IMPROVED DROPLET SEQUENCING APPARATUS AND METHOD

Abstract

An apparatus for sequencing a polynucleotide analyte is provided and comprises; •a first zone in which a stream of single nucleotides is generated by progressive digestion of a molecule of the analyte attached to a particle located therein and exposed to a flowing aqueous medium; •a second zone in which a corresponding stream of aqueous droplets is generated from the aqueous medium and the nucleotide stream and wherein at least some of the droplets contain a single nucleotide and •a third zone in which each droplet is stored and/or interrogated to reveal a property characteristic of the single nucleotide it may contain; characterised in that the first zone comprises a microfluidic channel through which the aqueous medium flows and the location comprises a hollow seating in a wall thereof to which suction can be applied and into which the particle can be close-fitted.

Claims

1. An apparatus for sequencing a polynucleotide analyte, said apparatus comprising: a first zone in which a stream of single nucleotides is generated by progressive digestion of a molecule of the polynucleotide analyte attached to a particle located therein and exposed to a flowing aqueous medium; a second zone in which a corresponding stream of aqueous droplets is generated from the aqueous medium and the nucleotide stream and wherein at least some of the droplets contain a single nucleotide; and a third zone in which each droplet is stored and/or interrogated to reveal a property characteristic of the single nucleotide it may contain; characterised in that the first zone comprises a microfluidic channel through which the aqueous medium flows, and a location comprising a hollow seating in a wall thereof to which suction can be applied and into which the particle can be close-fitted.

2. The apparatus as claimed in claim 1, characterised in that the hollow seating is located immediately upstream of the second zone.

3. The apparatus as claimed in claim 1, characterised in that the particle comprises a bead having a surface to which the analyte molecule can be physically or chemically bound.

4. The apparatus as claimed in claim 1, characterised in that the digestion method is selected from exonucleolysis, phosphorolysis or pyrophosphorolysis.

5. The apparatus as claimed in claim 1, characterised in that the third zone includes a laser and a photodetector to detect Raman-scattered light.

6. The apparatus as claimed in claim 1, characterised by being capable of processing an aqueous medium which in at least one of the second or third zones contains at least one single-nucleotide probe selective for one of the nucleobase types from which the analyte is constituted; said probe(s) being capable of fluorescing substantially only after it has captured a single nucleotide and undergone subsequent exonucleolysis.

7. The apparatus as claimed in claim 6, characterised by further comprising a means to introduce the probe(s) into the aqueous medium before, as or after each droplet is created.

8. The apparatus as claimed in claim 1, characterised in that the third zone includes a printer nozzle adapted to print each droplet onto a surface comprised of an array of droplet-receiving locations.

9. The apparatus as claimed in claim 1, characterised in that the third zone includes an interrogation means for detecting fluorescence radiation emitted from each droplet.

10. A method of sequencing a polynucleotide analyte including the steps of: (a) generating a stream of single nucleotide triphosphates by progressive pyrophosphorolysis of an analyte molecule attached to a particle exposed to a flowing aqueous medium; (b) generating a stream of droplets from the aqueous medium and the stream of the single nucleotides, wherein at least some of the droplets contain a single nucleotide, and (c) storing and/or interrogating each droplet and detecting a property characteristic of the single nucleotide it may contain; characterised in that step (a) further includes the sub-step of immobilising the particle in a close-fitting hollow seating in a microfluidic channel to which suction can be applied.

11. The method as claimed in claim 10, characterised in that the aqueous medium contains at a given point at least one single-nucleotide probe selective for capturing one of the nucleotide triphosphate types from which the polynucleotide analyte is constituted; said probe(s) being capable of fluorescing substantially only after they have captured a single nucleotide and undergone subsequent exonucleolysis.

12. The method as claimed in claim 11, characterised in that the probe(s) comprises (a) a first single-stranded oligonucleotide labelled with characteristic fluorophores in an undetectable state, and (b) second and third single-stranded oligonucleotides capable of hybridising to complementary regions on the first oligonucleotide.

13. The method as claimed in claim 12, characterised in that the second and third oligonucleotides are oligonucleotide regions of a single oligonucleotide so that addition of a target single nucleotide creates a single-stranded closed loop resistant to exonucleolysis.

14. The method as claimed in claim 11, characterised in that the probe(s) are either contained within the original flowing aqueous medium or subsequently introduced directly into each droplet after it has been created.

15. The method as claimed in claim 10, characterised in that the particle comprises a bead having a reactive surface onto which the analyte molecule is attached.

Description

[0030] An apparatus according to the invention is now illustrated by the following FIGS. 1 and 2 which schematically illustrate a sequencing device according to the present invention in which aqueous droplets containing a single nucleotide and nucleotide-detecting oligonucleotide probe system are created and interrogated.

