bases such as adenine and thymine, adenine and uracil, or guanine and cytosine. The term artificial base pairing encompasses chemical bonding via a hydrogen bond as observed in base pairing between natural bases, physical bonding via molecular structure-based interlocking between artificial bases, and stacking effects via hydrophobic interaction.

(18) Properties similar to those of natural bases of an artificial base include properties capable of replication or transcription (including reverse transcription) of nucleic acids by complementarity caused by artificial base pairing. As with the case of natural bases, artificial bases have exclusive selectivity in artificial base pairing. In the presence of an unnatural nucleotide comprising a pair of complementary artificial bases in a substrate nucleotide, accordingly, a nucleic acid molecule comprising an unnatural nucleotide can also be accurately replicated or transcribed as with a natural nucleotide based on complementarity between artificial bases. In the presence of an unnatural nucleotide, accordingly, a DNA molecule can be amplified via nucleic acid amplification, such as PCR.

(19) Specific examples of the artificial bases include 7-(2-thienyl)-3H-imidazo[4,5-b]pyridin-3-yl (referred to as Ds herein), 2-nitropyrrol-1-yl (referred to as Pn herein), 2-formyl-1H-pyrrol-1-yl (referred to as Pa herein), 2-amino-imidazo[1,2-a]-1,3,5-triazin-4(8H)-one (referred to as P herein), 6-amino-5-nitro-2(1H)-pyridone (referred to as Z herein), 6-methylisoquinoline-1(2H)-thione (referred to as 5SICS herein), 3-methoxynaphthalen-2-yl (referred to as NaM herein), and 2-methoxy-4-methylphenyl (referred to as MMO2 herein). Among these artificial bases, examples of complementary artificial bases of Ds include Pn and Pa, an example of a complementary artificial base of P is Z, and examples of complementary artificial bases of 5SICS include NaM and MMO2.

(20) When a substrate does not comprise an unnatural nucleotide having complementary artificial base, at the time of replication or transcription, an artificial base can undergo alternative base pairing with a natural base having similar structure and/or property with the complementary artificial base. In such a case, an unnatural nucleotide in the template nucleic acid molecule will be substituted with a natural nucleotide after replication or transcription. For example, Ds is known to be substituted with A or T.

(21) The term modified base used herein refers to an artificially and chemically modified base. Examples of modified bases include modified pyrimidine, such as 5-hydroxycytosine, 5-fluorouracil, 4-thiouracil, 5-(3-indole-2-ethyl)uracil, and 5-(4-hydroxyphenyl-2-ethyl)uracil), modified purine, such as 6-methyladenine and 6-thioguanosine, and other heterocyclic bases.

(22) The term DNA aptamer used herein refers to an aptamer composed of DNAs. A DNA aptamer is a ligand molecule that firmly and specifically binds to a target molecule through a conformational structure formed based on a secondary and a tertiary structure of a single-stranded nucleic acid molecule via a hydrogen bond or other means. When a DNA aptamer has an ability of specifically inhibiting or suppressing functions such as physiological activity of a target molecule, such DNA aptamer can serve as a functional inhibitor of a target molecule. The term functional inhibition of a target molecule used herein refers to inhibition or suppression of biological functions, such as catalytic activity, function of gene expression regulation (including regulation of transcription, translation, and transportation), and regulation of apoptosis of a target molecule. The term target molecule used herein refers to a substance to which the DNA aptamer can bind. In the present invention, a target molecule is vWF.

(23) The term vWF used herein refers to a von Willebrand factor protein (also referred to as a vWF protein herein). vWF is a blood coagulation factor existing in the blood, and it is known that genetic mutation thereof is involved in various diseases such as the von Willebrand's disease, and that acquired thrombotic thrombocytopenic purpura and the like are induced upon production of an autoantibody to vWF. In the present invention, organism species from which vWF protein is derived are not particularly limited. Examples thereof include mammals, for example, primates such as humans and chimpanzees, experimental animals such as rats and mice, livestock animals such as pigs, cows, horses, sheep, and goats, and pet animals such as dogs and cats, preferably, human vWF.

(24) vWF comprises, for example, (a) the amino acid sequence as shown in SEQ ID NO: 28; (b) an amino acid sequence in which one or several amino acids are added, deleted, and/or substituted in the amino acid sequence as shown in SEQ ID NO: 28, or (c) an amino acid sequence having 70% or higher, 80% or higher, and preferably 90% or higher, 95% or higher, 97% or higher, 98% or higher, or 99% or higher identity to the amino acid sequence as shown in SEQ ID NO: 28. vWF may consist of any of such amino acid sequences. The degree of identity herein is determined with the use of software that computes the degree of identity among a plurality sequences (e.g., FASTA, DANASYS, or BLAST) with the default settings.

(25) The term vWF A1 domain used herein refers to a domain in vWF having an ability to bind to a GPIb receptor on platelets. For example, the vWF A1 domain comprises (a) an amino acid sequence of positions 1238 to 1481 of SEQ ID NO: 28, (b) an amino acid sequence in which one or several amino acids are added, deleted, and/or substituted in the amino acid sequence of positions 1238 to 1481 of SEQ ID NO: 28, or (c) an amino acid sequence having 70% or higher, 80% or higher, and preferably 90% or higher, 95% or higher, 97% or higher, 98% or higher, or 99% or higher identity to the amino acid sequence of positions 1238 to 1481 of SEQ ID NO: 28. The vWF A1 domain may consist of any of such amino acid sequences.

(26) The term several used herein refers to, for example, 1 to 6, 1 to 5, 1 to 4, 1 to 3, or 1 or 2.

(27) The term mini-hairpin structure used herein refers to a structure comprising the 3 DNA nucleic acid regions described below: i.e., a first nucleic acid region, a second nucleic acid region, and a third nucleic acid region, sequentially ligated from the 5-terminus toward the 3-terminus. Mini-hairpin-shaped DNA may improve heat stability of the DNA aptamer by enhancing degradation resistance against a nuclease and/or increasing a Tm value of the DNA aptamer.

(28) The first nucleic acid region is a nucleic acid region consisting of 2 to 5 arbitrary nucleotides. The nucleotide is a deoxyribonucleotide comprising a base selected from among guanine (G), adenine (A), cytosine (C), and thymine (T). A base constituting the nucleic acid region is preferably guanine or cytosine. This is because when the first nucleic acid region forms a stem structure with the third nucleic acid region described below, a Tm value elevates as the GC content increases, and the stem structure can be maintained stably. Accordingly, most preferably, the full-length nucleotide sequence of the first nucleic acid region is composed of G and/or C.

(29) The second nucleic acid region is a nucleic acid region consisting of a nucleotide sequence 5-GNA-3 or 5-GNNA-3. In the sequence, each N is a natural base (G, A. T. or C) such as T.

(30) The third nucleic acid region is a nucleic acid region consisting of a nucleotide sequence complementary to the first nucleic acid region. Accordingly, the nucleotide sequence of the third nucleic acid region is determined based on the nucleotide sequence of the first nucleic acid region, and the first nucleic acid region forms base pairing with the third nucleic acid region in the molecule. As a result, the first nucleic acid region and the third nucleic acid region form a completely base-paired stem structure, and the second nucleic acid region flanked by the first nucleic acid region and the third nucleic acid region forms loop structures therewith, and, as a whole, mini-hairpin-shaped DNA consisting of 7 to 14 nucleotides is formed. An example of mini-hairpin-shaped DNA is DNA consisting of a nucleotide sequence CGCGTAGCG (SEQ ID NO: 26).

