GENERATION OF HEAVY-CHAIN ONLY ANTIBODIES IN TRANSGENIC ANIMALS

Abstract

The present invention relates to a method for the generation of V.sub.H heavy chain-only antibodies in a transgenic non-human mammal. In particular, the present invention relates to a method for the production of a V.sub.H heavy chain-only antibody in a transgenic non-human mammal comprising the step of expressing more than one heterologous V.sub.H heavy chain locus in that mammal.

Claims

1-34. (canceled)

35. A method for increasing the diversity of V.sub.H heavy chain-only antibodies in a transgenic non-human mammal comprising the steps of a) providing a transgenic non-human mammal whose genome comprises more than one heterologous V.sub.H heavy chain locus, wherein each heterologous V.sub.H heavy chain locus comprises V.sub.H gene segments, D gene segments, and J gene segments, and a gene segment encoding a heavy chain constant region which, when expressed, does not include a functional C.sub.H1 domain and b) expressing a V.sub.H heavy chain-only antibody from at least one of said loci in B-cells, wherein said V.sub.H gene segments do not encode camelid VHH domains, and wherein said heterologous V.sub.H heavy chain loci are present on the same or different chromosomes, and the expression of a heterologous V.sub.H locus is determined by allelic exclusion.

36. The method of claim 35, wherein each heavy chain locus comprises one V.sub.H gene segment.

37. The method of claim 35, wherein each V.sub.H gene segment is different from all other V.sub.H gene segments.

38. The method of claim 35, wherein the V.sub.H gene segments are of human origin.

39. The method of claim 35, wherein the multiple V.sub.H heavy chain loci comprise any number or combination of the 39 functional human V gene segments.

40. The method of claim 39, wherein each different V.sub.H heavy chain locus is present as a single copy in the genome of the transgenic non-human mammal.

41. The method of claim 35, wherein each V.sub.H heavy chain locus comprises from one to forty D gene segments.

42. The method of claim 35, wherein the D gene Segments are human D gene segments.

43. The method of claim 35, wherein each V.sub.H heavy chain locus comprises from one to twenty J gene segments.

44. The method of claim 35, wherein the J gene segments are human J gene segments.

45. The method of claim 35, wherein each V.sub.H heavy chain locus comprises one or more human V.sub.H gene segments, twenty-five functional human D gene segments and 6 human J gene segments.

46. The method of claim 35, wherein each gene segment encoding a heavy chain constant region comprises one or more heavy chain constant region exons of the C, C.sub.1-4, C, C or C.sub.1-2 classes, with the proviso that at least one of the heavy chain constant region gene segments does not express a C.sub.H1 domain.

47. The method of claim 35, wherein the heavy chain constant region is of human origin.

48. The method of claim 45, wherein the heavy chain constant region is of human origin.

49. The method of claim 35, wherein the transgenic non-human mammal is a rodent.

50. The method of claim 45, wherein the transgenic non-human mammal is a rodent.

51. The method of claim 49, wherein the rodent is a mouse.

52. A transgenic non-human mammal comprising more than one heterologous V.sub.H heavy chain locus as defined in claim 35.

53. A transgenic non-human mammal comprising more than one heterologous V.sub.H heavy chain locus as defined in claim 45.

54. A method for the production of heavy chain-only antibodies comprising: a) immunising a transgenic non-human mammal of claim 52 with an antigen; and b) isolating antigen-specific heavy chain-only antibodies.

55. A method for the production of heavy chain-only antibodies comprising: a) immunising a transgenic non-human mammal of claim 53 with an antigen; and b) isolating antigen-specific heavy chain-only antibodies.

56. A method of producing high affinity, antigen-specific V.sub.H heavy chain-only antibodies comprising: a) immunising a transgenic non-human mammal according to claim 52 with an antigen; b) generating B-cell hybridomas; c) selecting cells expressing antigen-specific heavy chain-only antibody; and d) isolating antigen-specific heavy chain-only antibody.

57. A method of producing high affinity, antigen-specific V.sub.H heavy chain-only antibodies comprising: a) immunising a transgenic non-human mammal according to claim 53 with an antigen; b) generating B-cell hybridomas; c) selecting cells expressing antigen-specific heavy chain-only antibody; and d) isolating antigen-specific heavy chain-only antibody.

Description

FIGURES

[0086] FIG. 1: Schematic representation of the DNA fragments used to generate the transgenic mice. Two of the llama V.sub.HH exons are linked to the human heavy chain diversity (D) and joining (J) gene segments, followed by the C, C, C2 and C3. human constant region genes and human heavy chain Ig 3 LCR. Modifications of human C2 and C3 genes were a complete deletion of the CH1 exon from C2 and C3 genes in constructs MG and G or also from C in construct MG. The presence of two Lox P sites (in red) in the same direction enables the removal of C and C genes upon Cre mediated recombination. The presence of the Frt site (in green) enables the generation of a single copy transgenic mouse from a multi-copy transgene array by Flp mediated recombination.

[0087] FIG. 2A-2D: Panel A: Table of the flow cytometric analysis of the B lymphocytes expressed as the percentage of B220/CD19 positive cells of total cells in the different organs. Panel B: Flow cytometric analysis of B cell populations of wt, MT, MG/MT, MG/MT and G/MT mice in the BM. Lymphoid cells were gated on the basis of forward and side scatter and surface expression of B220 and human IgM or IgG is plotted. Data are displayed as dot plots. For MG MT mice the B220+ fraction was gated and analyzed for the expression of intracellular (ic) human Ig and H chains, displayed as histogram overlays (red lines), with background staining of B220+ cells from MT mice (black lines) as controls. The percentages of positive cells are indicated. Panel C: Expression of the MG or G transgene rescues pre-BCR and BCR function. Expression profiles of the indicated markers in total CD 19+ fractions from MT mice (pro-B cells), in CD19+ surface IgM-fractions (pro-B/pre-B cells) and CD 19+ surface IgM+ fractions (B cells) from wild-type mice, in CD 19+ surface human IgM+ fractions from MA-G MT mice (B cells) and CD19+ surface human IgG+ fractions from G MT mice (B cells). ic-Ig =intracellular Ig L chain. Flow cytometric data are displayed as histograms. Data shown are representative of 3-8 animals examined within each group. Panel D: Sequence alignment of the PCR products obtained from BM cDNA using YHH1 and VHH2 specific primers in combination with human C2 primer, showing VDJ recombination. Sequences are from G. Sequence Glg1 is SEQ ID NO: 17, Sequence Glg2 is SEQ ID NO: 18, Sequence Glg3 is SEQ ID NO: 19, Sequence Glg4 is SEQ ID NO:20, Sequence Glg5 is SEQ ID NO:21, Sequence Glg6 is SEQ ID NO:22, Sequence Glg7 is SEQ ID NO:23, Sequence Glg8 is SEQ ID NO:24, Sequence Glg9 is SEQ ID NO:25, Sequence Glg10 is SEQ ID NO:26. Green shows sequence identity.

[0088] FIG. 3A-3F: Panel A-E: DNA FISH of a five copy human G locus. Panel A: Stretched 30 chromatin fiber from lung cells of G linel transgenic mouse carrying five intact copies (1-5) of the G locus, flanked by half a locus containing the LCR (red) and half a locus carrying VHH to J region (green). Panel B: Stretched chromatin fiber FISH of a hybridoma (G20) derived from G linel B cells where one copy has rearranged (white arrow). Panel C: Non stretched DNA FISH of hybridoma T1 with the LCR probe (red). Panel D: Same as C with a probe between VHH and D (green). Panel E overlay of panels C and E. Note that T1 has four rearrangements visible as the loss of 4 green signals compared to no loss of red signals. Panel F: Allelic exclusion in G transgenic mice is preserved. Flow cytometric analysis of murine surface or intracellular (ic)H chain and transgenic human IgG on total BM CD 19+ cell fractions from the indicated mice. Data are displayed as dot plots and the percentages of cells within the indicated quadrants are given. Data shown are representative of four mice examined within each group.