[0031] A ten micron diameter microfluidic tube 1 is provided with a side-channel 2 to which vacuum suction can be applied. 2 intersects 1 at a junction comprising a frustoconical orifice 3 of circular cross-section with an internal diameter of two microns. A spherical glass bead 4 of diameter four microns is previously introduced into 1 and seated in 3 so that a significant part of its outer surface protrudes into a stream of aqueous medium 5 when the latter is caused to flow through 1 from a point of introduction upstream of 3. Attached to 4 by streptavidin conjugation is an analyte comprising 1000 nucleobase double-stranded fragment of DNA. 5 comprises a buffered (pH 7.5) reaction medium at 37° C., comprising Bst Large Fragment DNA Polymerase and a 2 millimoles per litre concentration of each of sodium pyrophosphate and magnesium chloride. The temperature of the bead is maintained at 37° C. and under these conditions the polymerase progressively digests the analyte in the 3′ to 5′ direction thereby releasing a stream of single nucleotides (deoxyribonucleotide triphosphates) which are then carried downstream of 4 by the flow of the medium. The order of single nucleotides in the downstream part of 5 thus corresponds to their original sequence in the analyte. Downstream part of 5 emerges from a droplet head 6 into a first chamber 7 where it is contacted with one or more streams of light silicone oil 8. The velocities of these streams at the point of contact are chosen to avoid turbulent mixing and to create substantially aqueous spherical droplets 9 suspended in the oil each having a diameter of approximately eight microns. A stream of 9 is then carried forward along a second microfluidic tube of the same diameter at a rate of 1000 droplets per second to a second chamber 10 into which a second stream of five micron aqueous spherical droplets 11 is also fed using a second droplet head 12. Droplets 11 comprise a nucleotide-detecting oligonucleotide probe system such as that outlined below and are caused to coalesce in a sequential fashion with 9 to form enlarged aqueous droplets 13 approximately nine microns in diameter. The stream of droplets 13 so created is then delivered to a printer assembly 14 provided with a droplet printer head 14a where each droplet is in turn printed onto a glass slide 15 moveable along both axes of the plane which defines its face and patterned with a two-dimensional array of wells 16 for containing the individual droplets.

[0032] The droplets are then incubated on the glass slide before being interrogated by a detection system comprising one or more lasers 17 and detectors 18 tuned to the appropriate wavelengths for the excitation and detection of fluorescence from the fluorescent dyes used in the probe system. The detection of fluorescence at a given wavelength above a determined threshold then indicates the presence of a single nucleotide base of a given type within the droplet. Thus as the droplets are interrogated in turn the sequence of nucleotide bases in the original polynucleotide analyte can in effect be read off.

[0033] An example of an oligonucleotide probe system that may be used in the system described above is now described in detail.

[0034] A single-stranded first oligonucleotide 1 is prepared, having the following nucleotide sequence:

TABLE-US-00001 5′TCGTGCCTCATCGAACATGACGAGGXXQXXGGTTTGTGGT3′
wherein A, C, G, and T represent nucleotides bearing the relevant characteristic nucleotide base of DNA; X represents a deoxythymidine nucleotide (T) labelled with Atto 655 dye using conventional amine attachment chemistry and Q represents a deoxythymidine nucleotide labelled with a BHQ-2 quencher. It further comprises a capture region (A nucleotide) selective for capturing deoxythymidine triphosphate nucleotides (dTTPs).

[0035] Another single-stranded oligonucleotide 2, comprising (1) a second oligonucleotide region having a sequence complementary to the 3′ end of the first oligonucleotide with a single base mismatch; (2) a third oligonucleotide region having a sequence complementary to the 5′ end of the first oligonucleotide and (3) a 76 base pair single-stranded linker region, is also prepared. It has the following nucleotide sequence:

TABLE-US-00002 5′PCATGTTCGATGAGGCACGATAGATGTACGCTTTGACATACGCTTTGA CAATACTTGAGCAGTCGGCAGATATAGGATGTTGCAAGCTCCGTGAGTCC CACAAACCAAAAACCTCG3′
wherein additionally P represents a 5′ phosphate group.

[0036] A reaction mixture comprising the probe system is then prepared having a composition corresponding to that derived from the following formulation:

[0037] 56 uL 5× buffer pH 7.5

[0038] 28 uL oligonucleotide 1, 100 nM

[0039] 28 uL oligonucleotide 2, 10 nM

[0040] 2.8 uL mixture of dNTPs (including dTTP), 10 nM

[0041] 0.4 U Phusion II Hot Start polymerase (exonuclease)

[0042] 1.6 U Bst Large Fragment polymerase

[0043] 20 U E. coli ligase

[0044] 4 U Thermostable Inorganic Pyrophosphatase

[0045] Water to 280 uL

wherein the 5× buffer comprises the following mixture:

[0046] 200 uL Trizma hydrochloride, 1M, pH 7.5

[0047] 13.75 uL aqueous MgCl.sub.2, 1M

[0048] 2.5 uL Dithiothreitol, 1M

[0049] 50 uL Triton X-100 surfactant (10%)

[0050] 20 uL Nicotinamide adenine dinucleotide, 100 uM

[0051] 166.67 uL KCl

[0052] Water to 1 mL

[0053] In the presence of a single dTTP nucleotide, said nucleotide is incorporated onto the 3′ end of one of the oligonucleotides 2 and ligation of oligonucleotide 2 to form a closed-loop used probe occurs. This process is carried out by incubating the mixture at 37° C. for 50 minutes. The reaction medium is then incubated at 70° C. for a further 50 minutes, activating the Phusion II polymerase. One of the oligonucleotides 1 can anneal to a circularised oligonucleotide 2 at this temperature and in this double-stranded form is digested by the polymerase, releasing its fluorophores into a detectable state. A further oligonucleotide 1 is then able to anneal to the circularised probe, allowing this process to repeat in a continuous cycle and resulting in a growth of fluorescence intensity over time.

[0054] Further sets of similar oligonucleotide probes are also prepared having different capture sites, sequences and fluorophores which, combined with the first probe set, allow the capture, detection and discrimination of the four nucleotide bases to be achieved.