2. DNA Aptamer that Binds to vWF

(31) In one aspect, the present invention relates to a DNA aptamer that binds to vWF comprising the nucleotide sequence (i) or (ii) below:

(32) (i) the nucleotide sequence as shown in any of SEQ ID NOs: 13 to 16, 19, and 20, preferably, the nucleotide sequence as shown in any of SEQ ID NO: 13, 14, 19, and 20; or

(33) (ii) a nucleotide sequence in which one or several nucleotides are added, deleted, and/or substituted in the nucleotide sequence (i) at position(s) other than that of Ds.

(34) In one embodiment, the nucleotide sequence (i) comprises, at its terminus, base pair(s), for example, 1 to 5, 1 to 4, 1 to 3, 1 or 2, or 1 GC pair(s). Base pair(s) at the terminus may increase the Tm value and enhance thermal stability of the DNA aptamer. In addition to or instead of the base pair(s) mentioned above, the nucleotide sequence (i) may comprise a sequence constituting a mini-hairpin structure at, for example, the 3-terminus (hereafter, also referred to as the mini-hairpin sequence).

(35) Examples of sequences in which the mini-hairpin sequence is added to the sequence (i) include the sequence as shown in SEQ ID NO: 18 in which the mini-hairpin sequence is added to the sequence as shown in SEQ ID NO: 19, and the sequence as shown in SEQ ID NO: 21 in which the mini-hairpin sequence is added to the sequence as shown in SEQ ID NO: 20.

(36) In one aspect, the present invention relates to a DNA aptamer that binds to vWF comprising the nucleotide sequence as shown in SEQ ID NO: 18 or 21 or a nucleotide sequence in which one or several nucleotides are added, deleted, and/or substituted in to the nucleotide sequence as shown in SEQ ID NO: 18 or 21 at position(s) other than that of Ds.

(37) In one embodiment, the DNA aptamer according to the present invention comprises the nucleotide sequence (i) or (ii) or a nucleotide sequence in which base pair(s) and/or a mini-hairpin sequence is added thereto at the terminus.

(38) The DNA aptamer according to the present invention comprising the nucleotide sequence (i) or (ii) binds to vWF, for example, the vWF A1 domain.

(39) The DNA aptamer according to the present invention comprising the nucleotide sequence (i) or (ii) can have a high vWF-binding ability in terms of the dissociation constant (K.sub.D) and/or the dissociation rate (k.sub.off). Here, K.sub.D is a dissociation constant represented by k.sub.off (dissociation rate)/k.sub.on (binding rate). As the K.sub.D value decreases, affinity to the target becomes higher. As the k.sub.off value decreases the DNA aptamer is less likely to dissociate after it binds to the target.

(40) The DNA aptamer according to the present invention comprising the nucleotide sequence (i) or (ii) can have K.sub.D of 1.010.sup.7 or lower, 1.010.sup.8 or lower, or 1.010.sup.9 or lower, and preferably 5.010.sup.10 or lower, 3.010.sup.10 or lower, 1.010.sup.10 or lower, or 8.010.sup.11 M or lower, in vWF-binding analysis using Biacore.

(41) The DNA aptamer according to the present invention comprising the nucleotide sequence (i) or (ii) can have k.sub.off of 1.010.sup.1 or lower, and preferably 9.010.sup.2 or lower, 8.010.sup.2 or lower, 7.010.sup.2 or lower, 6.010.sup.2 or lower, or 5.010.sup.2 (1/Ms) or lower, in vWF-binding analysis using Biacore.

(42) In one aspect, the present invention relates to a DNA aptamer that binds to vWF comprising the nucleotide sequence (I) or (II) below:

(43) (I) the nucleotide sequence as shown in any of SEQ ID NOs: 1 to 4, 9, and 11, preferably, the nucleotide sequence as shown in SEQ ID NO: 1 or 11; or

(44) (II) a nucleotide sequence in which one or several nucleotides are added, deleted, and/or substituted in the nucleotide sequence (I) at position(s) other than that of Ds.

(45) In one embodiment, the nucleotide sequence (i) comprises, at its terminus, base pair(s), for example, 1 to 5, 1 to 4, 1 to 3, 1 or 2, or 1 GC pair(s). Base pairs at the terminus may increase the Tm value and enhance heat stability of the DNA aptamer. In addition to or instead of the base pair(s) mentioned above, the nucleotide sequence (I) may comprise a mini-hairpin sequence at, for example, the 3-terminus.

(46) An example of a sequence in which the mini-hairpin sequence is added to the sequence (I) includes the sequence as shown in SEQ ID NO: 12 in which the mini-hairpin sequence is added to the sequence as shown in SEQ ID NO: 11.

(47) Accordingly, in one aspect, the present invention relates to a DNA aptamer that binds to vWF comprising the nucleotide sequence as shown in SEQ ID NO: 12 or a nucleotide sequence in which one or several nucleotides are added, deleted, substituted, and/or inserted in the nucleotide sequence as shown in SEQ ID NO: 12 at position(s) other than that of Ds.

(48) In one embodiment, the DNA aptamer according to the present invention comprises the nucleotide sequence (I) or (II) or a nucleotide sequence in which base pair(s) and/or a mini-hairpin sequence is added at the terminus.

(49) The DNA aptamer according to the present invention comprising the nucleotide sequence (I) or (II) binds to vWF, for example, vWF A1 domain.

(50) The DNA aptamer according to the present invention comprising the nucleotide sequence (I) or (II) can have an excellent vWF-binding ability, especially in the dissociation rate (k.sub.off). For example, the DNA aptamer according to the present invention comprising the nucleotide sequence (I) or (II) can have k.sub.off of 1.010.sup.1 or lower, 1.010.sup.2 or lower, and preferably 5.010.sup.3 or lower, 4.010.sup.3 or lower, 3.010.sup.3 or lower, or 2.010.sup.3 or lower (1/Ms), in vWF-binding analysis using Biacore.

(51) Also, the DNA aptamer according to the present invention comprising the nucleotide sequence (I) or (II) can have K.sub.D of 1.010.sup.6 or lower, 1.010.sup.7 or lower, 1.010.sup.8 or lower, and preferably 5.010.sup.9 or lower, 4.010.sup.9 or lower, 3.010.sup.9 or lower, or 2.010.sup.9 M or lower, in vWF-binding analysis using Biacore.

(52) The length of the DNA aptamer comprising the sequence (i) or (ii) or the sequence (I) or (II) (hereafter, simply referred to as the DNA aptamer according to the present invention) is, for example, 150 mer or shorter, 140 mer or shorter, 130 mer or shorter, 120 mer or shorter, or 110 mer or shorter, and preferably 100 mer or shorter, 90 mer or shorter, 80 mer or shorter, 70 mer or shorter, 60 mer or shorter, or 50 mer or shorter.

(53) The DNA aptamer according to the present invention may arbitrarily comprise a base analog, another artificial base, another modified base, or the like, in addition to Ds.

(54) The DNA aptamer according to the present invention may be modified with the addition of other substances, such as polyethylene glycol (PEG) (e.g., a PEG polymer of about 20 to 60 kDa), an amino acid, a peptide, inverted dT, a lipid, a dye, a fluorescent substance, an enzyme, a radioactive substance, and biotin. Such substance may be linked via a known linker, if needed. Examples of linkers that can be used herein include a nucleotide linker, a peptide linker, and a linker containing a disulfide bond. It is generally known that a half-life of the DNA aptamer is extended by conjugating PEG to the DNA aptamer.