[0089] FIG. 4A-4D: Analysis of B cell populations in the spleen of wt, MT, G, MG and MG mice. Data shown are representative of 4-8 mice examined within each group. Panel A: Top, FACS data of spleen cells, stained for mouse IgM, human IgG, human IgM versus B220. Bottom, flow cytometric analysis of B cell populations in the spleen. Lymphoid cells were gated on the basis of forward and side scatter and surface expression of B220 and the indicated Ig (upper part) or the CD21/CD23 profile is displayed as dot plots and the percentages of cells within the indicated gates are given. C-D21.sub.lowCD23.sub.low: immature B cells; CD21.sub.+CD23.sub.+: follicular B cells; CD2l.sub.highCD23.sub.low: marginal zone B cells. Panel B: Histology of the spleen of wt, MT, G/MT, MG/MT and MG/MT mice. Immunohistochemical analysis; 5 m frozen sections were stained with anti B220 (blue) for B cells and anti-CD 1 1c/N418 (brown) for dendritic cells. Arrows indicate the location of small clusters of B cells in the MGA spleens. Panel C: Sequence alignment of the PGR products obtained from Payer's patches cDNA using YHH1 and VHH2 specific primers in combination with human C2 primer, showing that the transgenic locus undergoes hypermutation in the CDR1 and 2 regions. Sequences are from the transgenic locus G with a CH1 deletion. Germline VHH1 is SEQ ID NO:27, Clone 1 is SEQ ID NO:28, Clone 2 is SEQ ID NO:29, Clone 3 is SEQ ID NO:30, Germline VHH2 is SEQ ID NO:31, Clone 4 is SEQ ID NO:32, Clone 5 is SEQ ID NO:33, Clone 6 is SEQ ID NO:34. Panel D: Top; FACS data of spleen cells, stained with anti-CD 19 and anti-B220. Bottom left: Schematic representation of Flp recombination in vivo by breeding to FlpeR transgenic line and FACS data on spleen cells of the single copy recombinant derived from the five copy G line 1. Bottom right: Schematic representation of Cre recombination in vivo by breeding MG lines to a CAGCre transgenic line and supporting FACS scan data on spleen cells of the recombinant, showing B cell rescue as seen in the directly generated original G lines.

[0090] FIG. 5A-5B: Southern blots showing the absence of the K light chain rearrangement in G/MT (panel A) and MG/yMT (panel B) transgenic lines. Liver DNA (L) and B cell DNA (B) from a wt mouse and two G or four MG transgenic mice was Hind III digested and probed with the .sup.32P radiolabeled J.sub.K probe and the carbonic anhydrase II (CAII) probe. The CAII probe, which hybridizes to a 4 kb band was used as a loading control. Liver DNA was run to show the.sub.K germline configuration (2.8 Kb band). Only the wt B cells show.sub.K locus rearrangement measured as a decrease in intensity of the 2.8 kb fragment (30% of signal left when compared to liver).

[0091] FIG. 6A-6G: Prot G or concavalin purified serum samples of 6 different G lines (A, B), 4 different MG lines (C) and 2 different MG lines (E-G), in the MT background run under non-reducing (A) and reducing conditions (B-G). The size of the transgenic human IgG (panels B, F) and IgM (panel C, D) is consistent with the CH1 deletion and the absence of light chains. Mouse.sub.K light chains were normal size (G). Human serum was used as a positive control. Panel D: Superose 6 size fractionation of MG serum aftermixing in a human IgM control under non-reducing conditions. Each fraction was analysed by gel electrophoresis under reducing conditions. Fractions collected from the Superose 6 column are from left (high MW) to right (low MW). The controls are human serum alone (first lane left) and mouse serum before mixing in the human IgM control serum (lane MG serum). Size markers are indicated.

[0092] FIG. 7A-7E: Panel A: Sequences of monoclonal antibody cDNAs specific for tetanus toxoid; HSP70, rtTA and human TNF. The top sequence is the germline VHH2 sequence, identified as SEQ ID NO:35. The -B. Pertusis sequences 1-5 are, in order, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, and SEQ ID NO:40. The -Tetanus sequences 1-4 are, in order, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, and SEQ ID NO:44. The A-hsp70 sequence is SEQ ID NO:45. The -rTTA sequences are, in order, top to bottom, SEQ ID NO:46, SEQ ID NO:47, and SEQ ID NO:48. The -TNF sequences are, in order, top to bottom, SEQ ID NO:49, SEQ ID NO:50, and SEQ ID NO:51. The CDR 1, 2 and 3 and hinge regions are indicated above the sequence. Different isotypes and classes are indicated by different colors on the right. The J regions that are used are indicated on the right. Panel B: Examples of western blots using the different heavy chain-only antibodies (hybridomas, sera and sdAb). Left panel anti-rtTA serum and hybridoma medium, diluted 1/100 and 1/250 respectively. Middle panel, anti DKTP serum from wt and G mice diluted 1/200 and 1/100 respectively. Right panel, anti B. Pertussis sdAb against vaccine containing B. Pertussis antigen (DKTP) or lacking it (DTP, since we were unable to purchase purified B. Pertussis antigen). Panels C and D:Immunostaining of one of Tet-on cell lines additionally transfected with a marker plasmid that responds to the presence of rtTA by expressing a marker protein in the cytop1asm.sub.51. Panel C shows nuclei expressing rtTA (green). Panel D shows doxycycline induced expression of the marker protein in the cytoplasm (red) in response to rtTA and nuclear staining of the cells with DAPI (blue). Panel E: Example of BiaCore analysis of the anti rtTA antibody. Affinity is indicated.

[0093] FIG. 8A-8B: Panel A: Schematic drawing of the Ig loci with camelid like splice mutations. The two human IgG constant regions (C2 and C3) were first mutated by altering the splice G.sub.+1 to A.sub.+1, thought to result in CH1 exon skipping in camelid IgG HCAb.sub.S5 depicted as G2-S and G3-S. The locus contained two llama VHH regions all of the human D and JH regions and human C, C and C2 and C3 and the LCR (see also main text). These loci were introduced into MT transgenic mice and analysed for the expression of the human loci. Panel B: Sequencing of bone marrow (BM) human IgG cDNA from the GS mice showed that both VHHs recombined with different human D and J segments and were transcribed with the C2 constant region. However, the CH1 exon was still present, save the last 16 bp, which were spliced out and is identified as SEQ ID NO:57. While in progress, the same cryptic splice site in the CH1 exon was reported in a leukemia patient due to an A to G transition in position 4 of intron 1 [31]. None of the MGS or GS lines rescued B cell development (not shown) in MT mice. Although the mouse B cell transcriptional/translational machinery can process rearranged dromedary VHH-2a [34, 60] our data show that in addition to the G to A mutation, other features are important for CH1 exon skipping. Sequence VDJg*1 is SEQ ID NO:52, VDJg*2 is SEQ ID NO:53, VDJg*3 is SEQ ID NO:54, VDJg*4 is SEQ ID NO:55, VDJg*5 is SEQ ID NO:56.

[0094] FIG. 9: Schematic representation of the cloning of human V.sub.H regions onto the various loci as described in Examples 3 and 4

[0095] FIGS. 10 and 11: Examples of heavy chain loci containing multiple V.sub.H gene segments, the entire D region, the entire JH region, the O2, C3 and Cx regions and the 3 LCR.

[0096] FIG. 12: Shows a karyogram with one locus integrated on chromosome 1 and one locus on chromosome 8.

EXAMPLES

Example 1a Heavy Chain-Only Antibody Locus is Fully Functional in Mice and Sensitive to Allelic Exclusion

[0097] As discussed above, Janssens et al. [15] have developed methods for the derivation of heavy chain-only antibodies in transgenic mice. For further details of the methods and experiments described herein, the skilled person should refer to Janssens et al.[15], which is incorporated herein by reference..sup.1

Methods

Constructs

[0098] A genomic cosmid library was made from peripheral blood cells of Lama glama using standard methods. Two different germline VHHs were chosen based on their sequence, an open reading frame without stop codon and the presence of hydrophilic amino acid codons at positions 42, 50 and 52 according to Lefranc numbering [32] and one with and one without a hydrophilic amino acid at position 49. One is identical to IGHV1S1 (acc.num. AF305944) and the other has 94% identity with IGHV1S3 (acc. num.AF305946). Two clones were selected from the human genomic Pac library RPCI-11 (BACPAC Recource Center, USA): clone 1065 N8 containing human heavy chain D and J regions, C and C and clone 1115 N15 containing the C 3 gene. Bac clone 11771 from a different human genomic library (Incyte Genomics, CA, USA) was used as a source of C2 gene and the Ig heavy chain LCR [33]. Using standard techniques, the C3 and C2 genes were subcloned separately into pFastBac (Invitrogen). The single point mutation (G to A) [34] or a complete deletion of CH1 exon was achieved by homologous recombination [35]. Similarly frt and lox P sites were introduced in front of the C switch region and a second lox P site was placed in front of the C2 switch region, resulting in MGS or MGA.

[0099] In order to obtain the GS or G constructs, the MGS or MG vector (FIG. 1), containing two llama VHH genes, followed by human D and J heavy chain regions, C, C and the modified human C2 and C3 genes and 3 LCR, was transformed into 16 294 Cre E. coli strain.sub.44 yielding the GS or G locus through ere mediated recombination (FIG. 1). MG was obtained from MG by deletion of the CCH1 region through homologous recombination.

