Micro-fluidic chip and its modification method and application in detection of the quantity of food bacteria

10752963 ยท 2020-08-25

Assignee

Inventors

Cpc classification

International classification

Abstract

A micro-fluidic chip and its modification method and application in detection of food bacteria quality, includes the following steps: changing a functional group CH.sub.3 on the internal surface of micro-fluidic channel of micro-fluidic chip to a functional group OH through modification; Supplying amino silane reagent to the micro-fluidic channel; supplying dendritic polymer as modified by COOH to internal surface of the micro-fluidic channel after drying; grafting primer of aminated aptamer RCA on terminus 5 and hybrid from its padlock probe on dendrimer on internal surface of the micro-fluidic channel; wherein, the padlock probe is the complementary sequence of the aptamer of the target pathogenic bacteria to be tested; after that, supplying RCA reaction reagent to the micro-fluidic channel to make aptamer RCA generate long-chain aptamer in series. The present invention adopts two RCA reactions of varied functions in combination, and uses dendritic polymer to modify internal surface of the chip.

Claims

1. A method of modifying a micro-fluidic channel of a micro-fluidic chip, the method comprising the following steps: (1) modifying a CH.sub.3 functional group on an internal surface of the micro-fluidic channel to a OH functional group; (2) performing an amino silane reaction by supplying an amino silane reagent to the micro-fluidic channel after the modifying of step (1) is completed; (3) drying the micro-fluidic channel after performing step (2); (4) supplying a COOH modified dendritic polymer to the micro-fluidic channel for coupled reaction after drying the micro-fluidic channel; (5) after completing step (4), grafting to the COOH modified dendritic polymer: a primer for producing an aptamer RCA animated on the 5 terminus of the aptamer RCA, and a hybrid of a padlock probe comprising a sequence that is complementary to the aptamer RCA; (6) supplying a RCA reaction reagent to the micro-fluidic channel after the grafting of step (5); (7) performing an RCA reaction in the micro-fluidic channel to make an aptamer RCA comprising a long-chain of aptamers in series, wherein the aptamers target a pathogenic bacteria to be tested; (8) terminating the RCA reaction through heating once the RCA reaction is completed; and (9) cleaning the micro-fluidic channel by supplying phosphate buffer to the micro-fluidic channel.

2. The method of claim 1, wherein the COOH modified dendritic polymer comprises a polyethylenediamine dendritic polymer.

3. The method of claim 1, wherein the RCA reaction agent is supplied in a volume of 100 l, wherein the volume comprises 10 U phi29 DNA polymerase, 10 l phi29 DNA polymerase buffer and 10 mM dNTPs; wherein step (5) comprises the following steps: (a) heating 2 M of the primer and 2 M of the padlock probe at a temperature of 95 C. for 5 minutes and cooling down to room temperature, wherein the heating is performed in a 50 l reaction system; (b) placing the reaction system in a 37 C. water bath for 30 minutes; (c) after the 30 minutes, adding 10 U of T4 DNA ligase and 5 l of 10 T4 DNA ligase buffer to the reaction system; (d) performing a ligation reaction at room temperature for 30 minutes; (e) heating the reaction system to a temperature of 65 C. and maintaining that temperature for 10 minutes; and (f) obtaining the primer and a hybrid of the padlock probe by terminating the ligation reaction; and wherein step (7) comprises the following steps: (a) performing the RCA reaction for 10 hours at a temperature of 37 C.; and (b) maintaining for 10 minutes the whole RCA reaction at a temperature of 65 C. before terminating reaction.

4. The method of claim 1, wherein the primer comprises the sequence of SEQ ID NO: 1.

5. The method of claim 4, wherein the padlock probe comprises the sequence of SEQ ID NO: 2.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is the diagram for working principles of the present invention.

(2) FIG. 2 is the diagram showing modification process on the internal surface of bacteria detection micro-fluidic chip and production of series aptamers by aptamer RCA according to the present invention.

(3) FIG. 3 is the schematic diagram for RCA signal amplification according to the present invention.

(4) FIG. 4 is the comparison diagram for double-layer RCA used to micro-fluidic chip and existing micro-fluidic chip used for detection of fluorescent signal strength of E. coli O157:H7 according to the present invention.

PREFERRED EMBODIMENTS OF THE INVENTION

Embodiment 1

(5) Part 1: Modification to Internal Surface of Micro-Fluidic Chip

(6) Firstly, a polyethylenediamine dendritic polymer (Generation 7) subjected to superficial carboxylation was grafted on an internal surface of micro-fluidic channel through plasma treatment. The micro-fluidic channel was made of polydimethylsiloxane (PDMS), subjecting to amination by using (3-aminopropyl)-trimethoxysilane (APTMS). This process refers to condensation reaction of carboxyl (FIG. 2, Step 1-3, grafting of dendritic polymer). Existing method as used to this process is not to be described herein in details.

(7) After that, a primer (primer 1) of animated aptamer RCA on terminal 5 and hybrid product from primer 1's padlock probe (padlock probe 1) were grafted on dendritic polymer on the internal surface of the micro-fluidic chip, and a RCA reagent was supplied; aptamer RCA reaction was started to produce series long-chain aptamers, and RCA reaction was terminated through heating once upon completion of reaction. Phosphate buffer was used to clean the channel inside the modified micro-fluidic chip for further use (FIG. 2, Step 4-5, in-situ production of series aptamer product).

