VECTORS AND METHODS FOR GENE EXPRESSION IN MONOCOTS

Abstract

The invention relates to the field of genetic engineering tools for gene expression in plants. Specifically, the invention concerns modified Foxtail Mosaic Virus (FoMV) vectors comprising polynucleotide sequences which are capable of driving expression of a gene of interest in a plant host. Accordingly, the invention concerns FoMV-based expression vectors comprising said polynucleotides, compositions comprising modified FoMV vectors, methods of generating gene expression in plants infected with the modified FoMV vectors. The expression vectors, compositions, plants and methods of the present invention find application in many fields of biotechnology, including, for example, gene characterization, protein production and agricultural biotechnology.

Claims

1. (canceled)

2. A modified Foxtail Mosaic Virus (FoMV) for expression of a gene of interest (GOI) in a plant, plant part or plant cell, wherein the virus comprises a first sgp2 promoter and at least a second sgp2 promoter; and wherein the GOI is under transcriptional control of the at least second sgp2 promoter.

3. A modified FoMV as claimed in claim 2, wherein the first sgp2 promoter is 5 of a polynucleotide encoding the virus coat protein (CP) and the at least second sgp2 promoter and polynucleotide encoding the polypeptide of interest are 5 of the first sgp2 promoter.

4. A modified FoMV as claimed in claim 2, wherein the polynucleotide sequence of the at least second sgp2 promoter comprises a polynucleotide sequence selected from the group consisting of: (a) a polynucleotide sequence of SEQ ID NO: 1, or a sequence of at least 90% identity thereto; (b) a polynucleotide sequence of SEQ ID NO: 2, or a sequence of at least 90% identity thereto; (c) a polynucleotide sequence of SEQ ID NO: 3, or a sequence of at least 90% identity thereto; (d) a polynucleotide sequence of SEQ ID NO: 4, or a sequence of at least 98% identity thereto; (e) a polynucleotide sequence of SEQ ID NO: 5, or a sequence of at least 90% identity thereto; (f) a polynucleotide sequence of SEQ ID NO: 6, or a sequence of at least 90% identity thereto; and (g) a polynucleotide sequence of SEQ ID NO: 7, or a sequence of at least 90% identity thereto.

5.-6. (canceled)

7. A modified FoMV as claimed in claim 2, wherein the virus comprises the sequence selected from the group consisting of: (a) SEQ ID NO: 8, or a sequence of at least 80% identity thereto; and (b) SEQ ID NO: 9, or a sequence of at least 80% identity thereto.

8. (canceled)

9. A modified FoMV as claimed in claim 2, wherein the modified FoMV is in the form of a vector; preferably a DNA viral vector or an RNA viral vector.

10. A modified FoMV as claimed in claim 2, wherein the GOI encodes a sequence selected from the group consisting of: (a) a polypeptide; preferably a heterologous polypeptide; more preferably a polypeptide of microbial, plant or animal/human origin, wherein the polypeptide is at least 200 amino acids in length; and (b) a protein non-coding sequence, optionally wherein the protein non-coding sequence is selected from the group consisting of a microRNA (miRNA) or a long non-coding RNA (IncRNA).

11-14. (canceled)

15. A Foxtail Mosaic Virus (FoMV) DNA expression construct comprising from 5 to 3 polynucleotide sequences encoding a strong heterologous promoter that is active in plants, followed by the viral ORF1, sgp1 promoter, ORF2, ORF3, ORF 4, at least two sgp2 promoters, coat protein (CP) and nopaline synthase terminator (nos), wherein the ORF2 overlaps with ORF3 and ORF3 overlaps with ORF4, and ORF4 includes the start codon of ORF5A, wherein the polynucleotide sequence comprised in or between the duplicated sgp2 promoters includes insertion site(s) for a gene of interest (GOI).

16. An FoMV expression construct as claimed in claim 15, wherein the duplicated portion of the sgp2 promoter has a polynucleotide sequence comprises: (a) a polynucleotide sequence of SEQ ID NO: 2 or a sequence of at least 90% identity thereto; or (b) a polynucleotide sequence of SEQ ID NO: 3 or a sequence of at least 90% identity thereto; or (c) a polynucleotide sequence of SEQ ID NO: 4; or (d) a polynucleotide sequence of SEQ ID NO: 5 or a sequence of at least 90% identity thereto; or (e) a polynucleotide of SEQ ID NO: 6 or a sequence of at least 90% identity thereto.

17. An FoMV expression construct as claimed in claim 15, wherein the insertion site comprises at least one selected from the group consisting of: (a) restriction sites; optionally wherein the restriction sites are Sal\-Cla\-Asc\-Hpa\-Xba\; or Not\-Cla\-Asc\-Hpa\-Xba\; (b) att recombination cloning sites; optionally wherein the att recombination site is at least one of att or attR; and (c) a Gateway cassette is inserted between the sgp2 promoters.

18. (canceled)

19. An FoMV expression construct as claimed in claim 15, further comprising a GOI under the control of the duplicated sgp2 promoter.

20. FoMV viral genomic RNA (gRNA) encoded by an FoMV expression construct of claim 19.

21. A method of expressing a protein in a plant, plant part or plant cell, comprising infecting the plant, plant part or a plant cell with a modified FoMV of claim 2.

22. A method as claimed in claim 21, wherein the plant is a monocotyledonous plant, or the plant part or plant cell is of a monocotyledonous plant; preferably a plant selected from the group consisting of Triticum sp. and Zea sp.; more preferably Triticum aestivum.

23. A method as claimed in claim 21, wherein the modified FoMV is in the form of an FoMV expression construct comprising from 5 to 3 polynucleotide sequences encoding a strong heterologous promoter that is active in plants, followed by the viral ORF1, sgp1 promoter, ORF2, ORF3, ORF 4, at least two sgp2 promoters, coat protein (CP) and nopaline synthase terminator (nos), wherein the ORF2 overlaps with ORF3 and ORF3 overlaps with ORF4, and ORF4 includes the start codon of ORF5A, wherein the polynucleotide sequence further comprises a GOI, under the control of the duplicated sgp2 promoter, wherein the FoMV expression construct is transformed into Agrobacterium sp. and further wherein a dicotyledonous plant, or a plant part or plant cell of a dicotyledonous plant is inoculated with the Agrobacterium; preferably wherein the dicotyledenous plant is Nicotiana sp.; more preferably Nicotiana benthamiana, or parts or cells thereof; optionally further comprising infecting a monocotyledonous plant with modified FoMV virus particles or FoMV RNA obtained from the Agrobacterium infected diclotyledonous plant.

24. (canceled)

25. A method of transient local or systemic overexpression of a protein in a plant comprising infecting or transfecting the plant with a modified FoMV virus or viral vector of claim 2, and afterwards growing the plant, wherein the infection or transfection is carried out under a first set of environmental conditions and the growing of the plant is carried out under a second set of environmental conditions; optionally wherein the second set of environmental conditions comprises a light/dark photoperiod, with a light temperature of greater than 21 C. and/or a dark temperature of greater than 24 C.; optionally wherein the light intensity is in the range 200 mol.Math.m.sup.2.Math.s.sup.1 to 2500 mol.Math.m.sup.2.Math.s.sup.1.

26.-27. (canceled)

28. A plant, plant part or plant cell infected with a modified FoMV as defined in claim 2, wherein the expressed GOI is selected from the group consisting of: (a) a protein or polypeptide at least 200 amino acids in length; (b) a protein non-coding sequence; optionally a sequence encoding a microRNA (miRNA) or long non-coding RNA (IncRNA) (c) a fungal protein; preferably a fungal effector protein; and (d) a protein with insecticidal or fungicidal activity.