(55) A method for producing the DNA aptamer according to the present invention is not particularly limited. A method known in the art may be employed. For example, the DNA aptamer according to the present invention can be chemically synthesized based on the sequences indicated above in accordance with a known solid-phase synthesis method. Regarding a method of chemical synthesis of nucleic acids, see, for example, Current Protocols in Nucleic Acid Chemistry, Volume 1, Section 3. Many life science manufacturers (e.g., Takara Bio Inc. and Sigma-Aldrich Corporation) provide contract manufacturing services concerning such chemical synthesis, and such services may be used. A DNA aptamer may be prepared by synthesizing several fragments based on the DNA aptamer sequence and then ligating the fragments via, for example, intramolecular annealing or ligation by a ligase.

(56) The DNA aptamer according to the present invention prepared via chemical synthesis is preferably purified by a method known in the art before use. Examples of methods of purification include gel purification, affinity column purification, and HPLC.

3. Pharmaceutical Composition Comprising DNA Aptamer

(57) In one aspect, the present invention relates to a pharmaceutical composition comprising the DNA aptamer according to the present invention. The pharmaceutical composition according to the present invention can comprise one or more other drugs, provided that the binding ability of the DNA aptamer according to the present invention to vWF is not lost.

(58) In one embodiment, the present invention relates to a pharmaceutical composition comprising the DNA aptamer and another drug for delivering the drug. The other drugs may be bound to the DNA aptamer, so that the drug can be efficiently delivered to the lesion, utilizing the ability of the DNA aptamer to bind to vWF. A method for binding the DNA aptamer to the drug is not particularly limited.

(59) Target diseases to be prevented and/or treated with the pharmaceutical composition according to the present invention are diseases that can be caused by, for example, mutation or overexpression of the vWF gene and production of an autoantibody to vWF (such disease may be referred to as the vWF-associated disease hereinbelow). Examples of vWF-associated diseases include thrombosis, thrombotic thrombocytopenic purpura, intracranial embolism, brain embolism, carotid artery stenosis, thrombotic microangiopathy, and acute myocardial infarction.

(60) Therapeutic effects are expected by administrating the pharmaceutical composition to a subject afflicted with such disease, and preventive effects are expected by administrating the pharmaceutical composition to a subject at risk of such disease.

(61) The pharmaceutical composition according to the present invention can comprise a pharmaceutically acceptable carrier. The term pharmaceutically acceptable carrier refers to a substance generally used in the art that facilitates preparation of a pharmaceutical composition or application thereof to an organism, and such substance is added to the pharmaceutical composition in an amount that does not inhibit or suppress the activity of the pharmaceutical composition. Examples of carriers include an excipient, a binder, a disintegrator, a filler, an emulsifier, a fluidity adjustor, a lubricant, and a stabilizer.

(62) Examples of excipient include a sugar, such as monosaccharide, disaccharide, cyclodextrin, and a polysaccharide (specific examples include, but are not limited to, glucose, sucrose, lactose, raffinose, mannitol, sorbitol, inositol, dextrin, maltodextrin, starch, and cellulose), metal salt (e.g., sodium phosphate, calcium phosphate, calcium sulfate, and magnesium sulfate), citric acid, tartaric acid, glycine, low-, middle-, and high-molecular-weight polyethylene glycol (PEG), Pluronic, and a combination thereof.

(63) Examples of binder include starch glue using corn, wheat, rice, or potato starch, gelatin, gum tragacanth, methylcellulose, hydroxypropyl methylcellulose, carboxymethyl cellulose sodium, and polyvinyl pyrrolidone.

(64) Examples of disintegrator include the starch, carboxymethylstarch, crosslinked polyvinyl pyrrolidone, agar, alginic acid, sodium alginate, and a salt thereof.

(65) Examples of filler include the sugar and calcium phosphate (e.g., tricalcium phosphate and calcium hydrogen phosphate).

(66) Examples of emulsifier include sorbitan fatty acid ester, glycerin fatty acid ester, sucrose fatty acid ester, and propylene glycol fatty acid ester.

(67) Examples of fluidity adjuster and lubricant include silicate, talc, stearate, and polyethylene glycol.

(68) Examples of stabilizer include an anti-oxidant, such as ascorbic acid or sulfite, and sugar, such as trehalose or glucose.

(69) Such carrier may adequately be used, if needed. In addition to the additives described above, the pharmaceutical composition according to the present invention can comprise a corrigent, a solubilizer (a solubilizing agent), a suspension, a diluent, a surfactant, an absorbefacient (e.g., a quaternary ammonium salt and sodium lauryl sulfate), an extender, a wetting agent, a moisturizing agent (e.g., glycerin and starch), an absorbent (e.g., starch, lactose, kaolin, bentonite, and colloidal silicic acid), a disintegrator (e.g., saccharose, stearin, cacao butter, and hydrogenated oil), a coating agent, a colorant, a preservative, a flavoring agent, an aromatic agent, a sweetening agent, a buffer, an isotonizing agent, a soothing agent, solubilizer, or the like.

(70) Examples of surfactant include alkali metal salt, alkaline earth metal salt, and ammonium salt of lignosulfonic acid, naphthalenesulfonic acid, phenolsulfonic acid, and dibutylnaphthalenesulfonic acid, alkyl aryl sulfonate, alkyl sulfate, alkyl sulfonate, fatty alcohol sulfate, fatty acid, sulfated fatty alcohol glycol ether, a condensate of a naphthalene sulfonate or naphthalene derivative and formaldehyde, a condensate of naphthalene, naphthalane sulfonic acid, or phenol and formaldehyde, polyoxyethylene octyl phenyl ether, ethoxylated isooctyl phenol, octyl phenol, nonyl phenol, alkylphenyl polyglycol ether, tributylphenyl polyglycol ether, tristearyl phenyl polyglycol ether, alkyl aryl polyether alcohol, a condensate of an alcohol/fatty alcohol and ethylene oxide, ethoxylated castor oil, polyoxyethylene alkyl ether, ethoxylated polyoxypropylene, lauryl alcohol polyglycol ether acetal, sorbitol ester, lignosulfite waste liquor, and methylcellulose.

(71) A pharmaceutical composition according to this embodiment can contain 1 or more of the carriers mentioned above.

(72) A dosage form of the pharmaceutical composition according to the present invention is not particularly limited, provided that an active ingredient is not inactivated and pharmacological effects can be exerted in vivo after administration. In general, a dosage form varies depending on a route of administration and/or prescription conditions.

(73) Examples of dosage forms suitable for oral administration include solid preparations (including tablets, pills, sublingual formulations, capsules, drops, and troches), granules, powders, and liquids. If needed, solid preparations can be preparations with coating materials known in the art, such as sugar-coated tablets, gelatin-coated tablets, enteric coated tablets, film-coated tablets, double-layer tablets, or multi-layer tablets.

(74) Parenteral administration is classified as systemic administration or topical administration, and topical administration is further classified as interstitial administration, transdermal administration, transmucosal administration, or transrectal administration. The pharmaceutical composition can be prepared in a dosage form suitable for the route of administration. Examples of dosage forms suitable for systemic or interstitial administration include injection preparations, which are liquids. Examples of dosage forms suitable for transdermal or transmucosal administration include liquids (including embrocation, eye drops, nasal drops, and inhalants), suspensions (including emulsifiers and cream agents), powders (including nasal drops and inhalants, pastes, gels, ointments, and plasters). An example of a dosage form suitable for transrectal administration is a suppository.

(75) Specific configurations and sizes of the dosage forms mentioned above are not particularly limited, provided that they are within the scope of the dosage forms known in the art.

(76) In principle, the pharmaceutical composition according to the present invention may be prepared in accordance with a method known in the art. For example, see the method described in Remington's Pharmaceutical Sciences (Merck Publishing Co., Easton, Pa.).