(8) The reaction conditions for aforesaid aptamer RCA are as follows:

(9) (1) Taking 50 l reaction system as an example, heating primer (2 M) of aptamer RCA and padlock probe (2 M) under the temperature of 95 C. for 5 minutes before cooling down to the room temperature; placing it into 37 C. water bath, and waiting for 30 min before adding 10 U T4 DNA ligase and 5 l 10T4 DNA ligase buffer for reaction under the room temperature for 30 min; after that, heating it to the temperature of 65 C., and maintaining the temperature for 10 min before terminating the reaction. This process primer and padlock probe formed a cyclic template through hybridization.

(10) (2) Once aforesaid linked product is grafted on the internal surface of the micro-fluidic channel, supplying RCA reagent. Taking the 100 l reaction system for instance, RCA reagent comprises 10 U phi29 DNA polymerase, 10 l phi29 DNA polymerase buffer and 4 l dNTPs (10 mM). Following reaction under the temperature of 37 C. for 10 hours, maintaining the whole reaction system for 10 min under the temperature of 65 C. before terminating the reaction.

(11) Part 2: Target Identification and Amplification of Detection Signal

(12) Once the internal surface of the micro-fluidic chip as modified by target pathogens is identified and captured, supplying RCA reagent to the micro-fluid to initiate RCA reaction so as to generate further amplified signals of long-chain RCA product. Once reaction is completed, proceed with heating to the temperature of 65 C., and maintain it for 10 min before terminating RCA reaction.

(13) Reaction conditions for signal amplified RCA are as follows:

(14) (1) Taking 50 l as an instance, the heat primer compound (200 nM) of aptamer Signal amplified RCA and padlock probe (200 nM) were heated under the temperature of 95 C. for 5 minutes before cooling down to the room temperature; it was placed into 37 C. water bath, and waited for 30 min before adding 10 U T4 DNA ligase and 5 l 10T4 DNA ligase buffer for reaction under the room temperature for 30 min; after that, it was heated to the temperature of 65 C., and the temperature was maintained for 10 min before terminating the reaction. This process primer and padlock probe formed a cyclic template through hybridization.
(2) Once the aforesaid link product was delivered into the micro-fluidic chip, and identified and fixed to the surface of target pathogens to be tested, RCA reagent was supplied. Taking a 100 l reaction system for instance, RCA reagent comprises 10 U phi29 DNA polymerase, 10 l phi29 DNA polymerase buffer and 4 l dNTPs (0 mM). Let the whole reaction system subject to reaction under the temperature of 37 C. for 2 hours before termination (65 C., 10 min).

(15) Finally, to identify detection signal, the fluorescent probe subjecting to specific identification with RCA product was inserted into the micro-fluid channel for hybrid with signal amplified RCA product; meanwhile, phosphate buffer was sued to rinse surplus fluorescent probe not bound inside the channel.

(16) Part 3: Collection and Processing of Fluorescent Signal

(17) The reaction area of the micro-fluidic chip was observed under the fluorescent microscope, and photos were taken; photo processing software was used to convert the fluorescent photos into quantitative fluorescent signals. The detection signals were compared with standard curve to realize quantitative detection of foodborne pathogens.

(18) Aforesaid aptamer RCA, primer of signal amplified RCA and corresponding padlock probe are listed in Table 1.

(19) TABLE-US-00001 TABLE1 TheCaseofDouble-LayerRCAUsedforDetectionofE.coli O157:H7byMicro-fluidicChip Designation Sequence(5-3) Aptamer Primer 5-NH.sub.2-TTTTTTTTTTGAAGGACTTAGTTACTGTCG RCA AGCGAT-3 Padlockprobe 5-AACTAAGTCCTTCATACGGGAGCCAACACC ATCTTGTACAAATCGTCTTGATATCTGCACATTTG ATAGAGCAGGTGTGACGGATATCGCTCGACAGT-3 Signal Aptamer-primer 5-NH.sub.2-ATCCGTCACACCTGCTCTATCAAATGTGCA amplified compound GATATCAAGACGATTTGTACAAGATGGTGTTGGCT RCA CCCGTATTTTTTTTTGTCCGTGCTAGAAGGAAACA GTTAC-3 Padlockprobe 5-TAGCACGGACATATATGATGGACCGCAGTA TGAGTATCTCCTATCACTACTAAGTGGAAGAAATG TAACTGTTTCCTTC-3 Fluorescentprobe 5-Cy3-TTTTAGTATGAGTATCTC-3

(20) Detection principles in this embodiment are as shown in FIG. 1 from the bottom to the top: The first step was the modification to the internal surface of micro-fluidic chip; grafting dendritic polymer (its major functions include provision of a mass of DNA sequence binding sites and reduction of background signals) on the internal surface of the micro-fluidic chip; after that, linking it with the primer of aptamer RCA and cyclic template on the basis of dendritic polymer so as to produce long-chain series aptamers through RCA reaction to improve efficiency in identification and capture of targets. Once target cells are identified and captured, aptamer of signal amplified RCA-primer compound and cyclic template were delivered, identified and adsorbed to the surface of target cells. A mass of fluorescent probe binding sites were produced through RCA reaction to facilitate integration of fluorescent probes through hybridization for the purpose of signal amplification.