29-32. (canceled)

33. A plant, plant part or plant cell as claimed in claim 28, wherein the plant, plant part or plant cell has an increased level of expression of a desired GOI compared to a genetically equivalent but uninfected control plant, plant part or plant cell; optionally wherein the plant is a monocotyledonous plant, or the plant part or plant cell is of a monocotyledonous plant preferably Triticum sp. or Zea sp.; more preferably Triticum aestivum.

34. (canceled)

35. A composition comprising a modified FoMV virus particle, as defined in claim 2.

36. A composition as claimed in claim 35 which is an extract of or sap from a plant infected with a modified FoMV.

37. A method of identifying monocotyledonous plants for suitability for a breeding process, comprising infecting a monocot plant with a modified FoMV virus as defined in claim 2, growing the plant for a period of time and then examining the plant for the presence or absence of one or more phenotypic, biochemical and/or genetic characteristics as a measure of said suitability.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0114] Embodiments of the invention are further described hereinafter with reference to the accompanying drawings, in which:

[0115] FIG. 1 shows an alignment of the duplicated subgenomic promoter 2 (sgp2) sequences used for expression of heterologous proteins. 1. to 5. 170 nt-, 101 nt-, 90 nt-, 55 nt- and 45 nt-long sgp2 sequence duplications used in the modified FoMV vectors. Fragments of the viral genes TGB3, ORF 5A and CP spanned by the different sgp2 duplications are boxed and displayed underneath each sequence. The core sequence is an octa-nucleotide sequence (GTTAGGGT) which is found across different FoMV isolates, and is essential for sgp2 activity. Vertical arrows indicate two single nucleotide polymorphisms between the sgp2 sequence duplication used by Liu and colleagues and the sgp2 duplications we produced. Liu et al. (2016) used a different FoMV isolate, Robertson vs pCF, for their VIGS vector development.

[0116] FIG. 2 shows polynucleotide sequences of the duplicated sgp2 used for expression of heterologous proteins.

[0117] FIG. 3 shows levels of heterologous gene expression obtained from the modified FoMV vectors.

[0118] FIG. 4 shows heterologous expression of Green Fluorescent Protein (GFP) in N. benthamiana using the developed modified FoMV vectors. FIG. 4 A shows immuno-detection of GFP and FoMV coat protein (CP) by Western-blotting from infiltrated leaf samples collected 3 days post infiltration (dpi). p19 is a suppressor of RNA silencing from Tomato bushy stunt virus, which was coinfiltrated with each vector. pCF is the non-modified virus. sgp2-101 is an empty modified FoMV vector containing a 101 nt-long duplicated sgp2 promoter sequence. sgp2/101-GFP, sgp2/90-GFP, sgp2/55-GFP and sgp2/45-GFP are modified FoMV vectors where GFP is expressed under the control of the duplicated 101-, 90-, 55- or 45-nt long sgp2 promoter sequences, respectively. Ponceau-stained protein gel panels show equal protein loading between the samples. FIG. 4B shows sections of infiltrated leaves observed using stereomicroscopy under bright field and UV light at 3-dpi. FIG. 4C shows a section of upper non-infiltrated leaf observed using stereomicroscopy under bright field and UV light at 21-dpi. GFP-expressing areas are delimited by white lines for clarity.

[0119] FIG. 5 shows heterologous expression of GFP in maize (Zea mays) using the newly developed modified FoMV vector sgp2/101-GFP. Sections of rub-inoculated (leaf 3) and upper non-inoculated leaves (leaves 4, 5, 6) observed using stereomicroscopy under bright field and UV light at 13-dpi are shown.

[0120] FIG. 6 shows heterologous expression of GFP in bread wheat (Triticum aestivum) using the developed modified FoMV vector sgp2/101-GFP. Panel A shows sections of rub-inoculated leaves (leaf 1, 2) observed using stereomicroscopy under bright field and UV light at 8-dpi. Panel B shows sections of upper non-inoculated fourth leaves observed using stereomicroscopy under bright field and UV light at 26-dpi. Fourth leaves of two plants (plant 1, 2) are shown.

[0121] FIG. 7 shows heterologous expression achieved in wheat under different growth conditions, using the pCF.sgp2/101 vector

: No detectable gene expression
+: Low expression level, with gene expressing areas being very limited in size and number
++: High expression level with gene expressing areas being numerous and wide

[0122] FIG. 8 shows heterologous expression levels achieved in wheat using the pCF.sgp2/101, PV139wa.sgp2/101 and PV139wa.sgp2/170 vectors

+: Low expression level
++: High expression level
x: Limited spread. Gene expressing areas are limited in size and number
xx: Medium spread. Gene expressing areas can be numerous in some parts of the leaf
xxx: Gene expressing areas are numerous and nearly uniformly spread along the leaf width and/or length.

[0123] FIG. 9 shows micrographs and Western blots of samples involving FoMV-mediated expression of GFP in Agro-infiltrated Nicotiana benthamiana leaves.

[0124] FIG. 10 shows PV101gw-mediated expression of the green fluorescent protein (GFP) in Nicotiana benthamiana.

[0125] FIG. 11 shows micrographs of FoMV-mediated expression of a necrotrophic fungal effector, ToxA from Stagonospora nodorum. A=ToxA-expressing FoMV (PV101-SnToxA) was rub-inoculated to a ToxA-sensitive (Halberd, Hal) and a ToxA-insensitive wheat cultivar (Chinese Spring, CS). Plants 13 day-old were inoculated and then inoculated leaves 2 were observed at 6 dpi. PV101-GFP was used as a control. The white bar represents 20 mm. B=FoMV-expressing full-length ToxA (PV101-SnToxA) or a non-secreted version of ToxA (PV101-SnToxA_noSP) were inoculated to 10 day-old wheat plants. First systemic leaves (3rd leaves) were observed at 11 dpi and 16 dpi under a fluorescence stereomicroscope mounted with a longpass filter (LP). Photographs taken at 16 dpi are from the same leaf areas as those shown at 11 dpi. White bars represent 2.5 mm.

[0126] FIG. 12 shows micrographs of FoMV-mediated expression of a ca. 600 aa-long protein, GUSPlus. GUSPlus-expressing FoMV (PV101-GUSPlus) was rub-inoculated onto wheat cvs. Pakito (A) and Riband (B) and onto maize plants (line B73, C). The empty vector PV101 was used as a control. GUSPlus activity in leaf samples was detected by histochemical staining with X-Gluc. Inoculated leaves taken at 9 dpi were cut and stained. Systemic leaves taken at either 15 dpi (1st) or 22 dpi (2nd and 3rd) were cut and then stained. Each leaf piece comes from a different individual plant. Black bars represent 20 mm.

[0127] FIG. 13 shows the nucleotide sequence of the Taiwanese FoMV isolate pCF, with no modifications [SEQ ID NO: 8].

[0128] FIG. 14 shows the nucleotide sequence of the wheat-adapted isolate PV139wa, with no modifications [SEQ ID NO: 9].

[0129] FIG. 15 shows the nucleotide sequence of the vector pCF.sgp2/45-GFP SEQ ID NO: 10] where the duplicated sgp2 is 45 nt-long (duplicated regions are in highlighted in grey), and where the GFP coding sequence is underlined.

[0130] FIG. 16 shows the nucleotide sequence of the vector pCF.sgp2/55-GFP [SEQ ID NO: 11] where the duplicated sgp2 is 55 nt-long (duplicated regions are in highlighted in grey), and where the GFP coding sequence is underlined.

[0131] FIG. 17 shows the nucleotide sequence of the vector pCF.sgp2/90-GFP [SEQ ID NO: 12] where the duplicated sgp2 is 90 nt-long (duplicated regions are in highlighted in grey), and where the GFP coding sequence is underlined. The start codon which is present in the duplicated region was mutated by a T to G substitution in the first repeat of the duplicated sequence. The mutated nucleotide is in lower case.