(77) For example, injection preparations can be prepared by a method generally used in the art, comprising dissolving the DNA aptamer according to the present invention in a pharmaceutically acceptable solvent and adding a pharmaceutically acceptable carrier thereto, if needed.

(78) Examples of pharmaceutically acceptable solvent include water, ethanol, propylene glycol, ethoxylated isostearyl alcohol, polyoxylated isostearyl alcohol, and a polyoxyethylene sorbitan fatty acid ester. Such solvent is preferably made isotonic to the blood, if needed.

(79) The pharmaceutical composition according to the present invention can be administered to an organism in a pharmaceutically effective amount for treatment or prevention of a target disease such as cancer. A target organism is a vertebrate, preferably a mammal, and more preferably a human.

(80) The pharmaceutical composition according to the present invention may be administered systemically or topically. An adequate administration route can be selected depending on a disease type, a site of disease onset, a stage, or the like. In the case of a disease that develops in a topical site, for example, topical administration directly to the site of disease onset and a region in the vicinity thereof by means of injection is preferable. This is because a sufficient amount of the DNA aptamer according to the present invention can be administered to a site to be treated (i.e., the tissue or organ) and other tissue is less likely to be affected. When the site to be treated cannot be identified or a disease develops throughout the body, systemic administration via intravenous injection or the like is preferable, although the administration route is not limited. By spreading the DNA aptamer according to the present invention through the blood flow throughout the body, it can be administered to a lesion that cannot be identified by diagnosis.

(81) The pharmaceutical composition according to the present invention can be administered by any adequate method, provided that active ingredients are not inactivated. For example, a parenteral route (e.g., by means of injection, aerosol, topical application, instillation, or nasal drip) or an oral route may be employed, preferably, by injection.

(82) In the case of injection administration, the site of injection is not particularly limited, provided that the DNA aptamer as an active ingredient is binding ability to a target substance. For example, intravenous, intraarterial, intrahepatic, intramuscular, intraarticular, intramedullary, intraspinal, intraventricular, transpulmonary, percutaneous, subcutaneous, intracutaneous, or intraperitoneal administration may be performed.

4. Method of Treatment and/or Prevention Using DNA Aptamer

(83) In one aspect, the present invention relates to a method of treatment and/or prevention of a disease comprising administering the DNA aptamer or pharmaceutical composition according to the present invention to a subject.

(84) An example of a disease to be prevented and/or treated with the pharmaceutical composition according to the present invention is the vWF-associated disease. Examples thereof include thrombosis, thrombotic thrombocytopenic purpura, intracranial embolism, brain embolism, carotid artery stenosis, thrombotic microangiopathy, and acute myocardial infarction.

(85) Examples of animal species encompassed by subjects herein include mammals, and specific examples include primates such as humans and chimpanzees, experimental animals such as rats and mice, livestock animals such as pigs, cows, horses, sheeps, and goats, and pet animals such as dogs and cats, preferably, humans.

5. Detection Agent Comprising DNA Aptamer

(86) In one aspect, the present invention relates to an agent for detecting vWF comprising the DNA aptamer according to the present invention. The agent for detecting vWF according to the present invention is an agent that is used for detecting vWF in vivo or in vitro utilizing the ability of the DNA aptamer according to the present invention to bind to vWF. For example, the DNA aptamer is labeled with a fluorescence reagent beforehand, and the labeled DNA aptamer is administered to an organism, so as to determine expression intensity of vWF in vivo and investigate localization thereof. This can assist diagnosis of the vWF-related diseases described above. The DNA aptamer according to the present invention is useful for imaging and tissue staining.

(87) In one aspect, the present invention relates to a composition for detecting vWF comprising the DNA aptamer according to the present invention. The constitution of the composition is the same as described with regard to the pharmaceutical composition above and explanation thereof is accordingly omitted herein.

(88) In one aspect, the present invention relates to a kit for detecting vWF comprising the DNA aptamer according to the present invention. In addition to the DNA aptamer according to the present invention, the kit according to the present invention may comprise, for example, a buffer, a label reagent, and/or instructions.

6. Method of vWF Detection

(89) In one aspect, the present invention relates to a method for detecting vWF. The method comprises a step of contacting a sample obtained from a subject with the DNA aptamer according to the present invention and a step of detecting vWF based on the binding between the sample and the DNA aptamer. This method can assist diagnosis of the vWF-associated disease.

(90) Samples used in the method of the present invention include tissue and biological samples. Tissue examples include sites of lesions, such as the brain, the heart, the liver, the pancreas, the lung, the bone marrow, the lymph node, and the spleen. For example, biopsy samples of such tissues can be used. Examples of biological samples include the blood, the blood plasma, the lymph, the interstitial fluid, the urine, and cells, such as peripheral blood cells, hair matrix cells, oral cavity cells, nasal cavity cells, intestinal tract cells, intravaginal cells, mucosal cells, and sputum (that can contain alveolar cells or tracheal cells), preferably, blood or blood plasma.

(91) A step of detection in the method of detection according to the present invention is not particularly limited, provided that the binding between the sample and the DNA aptamer is utilized, and any known method may be employed. For example, SPR method, turbidimetric method, colorimetric method, or fluorescence method may be employed.

(92) Surface plasmon resonance (SPR) is a phenomenon that the intensity of a reflected light decreases sharply at a particular angle of incidence (i.e., an angle of resonance) when a laser beam is irradiated to a metal thin film SPR is a measurement method based on the phenomenon described above and is capable of assaying a substance adsorbed on the surface of the metal thin film, which is a sensor, with high sensitivity. According to the present invention, for example, the target substance in the sample can then be detected by immobilizing the DNA aptamer according to the present invention on the surface of the metal thin film beforehand, allowing the sample to pass through the surface of the metal thin film, and detecting the difference of the amount of the substance adsorbed on the surface of the metal thin film resulting from the binding of the nucleic acid and target substance, between before and after the sample passes therethrough. Examples of known SPR techniques include the displacement method and the indirect competitive method, and any method may be employed herein.

(93) Turbidimetry is a method comprising irradiating a light to a solution, optically assaying an attenuation in the light scattered by substances suspended in the solution or a light transmitted through the solution using a colorimeter or the like, and assaying the amount of the substance of interest in the solution. According to the present invention, the target substance in the sample can be quantitatively detected by assaying the absorbance before and after the DNA aptamer according to the present invention is added to the sample.

(94) Also, the target substance can be detected by using an antibody reacting with the target substance in combination. For example, sandwich ELISA may be employed. With this technique, the DNA aptamer according to the present invention is first immobilized on a solid-phase support, the sample is added, and the target substance in the sample is then allowed to bind to the DNA aptamer. Subsequently, the sample is washed away, and the anti-target substance antibody is added and allowed to bind to the target substance. After washing, an adequately labeled secondary antibody is used to detect the anti-target substance antibody, and the target substance in the sample can be thus detected. Examples of solid-phase supports that can be used include insoluble supports in the form of beads, microplates, test tubes, sticks, test pieces, and the like, made of materials such as polystyrene, polycarbonate, polyvinyl toluene, polypropylene, polyethylene, polyvinyl chloride, nylon, polymethacryate, latex, gelatin, agarose, cellulose, sepharose, glass, metal, ceramic, or magnet.