Generation of Transgenic Mice, Breeding and Genotyping

[0100] The 220 Kb MGS or MG or MG fragments, 150 Kb GS or G fragments (FIG. 1) were purified from vector sequences and injected into pronuclei of fertilized FVB X B16/MT/eggs at a concentration of 2 ng/l. Transgenic loci were checked for integrity and number of copies by Southern blot analysis of tail DNA using 5 and 3end probes. Transgenic MT+/founders were bred as lines in the MT/background. Genotyping was done by PCR (30 cycles with denaturation at 94 C. for 45 s, annealing at 60 C. for 30s and extension at 72 C. for lmin 40 s) using the following primers: Asp5IgM fw: 5-GCGGGTACCGAATGGTGGCAGGGATGGCTC-3 (SEQ ID NO: 1) in combination with Asp 3IgG2 rv: 5-CGCGGTACCCTGCGGTGTGGGACAGAGCTG-3(SEQ ID NO:2) for HLL-MD or with Asp3IgM rv: 5-CGCGGTACCACGGCCACGGCCACGCTGCTCGATTC-3(SEQ ID NO:3) for MGS and MIGMEMBINTRON1: fw: 5-CCAGTCAATACTACTCGCTAAGATTC-3(SEQ ID NO:4) in combination with MIGMEMBEXON1 rv: 5-CAGTGGTCCACAGTTTCTCAAAGC-3 (SEQ ID NO:5) for the MT genotype.

RT-PCR

[0101] Total RNA was isolated using Ultraspec RNA isolation system (Biotecx Laboratories, Houston). cDNA was synthesized using reverse transcriptase (Superscript II, Life technology) and an oligo (dT) primer. PGR was performed using following primers: LVHHfw: 5-AGACTCTCCTGTGCAGCCTCTGG-3(SEQ ID NO:6) in combination with HINGEIgG2rv: 5CACTCGACACAACATTTGCGCTC-3(SEQ ID NO:7) or hIgMCH2rv: CACTTTGGGAGGCAGCTCAGC-3 (SEQ ID NO: 8) Amplification was for 30 cycles with denaturation at 94 C. for 30s, annealing at 60 C. for 30s and extension at 72 C. for 1 min. PGR products were cloned into pGEM T easy vector (Promega) and sequenced using T7 or SP6 primers.

Flow Cytometric Analyses:

[0102] Single cell suspensions were prepared from lymphoid organs in PBS, as described previously.sub.45. Approximately 110.sup.6 cells were incubated with antibodies in PBS/0.5% bovine serum albumin (BSA) in 96 well plates for 30 min at 4 C. Cells were washed twice in PBS/0.5% BSA. For each sample, 310.sup.4 events were scored using a FACScan analyzer (Becton Dickinson, Sunnyvale, Calif.). FACS data were analyzed using CellQuest version 1.0 computer software. Four-color analysis was done on a Becton Dickinson FACS Calibur. Most antibodies used have been described [36]; FITC conjugated anti-human IgG and anti human IgM were purchased from Sigma (Zwijndrecht, NL).

Ig Gene Rearrangement Analysis

[0103] Single cell suspensions were made from spleens and livers of wt mice MG and G transgenic mice. B cells were positively selected using MACS CD45 (B220) MicroBeads (Miltenyi Biotec, Germany) on an Automacs separator according to the manufacturer's instructions to 90% purity [37]. Genomic DNA was Hind III digested and blotted onto Hybond nylon filters. The filter was hybridized with a .sub.32P radiolabeled JK probe (obtained by PGR amplification from genomic DNA over J.sub.KI and J.sub.KS regions) and .sup.32P radiolabeled carbonic anhydrase II (CAII) probe. Liver DNA was run to show the signals of the K germline configuration (2.8 Kb band). The CAII probe, which hybridizes to a 4 kb band was used as a loading control. Filters were scanned on a Tyfoon 9200 (Amerscham Biosciences). The intensity of germ line JK band was quantified using Image Quant 5.2 software, normalized to that of the loading control, and expressed as a percentage of the control liver DNA (which is 100%). PGR primers used on genomic DNA from hybridomas for amplification of different rearrangement events were as follows:

TABLE-US-00002 IGIIJ1R: (SEQIDNO:9) 5-CCAGTGCTGGAAGTATTCAGC-3, IGHJ2R: (SEQIDNO:10) 5-CAGAGATCGAAGTACCAGTAG-3, IGHJ3R: (SEQIDNO:11) 5-GGCCCCAGAYATCAAAAGCAT-3, IGHJ4R: (SEQIDNO:12) 5-GGCCCCAGTAGTCAAAGTAGT-3, IGHJ5R: (SEQIDNO:13) 5-CCCAGGRGTCGAACCAGTTGT-3, IGHJ6R: (SEQIDNO:14) 5-CCAGAACGTCCATRYMGTAGTA-3,

DNA FISH Analysis

[0104] Preparation of target DNA: Monoclonal hybridoma cells were cultured in DMEM/10% FCS and embedded in agarose as described by Heiskanen [38]. Lungs from a mouse of the G transgenic line 1 were collected and a single cell suspension was made. The embedded cells were treated with proteinase K and Rnase H. Mechanically extended DNA was prepared on poly-L-lysine slides (Sigma) using a microwave oven and the edge of another slide.

[0105] Probes: To detect rearranged and non-rearranged copies of the G transgene, DNA fragments were purified. A 2.3 kB SpeI and a 3.6 kB SpeI-BssHII fragment for hybridizing the region between VHH and D, and a 5.9 kB BamHI-SpeI fragment or the low copy Bluescript plasmid containing the IgH 3LCR (16 kB) for LCR detection. The probes were labeled by nick-translation with biotin-11-dUTP (Roche) or digoxigenin-11-dUTP (Roche). Prior to pipetting the probes on the slides, they are denatured by for 5 minutes at 90 C., 5 minutes on ice, and 45 minutes at 37 C. In situ hybridization: The hybridization mixture contained 50% formamide, 2SSC, salmon sperm DNA (200 ng/l), 5Denhardt's, 1 mM EDTA, and 50 mM sodium phosphate, pH 7.0. Hybridization of the probes is done by pipetting 25p1 mixture onto the slides, and covering with a 2432-mm cover slip. To denature the probes and target sequences the slides were put on an 80 C. heating plate for 2 minutes. The probes hybridize overnight at 37 C. in a humidified chamber (humidifier is 50% formamide, 2SSC). Post hybridization washes were performed as described [39].

[0106] Immunological detection of the hapten-labeled probes: The digoxigenin probe was detected with sheep-anti-digoxigenin (1:500, Sigma), fluorescein-conjugated rabbit-antisheep (1:500, Sigma), and fluorescein-conjugated goat-anti-rabbit (1:500, Sigma). The biotin probe was detected with Texas Red-conjugated avidin (1:500, Sigma) and biotinconjugated goat-anti-avidin (1:500, Boehringer). This step was repeated twice. All incubations and washes were performed as described.sub.48. After staining the slides were dehydrated in a graded series of ethanol (70, 90, and 100%) 5 minutes each step at room temperature. Cells or DNA was embedded in 25 l anti-fading embedding medium Vectashield (Vector Laboratories). Visualization was done with a Leica DMRBE fluorescent microscope using a 100 objective.

Immunization and Hybridoma Production

[0107] 8 weeks old mice were immunized with 5-20 g of antigen with Specol adjuvant (IDDLO, Lelystadt, NL) or with preformulated DKTP vaccine s.c. on days 0, 14, 28, 42 and i.p. on day 50. Blood was taken on day 0, 14 and 45. Spleen cells were fused with Sp2-0-Ag14 myeloma cells line (gift from R. Haperen) on day 56 using a ClonalCellTMHY kit (StemCell Technologies, Canada) according to the manufacturer's instructions. DKTP vaccine was obtained from the Netherlands Vaccine Institute (Bilthoven, NL).

sdAB Library Construction and Screening

[0108] Total RNA was isolated from spleens of DKTP immunized single copy G and TNF a immunized MG mice using an Ultraspec RNA isolation system (Biotecx Laboratories Inc, Houston, Tex., USA). cDNA was made using oligo (dT) primer. DNA fragments encoding VHHDJ fragments were amplified by PGR using specific primers: vhl back Sfi I primer [40-42] in combination with hIgG2hingrev primer (5-A ATCTGGGCAGCGGCCGCCTCG ACACAACATTTGCGCTC-3 (SEQ ID NO: 15)) or CH2huIgMrev primer (5-TGGGACGAAGACGGCCGCTTTGGGAGGCAGCTCGGCAAT-3 (SEQ ID NO: 16)). The amplified VHHDJs (400 bp) were Sfi I/Not I digested, gel purified and cloned into Sfi I/NotI digested phagemid pHEN derived vector. Transformation into TG1 electro-competent cells (Stratagene La Jolla, USA) yielded in a human single domain antibody library. Two rounds of selection were performed using panning on DKTP vaccine antigens adsorbed onto plastic (immunotubes coated with undiluted vaccine) or purified human TNF (Biosource International, USA).