[0132] FIG. 18 shows the nucleotide sequence of the vector pCF.sgp2/101-GFP [SEQ ID NO: 13] where the duplicated sgp2 is 101 nt-long (duplicated regions are in highlighted in grey), and where the GFP coding sequence is underlined. The start codon which is present in the duplicated region was mutated by a T to G substitution (shown in lowercase) in the first repeat of the duplicated sequence.

[0133] FIG. 19 shows the nucleotide sequence of the vector PV139wa.sgp2/101-GFP [SEQ ID NO: 14] where the duplicated sgp2 is 101 nt-long (duplicated regions are in highlighted in grey), and where the GFP coding sequence is underlined. The start codon which is present in the duplicated region was mutated by a T to G substitution in the first repeat of the duplicated sequence. The mutated nucleotide is in lower case.

[0134] FIG. 20 shows the nucleotide sequence of the vector PV139wa.sgp2/170-GFP [SEQ ID NO: 15] (170-nt long sgp2 duplication). Duplicated regions highlighted in grey. GFP coding sequence is underlined.

DETAILED DESCRIPTION

Example 1: General Materials and Methods

[0135] Plants and Growth Conditions

[0136] Nicotiana benthamiana plants were grown in a controlled environment room with day/night temperature of 23 C./20 C. at 60% relative humidity and a 16 h photoperiod (approximately 130 mol.Math.m-2.Math.s-1 light).

[0137] Maize (Zea mays, line B73) and bread wheat (Triticum aestivum, cv. Riband) plants were grown in a controlled environment cabinet with day/night temperature of 26.7 C./21.1 C. at approximately 50% relative humidity and a 16 h photoperiod (approximately 250 mol.Math.m-2.Math.s-1 light).

[0138] Vector Construction

[0139] All Polymerase Chain Reactions (PCRs) were carried out using the high fidelity DNA polymerase Phusion (New England Biolabs) unless otherwise stated. All the constructs described below were verified by sequencing. Oligonucleotide sequences used in the construction of vectors are listed in Table 1.

[0140] Plasmids

[0141] The plasmid pCF containing the genome of Foxtail mosaic virus (FoMV) isolate pCF cloned under the control of Cauliflower mosaic virus (CaMV) 35S promoter was a gift from Ming-Ru Liou and Yau-Heiu Hsu (National Chung Hsing University, Taichung, Taiwan).

[0142] Sequence of the Taiwanese FoMV isolate pCF, with no modifications is provided as SEQ ID NO: 8. Many of the vectors described herein derive from this isolate.

[0143] The binary vector pGR106 is an agroinfection vector containing a modified Potato virus X genome with a duplicated subgenomic promoter, cloned between CaMV 35S promoter and the nos (nopaline synthase gene from Agrobacterium tumefaciens) terminator sequence (Lu et al., EMBO J, 2003).

[0144] The vector pActIsGFP is a vector containing the coding sequence of an improved version of Green Fluorescent Protein (GFP S65T; Heim et al., Nature, 1995).

[0145] The vector pBIN61-P19 was a gift from Patrice Dunoyer (Institut de Biologie Molculaire des Plants, CNRSUniversity of Strasbourg, France). This is a binary plasmid for expression of the p19 protein from Tomato bushy stunt virus, a well-known suppressor of gene silencing often used to ensure high levels of heterologous protein production in planta.

[0146] Construction of a binary pGR-FoMV.pCF plasmid containing full length genome of FoMV, isolate pCF

[0147] The genome of FoMV isolate pCF was cloned into a binary vector as follows. CaMV 35S promoter sequence was amplified by PCR from the vector pGR106 with the oligonucleotides 535Sp and 5FoMV-335Sp. The 5-part of FoMV isolate pCF was amplified by PCR from the plasmid pCF with the oligonucleotides 335Sp-5FoMV and SpeI-FoMV1040R. The two resulting amplicons were fused by PCR with the oligonucleotides 535Sp and SpeI-FoMV1040R, using a 38-nt long complementary region which was artificially introduced at the 3-extremity of 35S promoter and at the 5-extremity of FoMV amplicons. The resulting 35S-5-FoMV fragment was then cloned between EcoRV SpeI recognition sites into EcoRV+SpeI-digested pGR106 vector backbone to produce the plasmid pGR-5-pCF. Finally, the 3-part of FoMV pCF was obtained by BlpI+XbaI digestion of pCF plasmid and this fragment was then inserted into the BlpI+SpeI-digested pGR-5-pCF. The resulting construct was named pGR-FoMV.pCF. In this binary plasmid the FoMV genome is under control of CaMV 35S promoter, and is flanked by the nos terminator sequence at the 3-end.

[0148] Construction of a binary FoMV vector pGR-FoMV.pCF.sgp2/101-GFP for expression of green fluorescent protein (GFP)

[0149] To avoid doing all cloning steps with the full-length pGR-FoMV.pCF plasmid (10.8 kbp), successive insertions of a duplicated promoter 2 (sgp2) and then of the GFP coding gene were done into a smaller shuttle vector of about 4 kbp. This vector contains the FoMV 3-part from the middle of TGB2 coding gene up to the end of the virus 3-end. The non-modified sgp2 promoter is thus present in this plasmid. After assembly, the sequence sgp2-GFP-FoMV 3-part was cloned back into the pGR-FoMV.pCF binary vector.

[0150] The nucleotide sequence of the vector pCF.sgp2/101-GFP where the duplicated sgp2 is 101 nt-long is provided as SEQ ID NO: 13 (duplicated regions are in highlighted in grey), and where the GFP coding sequence is underlined. The start codon which is present in the duplicated region was mutated by a T to G substitution (shown in lowercase) in the first repeat of the duplicated sequence:

[0151] Construction of the shuttle vector pB-Fmcs-10

[0152] A pBxs plasmid was created by introducing SpeI and XhoI restriction sites into pMA-RQ (ampR)pMA-T plasmid by PCR with the oligonucleotides pBxs-fw and pBxs-rev.

[0153] A fragment corresponding to FoMV pCF 3-part was obtained by SpeI+XhoI digestion of plasmid pCF and then cloned into SpeI+XhoI-digested-pBxs to give the plasmid called pB-F. A multi cloning site was then inserted into pB-F by two successive PCRs with the oligonucleotides pB-Fmcs-10-fw1 and pB-Fmcs-10-rev1 for the first reaction, and pB-Fmcs-10-fw2 and pB-Fmcs-10-rev2 for the second reaction.

[0154] Construction of pB-Fsgp2/101-GFP

[0155] A 101 nt-long sequence of subgenomic promoter 2 and the GFP coding sequence were inserted into the shuttle vector as follows. A sequence corresponding to the 101-nt long variant of predicted FoMV pCF subgenomic promoter 2 (sgp2/101) was produced by gene synthesis and cloned into SphI+AscI-digested pB-Fmcs-10 to give the plasmid pB-Fsgp2/101. GFP S65T coding sequence was amplified by PCR with oligonucleotides GFP5-ClaI-fw and GFP3-XbaI-rev from the plasmid pActIsGFP and cloned into ClaI+XbaI-digested pB-Fsgp2/101 to give pB-Fsgp2/101-GFP. This plasmid contains a sgp2/101-GFP-FoMV 3-part sequence.