(95) In one aspect, the present invention relates to a method of assisting diagnosis as to whether or not a subject is afflicted with the vWF-associated disease. This method comprises: a step of administering the DNA aptamer according to the present invention or the agent for detecting vWF or composition for detecting vWF according to the present invention to a subject; and a step of detecting the DNA aptamer. When the DNA aptamer is detected at high concentration at a particular site in an organism, for example, it can be determined that the disease has developed at the site of interest. The step of detection may be carried out in accordance with a conventional technique. For example, the fluorescence method mentioned above may be employed.

EXAMPLES

Example 1: Selection of DNA Aptamer that Binds to vWF Using Ds-Predetermined DNA Library

(96) In accordance with the predetermined method described in WO 2013/073602, a DNA library comprising artificial bases (Ds) was prepared. The library used in the predetermined method was designed to comprise artificial bases (Ds) at particular fixed positions in a random nucleotide sequence. Briefly, a pool of DNA fragment (the total number of molecular species: 300 pmol, about 210.sup.14 molecules) was used as the first-round library, the target protein (i.e., the vWF A1 domain. V003, U-Protein) was mixed, a pool of DNA that binds to the target protein was selected and isolated using magnetic beads, then the DNA-vWF A1 domain complex was cleaved via polyacrylamide gel electrophoresis to select and isolate the DNA of interest, and the resultant was amplified via PCR. In total, 8 rounds of selection procedures were performed. Table 1 shows the selection conditions. After the completion of the 8th round of selection, sequence analysis was performed, and the sequences of the DNA aptamers comprising artificial base(s) (Ds) were obtained.

(97) TABLE-US-00001 TABLE 1 Selection conditions DNA Protein Volume Number of washing Gel Electrophoresis PCR Round Method (nM) (nM) (ml) Without urea With 3M urea conditions conditions cycles 1 a 50 25 6 5 25 2 a 25 10 2 5 23 3 b 500 2000 0.05 Native 0.5x TBE, 4 C., 12 300 V, 40 min 4 b 250 250 0.02 Native 0.5x TBE, 4 C., 16 300 V, 40 min 5 b 125 125 0.04 Native 0.5x TBE, 4 C., 16 300 V, 40 min 6 a 1 1 3 5 25 7 a 1 1 3 3 2 17 8 b 100 100 50 +3M urea 0.5x TBE, 4 C., 16 300 V, 40 min Method a: Complex biotinylation Method b: Gel shift separation

(98) As a result of sequencing the DNA library after the 8th round, 420,526 sequences for analysis were obtained. In accordance with the method of analysis described in WO 2013/073602, sequences that were deduced to retain artificial bases were extracted from among 100 or more clone sequences. As a result, 406,086 sequences were extracted in total. The number of sequences was counted, and the most common sequences were found to be single-copy sequences, which accounted for 80% or more of the whole, and 90% of the whole when similar sequences were included.

Example 2: Determination of DNA Aptamer Sequence

(99) The following procedure was carried out in order to accurately identify the positions of artificial bases (Ds) and the accurate sequence was determined.

(100) A probe sequence of a DNA fragment consisting of 25 bases that was designed to be specific to the most common sequence obtained in Example 1 was used (5-ACTCCCTCGGTTGTTGGCGAAAGTTG-3: SEQ ID NO: 22). The 5-biotin labeled probe, which was chemically synthesized and simply purified, was purchased from Thermo Fisher Scientific. The pool of DNA fragment obtained after the 8th round was amplified via PCR using dDsTP and Diol1-dPxTP to prepare a single-stranded DNA library, the resulting library was diluted with a solution to 100 nM/l binding solution (20 mM Tris-HCl, 0.5 M NaCl, 10 mM MgCl.sub.2. pH 7.6), and 20 l of the solution was mixed with a biotinylated probe (5 M, 1 l). Thereafter, annealing was carried out (90 C. for 3 minutes, gradual cooling at 0.1 C./sec. 55 C. for 15 minutes), and streptavidin magnetic beads in 5 l of the 1 binding solution was mixed therewith, followed by incubation at 55 C. for 5 minutes. Thus, the biotinylated probe and the DNA fragments complementarily hybridized to the probe were immobilized on the magnetic beads. The solution was removed with the use of a magnetic stand, excess DNA fragments that did not hybridize with the probe were removed, and the magnetic beads were then washed 5 times with 150 l of the 1 binding solution (55 C.). Thereafter, 20 l of sterile water was added to the washed magnetic beads, the resultant was heated at 75 C. for 5 minutes, and the solution was recovered immediately thereafter. Thus, the DNA fragments hybridized with the probe were recovered.

(101) When sequencing DNA comprising artificial base(s) sequence patterns vary by adding (Ds), ddPaTP or dPaTP as a substrate complementary to an artificial base (Ds), or ddDsTP or dDsTP as a substrate complementary to Px, which is a base complementary to an artificial base (Ds), during the sequencing reaction using a common dye-terminator. Thus, the presence or absence of an artificial base(s) (Ds) in the DNA fragment used as a sequencing template and an accurate position thereof can be determined. With the use of the DNA fragment recovered using a probe as a template, accordingly. DNA sequencing was performed in accordance with the 2 types of methods (i) and (ii) described below.

(102) (i) With the use of 10 l of the recovered DNA solution, 15 cycles of PCR was carried out for amplification using AccuPrime Pfx DNA polymerase in the presence of dDsTP and Diol1-dPxTP, then, the DNA fragment recovered via gel purification was dissolved in 20 l of water. Subsequently the solution was used as a template in the presence of 0.05 mM ddPaTP, 0.05 mM dPaTP, 0.05 mM ddDsTP, or 0.05 mM dDsTP for sequencing. (If the recovered DNA retains an artificial base(s) (Ds). Ds would be retained during PCR according to this method.)

(103) (ii) With the use of 10 l of the recovered DNA solution, 15 cycle of PCR was carried out for amplification using AccuPrime Pfx DNA polymerase in the presence of 0.05 mM dPaTP, then, the fragment recovered via gel purification was dissolved in 20 l of water. Subsequently the solution was used as a template in the presence of 0.05 mM ddPaTP, 0.05 mM dPaTP, 0.05 mM ddDsTP, or 0.05 mM dDsTP for sequencing. (If the recovered DNA retains an artificial base(s) (Ds), Ds would be substituted with A or T after PCR according to this method.)

(104) Specifically, DNA sequencing was carried out in 20 l (in total) using a commercially available BigDye Terminator v1.1 Cycle Sequencing Kit (Thermo Fisher Scientific). With the use of the sequence primers: 5-ACGACCGTTCTCTAATTTTGACGTT-3 (SEQ ID NO: 23) and 5-ACCAAATTATTGCGATACAGACCCT-3 (SEQ ID NO: 24), the double-stranded DNA fragment amplified by PCR and purified (approximately 0.15 pmol) and ddPaTP or dPaTP, or ddDsTP or dDsTP (500 pmol) were added to the reaction solution, and 25 cycles of PCR (96 C. for 10 seconds, 50 C. for 5 seconds, and 60 C. for 4 minutes) were conducted. The unreacted dye-terminator was removed via desalting column treatment, and the remaining solution was dehydrated under a reduced pressure. A solution of Blue-Dextran diluted in formamide (4 l) was added to the remnant, and a part thereof was analyzed using the ABI377DNA sequencer. The sequence peak patterns were analyzed using Applied Biosystems PRISM sequencing analysis software v3.2.

(105) As a result of sequence pattern analysis, a pattern (a gap) indicating an artificial base was observed at 3 positions in the sequencing reaction using a Px strand as a template when using artificial base template, whereas peak A was observed in the sequencing reaction when using naturally substituted DNA as a template. This indicates the presence of an artificial base (Ds) at position 19, in addition to the 2 positions of the Ds bases indicated by tag sequences (i.e., 6 and 15 positions in random region).