Immunocytochemistry and Western Blots

[0109] Cells of the tet-on cell line transfected with a marker plasmid that responds to the presence of rtTA were grown on a slide. After a 24 hrs doxycycline induction, the cells were fixed in 4% paraformaldehyde/PBS and permeabilized in 0.5% Triton-X-100/PBS. The HCAb against rtTA was used in a 1:50 dilution, followed by goat anti human-IgG FITC staining (Sigma 1:500 dilution). The marker protein was detected as described previously.sub.51. Western blots were standard using goat anti human IgG-HRP (Sigma, 1/2500 dilution), human IgM-HRP (Sigma, 1/2500 dilution).

Superose 6 Gel Filtration.

[0110] Size fractionation of MG mouse serum and human control serum was carried out using an AKTA FPLC apparatus (Amersham Biosciences, Piscataway N.J.) with a Superose 6 10/30 column equilibrated in 200 mM KCl/20 mM HEPES-KOH pH 7.9/1 mM MgCl.sub.2/0.5 mM EGTA/20% glycerol. Using a flow of 100 l/min, fractions of 500 l were collected, precipitated with 100% trichloroacetic acid and analyzed by SDS-PAGE (under reducing conditions) followed by Western immunoblotting.

BIAcore Measurements.

[0111] Experiments were carried out on a BIAcore 3000 surface plasmon resonance biosensor (Biacore AB, Uppsala, Sweden). Purified proteins were immobilized on a CMS sensor chip to a level of 3000 resonance units (RU, arbitrary binding response units) with the standard NHS-EDC kit supplied by the manufacturer. Antibodies were passed over the immobilized antigens at a constant flow rate of 40 micrograms per ml in 10 mM Hepes, pH 7.4, 150 mM NaCl, 2 mM EDTA, 0.005% Tween 20. The response at equilibrium was recorded and curve fitting was used to obtain the equilibrium dissociation constants, using the manufacturer's BIA evaluation software.

Results

The Camelid Like CH1 Splice Mutation is Insufficient for Exon Skipping in the Human Heavy Chain Locus.

[0112] It is not known whether the generation of HCAb (IgG2 and IgG3) in camelids involves an IgM.sub.+ intermediate step. We therefore first generated two hybrid human loci, one locus (MGS) with a human C, C, C2 and C3 constant regions and one with only human C2 and C3 (FIG. 1) in a MT background [43], The Cy regions were first mutagenised to contain the camelid CH1 splice mutations. MGS was generated because it has been shown that MT animals, which almost completely lack B cells due to a transmembrane domain deletion of the chain gene [43], do have a small B cell population, producing functional IgG, IgA and IgE in the absence of membrane IgM [44-46], suggesting that (some) B cells develop without IgM surface expression. Instead of mutating human VH domains for improved VH solubility [47,48] two YHHs of llama origin were introduced. Camelid VHH regions contain a number of characteristic amino acids at positions 42, 49, 50 and 52 [49], The first, VHH1, contained all of these VHH hallmark amino acids, but to test the importance of solubility in this proof of principle experiment, the other, VHH2, lacked one of these critical solubility amino acids, a Gln (Q) instead of a Glu (E) at position 49. We chose 49 rather than position 50 (Arg, R), as it is thought to be additionally important for variable light chain (VL) pairing.sub.21. The locus also contained all of the 5 human heavy chain D and J regions and the Locus control region (LCR) at the 3end of the locus (FIG. 8). Surprisingly, the splice mutation did not lead to correct CHI exon skipping in transgenic mice and lack of human Ig expression (FIG. 8).

Analysis of Transgenic Mice Containing Human Loci Lacking a CH1 Region

[0113] To overcome the CHI splicing problem, we generated 3 new constructs (FIG. 1), all containing C2 and C3 from which CHI was deleted, one with C and C (MGA), one without C and C (G) and one with a C segment from which CHI was deleted (MG). Three MGA, six G and four MG transgenic mouse lines with different copy numbers (1-5 copies) were obtained in a MT background. B cell development was analysed in bone marrow (BM) and spleen. Mice with different copy numbers gave the same results.

Expression of G and M G Rescues B Cell Development in MT Mice

[0114] MG mice were unable to rescue B cell development in a MT background, whereas the G and MG constructs efficiently rescued B cell development. The rescue of B220/CD19 positive cells was between 30-100% in the different lymphoid compartments independent of copy number (FIG. 2A). This is confirmed by flow cytometry of BM using B220 versus human IgM or human IgG staining (FIG. 2B). The MG mice contain human IgM producing cells in the BM absent in wildtype or MT mice. Appropriately these cells have not undergone a class switch as they do not contain human IgG. The G mice contain only human IgG expressing B cells. The MG mice contain very few if any B cells that express human Ig on the cell surface, but interestingly a proportion of the B220 cells express intracellular IgM, but not IgG (FIG. 2B). In contrast to the MG and G mice (see below), the MG mice express mouse Ig light chains (FIG. 6G). These results show that the C and Cy genes in the different constructs are expressed and strongly suggest that the absence of CH1 is crucial for cell surface expression of VHH based antibodies.

Human HCAb IgG and IgM Functionally Replace Murine (Pre-)BCR During B Cell Development in the BM

[0115] During the developmental progression of large cycling into small resting pre-B cell the expression of specific cell surface markers is downregulated in a pre-BCR-dependent fashion [36], To investigate the capacity of human HCAb to functionally replace the pre-BCR, the expression of various markers was analysed by FACS. Pro-B cells express high levels of cytoplasmic SLC, IL-7R and CD43, which are downregulated upon pre-BCR expression and absent in mature B cells (FIG. 2C, compare pro-B cells from MT mice and the surface IgM-pro-B/pre-B cell fraction and the surface IgM+ B cell fraction of wt mice).

[0116] The human Ig+ B cells from MG/MT or G/MT mice have low levels of SLC and IL-7R, indicating that the human single chain IgG and IgM receptors functionally replace the murine pre-BCR in the downregulation of SLC and IL-7R. For CD43 this appears to be the case only in G mice, but the persistence of CD43 expression in MG mice could be related to the finding of increased B-1 B cell differentiation in these mice. Likewise, CD2 and MHC class II expression is induced, as in normal pre-BCR signalling. The levels of the IL-2R/CD25, transiently induced at the pre-B cell stage, are very low on mature MG or G/MT B cells and comparable to those of mature wt B cells (FIG. 2C). Furthermore, is I.sub.gk expression was not detectable in mature MG or G/MT B cells (FIG. 2C) and was also not induced in in vitro BM cultures upon IL-7 withdrawal after 5 days of IL-7.sub.+ culture (not shown). Finally, the human HCAb expressing B cell populations in MG or G transgenic mice consisted partially of cells that were generated in the BM (HSA.sub.high and AA4. 1/CD93.sub.high), and partially of cells that have matured in the periphery and are recirculating (HSA.sub.low and CD93.sub.low), comparable to findings in normal mice.

[0117] Collectively, these results show that human HCAb IgG and IgM functionally replace murine (pre-)BCR during B cell development with respect to the expression of developmentally regulated markers. Ig L chain is not induced (see below). cDNA analysis of BM RNA shows usage of both VHH segments for VDJ recombination, absence of CH1, and importantly a large diversity in the CDR3 region (FIG. 2D).

Multiple Rearrangements and Allelic Exclusion

[0118] A number of hybridomas were made from the MG and G lines after immunisation, in particular of the five copy G linel (see below). Sequence analysis showed that more than one rearrangement could take place in the multicopy G loci. Of the 5 different 5 copy hybridomas analysed, one (G20) rearranged one copy which was in frame; two hybridomas (T7 and T12) had 2 rearrangements each with one out of frame in both; one hybridoma (T3) had two in frame rearrangements (J2 and J4); while one hybridoma (T1) had 4 rearrangements with 2 in frame (J2 and J4).