[0156] Construction of pGR-FoMV.pCF.sgp2/101-GFP

[0157] The sequence sgp2/101-GFP-FoMV 3-part from the shuttle vector pB-Fsgp2/101-GFP was inserted into pGR-FoMV.pCF as follows.SpeI+XhoI-digested pB-Fsgp2/101-GFP (FoMV fragment) was cloned into SpeI+XhoI-digested pGR-FoMV.pCF to give the plasmid pGR-FoMV.pCF.sgp2/101-GFP. The corresponding empty vector pGR-FoMV.pCF.sgp101 (a vector with the duplicated sgp2 but without the GFP coding gene) was constructed by cloning SpeI+XhoI-digested pB-Fsgp101 (FoMV fragment) into SpeI+XhoI-digested pGR-FoMV.pCF.

[0158] Construction of pGR-FoMV.pCF.sgp2/90-GFP, pGR-FoMV.pCF.sgp2/55-GFP and pGR-FoMV.pCF.sgp2/45-GFP

[0159] Three other FoMV vectors similar to pGR-FoMV.pCF.sgp2/101-GFP except that they contain different fragments of predicted FoMV pCF sgp2 of 90 nts, 55 nts and 45 nts in size were constructed. The cloning steps to assemble these vectors, though very similar to the steps described in the part about pGR-FoMV.pCF.sgp2/101-GFP, involved another shuttle vector called pB-Fmcs.

[0160] Construction of pB-Fmcs

[0161] A multiple cloning site (MCS) was inserted into pB-F (see paragraph B. 3. a.) by two successive PCRs with the oligonucleotides pB-Fmcs-fw1 and pB-Fmcs-rev1 for the first reaction, and pB-Fmcs-fw2 and pB-Fmcs-rev2 for the second reaction.

[0162] Construction of pB-Fsgp2/90-GFP, pB-Fsgp2/55-GFP and pB-Fsgp2/45-GFP

[0163] The three variants of sgp2 and the GFP coding sequence were inserted into the shuttle vector pB-Fmcs as follows. Sequences corresponding to the 90-, 55- and 45-nt long fragments of predicted FoMV pCF sgp2 (sgp2/90, sgp2/55 and sgp2/45, respectively) were synthesised commercially and cloned into SphI+AscI-digested pB-Fmcs to give the plasmids pB-Fsgp90, pB-Fsgp55 and pB-Fsgp45, respectively. GFP S65T coding sequence was then amplified by PCR from the plasmid pActIsGFP with oligonucleotides GFP5-ClaI-fw and GFP3-XbaI-rev and cloned into ClaI+XbaI-digested pB-Fsgp2/90, pB-Fsgp2/55 and pB-Fsgp2/45 to give pB-Fsgp2/90-GFP, pB-Fsgp2/55-GFP and pB-Fsgp2/45-GFP, respectively. These plasmids contain a sgp2/90- or sgp2/55- or sgp2/45-GFP-FoMV 3-part sequence.

[0164] Construction of pGR-FoMV.pCF.sgp90-GFP, pGR-FoMV.pCF.sgp55-GFP and pGR-FoMV.pCF.sgp45-GFP

[0165] The sgp2/90- or sgp2/55- or sgp2/45-GFP-FoMV 3-part sequences were cloned back into pGR-FoMV.pCF as follows. The FoMV fragments of SpeI+XhoI-digested pB-Fsgp2/90-GFP, pB-Fsgp2/55-GFP and pB-Fsgp2/45-GFP were inserted into SpeI+XhoI-digested pGR-FoMV.pCF to give the plasmids pGR-FoMV.pCF.sgp2/90-GFP, pGR-FoMV.pCF.sgp2/55-GFP and pGR-FoMV.pCF.sgp2/45-GFP, respectively. The corresponding empty vectors pGR-FoMV.pCF.sgp2/90, pGR-FoMV.pCF.sgp2/55 and pGR-FoMV.pCF.sgp2/45 were constructed by cloning the FoMV fragments of SpeI+XhoI-digested pB-Fsgp2/90, pB-Fsgp2/55 and pB-Fsgp2/45, respectively, into SpeI+XhoI-digested pGR-FoMV.pCF.

[0166] 5. Construction of the Wheat Adapted Isolate

[0167] The FoMV sequence from which the vectors have been developed derives from the isolate PV139 obtained from Jeff Ackerman and Dallas Seifers (KSU). All the isolates were a gift. Wheat adapted isolate was constructed as follows; freeze-dried PV139-infected sorghum leaf tissue was used to infect wheat plants (cvs. Chinese Spring, Riband and Bobwhite). Systemic and symptomatic wheat leaves were collected and used for serial passaging of the virus in order to adapt it to wheat. After six passages, total RNA was extracted from systemic and symptomatic wheat leaves and then small-RNA sequenced. The master genome of the wheat adapted FoMV-PV139 was obtained by aligning the small RNA reads to a FoMV template sequence (FoMV sequence of the p9 clone, obtained from Nancy Robertson). The wheat-adapted FoMV-PV139 clone was then created by gene synthesis and restriction cloning assembly.

[0168] The nucleotide sequence of the wheat adapted isolate PV139wa, with no modifications is provided as SEQ ID NO: 9.

[0169] The nucleotide sequence of the wheat adapted isolate PV139wa, with sgp2 duplicated 101 nt insert (PV139wa.sgp2/101) is provided as SEQ ID NO: 14.

[0170] The nucleotide sequence of the wheat adapted isolate PV139wa, comprising a 170 nt long sgp2 duplication (PV139wa.sgp2/170) is provided as SEQ ID NO: 15. Duplicated regions are in highlighted in grey and the GFP coding sequence is underlined.

[0171] Delivery of the FoMV Vectors to Host Plants

[0172] Nicotiana benthamiana

[0173] FoMV vectors were delivered to N. benthamiana by agroinfiltration. FoMV vectors or pBIN61-P19 plasmid were introduced into Agrobacterium tumefaciens GV3101 pCH32 pSa-Rep by electroporation. Transformants were selected on Luria-Bertani (Lennox) agar plates supplemented with gentamycin (25 g/mL) and kanamycin (50 g/mL) after 48 h incubation at 28 C. Single colonies were streaked and grown in liquid Luria-Bertani (Lennox) medium supplemented with antibiotics at 28 C. for 20 h under constant shaking (250 rpm). Agrobacterium cultures were then pelleted at 2013g for 20 min at 17 C. After having discarded the supernatant, the cells were resuspended in induction medium (10 mM 2-(N-Morpholino)ethanesulfonic acid, 10 mM MgCl2 and 100 M acetosyringone), adjusted at 1.2-1.5 OD600 and incubated at room temperature for h. Each FoMV vector-containing Agrobacterium culture was mixed with an equal volume of pBIN61-P19-containing Agrobacterium culture diluted at a similar OD600 and then pressure infiltrated to the abaxial face of leaves from 6 to 8 leaf-stage N. benthamiana plants using needleless syringe.

[0174] Bread Wheat (Triticum aestivum) and Maize (Zea mays)

[0175] FoMV vectors were delivered to young wheat and maize plants by rub inoculation onto the leaves. Virus-containing sap was prepared from FoMV-vector agroinfiltrated N. benthamiana leaves collected at 6 to 7 days post-infiltration. Leaves were ground in 0.67 w/v deionized water and then supplemented with 1% (w/v) celite. Sap was then rub-inoculated onto the first two leaves of 10-11 day-old wheat plants (cv. Riband; 2 leaf-stage) or the second and third leaves of 10 day-old maize plants (line B73; 3 leaf-stage). After inoculation, the plants were left for 5 min and then sprayed with water to clean up the leftover sap and celite present on the inoculated leaves. The inoculated plants were then covered with lids or autoclave bags in order to keep the humidity content high, and kept under low light conditions (usually under a growing shelf) for about 24 h before being returned to standard growth conditions.