Example 3: Analysis of Binding Activity of DNA Aptamer Via Gel Shift Assay

(106) In order to examine the binding ability of the sequenced DNA aptamer comprising artificial bases (Ds) at 3 positions to the vWF protein A1 domain, 40-mer and 38-mer DNA aptamers from which the primer regions were cleaved were prepared. Table 2 shows the names and the sequences of the prepared DNA aptamers and FIG. 1 shows the secondary structures deduced based on the nucleotide sequences obtained via selection and the like.

(107) TABLE-US-00002 TABLE2 SequencesofvariousDNAaptamersused SEQIDNO: Aptamername Sequence(5.fwdarw.3) 1 vWF1-DsDsDs TGAGACTCCCCADsCTTTCGCCDsACADsCCGAGGGAGTCTCA 2 vWF1-DsDsA TGAGACTCCCCADsCTTTCGCCDsACAACCGAGGGAGTCTCA 3 vWF1-DsADs TGAGACTCCCCADsCTTTCGCCAACADsCCGAGGGAGTCTCA 4 vWF1-ADsDs TGAGACTCCCCAACTTTCGCCDsACADsCCGAGGGAGTCTCA 5 vWF1-DsAA TGAGACTCCCCADsCTTTCGCCAACAACCGAGGGAGTCTCA 6 vWF1-ADsA TGAGACTCCCCAACTTTCGCCDsACAACCGAGGGAGTCTCA 7 vWF1-AADs TGAGACTCCCCAACTTTCGCCAACADsCCGAGGGAGTCTCA 8 vWF1-AAA TGAGACTCCCCAACTTTCGCCAACAACCGAGGGAGTCTCA 9 vWF1-R1Ds GAGACTCCCCADsCTTTCGCCDsACAACCGAGGGAGTCTC 10 ARC1172 GGCGTGCAGTGCCTTCGGCCGTGCGGTGCCTCCGTCACGCC 11 vWF1-DsDsDs-GC CGAGGCTCCCCADsCTTTCGCCDsACADsCCGAGGGAGCCTCG 12 vWF1-DsDsDs-mhGC CGAGGCTCCCCADsCTTTCGCCDsACADsCCGAGGGAGCCTCGCGCGTAGCG

(108) On the basis of vWF1-DsDsDs (SEQ ID NO: 1), 3-terminal Ds was substituted with A to prepare vWF1-DsDsA (SEQ ID NO: 2), internal Ds was substituted with A to prepare vWF1-DsADs (SEQ ID NO: 3), 5-terminal Ds was substituted with A to prepare vWF1-ADsDs (SEQ ID NO: 4), internal Ds and 3-terminal Ds were each substituted with A to prepare vWF1-DsAA (SEQ ID NO: 5), 5-terminal Ds and 3-terminal Ds were each substituted with A to prepare vWF1-ADsA (SEQ ID NO: 6), 5-terminal Ds and internal Ds were each substituted with A to prepare vWF1-AADs (SEQ ID NO: 7), all Ds bases were each substituted with A to prepare vWF1-AAA (SEQ ID NO: 8), and 3-terminal Ds was substituted with A and the AT pair was removed from the terminal stem region to prepare vWF1-R1Ds (SEQ ID NO: 9). As a positive control, an existing vWF-binding DNA aptamer (i.e., ARC1172; SEQ ID NO: 10) was prepared and used for analysis. The DNA aptamers were chemically synthesized in accordance with a conventional technique.

(109) The binding ability of the synthesized DNA aptamers was analyzed via gel shift assay. Specifically, the DNA aptamers (100 nM) and the vWF A1 domain (100 nM, V003, U-Protein) were suspended in 20 l of a reaction solution (1PBS, 0.005% Nonidet P-40), and incubated at 37 C. for 30 minutes. Thereafter, 25% glycerol containing bromophenol blue was added to be a final concentration of glycerol to 5% therein, the resultant was subjected to 8% nondenaturing polyacrylamide gel electrophoresis at 4 C., and the DNA aptamers bound to the vWF A1 domain were separated from the free DNA aptamers. Thereafter, the DNA aptamers were stained with SYBR Gold (Thermo Fisher Scientific) diluted 1/20,000-fold with the 1TBE solution and detected by a bioimage analyzer (LAS-4000, Fujifilm Corporation). The percentage of gel shifting was determined by dividing the amount of the complex by the amount of the free form and the complex, each deduced based on a band and expressing the determined value in a percentage figure.

(110) The results are shown in FIG. 2. As a result of gel shift assays, All DNA aptamers in which Ds was substituted with A (i.e., vWF1-DsDsA (b), vWF1-DsADs (c), and vWF1-ADsDs (d)) were observed to have a lower binding activity. This indicates that all the three artificial bases (Ds) are involved in binding. Regarding vWF1-ADsDs (d), the binding ability was not significantly lowered. This indicates that 5-terminal and internal Ds, in particular, are strongly contributed to binding. In addition, the binding ability of vWF1-DsDsDs (a) was found to be higher than that of the existing vWF-binding DNA aptamer, ARC1172 (j) used as a positive control.

Example 4: Biacore Analysis of Binding Ability of DNA Aptamer to vWF

(111) The binding ability of the DNA aptamers was assayed via surface plasmon resonance (SPR) using BiacoreT200 (GE Healthcare). Table 2 shows the sequences of the DNA aptamers used for analysis and FIG. 3 shows the putative secondary structures. On the basis of vWF1-DsDsDs (SEQ ID NO: 1), all of 3 Ds bases were each substituted with A to prepare vWF1-AAA (SEQ ID NO: 8), a part of the AT pairs in the stem region was substituted with the GC pairs to prepare vWF1-DsDsDs-GC (SEQ ID NO: 11), and a mini-hairpin structure was added to the 3 terminus of vWF1-DsDsDs-GC to prepare vWF1-DsDsDs-mhGC (SEQ ID NO: 12). As a positive control, ARC1172 (SEQ ID NO: 10) was used.

(112) These DNA aptamers were prepared by chemical synthesis as biotin-labeled nucleic acids comprising the nucleotide sequences shown in the figure and purified with denaturing acrylamide gel. The nucleic acid fragments were mixed in phosphate buffer (pH 7.4), and the resultant was heated at 95 C., followed by folding (reconstruction) via gradual cooling to 25 C. A streptavidin-coated SA chip (GE Healthcare) was used as an SPR sensor chip, the DNA aptamers were irreversibly immobilized on the chip, and binding thereof to the vWF A1 domain was then analyzed. SPR assay was carried out in a running buffer (a phosphate buffer containing 155 mM NaCl, 0.05% Nonidet P-40) at 37 C. The DNA aptamers were immobilized on a sensor chip by subjecting the DNA solution diluted to 25 nM with a PBS solution to folding treatment (heat-denaturation at 95 C. for 3 minutes, followed by gradual cooling to 25 C.) and then adding Nonidet P-40 to a final concentration of 0.050/%, and then immobilizing the DNA solution (40 l) on the SA chip via injection at a flow rate of 5 l/min (equivalent to 8 minutes). Thereafter, 5 l of a 50 mM NaOH solution was injected thereinto at a flow rate of 20 l/min 5 times to wash the DNA aptamers non-specifically adsorbed to the SA chip. The interaction between the immobilized DNA aptamer and the vWF A1 domain was monitored by injecting the vWF A1 domain solution (diluted with a running buffer) at 0 nM, 0.3125 nM, 0.625 nM, 1.25 nM, 2.5 nM, 5 nM, 10 nM, and 20 nM in the kinetic injection mode. Assay was carried out at a flow rate of 100 l/min and a protein injection duration was 150 seconds. The chip was regenerated (i.e., dissociating the bound protein and refolding DNA) by injecting 5 l of a 50 mM NaOH solution (equivalent to 15 seconds) and flushing the chip with the running buffer for 10 minutes. In order to deduct a response value caused by bulk effects or non-specific adsorption to the sensor chip, the response value of a cell to which no DNA is immobilized (i.e., reference cell) was deducted from the sensorgram of each DNA aptamer.