[0119] T1 and T3 express two productive mRNA's, that were confirmed by mass spectrometry of the secreted antibodies exactly matching the cDNA (not shown). We also carried out DNA stretched fiber FISH and normal DNA FISH on two different hybridomas: G20 (1 rearrangement) and T1 (4 rearrangements), using an LCR probe detecting each copy, and a probe located between VHH and D segment detecting only non-rearranged copies (FIG. 3 A-E). Control lung cells showed five complete copies plus half a transgene at either end (FIG. 3A) in agreement with Southern blot mapping (not shown), while the hybridomas indeed show one and four rearranged copies in G20 and T1 respectively (FIG. 3B, C-E). Thus multiple copies can successfully rearrange on the same allele. We next asked whether the HCAb loci have any (dis)advantage over the normal murine loci and whether there is allelic exclusion of loci. B220/CD 19 positive BM cells of G linel transgenic mice in a wt background were analyzed for the expression of human IgG and mouse IgM. Clearly the G B cells express either mouse Ig or human Ig (FIG. 3F), showing allelic exclusion.

Splenic B Cells in G , M G and MG Transgenic Mice

[0120] To determine the effect of the transgenes on B cell differentiation in MT mice, we examined spleen B cell subpopulation sizes by flow cytometry, using the CD21/CD23 profiles (FIG. 4A). In G mice, the proportions of CD21.sub.lowCD23.sub.low immature B cells were in normal ranges, and human single chain IgG expressing cells were able to differentiate both into follicular (FO; CD21.sub.+CD23.sub.+) and into marginal zone (MZ; CD2l.sub.highCD23.sub.low) B cells. In the MG mice the immature B cell fractions were increased, indicating that differentiation of HCAb IgM expressing cells into FO and MZ 8 B cells is somewhat impaired. In these spleens, reduced expression of CD23 was accompanied by increased surface expression levels of CD43 and CD5, indicative of differentiation into the B-1 B cell lineage. The few human IgM expressing B cells (also expressing mouse light chains see FIG. 6) present in MG transgenic mice manifested a FO/MZ distribution that was similar to the one in MG transgenic mice. MG and G, but not MG mice, have a normal spleen architecture showing segregation of T cell clustering in the peri-arteriolar lymphocyte sheet (PALS) surrounded by B cell-rich areas containing follicles and marginal zones present at outer boundaries of the white pulp (FIG. 4B).

[0121] They also form germinal centers in B cell follicles of secondary lymphoid tissues (not shown) comparable to wt during T cell-dependent antibody responses. These are the sites of memory formation and affinity based selection due to somatic hypermutation. In the G mice human IgG positive cells are detected in these germinal centers. We confirmed hypermutation of the human IgG genes by cDNA analysis from B cells present in Payer's patches. (FIG. 4C). Both VHH1 and VHH2 are used. Taken together, these findings demonstrate that in G and MG transgenic mice immature B cells that migrate from the BM have the capacity to differentiate in the spleen into both FO and MZ B cells, and to undergo somatic hypermutation after antigenic challenge.

Single Copy Loci Rescue Efficiently and CH1 Absence is Essential

[0122] The G linel mice (FIG. 2A) contained 5 copies of the G locus and hence there was a possibility that the efficient rescue was related to the copy number of the locus. However a single copy transgenic line obtained from the 5 copy G linel by Flp recombination through breeding with a FlpeR line.sub.23, rescued B cell development to a similar extent (FIG. 4D, FIG. 2A). It was confirmed that a single copy of the locus is sufficient for rescue and that the presence of the C. constant region with a CH1 region is inhibitory, by deleting the Cu, and C regions from the non-rescuing single copy line MG (line 3) by Cre recombination (breeding to a ere expressing line) resulting in a single copy G line (FIG. 4D). The previously non-rescuing locus now gives the same B cell development 9 as the other G lines. Thus copy number does not affect rescue and presence of CH1 in the Cu region inhibits B cell rescue (see also below).

Mouse Ig Light Chain Loci do not Rearrange in MG and G Transgenic Mice

[0123] Murine Ig light chain proteins were not detected in the MG and G mice by Western blots of serum (not shown, but see FIGS. 2C and 6A) or by FACS, suggesting that the murine light chain genes do not rearrange. This was confirmed by comparing the densities of the Ig locus germline signals in DNA from sorted splenic B220+ cell fractions and liver cells by Southern blot analysis (FIGS. 5A and B), which shows that the mouse light chains do not rearrange and remain in a germline configuration. In contrast light chains are detected in the few human Ig expressing cells in the MG/MT mice (See FIG. 6G).

[0124] Thus the expression of human HCAb in early B cell development in the BM fails to provide the signal leading to light chain rearrangement. In this context, the HCAb mimic a BCR rather than a pre-BCR, which is likely related to their failure to bind pseudo-light chains in the absence of CHI [61].

Serum Analysis of G /MT and M G /MT Mice.

[0125] Human IgM was present in MG serum and human IgG in both MG and G mouse serum. In non-immunized adult animals, the human IgM (<50 g/ml) and IgG (200-1000 g/ml) is present at levels comparable to those seen in normal mice or transgenic mice carrying a normal human IgH locus [65]. Gel electrophoresis of the serum of all six G mice revealed HCAb IgG's with a MW of 70 kD under non-reducing and 35 kD under reducing conditions, consistent with heavy chain dimers lacking a light chain and each heavy chain lacking the CH1 exon (FIG. 6A,B).

[0126] The serum of MG mice contained multimeric heavy chain-only human IgM. Under reducing conditions (FIG. 6C) all four lines contained IgM chains with the MW as a human control IgM after subtraction of the MW of CH1. The serum was also fractionated (FIG. 6D horizontal fractions) under non-reducing conditions after which each fraction 10 was analysed by gel electrophoresis under reducing conditions (FIG. 6D, vertical lanes). When compared to the human serum pentameric 900 kD IgM control the transgenic IgM fractionates at 600 kD consistent with it also being multimeric and lacking light chains and CH1. Thus MG mice produce HCAb multimeric IgM and dimeric IgG, while G produce dimeric IgG in the serum.

[0127] Serum Analysis of MG Mice

[0128] In the periphery and spleen of MG/MT lines, almost no B220 positive cells (<1% of the wild type) and only occasional small B cell clusters are seen in spleen (FIG. 4B). Small quantities of human IgM and IgGs were detected in the serum only after purification (FIG. 6E,F). The human IgM in these mice was normal size under reducing conditions, whereas the circulating human IgGs are shorter (apparent MW of 35 kD, consistent with a CH1 deletion). Interestingly mouse K light chains, presumably associated with the human IgM, were also detected (FIG. 6G).

[0129] Human IgM and IgGs were below the detection level in a quantitative ELISA assay, but we nevertheless tested whether the MG/MT mice can respond to immunization. Mice were immunized with human Tumor Necrosis Factor- (TNF-) and wt mice developed a strong TNF- specific antibody response, while in the two MG line 3 mice used, antigen specific human IgGs could not be detected by ELISA or Western blot analysis (not shown).

Immunisation of MG and G Mice Results in Antigen Specific Ab Production

[0130] The G/MT mice were immunized with E.Coli hsp70, DKTP {Diphteria toxoid, whole cell lysate of Bordetella Pertussis, Tetanus toxoid and inactivated polio virus types 1, 2 and 3) and rtTA [50], while the MG mice were immunized with human TNF. From mice with positive sera by ELISA, individual complete antibodies were isolated using hybridomas or single domain Ab (sdAb) by phage display libraries.

[0131] The hsp70-, tetanus toxoid- and rtTA-specific monoclonals were sequenced after RTPCR of the antibody RNAs (FIG. 7A). This showed that both IgG2 (7 out of 8) and IgG3 (1 out of 8) antibodies were produced (the sdAb were isolated from a IgG2 library). Different D and J regions were used. Although not at high frequency, the VHH from the 11 HCAbs were hypermutated. The three hTNF-specific antibodies (one positive IgM hybridoma, FIG. 6 -hTNF #1 and two sdAb -hTNF #2 & 3) all had different hypermutations in the CDR2 region. When comparing the sequences of all 14 antibodies it was evident that although all J regions are used, like in humans JH4 is used most frequently. Surprisingly all antibodies contained llama VHH2 (with a glutamine (Q) rather than the archetypical glutamic acid at position 49 [51]). Lastly clearly the CDR3 region provides most of the diversity.sub.27. It varies between 10 and 20 aminoacids in length (average of 13.6 aa), very similar to that normally seen in llamas and humans [52, 53]. We next tested whether these HCAb are functional in regular assays as hybridoma supernatants and bacterial periplasmic fractions of sdAbs (FIG. 7). All of the antibodies were positive in ELISA's and all were positive in antigen detection on Western blots (e.g. -DKTP and -rtTA serum and hybridoma medium and -B. Pertussis sdAb, FIG. 7B). We also tested the -rtTA IgG in immunocytochemistry using a cell line transfected with a rtTA expression plasmid (FIG. 7C, D). The rtTA HC-IgG gave a very clear and specific nuclear staining. The affinity of a number of the antibodies was high, although some (particularly sdAb) were much lower. For example the -rtTA antibody used in the immunocytochemistry (FIG. 7C, D) was approximately 3 nM as determined on a BiaCore (FIG. 7E).