[0176] Assessment of Heterologous Expression

[0177] Immuno-Detection of GFP and FoMV Coat Protein (FoMV-CP)

[0178] 50-100 mg of N. benthamiana leaf samples were put in 2 ml safe-lock micro-tubes with 0.17 w/vol suspension buffer (100 mM Tris-HCl, pH 8 1 mM DL-Dithiothreitol) and 3 chrome beads (3 mm diameter) and then homogenized for 220 s at 1750 rpm in a tissue homogenizer (2010 Geno/Grinder, SPEX SamplePrep). 100 l of leaf extract were supplemented with 33 l 4 Laemmli extraction buffer (8% SDS, 20% 2-mercaptoethanol, 40% glycerol, 0.008% bromophenol blue, 0.25 M Tris-HCl pH 6.8) and incubated at 95 C. for 5 min to allow denaturation of proteins. The samples were spun down (centrifuged) at 16100g for 5 min to pellet any cell debris and the supernatants were loaded onto a 16% SDS-polyacrylamide gel. Proteins were separated by electrophoresis performed in 25 mM Tris, 192 mM glycine, 0.1% (w/v) SDS and then electrotransferred to a nitrocellulose membrane (Amersham Protran Premium 0.45 NC, GE Healthcare Life Sciences) for 90 min at 90 V in 25 mM Tris, 192 mM glycine, 20% (v/v) methanol. After transfer, membranes were rinsed in PBS-T buffer (50 mM Tris, 150 mM NaCl and 0.1% (w/v) Tween 20) for 5 min and then blocked in PBS-T+5% (w/v) dry milk for 45 min at room temperature and under constant shaking. Blocked membranes were incubated overnight at 4 C. under constant shaking with primary antibodies diluted in PBS-T+5% dry milk. The rabbit anti GFP antibody (ref G10362, Life Technologies) was diluted at 1:200 and the rabbit anti FoMV-CP antibody (ChinaPeptides) was diluted at 1:10000. Non-bound antibodies were eliminated by rinsing the membranes three times in PBS-T for 15 min at room temperature under constant shaking. Incubation with secondary antibody (goat anti-rabbit-peroxidase antibody, ref A0545, Sigma-Aldrich) diluted at 1:10000 in PBS-T+5% dry milk was performed for 3 hours at room temperature under constant shaking. Non-bound antibodies were removed by rinsing the membranes three times in PBS-T for 10 min at room temperature under constant shaking. Membrane-bound immune complexes were revealed with Amersham ECL Prime kit (GE Healthcare Life Sciences). Chemiluminescence signals were visualised using X-ray films (Hyperfilm ECL, GE Healthcare Life Sciences). Protein loading was then estimated by staining the membranes in Ponceau S (Sigma-Aldrich) solution for 5 min (5% acetic acid (v/v) 0.1% Ponceau S (w/v)). Excess of Ponceau S was eliminated by soaking the stained membranes into deionized water for about 1 min under constant shaking.

[0179] Stereomicroscopy

[0180] GFP-induced fluorescence in plant samples was visualised with a Leica M205 FA stereomicroscope using a GFP3 filter (excitation filter: 450-490 nm; barrier filter 500-550 nm). Pictures were taken using Leica LAS AF software.

TABLE-US-00001 TABLE1 Oligonucleotidesequencesusedinthe constructionofvectors 535Sp CTCGCATGCCTGCAGGTC [SEQID NO:16] 5FoMV- CGGTTTCGGAAGAGTTTTCCCTCTCCAAAT [SEQID 335Sp GAAATGAA NO:17] 335Sp- TTCATTTCATTTGGAGAGGGAAAACTCTTC [SEQID 5FoMV CGAAACCG NO:18] Spel- TATCACTAGTGGTTTGCCTCAGCTTAGC [SEQID FoMV1040R NO:19] pBxs-fw ATACTCGAGGCGTGGATCCCGCTGGGCCTC [SEQID NO:20] pBxs-rev GTTATACTAGTTTTTTCCTTATGCGGCCTT [SEQID NO:21] pB-Fmcs- CAGTTAACTTACTCTAGACACTCAACGACC [SEQID 10-fw1 GCATTGAG NO:22] pB-Fmcs- GTCGACTTGTTCGGCCGAGTGCCAGCAGTT [SEQID 10-rev1 TCCGGT NO:23] pB-Fmcs- AGTTGGCGCGCCAATCAGTTAACTTACTCT [SEQID 10-fw2 AGACA NO:24] pB-Fmcs- ATCGATAGCTGTCGACTTGTTCGGCCGAG [SEQID 10-rev2 NO:25] pB-Fmcs- CAGTTAACTTACTCTAGACGCATTGAGGGT [SEQID fw1 GTTAGGG NO:26] pB-Fmcs- GTCGACTTGTTCGGCCGTCGTTGAGTGGAG [SEQID rev1 TGCCAG NO:27] pB-Fmcs- AGTTGGCGCGCCAATCAGTTAACTTACTCT [SEQID fw2 AGACG NO:28] pB-Fmcs- ATCGATAGCTGTCGACTTGTTCGGCCGTC [SEQID rev2 NO:29] GFP5- AGGTCAATCGATATGGTGAGCAAGGGCGAG [SEQID ClaI-fw G NO:30] GFP3- TATGCTTCTAGATTACTTGTACAGCTCGTC [SEQID XbaI-rev CATG NO:31]

Example 2: Sgp2 Promoter Sequences Used to Drive Expression of Proteins in Plants

[0181] FIG. 1 shows an alignment of the duplicated subgenomic promoter 2 (sgp2) sequences used for expression of proteins in plants. Sequence 1 refers to a 170 nt-long sgp2 duplication originally used by Liu and colleagues (Liu et al. 2016, Plant Physiology 171:1801-1807) in their FoMV-VIGS (virus-induced gene silencing) vector. Sequences 1 to 5 refer to 170 nt-, 101 nt-, 90 nt-, 55 nt- and 45 nt-long sgp2 sequence duplications used in our modified FoMV vectors for protein expression respectively. Fragments of the viral genes TGB3, ORF 5A and CP spanned by the different sgp2 duplications are boxed and displayed underneath each sequence. The core sequence is an octa-nucleotide sequence (GTTAGGGT) which is found across different FoMV isolates, and it is thought to be essential for sgp2 activity. Vertical arrows indicate two single nucleotide polymorphisms between the sgp2 sequence duplication used by Liu and colleagues and the sgp2 duplications we produced. Liu et al. (2016) and us used different FoMV isolates, Robertson vs pCF, for their VIGS vector development.

Example 3: Polynucleotide Sequences of the Duplicated Sgp2 Used for Expression of Heterologous Proteins

[0182] Polynucleotide sequences of the duplicated sgp2 used for expression of heterologous proteins are shown in FIG. 2.

Example 4: Levels of Heterologous Gene Expression Obtained from the Modified FoMV Vectors

[0183] Gene expressing areas in inoculated leaves were numerous and nearly uniformly spread along the leaf width and/or length in Nicotiana benthamiana (tobacco), Zea mays (Maize) and Triticum aestivum (wheat) (FIG. 3).

[0184] Gene expressing areas are limited in size and number in Nicotiana benthamiana (tobacco) and Triticum aestivum (wheat).

[0185] Gene expressing areas in systemic leaves were numerous and nearly uniformly spread along the leaf width and/or length in Zea mays (Maize).