(113) The results are shown in FIG. 4. As a result of the assay, the K.sub.D values of the DNA aptamers were 1.03 nM (vWF1-DsDsDs), 1.08 nM (vWF1-DsDsDs-GC), and 0.78 nM (vWF1-DsDsDs-GCmh). This indicates that the binding ability was improved by adding mini-hairpin DNA to the 3 terminus. While the K.sub.D value of the DNA aptamer to which mini-hairpin DNA was added (vWF1-DsDsDs-GCmh) was equivalent to the K.sub.D value of conventional ARC1172, the k.sub.off value thereof was significantly lower than that of a conventional nucleic acid aptamer (ARC1172: k.sub.off=0.162 (1/s); vWF1-DsDsDs-GCmh: k.sub.off=0.00159 (1/s)).

Example 5: Analysis of Tm Value of DNA Aptamer

(114) Thermal stability of the DNA aptamers (vWF1-DsDsDs, vWF1-DsDsDs-GC, vWF1-DsDsDs-GCmh. and vWF1-AAA; final concentration: 2 M) was assayed (Tm values). Changes in the absorbance of the DNA aptamers were assayed using an ultraviolet-visible spectrophotometer UV-2450 (Shimadzu Corporation), and the melting temperature (Tm) was determined from the first derivative thereof. The results are shown in FIG. 5. It was found that Tm of vWF1-DsDsDs was 65.7 C., that of vWF1-DsDsDs-GC was 73.0 C., and that of vWF1-DsDsDs-mhGC was 74.7 C., indicating that thermal stability was improved by increasing GC pairs in the stem region and adding mini-hairpin DNA. In particular, the Tm value of vWF1-DsDsDs-GC and that of vWF1-DsDsDs-mhGC were higher than that of the conventional DNA aptamer (i.e., ARC1172) by 10 C. or more, and thermal stability of vWF1-DsDsDs-GC and vWF1-DsDsDs-mhGC was significantly superior to that of ARC1172. In contrast, vWF1-AAA in which Ds was substituted with A exhibited Tm of 63 C., which was slightly lower than the original level. This indicates that Ds is involved in thermal stability.

Example 6: Selection of DNA Aptamer that Binds to vWF Using Random DNA Library

(115) In accordance with the random library method described in WO 2013/073602, a DNA library containing artificial nucleotide(s) (Ds) was prepared. The library used in the random library method was designed to contain artificial nucleotide (Ds) at random positions in a random nucleotide sequence at a particular proportion. Selection was carried out in accordance with the method of Example 1. Briefly, a DNA fragment (the total number of molecular species: 300 pmol; i.e., about 210.sup.14 molecules) was used as the first-round library, the target protein (i.e., the vWF A1 domain; V003, U-Protein) was mixed therewith. DNA that binds to the target protein was selected and isolated using magnetic beads, the DNA-vWF A1 domain complex was cleaved via polyacrylamide gel electrophoresis to select and isolate the DNA of interest, and the resultant was amplified via PCR. In total, 7 rounds of selection procedures were performed. Table 3 shows the conditions of each selection round. After the completion of 7 rounds of selection, sequence analysis was performed, and the sequences of the DNA aptamers comprising artificial nucleotide(s) (Ds) were obtained.

(116) TABLE-US-00003 TABLE 3 Selection conditions DNA Protein Volume Competitive Gel Electrophoresis PCR Round Method (nM) (nM) (ml) molecule (nM) Number of washing conditions conditions cycles 1 a 50 25 6 5 28 2 a 25 10 1 5 25 3 a 5 5 1 5 20 4 a 1 1 3 10 5 25 5 a 1 1 3 100 5 27 6 a 1 1 3 500 5 17 7 b 100 100 0.05 Native 0.5x TBE, 37 C., 15 300 V, 40 min Method a: Complex biotinylation Method b: Gel shift separation

(117) As a result of sequence analysis of the DNA library after the 7th round, 151,495 sequences to be analyzed were obtained in total. In accordance with the method of analysis described above, 100 or more clone sequences were extracted, and the number of clones comprising similar sequences was counted. As a result, the most common sequence was a single sequence, which accounted for 44% or more of the whole, and 84% of the whole when similar sequences were included. In the sequences including the most common sequences, there were 3 positions at which only A or T would appear with a high probability.

Example 7: Determination of DNA Aptamer Sequence

(118) The following procedure was carried out in order to accurately identify the positions of artificial base(s) (Ds) and the accurate sequence was determined.

(119) A probe sequence of a DNA fragment consisting of 25 bases that was designed to be specific to the most common sequence obtained in Example 6 was used (5-CGTTGAGACCTGTTAGGTGCTCTTC-3: SEQ ID NO: 25). The probe with the biotin-labeled 5 terminus, which was chemically synthesized and simply purified, was purchased from Thermo Fisher Scientific. The target sequence was isolated from the library with using the probe in the same manner as in Example 2.

(120) Sequencing DNA comprising artificial base(s) (Ds) was carried out in the same manner as in Example 2. As a result of sequence pattern analysis, a pattern (a gap) indicating an artificial base was observed at 3 positions in the sequencing reaction using a Px strand as a template when using, whereas peak A was observed in the sequencing reaction when using naturally substituted DNA as a template. This result indicates the presence of artificial bases (Ds) at 3 positions (i.e., 9, 21, and 32 positions in random region).

Example 8: Analysis of Binding Activity of DNA Aptamer Via Gel Shift Assay

(121) In order to examine the binding ability of the sequenced DNA aptamer comprising artificial bases (Ds) at 3 positions to the A1 domain of the vWF protein, a DNA aptamer from which the primer region was cleaved was prepared, and the binding activity was analyzed via gel shift assay. Table 4 shows the sequences of the DNA aptamers used in this example and FIG. 6 shows the putative secondary structures.

(122) TABLE-US-00004 TABLE 4 Sequences of various DNA aptamers used SEQ ID NO: Aptamer name Sequence (5.fwdarw.3) 13 vWF2-DsDsDs CGTGACCGADsGAGCACCTAACDsGGTCTCAACGDsTGGAGGTCACG 14 vWF2-DsADs CGTGACCGADsGAGCACCTAACAGGTCTCAACGDsTGGAGGTCACG 15 vWF2-DsAA CGTGACCGADsGAGCACCTAACAGGTCTCAACGATGGAGGTCACG 16 vWF2-AADs CGTGACCGAAGAGCACCTAACAGGTCTCAACGDsTGGAGGTCACG 17 vWF2-AAA CGTGACCGAAGAGCACCTAACAGGTCTCAACGATGGAGGTCACG 18 vWF2-DsDsDs-mhGC CGCGGCCGADsGAGCACCTAACDsGGTCTCAACGDsTGGAGGCCGCGCGCGTAGCG 21 vWF2-DsDsDs-2mhGC CGCGGCCGADsGAGCACCGAAGGTCTCAACGDsTGGAGGCCGCGCGCGTAGCG

(123) On the basis of vWF2-DsDsDs (SEQ ID NO: 13), internal Ds was substituted with A to prepare vWF2-DsADs (SEQ ID NO: 14), internal Ds and 3-terminal Ds were each substituted with A to prepare vWF2-DsAA (SEQ ID NO: 15), 5-terminal Ds and internal Ds were each substituted with A to prepare vWF2-AADs (SEQ ID NO: 16), all Ds bases were each substituted with A to prepare vWF2-AAA (SEQ ID NO: 17), and the AT pairs in the stem region were substituted with the GC pairs and mini-hairpin DNA was added to the 3 terminus to prepare vWF2-DsDsDs-mhGC (SEQ ID NO: 18). On the basis of WF2-DsDsDs-mhGC (SEQ ID NO: 18), the internal loop structure of WF2-DsDsDs-mhGC was substituted with the partial sequence of the loop (5-GAA-3) to prepare vWF2-DsDsDs-2mhGC (SEQ ID NO: 21). A conventional DNA aptamer (ARC1172: SEQ ID NO: 10) was also prepared. The DNA aptamers were chemically synthesized in accordance with a conventional technique.