Conclusions

[0132] Here we reported the expression of modified HCAb loci that rescue B cell development in MT mice resulting in functional HCAb production. These mice can be immunized to produce antigen specific HCAb. As in camelids, removal of CH1 is crucial for HCAb-secretion, but the single camelid (review.sub.30) splice mutation at the 3.sup.1CH1/intron border is not sufficient for CH1 elimination, thus more than this single point mutation is required, at least in the human locus. IgM with CH1 in combination with a VHH blocks B cell development, probably caused by an ineffective assembly of an IgM surface molecule in the context of the pre-BCR. In contrast mice expressing a HCD-like human protein develop normal CD43-pre-B cells in a SCID background independent of 5 [54]. The truncated C proteins are expressed on the B cell surface without associated L chains and are thought to mimic pre-BCR signaling through self-aggregation [55].

[0133] Normally BiP chaperones the folding and assembly of antibody molecules by binding to hydrophobic surfaces of the Ig chains that subsequently participate in inter-chain contacts.sub.31. The presence of hydrophilic amino acids in FR2 of VHHs, most probably prevents BiP binding to VHH, which needs no (surrogate) light chain to become soluble. At the same time, CH1 provides the interaction with BiP proposed to hold heavy chains in the ER until assembly (replacement of BiP by a light chain) is complete. At the level of pre-B cell receptor, our results suggest that transgenic heavy chain pairing with the Vpre protein, as part of a surrogate light chain (SLC) in the noncovalent association with 5 protein, would not be able to take place when the heavy chain containing a CH1 domain is linked to a VHH. Thus the human IgM in MGS and MG transgenic mice would in this regard resemble an incomplete pre-BCR-like complex known to be insufficient to signal proliferative expansion and developmental progression [56, 57]. This may explain why only 30% of the B220 positive cells in BM have intracellular IgM (FIG. 2B). The presence of the few matured B cells in spleen of these mice may be explained by the recently described novel receptor complex that contains a heavy chain but lacks any SLC or conventional light chains [58],

[0134] When CH1 is absent from C2 and 3 and IgM is removed from the locus there is rescue of B cell development, showing that IgG can functionally replace IgM. An IgG1 receptor, expressed from the pro B cell stage onwards, is able to substitute for IgM in supporting the development of mature CD21+ B cells in Rag2/ mice [59]. Recently it was also shown that a pre-rearranged camelid IgG2a could partially rescue B cell development in one out two transgenic mice in a MT (and a C/) backgrounds. In our case IgM or IgG lacking CH1 rescue B cell development in 10 out of 10 independent transgenic mouse lines. In addition, we do not observe light chain rearrangement and conclude that light chain expression is not required for further B cell differentiation. The difference in the results obtained here and those of Zou et al. [60] may be explained by the level of expression of the heavy chain locus (and thus signaling) due to the inclusion of the LCR on our constructs. Our results confirm that truncated heavy chain protein lacking CH1 [61] or VH and CH1 [62], cannot associate with SLCs and fail to activate K gene rearrangement.

[0135] The 5 copy G linel (and other multicopy lines), rescues B cell development to the same extent as the single copy line integrated at the same position in the genome. Interestingly, one or more rearrangements occur in multicopy transgenic loci (FIG. 3). Two of the hybridomas, originating from two single splenocytes gave two productive HCAb transcripts and proteins. This result confirms that expression of two antibodies in the same B cell is not toxic [63], However the prediction.sub.37 that double antibody producing B cells would loose in competition with single antibody producing cells under antigen challenge is not borne out by our result of finding 2 double antibody expressing cells out of 5 hybridomas obtained after antigen challenge.

[0136] The (multicopy) locus is subject to allelic exclusion in wildtype mice, because BM cells express either mouse or human Ig on the cell surface. There is no significant population of cells expressing both on the cell surface (FIG. 3F, top panels). Perhaps most interesting is the number of mouse versus human Ig expressing cells. In a wt/5 copy G mouse there are three possible alleles available for rearrangement, two mouse alleles with one Ig locus and one allele with five human HCAb loci. If chosen stochastically, a human allele would be chosen only 1 out of 3 times.

[0137] If the numbers of loci are counted, the human locus would rearrange first in 5 out of 7 cells. However, endogenous mouse and transgenic human HCAb is expressed almost equally (44/38, FIG. 3F bottom panels). Although these numbers ignore possible deviations from the random use of V regions and a possible position effect on the transgenic locus, they strongly suggest that the first choice is a stochastic choice of allele followed by the possible rearrangement of multiple genes per allele.

[0138] This agrees with the fact that we frequently observe multiple rearrangements of the G locus. Normally, a productive rearrangement downregulates recombination to prevent rearrangement of the other allele. However, the multiple copies on the transgenic allele are present on the same open locus and apparently can be recombined before RAG downregulation. This could be because multiple rearrangements take place at the same time or, if it involves a spatial component (compartment), that there would be sufficient time to rearrange another gene in the locus as it would be close before the RAGs are downregulated.

[0139] Only when a rearrangement is not productive in wt mice (no signaling and the RAGs stay on) would there be sufficient time for a second locus to be activated, replace the first locus and be rearranged. In favor of this argument would be the observation that other species with multiple loci on the same chromosome have more cells expressing two Abs [64],

[0140] Importantly these experiments show that HCAb loci can be expressed successfully in the mouse. Antigen challenge results in the production of high affinity antigen specific human HCAb of different class dependent on the composition of the loci. These antibodies are expressed at levels comparable to those in normal mice or other normal human IgH transgenic mice [65], Only two variable regions were used in our experiments yet high affinity antibodies with diverse specificity were successfully isolated to almost all of the totally unrelated proteins we tested, demonstrating the efficiency and efficacy of the diversity generated by CDR3 [66]. Thus having V(D)J recombination and in vivo selection provides a critical advantage over the generation of human single chain antibody fragments from phagemid libraries using phage display.sub.39. Hybridomas can be generated easily, which importantly allows the direct cloning and expression of the complete human HCAb or sdAb fragment without the need of phage display and further screening.

[0141] Thus these mice open up completely new possibilities for the production of human HCAbs for clinical or other purposes, particularly in light of the evidence.sub.4 that HCAbs may recognize epitopes that are barely antigenic for conventional antibodies, such as active sites of enzymes. The restricted number of variable regions may explain why not all of the antigens were recognized; the polio and Diphteria proteins gave no response in G mice, whereas wt control mice did. Surprisingly all of the antibodies had the llamaVHH2 region. This does not include a conserved aminoacid [67] at position 49 in contrast to VHH1 that does have one and should be more soluble.

[0142] Nevertheless we expect that the addition of more variable regions in the locus would lead to an even broader repertoire. Whilst it is preferable to avoid multiple copies of the locus on a single allele, it would be advantageous to generate mice containing multiple alleles each comprising a single copy of different VH regions to increase diversity. In such new loci one can use either normally occurring (human) VH regions or VH regions engineered for increased solubility.sub.18 and light chain pairing.

[0143] In conclusion, we have demonstrated that antigen specific high affinity HCAb of potentially any class can be produced in mice. This technology will allow the production of fully human HCAb of any class or fragments thereof in response to antigen challenge for use as therapeutic or diagnostic agents in man. By using different vertebrate loci our technology also allows for the production of high affinity matured antibodies from any vertebrate for use as reagents, diagnostics or for the treatment of animals.

Example 2

[0144] Janssens et al. (2006) have shown that a transgenic V.sub.H locus recombines properly to produce transgenically coded heavy chain only antibodies and that such a locus is sensitive to allelic exclusion in the presence of the endogenous (mouse) heavy chain immunoglobulin locus. In order to show that the number of V.sub.H transgenic loci, that is used for heavy chain only antibody production, can be increased by using the process of allelic exclusion, two transgenic mice containing different heavy chain only loci were crossed resulting in offspring containing both loci. One mouse contained the MG locus (IgM and IgG locus, Janssens et al., 2006), while the other contained the G locus (IgG locus only, Janssens et al., 2006), both mice have the MT background. Hybridomas were derived from the B cells from the double transgenic offspring and grown in culture by standard methods. A number of the resulting individual monoclonal cell lines were analysed by PGR and Southern blots, which showed that lines containing a productively rearranged MG locus contained a non-rearranged G or a non-productively rearranged G locus. Conversely cell lines containing a productively rearranged G locus contained a non-rearranged or a non-productively rearranged MG locus. Thus the sum of the available V.sub.H regions is used in the recombination process.