Example 5: Heterologous Expression of Green Fluorescent Protein (GFP) in N. benthamiana Using the Modified FoMV Vectors

[0186] FoMV vectors were delivered to the leaves of N. benthamiana as described in the materials and methods (C.1.). FIG. 4 shows heterologous expression of Green Fluorescent Protein (GFP) in N. benthamiana using the modified FoMV vectors. Panel A shows Immuno-detection of GFP and FoMV coat protein (CP) by Western-blotting from infiltrated leaf samples collected 3 days post infiltration (dpi). p19 is a suppressor of RNA silencing from Tomato bushy stunt virus, which was coinfiltrated with each vector. pCF is the non-modified virus. sgp2-101 is an empty modified FoMV vector containing a 101 nt-long duplicated sgp2 promoter sequence. sgp2/101-GFP, sgp2/90-GFP, sgp2/55-GFP and sgp2/45-GFP are modified FoMV vectors where GFP is expressed under the control of the duplicated 101-, 90-, 55- or 45-nt long sgp2 promoter sequences, respectively. Ponceau-stained protein gel panels show equal protein loading between the samples. Panel B shows sections of infiltrated leaves observed using stereomicroscopy under bright field and UV light at 3-dpi. Panel C shows a section of upper non-infiltrated leaf observed using stereomicroscopy under bright field and UV light at 21-dpi. GFP-expressing areas are delimited by white lines for clarity.

Example 6: Modified FoMV Vector Sgp2/101-GFP Drives Heterologous Expression of GFP in Maize (Zea mays)

[0187] Maize leaves were rub-inoculated with modified FoMV vector sgp2/101-GFP as described in the materials and methods. Sections of rub-inoculated (leaf 3) and upper non-inoculated leaves (leaves 4, 5, 6) were made and GFP fluorescence was observed using stereomicroscopy under bright field and UV light at 13-dpi. Heterologous expression of GFP was observed in maize (Zea mays) using the newly modified FoMV vector sgp2/101-GFP in both inoculated and systemic leaves (FIG. 5).

Example 7: Modified FoMV Vector Sgp2/101-GFP Drives Heterologous Expression of GFP in Bread Wheat (Triticum aestivum)

[0188] Bread wheat (Triticum aestivum) leaves were rub-inoculated with modified FoMV vector sgp2/101-GFP as described in the materials and methods. Sections of rub-inoculated leaves (leaf 1, 2) were made and GFP fluorescence was observed using stereomicroscopy under bright field and UV light at 8-dpi (FIG. 6A). Sections of upper non-inoculated fourth leaves observed using stereomicroscopy under bright field and UV light at 26-dpi (FIG. 6B). Fourth leaves of two plants (plant 1, 2) are shown. Heterologous expression of GFP was observed in bread wheat (Triticum aestivum) using the newly modified FoMV vector sgp2/101-GFP in both inoculated and systemic leaves (FIG. 6).

Example 8: Extent of Spread and Level of GFP Expression in Bread Wheat (Triticum aestivum) are Influenced by Growth Conditions

[0189] To determine the influence of the growth conditions on the effectiveness of the modified FoMV vector bread wheat (Triticum aestivum) plants which had been rub-inoculated with modified FoMV vector sgp2/101-GFP as described in the materials and methods were grown under two sets of growth conditions and GFP fluorescence as a proxy for gene expression was observed as described previously.

[0190] Firstly, growth conditions similar to those described in Liu et al. 2016, Plant Physiology 171:1801-1807 (22-24 C., growth under 16 h light/8 h dark cycle) resulted in low expression level, with gene expressing areas being very limited in size and number in inoculated leaves (+) and no gene expression was detectable () in upper non-inoculated (systemic) leaves (FIG. 7).

[0191] Secondly, bread wheat (Triticum aestivum) plants which had been rub-inoculated with Modified FoMV vector sgp2/101-GFP as described in the materials and methods were grown under conditions of 26.7 C. day-21.1 C. night, under 16 h light of high intensity (approximately 250 mol.Math.m-2.Math.s-1 light) and 8 h dark cycle. In contrast to the first conditions, high levels of expression with gene expressing areas being numerous and wide (++) were observed in inoculated leaves and low levels of expression, with gene expressing areas being very limited in size and number (+) were observed in upper non-inoculated (systemic) leaves (FIG. 7).

[0192] This result indicates that the optimal conditions for this modified FoMV vector in achieving high-levels of localised expression and in achieving systemic expression are 26.7 C. day-21.1 C. night, under 16 h light of high intensity (approximately 250 mol.Math.m-2.Math.s-1 light) and 8 h dark cycle.

Example 9: Modified FoMV Vectors pCF.sgp2/101, PV139wa.sgp2/101 and PV139wa.sgp2/170 Vectors Drive Heterologous Expression of GFP in Bread Wheat (Triticum aestivum)

[0193] Bread wheat (Triticum aestivum) leaves were independently rub-inoculated with modified FoMV vectors pCF.sgp2/101, PV139wa.sgp2/101 and PV139wa.sgp2/170 as described previously. Sections of rub-inoculated leaves and upper non-inoculated leaves were made and GFP fluorescence was observed using stereomicroscopy under bright field and UV light as described previously. Heterologous expression of GFP was observed in bread wheat (Triticum aestivum) using the newly developed modified FoMV vectors pCF.sgp2/101, PV139wa.sgp2/101 and PV139wa.sgp2/170 in both inoculated and systemic leaves (FIG. 8).

[0194] The results were categorised as follows:

+: Low expression level
++: High expression level
x: Limited spread. Gene expressing areas are limited in size and number
xx: Medium spread. Gene expressing areas can be numerous in some parts of the leaf
xxx: Extensive spread. Gene expressing areas are numerous and nearly uniformly spread along the leaf width and/or length

[0195] pCF.sgp2/101 showed high expression levels (++) and limited spread (x) in inoculated leaves and systemic leaves. PV139wa.sgp2/101 showed high expression levels (++) and limited spread (x) in inoculated leaves and systemic leaves, limited spread (x) in inoculated leaves and medium spread (xx) in systemic leaves.

[0196] PV139wa.sgp2/170 showed low expression levels (+) in both inoculated leaves and systemic leaves and medium spread (xx) in inoculated leaves and extensive spread (xxx) in systemic leaves.

Example 10: FoMV-Mediated Expression of GFP Using a Long Duplicated sgp2

[0197] A 169 nt-long sgp2 duplication includes the full 5-part termini of ORF5A (see FIG. 9A) which is absent in the 101 nt-long duplication (bottom). FIG. 9B shows Agro-infiltrated Nicotiana benthamiana leaves were observed at 7 dpi. Pictures were taken using a camera mounted with a bandpass (BP) filter. FIG. 9C shows immuno-detection of GFP and FoMV-CP in agro-infiltrated leaves of several individual plants by western-blot. Samples were collected at 7 dpi. FIG. 9D shows cv. Riband wheat (Triticum aestivum) leaves rub-inoculated with PV101-GFP or PV169-GFP and observed at 8 dpi using a fluorescence stereomicroscope mounted with bandpass (BP) and longpass (LP) filters. Acquisition settings were kept identical between leaves. White bars represent 2.5 mm. The vector based on pGR-FoMV.PV139 that contains a 169-nt long duplication of sgp2 equivalent to that in the Virus-induced gene silencing vector pFoMV-sg.sub.[KK1]. The resulting vector PV169 could express GFP in both Nicotiana benthamiana and wheat (Triticum aestivum), however the observed GFP fluorescence in the infected leaves was less intense than that in the PV101-GFP infected leaves (FIGS. 9B & 9D) and the PV169-GFP-infiltrated Nicotiana benthamiana leaves accumulated less GFP but more viral CP than the PV101-GFP infiltrated leaves as determined by immunoblotting (FIG. 9C).