(124) Gel shift assay was carried out in the same manner as in Example 3, except that electrophoresis was carried out at 4 C. and 300 V, 25 C. and 40 W, and 37 C. and 40 W.

(125) The results are shown in FIG. 7. Gel shift assay indicates that the binding activity of vWF2-DsADs (n) was not decreased in comparison with the activity of vWF2-DsDsDs (m) to vWF A1 domain. And the activity of vWF2-DsAA (o) and vWF2-AADs (p) were decreased in comparison with vWF2-DsDsDs (m). These results indicate that 5-terminal Ds and 3-terminal Ds are involved in binding, among 3 artificial bases (Ds). In particular, the binding ability of vWF2-DsAA (o) was significantly lowered, indicating that 3-terminal Ds is significantly involved in with binding. ARC1172 (j) used as a positive control did not substantially bind to the target when subjected to electrophoresis at 25 C. to 37 C., whereas vWF2-DsDsDs (m), vWF2-DsADs (n), vWF2-DsDsDs-mhGC (r), and vWF2-DsDsDs-2mhGC (s) comprising artificial bases (Ds) maintained the binding activity after electrophoresis at 25 C. to 37 C.

Example 9: Biacore Analysis of Binding Ability of DNA Aptamer to vWF

(126) The binding ability of the DNA aptamers was assayed via surface plasmon resonance (SPR) using BiacoreT200 (GE Healthcare). Table 4 shows the sequences of the DNA aptamers used for analysis and FIG. 6 shows the secondary structures deduced based on the nucleotide sequences obtained via selection, and the like.

(127) These DNA aptamer mutants were prepared by chemical synthesis of nucleic acids comprising the nucleotide sequences shown in the figure and purified with denaturing acrylamide gel. The nucleic acid fragments were mixed in phosphate buffer (pH 7.4), and the resultant was heated at 95 C., followed by folding (reconstruction) via gradual cooling to 25 C. Binding analysis via SPR was carried out in the same manner as in Example 4, except that interaction between the DNA aptamer and the vWF A1 domain was detected at 0 nM, 0.078125 nM, 0.15625 nM, 0.3125 nM, 0.625 nM, 1.25 nM, 2.5 nM, and 5 nM.

(128) The results are shown in FIG. 8. As a result of the measurement, the K.sub.D values of the DNA aptamers were 326 M (ARC1172), 74.9 M (vWF2-DsDsDs), and 61.3 M (Bio-vWF2-DsDsDs-2mhGC). The binding ability was improved by adding mini-hairpin DNA to the 3 terminus, substituting the internal stem-loop structure with the mini-hairpin structure, and substituting the AT pairs with the GC pairs in the stem region. The DNA aptamer comprising artificial base(s) (Ds) obtained in this example was found to have a higher binding ability than the conventional vWF-binding DNA aptamer (ARC1172) used as a positive control (FIG. 8).

Example 10: Analysis of Stability of DNA Aptamer in Human Blood Serum

(129) Stability of the DNA aptamers against nucleases contained in human blood serum was examined. The DNA aptamers (vWF2-DsDsDs, vWF2-DsDsDs-mhGC, vWF2-DsDsDs-2mhGC, vWF2-AAA, and ARC1172; final concentration: 2 M) were mixed with human blood serum to be the 96% concentration of the human blood serum, and the mixture was incubated at 37 C. 10 l was taken from the mixture 0, 1, 6, 24, 48, and 72 hours later, and was mixed with 110 l of a solution of 1TBE in 10 M urea to terminate the degradation reaction. After the reaction, the sample was separated via denaturing 15% polyacrylamide gel electrophoresis, and the gel was stained with SYBR GOLD (Thermo Fisher Scientific) to detect a single-stranded nucleic acid. The band patterns of the products degraded by nucleases in human blood serum were analyzed using a bioimager LAS-4000 (Fujifilm Corporation).

(130) The results are shown in FIG. 9. The proportion (%) of the DNA aptamers remaining at each time point deduced based on the intensity of the undegraded band when 0 hour is considered as 100% is shown in Table 5.

(131) TABLE-US-00005 TABLE 5 Remaining DNA aptamer in blood serum (%) 1 hour 6 hours 24 hours 48 hours 72 hours Aptamer name later later later later later vWF2-DsDsDs 103 96 69 46 30 vWF2-DsDsDs-mhGC 101 100 78 61 46 vWF2-DsDsDs-2mhGC 107 111 95 87 75 vWF2-AAA 103 112 77 42 25 ARC1172 103 91 37 24 20

(132) The amount of the remaining full-length DNA aptamers of vWF2-DsDsDs-mhGC and vWF2-DsDsDs-2mhGC is significantly greater than that of vWF-DsDsDs. This indicates that stability of the DNA aptamer against nucleases in blood serum is improved. The amount of remaining ARC1172 used as a positive control was 20% after incubation at 37 C. for 72 hours, whereas 75% of vWF2-DsDsDs-2mhGC remained after 72 hours incubation at 37 C. Thus, the DNA aptamer according to the present invention was shown to have higher stability against nucleases than ARC1172 and its stability against nucleases in blood serum was shown to be significantly improved by adding the mini-hairpin sequence.

Example 11: Analysis of Thermal Stability of DNA Aptamer

(133) Thermal stability (Tm values) of the DNA aptamers (vWF2-DsDsDs, vWF2-DsADs, vWF2-DsAA, vWF2-AADs, vWF2-AAA, vWF2-DsDsDs-mhGC, and vWF2-DsDsDs-2mhGC; final concentration: 2 M) was assayed. Changes in the absorbance of the DNA aptamers were assayed using an ultraviolet-visible spectrophotometer UV-2450 (Shimadzu Corporation), and the melting temperature (Tm value) was determined from the first derivative thereof.

(134) The results are shown in FIG. 10. It was found that Tm value of vWF2-DsDsDs was 66.8 C., that of vWF2-DsADs was 63.5 C., that of vWF2-DsAA was 62.0 C., that of vWF2-AADs was 61.5 C., that of vWF2-AAA was 60.0 C., that of vWF2-DsDsDs-mhGC was 75.5 C., and that of vWF2-DsDsDs-2mhGC was 76.5 C. As described above, Tm value was increased by about 9 C. by substituting the AT pairs in the stem sequence with the GC pairs and adding mini-hairpin DNA to the 3 terminus. In addition, Tm value was increased by about 10 C. by substituting the internal stem-loop structure with the mini-hairpin sequence. Thus, a DNA aptamer that remain stable at higher temperatures was prepared.

(135) All publications, patents, and patent applications cited herein are incorporated herein by reference in their entirety.