Examples 3 and 4

[0145] In a preferred embodiment of the first aspect of the invention all of the number of functional human VH regions is increased by cloning human V.sub.H regions (or variants thereof) onto a multiple modified human locus containing the entire D.sub.H region, the entire J.sub.H region and a combination of the C, C2, C3 and Coo regions and the 3LCR using those methods described in the previous example and known in the art (Janssens et al 2006). This procedure can be carried out using multiple identical V.sub.H regions on separate loci or different V.sub.H region on separate loci. The different loci can contain identical heavy chain regions or different heavy chain regions. The example 3 is for a locus with identical V.sub.H regions on loci that have a different combination of heavy chain regions, example 4 for two loci with identical heavy chain constant regions but different V.sub.H regions. Obviously in both examples additional loci could be added.

Example 3

[0146] Human V.sub.H regions are isolated by PCR amplification of the human genomic DNA using primers that are specific for each selected V.sub.H out of the possible 39 functional human V.sub.H regions (alternatively human V.sub.L regions or TCR V regions or variants of all of these derived by mutagenesis could be used or added). The human V.sub.H regions are cloned in sets onto the locus described in the above example (FIG. 9), i.e. comprising the human D.sub.H plus J.sub.H (or other D and J regions) and C, C2, C3 each lacking a CH1 plus 3 LCR. The Ca region lacking CH1 plus switch regions will be cloned separately in the G locus (FIG. 10). This G locus is a variant of the original locus in that it does not contain lox sites and the llama VHH regions were removed by standard homologous recombination leaving a unique PI-Pspl site (FIG. 10).

[0147] The functional V.sub.H regions may be cloned together, with any multiple on each locus. Initially, 17 functional human V.sub.H regions will be cloned together in one set starting with 2 cloned genes per set. To each of these initial constructs, a second set will be added by conventional methodology (e.g. using Xhol-SalI restriction digestion/ligation, ligation of Xhol and SalI compatible sites destroys both). Sets containing 4, 4, 4, 3 and 2 will be linked into one set of 17 genes in a BAG vector. Obviously this procedure could be carried out by combining sets containing other numbers of genes. The above process may be terminated at any point to achieve the desired number of V.sub.H regions or extended to achieve a higher number of V.sub.H regions.

[0148] The entire set (e.g. 17 genes) is cloned into the modified G locus in the unique PI-Pspl site. The Ca region will be cloned into the I-CeuI site of this locus resulting in a AAGA locus capable of producing Iga and IgG (FIG. 10). Alternatively other heavy chain regions could be cloned in.

[0149] These final loci are then introduced into separate transgenic mice (preferably with a defective mouse IgH locus such as MT) as described in the example above. These separate loci are used to generate separate mouse lines, one that would make only IgG and one that would make IgA and/or IgG. These mice are subsequently crossed to bring the total of V.sub.H regions available to 34 on two different loci. Crossing these mice to homozygozity for both loci would make 68 V.sub.H regions available for recombination. Having multiple copies of an integrated locus would increase this number yet further. The analysis of hybridomas made from the B cells from these mice would be used to show that when a productively rearranged locus is present, the other loci that were bred in, are either non-rearranged or non-productively rearranged due to allelic exclusion by standard procedures.

Example 4

[0150] Different sets of 1 or more V.sub.H regions similarly isolated to the regions described above (or variants thereof derived by mutagenesis) are cloned onto two separate loci by the same methodology as described above. This would result in two different G loci (or variants thereof such as adding Ca). These loci would be introduced into separate mice resulting in separate transgenic lines (for example 2 loci having 10VH domains each, FIG. 11). These mice would subsequently be crossed to obtain double transgenic mice that would have all of the VH regions used available for the recombination process. Crossing these mice to homozygosity for both loci would double the number of VH regions available for recombination (FIG. 12 karyogram with one locus integrated on chromosome 1 and one locus on chromosome 8). Having multiple copies of an integrated locus would increase this number yet further. The analysis of hybridomas made from the B cells from these mice would be used to show that when a productively rearranged locus is present, the other loci that were bred in, are either non-rearranged or non-productively rearranged due to allelic exclusion.

[0151] The above process may be terminated at any point to achieve the desired number of V.sub.H regions. The D, JH and constant regions will be added to these VH regions. These final loci can then be introduced into separate transgenic mice (preferably with a defective mouse IgH locus) as described in the example above. Alternatively the position of the lox sites allows the elimination of individual constant regions to generate separate loci that contain or C (IgM) alone, or C2 and C3 (IgG2 and IgG3) alone, or Ca alone (IgA) or combinations thereof. These separate loci are used to generate separate mouse lines that would make either human IgM alone, or IgG alone or IgA alone or combinations thereof.