Example 11: Second Generation FoMV Expression Vector with Gateway Cassette

[0198] In vitro synthesized commercially (Invitrogen) full-length cDNA copy of the FoMV isolate PV139 was cloned into the pGR106 vector backbone between EcoRV and AflII restriction nuclease sites generating the binary plasmid pGR-FoMV.PV139. A full-length FoMV cDNA in this plasmid is flanked at the 5-end by the CaMV 35S promoter and at the 3-end by the nos terminator sequence. This pGR-FoMV.PV139 was used for developing a second generation FoMV expression vector using the same methodology as described above for pCF.sgp2/101. A 101-nt long fragment spanning the core FoMV SGP2 sequence was duplicated and a MCS containing recognition sites for NotI, ClaI, AscI, HpaI, and XbaI was inserted downstream of the first sgp2 copy. The resulting vector was named PV101. PV101 was modified by replacing the multiple cloning site with the Gateway cassette to produce a second, prototype vector, PV101gw, that allows insertion of heterologous sequences using recombination-based cloning. In more detail, a first PCR (PCR1) was done using pGR-FoMV.PV139 as the template and the oligonucleotides PVsorg-6F and PV101gw-R1. A Gateway cassette was amplified by PCR (PCR2) from the vector pGWB605 (Nakamura et al., 2010 Bioscience Biotechnology and Biochemistry 74: 1315-1319) using the oligonucleotides PV101gw-F2 and PV101gw-R2. A third amplicon (PCR3) was produced from pGR-FoMV.PV139 with the oligonucleotides PV101gw-F3 and PVsorg-8R. Amplicons from PCR1, PCR2 and PCR3 were assembled into SpeI plus AvrII digested pGR-FoMV.PV139 using the NEBuilder HiFi DNA assembly system to obtain the vector PV101gw. Both empty vectors made were infectious.

[0199] An expression construct produced by recombining coding sequence of gfp (S65T) into the Gateway-enabled vector PV101gw, was also fully infectious and GFP expression was detected in the infected plant tissues using a handheld Dual Fluorescent Protein flashlight (Nightsea). FIG. 10A shows agroinfiltrated leaves at 6 dpi. Leaves were co-agroinfiltrated with an Agrobacterium tumefaciens strain carrying a binary vector coding for the suppressor of silencing p19. The empty vector PV101 was used as negative control. FIG. 10B shows systemic leaves at 16 dpi. Pictures were taken using a camera mounted with bandpass (BP) and longpass (LP) filters.

Example 12: Cloning of Genes Encoding Reporter Proteins and a Fungal Necrotrophic Effector Protein into the FoMV Expression Vectors

[0200] The coding sequence of the S65T variant of GFP gene was amplified from the plasmid pActIsGFP using the oligonucleotides GFP5-C/al-fw and GFP3-XbaI-rev. The corresponding amplicon was digested with C/al plus XbaI and cloned into C/al plus XbaI-digested PV101 to create PV101-GFP. The GFP coding sequence was also amplified from pActIsGFP using the oligonucleotides attB1-GFP-F and attB2-GFP-R, and the obtained amplicon was recombined into the Gateway enabled FoMV vector PV101gw using BP clonase II enzyme mix (Invitrogen) following the manufacturers protocol, to produce PV101gw-GFP. The coding sequence of the Stagonospora nodorum ToxA gene was amplified from the plasmid pDONR207-ToxA+SP-STOP using the oligonucleotides ClaI-SnToxA-F and XbaI-SnToxA-R. The amplicon was then digested using C/al plus XbaI and cloned into C/al plus XbaI-digested PV101 to produce PV101-SnToxA.

[0201] The coding sequence of GUSPlus (Jefferson et al., 2002 Microbial beta-glucuronidase genes, gene products and uses thereof. In: Center for the Application of Molecular Biology to International Agriculture, Canberra, Australia) in the plasmid pRRes104.293 served as a template for two PCRs producing partially overlapping amplicons using primers ClaI-woGUS-F1 and woGUS-R1 (PCR 1) and woGUS-F2 and XbaI-woGUS-R2 (PCR 2). The amplicons from PCR1 and PCR2 were then fused together using an additional cycle of PCR and the oligonucleotides ClaI-woGUS-F1 and XbaI-woGUS-R2. The resulting amplicon, containing a GUSPlus coding sequence with the internal C/al recognition site removed, was digested using C/a and XbaI and cloned into C/al plus XbaI-digested PV101 to obtain PV101-GUSPlus.

[0202] The FoMV vector PV101 can be used as a tool for expression of pathogen effector proteins. The full-length coding sequence of a well-studied necrotrophic effector ToxA (Friesen et al., 2006; Liu et al., 2006) was cloned from Stagonospora nodorum, the causal agent of glume blotch disease in wheat, into PV101. ToxA is known to induce necrosis on wheat cultivars carrying the corresponding sensitivity gene Tsn1 (Friesen et al., 2006; Faris et al., 2010). Indeed, only ToxA-sensitive wheat (Triticum aestivum) cv. Halberd but not ToxA-insensitive wheat cv. Chinese Spring when inoculated with the PV101-SnToxA construct developed necrosis in both inoculated and systemically infected leaves (FIGS. 9A-B). A mature version of ToxA (without its native signal peptide) was also cloned into PV101. The resulting PV101-SnToxA_noSP induced necrosis in systemic leaves of wheat cv. Halberd only but the necrosis was delayed by at least 5 days in comparison with the necrosis induced by the full length ToxA. This indicates that secretion of ToxA into the apoplastic space is not absolutely required, which agrees well with the previous work by Manning and Cuiffetti (Manning and Ciuffetti, 2005) demonstrating that ToxA is imported within the cell in Tsn1 wheat lines. PV101-GFP was used as a control in these experiments and induced only mild chlorotic mosaics on both cultivars (FIG. 9). The FoMV vector PV101 is therefore is useful for VOX applications such as medium-to-high throughput screens for necrosis or cell-death inducing candidate fungal effectors.

Example 13: The FoMV Vector PV101 can be Used for Expression of Proteins as Large as 600 Amino Acids

[0203] PV101 was tested for in planta expression of proteins of a larger protein. For this experiment, a synthetic gene encoding a modified 600 amino acids long Staphylococcus spp. -glucuronidase protein GUSPlus (Jefferson et al., 2002) was cloned into PV101. Good levels of GUSPlus expression was observed in the PV101-GUSPlus-inoculated leaves of both wheat and maize seedlings (FIG. 10). However, GUSPlus expression in the systemically infected wheat leaves appeared to be even more limited than expression of GFP (FIG. 10 A-B). This suggests a negative correlation between insert length and vector stability. Marginally higher levels of GUSPlus expression were observed in the upper non-inoculated leaves of wheat cv. Pakito (compare FIGS. 10A and B), which agrees well with the fact that this same cultivar showed the best GFP fluorescence scores in the systemically infected leaves among all wheat cultivars tested. By contrast to the somewhat disappointing performance of PV101-GUSPlus in wheat, good levels of GUSPlus expression were observed in the upper non-inoculated maize leaves. The percentage of symptomatic maize plants showing systemic GUSPlus expression varied from 33% to 100% between different experiments. The best GUSPlus expression levels were observed in L5 with weaker and patchy expression in L4 and L6. The FoMV vector PV101 will express heterologous proteins of up to 600 amino acids in the inoculated leaves of wheat and maize, and in up to three consecutive systemically infected leaves in maize. The FoMV vector PV101 successfully expresses a wide range of native proteins from 178-aa long (SnToxA) to at least ca. 600-aa long (GUSPlus) in both inoculated and in systemically infected leaves of wheat and maize. PV101 can be used for VOX in plants such as Sorghum bicolor, Setaria italica and Setaria viridis, which are natural hosts for FoMV, as well as in several other monocots including important crops such as barley, oat and rye that can be systemically infected with FoMV under laboratory conditions (Paulsen and Niblett, 1977 Phytopathology 67: 346-1351).