REFERENCES

[0152] [1] Kabat, E., Wu, T. T., Perry, H. M., Gottesman, K. S., and Foefier, C. (1991) United States Public Health Services Publication No. 91-3242, National Institutes of Health, Bethesda, Md. [0153] [2] Jaton et al., (1968) Biochemistry, 7, 4185-4195 [0154] [3] Xu and Davies, (2000) Immunity, 13, 37-45 [0155] [4] Jakobovits A. The long-awaited magic bullets: therapeutic human monoclonal antibodies from transgenic mice. Expert Opin Investig Drugs. 1998 April; 7(4):607-14. Links [0156] [5] Davis C G, Jia X C, Feng X, Haak-Frendscho M. Production of human antibodies from transgenic mice.Methods Mol Biol. 2004; 248:191-200. [0157] [6] Kellermann S A, Green L L. Antibody discovery: the use of transgenic mice to generate human monoclonal antibodies for therapeutics. Curr Opin Biotechnol. 2002 December; 13(6):593-7. Links [0158] [7] E P1690935 [0159] [8] U S2005287630 [0160] [9] WO9634096 [0161] [10] WO9402602 [0162] [11] Hendershot et al., (1987) J. Cell Biol., 104, 761-767; [0163] [12] Brandt et al., (1984) Mol. Cell. Biol., 4, 1270-1277 [0164] [13] Hamers-Casterman et al., (1993) Nature, 363, 446-448 [0165] [14] Stanfield et al., (2004) Science, 305, 1770-1773 [0166] [15] Rick Janssens, Sylvia Dekker, Rudi W. Hendriks, George Panayotou, Alexandra van Remoortere, John Kong-a San, Frank Grosveld and Dubravka Drabek, Generation of heavy chain only antibodies in mice, Proc. Natl Acad USA 2006, 10; 103(41): 15130-5. Epub 2006 Oct. 2. [0167] [16] de Genst et al., Dev Comp Immunol. 2006; 30:187-98 [0168] [17] Davies, J and Riechmann L. Biotechnology (1995) vol 13, 475-479 Antibody VH domains as small recognition units [0169] [18] Ward et al., (1989) Nature, 341, 544-546 [0170] [19] Davies and Riechmann, (1996) Protein Eng., 9 (6), 531-537; [0171] [20] Lutz and Muyldermans, (1999) J. Immuno. Methods, 231, 25-38 [0172] [21] Tanha et al., (2001) J. Biol. Chem., 276, 24774-24780 [0173] [22] Yau et al., (2005) J. Immunol. Methods, 297, 213-224 [0174] [23] Van Dijk and van der Winkel, Curr. Opin. Chem. Biol., (2001) Aug. 5 (4), 368-374 [0175] [24] Leher et al., (1999) Exp. Eye. Res., 69, 75-84 [0176] [25] Sitia et al., (1990) Cell, 60, 781-790 [0177] [26] Jespers L, Schon O, Fatnm K, Winter G. (2004) Aggregation-resistant domain antibodies selected on phage by heat denaturation. Nat Biotechnol. 22(9): 1161-5. [0178] [27] Ravn P, Danielczyk A, Jensen K B, Kristensen P, Christensen P A, Larsen M, Karsten U, Goletz S. (2004) Multivalent scFv display of phagemid repertoires for the selection of carbohydrate-specific antibodies and its application to the Thomsen-Friedenreich antigen. J Mol Biol. 343(4):985-96. [0179] [28] Jespers L, Schon O, James L C, Veprintsev D, Winter G. (2004) Crystal structure of HEM, a soluble, refoldable human V(H) single domain with a germ-line scaffold. J. Mol. Biol. 337(4): 893-903. [0180] [29] Dolk E, van Vliet C, Perez J M, Vriend G, Darbon H, Ferrat G, Cambillau C, Frenken L G, Verrips T. (2005) Induced refolding of a temperature denatured llama heavy-chain antibody fragment by its antigen. Proteins. 59(3):555-64. [0181] [30] Dolk E, van der Vaart M, Lutje Hulsik D, Vriend G, de Haard H, Spinelli S, Cambillau C, Frenken L, Verrips T. (2005) Isolation of llama antibody fragments for prevention of dandruff by phage display in shampoo. Appl Environ Microbiol. 71(0:442-50. [0182] [31] Zhao, Y., Pan-Hammarstrom, Q., Zhao, Z., Wen, S. & Hammarstrom, L. Selective IgG2 deficiency due to a point mutation causing abnormal splicing of the Cgamma2 gene. Int Immunol 17, 95-101 (2005). [0183] [32] Lefranc, M., Giudicelli, V., Ginestoux, C., Bodmer, J., Muller, W., Bontrop, R., Lemaitre, M., Malik, A., Barbie, V. and D. Chaume. 1999. IMGT, the international ImMunoGeneTics database Nucleic Acids. Res. 127: 209-212. [0184] [33] Mills F, Harindranath N, Mitchell M &Max E. Enhancer complexes located downstream of human C alpha genes. J Exp. Med. 186, 845-58 (1997) [0185] [34] Nguyen, V. K., Hamers, R., Wyns, L. & Muyldermans, S. Loss of splice consensus signal is responsible for the removal of the entire C(H)1 domain of the functional camel IGG2A heavy-chain antibodies. Mol Immunol 36, 515-24 (1999). [0186] [35] Imam A, Patrinos G, de krom M, Bottardi S, Janssens R, Katsantoni E, Wai A, Sherratt D & Grosveld F. Modification of human P-globin locus PAC clones by homologous recombination in E. Coli. Nucleic Acids Res. 15, E65 2001) [0187] [36] Middendorp, S., Dingjan, G. M. & Hendriks, R. W. Impaired precursor B cell differentiation in Bruton's tyrosine kinase-deficient mice. J Immunol 168, 2695-703 (2002). [0188] [37] Melamed D and Nemazee D. Self-antigen does not accelerate immature B cell apoptosis, but stimulates receptor editing as a consequence of developmental arrest. Proc. Natl. Acad. Sci., 94, 9267-9272 (1997). [0189] [38] Heiskanen M, Hellsten E, Kallioniemi O P, Makela T P, Alitalo K, Peltonen L, Palotie A. Visual mapping by fiber-FISH. Genomics 30, 31-36 (1995). [0190] [39] Corput, M and Grosveld, F. Fluorescence in situ hybridization analysis of transcript dynamics in cells Methods 25, 111-118 (2001). [0191] [40] Van der Linden R, de Geus B, Stok W, Bos W, van Wassenaar D, Verrips T, Frenken L. Induction of immune response and molecular cloning of heavy chain repertoire of Lama glama. J immunol Methods. 240, 185-195 (2000). [0192] [41] Hoogenboom H. R, Griffiths A. D, Johnson K. S, Chiswell D. J, Hudson P, and Winter G. Multi-subunit proteins on the surface of filamentous phage: methodologies for displaying antibody (Fab) heavy and light chains. Nucleic Acids Research 19, 41334137 (1991). [0193] [42] Dekker S, Toussaint W, Panayotou G, de Wit T, Visser P, Grosveld F, Drabek D. Intracellularly expressed single-domain antibody against pi5 matrix protein prevents the production of porcine retroviruses. J Virol., 77, 12132-9 (2003) [0194] [43] Kitamura D, Roes J, Kuhn R & Rajewsky K. A B cell-deficient mouse by targeted disruption of the membrane exon of the antibody mu chain gene. Nature 350, 423-6 (1991). [0195] [44] Macpherson, A. J. et al. IgA production without mu or delta chain expression in developing B cells. Nat Immunol 2, 625-31 (2001). [0196] [45] Orinska, Z. et al. Novel B cell population producing functional IgG in the absence of membrane IgM expression. Eur J Immunol 32, 3472-80 (2002). [0197] [46] Hasan, M., Polic, B., Bralic, M., Jonjic, S. & Rajewsky, K. Incomplete block of B cell development and antibody production in mice carrying the mM T mutation on the BALB/c background. Eur J Immunol 32, 3463-71 (2002). [0198] [47] Davies, J and Riechmann, L. Single antibody domains as small recognition units: design and in vitro antigen selection of camelized, human VH domains with improved protein stability. Protein Eng. 9, 531-7 (1996). [0199] [48] Riechmann, L. & Muyldermans, S. Single domain antibodies: comparison of camel VH and camelised human VH domains. J Immunol Methods 231, 25-38 (1999). [0200] [49] De Genst E, Silence K, Ghahroudi M, Decanniere K, Loris R, Kinne J, Wyns L & Muyldermans S. Strong in vivo maturation compensates for structurally restricted H3 loops in antibody repertoires. J Biol Chem. 280, 14114-21 (2005) [0201] [50] Urlinger S, Baron U, Thelhnann M, Hasan M T, Bujard H & Hillen W. Exploring the sequence space for tetracycline-dependent transcriptional activators: novel mutations yield expanded range and sensitivity. Proc Natl Acad Sci USA. 97, 7963-8 (2000). [0202] [51] De Genst E, Silence K, Ghahroudi M, Decanniere K, Loris R, Kinne J, Wyns L & Muyldermans S. Strong in vivo maturation compensates for structurally restricted H3 loops in antibody repertoires. J Biol Chem. 280, 14114-21 (2005) [0203] [52] Vu, K. B., Ghahroudi, M. A., Wyns, L. & Muyldermans, S. Comparison of llama VH sequences from conventional and heavy chain antibodies. Mol Immunol 34, 1121-31 (1997). [0204] [53] Zemlin, M. et al. Expressed murine and human CDR-H3 intervals of equal length exhibit distinct repertoires that differ in their amino acid composition and predicted range of structures. J Mol Biol 334, 733-49 (2003). [0205] [54] Corcos D, Iglesias A, Dunda O, Bucchini D, Jami J. Allelic exclusion in transgenic mice expressing a heavy chain disease-like human mu protein. Eur J Immunol. 21, 2711-6(1991) [0206] [55] Corcos D, Dunda O, Butor C, Cesbron J Y, Lores P, Bucchini D, Jami J.Pre-B-cell development in the absence of lambda 5 in transgenic mice expressing a heavychain disease protein. CurrBiol. 5:1140-8 (1995). [0207] [56] Seidl, T., Rolink, A. & Melchers., F. The VpreB protein of the surrogate lightchain can pair with some mu heavy-chains in the absence of the lambda 5 protein. Eur J Immunol 31, 1999-2006 (2001). [0208] [57] Mundt, C., Licence, S., Shimizu, T., Melchers, F. & Martensson, I. L. Loss of precursor B cell expansion but not allelic exclusion in VpreB 1NpreB2 doubledeficient mice. J Exp Med 193, 435-45 (2001). [0209] [58] Su, Y. W. et al. Identification of a pre-BCR lacking surrogate light chain. J Exp Med 198, 1699-706 (2003). [0210] [59] Pogue, S. L. & Goodnow, C. C. Gene dose-dependent maturation and receptor editing of B cells expressing antibody (Ig)G1 or IgM/IgG1 tail antigen receptors. J Exp Med 191, 1031-44(2000). [0211] [60] Zou, X. et al. Expression of a dromedary heavy chain-only antibody and B cell development in the mouse. J Immunol 175, 3769-79 (2005). [0212] [61] Iglesias, A., Kopf, M., Williams, G. S., Buhler, B. & Kohler, G. Molecular requirements for the mu-induced light chain gene rearrangement in pre-B cells. Embo J 10, 2147-55 (1991). [0213] [62] Shaffer, A. L. & Schlissel, M. S. A truncated heavy chain protein relieves the requirement for surrogate light chains in early B cell development. J Immunol 159, 1265-75 (1997). [0214] [63] Sonoda, E. et al. B cell development under the condition of allelic inclusion. Immunity 6, 225-33 (1997). [0215] [64] Eason D D, Litman R T, Luer C A, Kerr W, Litman G W. Expression of individual antibody genes occurs in an unusual system consisting of multiple independent loci. Eur J Immunol. 34:2551-8 (2004). [0216] [65] Wagner S D, Gross G, Cook G P, Davies S L, Neuberger M S. Antibody expression from the core region of the human IgH locus reconstructed in transgenic mice using bacteriophage P I clones. Genomics. 35, 405-14 (1996). [0217] [66] Xu J L, Davis M M. Diversity in the CDR3 region of V(H) is sufficient for most antibody specificities. Immunity 13, 37-45 (2000) [0218] [67] De Genst E, Saerens D, Muyldermans S, Conrath K. Antibody repertoire development in camelids. Dev Comp Immunol. 30, 187-98 (2006).