[0204] Furthermore, FoMV-mediated VOX using PV101 and PV101gw can be used in medium throughput screens and the vector can be modified further to allow rapid restriction endonuclease independent cloning and thereby increase experimental throughput. This opens a wide range of applications where an easy and rapid method of heterologous protein expression in monocots is needed. For example, PV101 may be used in screens for cell-death activity of secreted or cytosolic candidate pathogen effectors in wheat, maize or other monocot crops or model species, or in screens for proteins with putative insecticide or antifungal activities. Throughout the description and claims of this specification, the words comprise and contain and variations of them mean including but not limited to, and they are not intended to (and do not) exclude other moieties, additives, components, integers or steps. Throughout the description and claims of this specification, the singular encompasses the plural unless the context otherwise requires. In particular, where the indefinite article is used, the specification is to be understood as contemplating plurality as well as singularity, unless the context requires otherwise.

[0205] Nucleotide Sequences Referred to Herein:

TABLE-US-00002 Nucleotidesequenceofthevariantsgp2/CSof subgenomicpromoter2: [SEQIDNO:1] GTTAGGGT Nucleotidesequenceofthevariantsgp2/45of subgenomicpromoter2: [SEQIDNO:2] CGCATTGAGGGTGTTAGGGTAACCAGCATCAGTGAAGAGAAACAA Nucleotidesequenceofthevariantsgp2/55of subgenomicpromoter2: [SEQIDNO:3] CGCATTGAGGGTGTTAGGGTAACCAGCATCAGTGAAGAGAAACAACCCA CCTCAA Nucleotidesequenceofthevariantsgp2/DSof subgenomicpromoter2: [SEQIDNO:4] TGGCAACA Nucleotidesequenceofthevariantsgp2/90of subgenomicpromoter2: [SEQIDNO:5] CGCATTGAGGGTGTTAGGGTAACCAGCATCAGTGAAGAGAAACAACCCA CCTCAAGTGTGACCTCATCATTTCAGGACACAATGGCAACA Nucleotidesequenceofthevariantsgp2/101of subgenomicpromoter2: [SEQIDNO:6] CACTCAACGACCGCATTGAGGGTGTTAGGGTAACCAGCATCAGTGAAGA GAAACAACCCACCTCAAGTGTGACCTCATCATTTCAGGACACAATGGCA ACA Nucleotidesequenceofthevariantsgp2/170of subgenomicpromoter2: [SEQIDNO:7] CACTCGACCCGTTCAACCATCGTGCCATGTCGAAATCAACGGCCACTCC ATCATCGTCACCGGAAACTGCTGGCACTCCACTCAACGACCGCATTGAG GGTGTTAGGGTAACCAACATCAGTGAAGAGAAACAACCCACCTCGAGTG TGACCTCATCATTTCAGGACACA
[SEQ ID NO: 8] Nucleotide sequence of the Taiwanese FoMV isolate pCF, with no modifications (see FIG. 13)
[SEQ ID NO: 9] Nucleotide sequence of the wheat-adapted isolate PV139wa, with no modifications (See FIG. 14):
[SEQ ID NO: 10] Nucleotide sequence of the vector pCF.sgp2/45-GFP where the duplicated sgp2 is 45 nt-long (duplicated regions are in highlighted in grey), and where the GFP coding sequence is underlined (see FIG. 15).
[SEQ ID NO: 11] Nucleotide sequence of the vector pCF.sgp2/55-GFP where the duplicated sgp2 is 55 nt-long (duplicated regions are in highlighted in grey), and where the GFP coding sequence is underlined (See FIG. 16).
[SEQ ID NO: 12] Nucleotide sequence of the vector pCF.sgp2/90-GFP where the duplicated sgp2 is 90 nt-long (duplicated regions are in highlighted in grey), and where the GFP coding sequence is underlined. The start codon which is present in the duplicated region was mutated by a T to G substitution in the first repeat of the duplicated sequence. The mutated nucleotide is in lower case (see FIG. 17).
[SEQ ID NO: 13] Nucleotide sequence of the vector pCF.sgp2/101-GFP where the duplicated sgp2 is 101 nt-long (duplicated regions are in highlighted in grey), and where the GFP coding sequence is underlined. The start codon which is present in the duplicated region was mutated by a T to G substitution (shown in lowercase) in the first repeat of the duplicated sequence (see FIG. 18).
[SEQ ID NO: 14] Nucleotide sequence of the vector PV139wa.sgp2/101-GFP where the duplicated sgp2 is 101 nt-long (duplicated regions are in highlighted in grey), and where the GFP coding sequence is underlined. The start codon which is present in the duplicated region was mutated by a T to G substitution in the first repeat of the duplicated sequence. The mutated nucleotide is in lower case (see FIG. 19).
[SEQ ID NO: 15] Nucleotide sequence of the vector PV139wa.sgp2/170-GFP (170-nt long sgp2 duplication). Duplicated regions highlighted in grey. GFP coding sequence is underlined (see FIG. 20).

TABLE-US-00003 535Sp [SEQIDNO:16] CTCGCATGCCTGCAGGTC 5FoMV-335Sp [SEQIDNO:17] CGGTTTCGGAAGAGTTTTCCCTCTCCAAATGAAATGAA 335Sp-5FoMV [SEQIDNO:18] TTCATTTCATTTGGAGAGGGAAAACTCTTCCGAAACCG Spel-FoMV1040R [SEQIDNO:19] TATCACTAGTGGTTTGCCTCAGCTTAGC pBxs-fw [SEQIDNO:20] ATACTCGAGGCGTGGATCCCGCTGGGCCTC pBxs-rev [SEQIDNO:21] GTTATACTAGTTTTTTCCTTATGCGGCCTT pB-Fmcs-10-fw1 [SEQIDNO:22] CAGTTAACTTACTCTAGACACTCAACGACCGCATTGAG pB-Fmcs-10-rev1 [SEQIDNO:23] GTCGACTTGTTCGGCCGAGTGCCAGCAGTTTCCGGT pB-Fmcs-10-fw2 [SEQIDNO:24] AGTTGGCGCGCCAATCAGTTAACTTACTCTAGACA pB-Fmcs-10-rev2 [SEQIDNO:25] ATCGATAGCTGTCGACTTGTTCGGCCGAG pB-Fmcs-fw1 [SEQIDNO:26] CAGTTAACTTACTCTAGACGCATTGAGGGTGTTAGGG pB-Fmcs-rev1 [SEQIDNO:27] GTCGACTTGTTCGGCCGTCGTTGAGTGGAGTGCCAG pB-Fmcs-fw2 [SEQIDNO:28] AGTTGGCGCGCCAATCAGTTAACTTACTCTAGACG pB-Fmcs-rev2 [SEQIDNO:29] ATCGATAGCTGTCGACTTGTTCGGCCGTC GFP5-ClaI-fw [SEQIDNO:30] AGGTCAATCGATATGGTGAGCAAGGGCGAGG GFP3-XbaI-rev [SEQIDNO:31] TATGCTTCTAGATTACTTGTACAGCTCGTCCATG

[0206] Features, integers, characteristics, compounds, chemical moieties or groups described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein unless incompatible therewith. All of the features disclosed in this specification (including any accompanying claims, abstract and drawings), and/or all of the steps of any method or process so disclosed, may be combined in any combination, except combinations where at least some of such features and/or steps are mutually exclusive. The invention is not restricted to the details of any foregoing embodiments. The invention extends to any novel one, or any novel combination, of the features disclosed in this specification (including any accompanying claims, abstract and drawings), or to any novel one, or any novel combination, of the steps of any method or process so disclosed.

[0207] The reader's attention is directed to all papers and documents which are filed concurrently with or previous to this specification in connection with this application and which are open to public inspection with this specification, and the contents of all such papers and documents are incorporated herein by reference.