BACULOVIRUS EXPRESSION SYSTEM

20200263144 ยท 2020-08-20

    Inventors

    Cpc classification

    International classification

    Abstract

    Method for preparing, in an insect cell, a recombinant baculovirus comprising one or more transgene(s) each encoding a protein maturation enzyme and n transgenes each encoding a polypeptide of interest, by homologous recombination between a replication deficient baculovirus genome which comprises one or more transgene(s) each encoding a protein maturation enzyme and n transfer vectors each comprising one of the n transgenes each encoding a polypeptide of interest, n being an integer at least equal to 2.

    Claims

    1-18. (canceled)

    19. Method for producing a recombinant baculovirus of which the genome comprises one or more transgene(s) each encoding a protein maturation enzyme and n transgenes each encoding a polypeptide of interest, said method comprising the steps of: a) Preparing, in an insect cell, a recombinant baculovirus genome capable of replicating which comprises one or more transgene(s), each encoding a protein maturation enzyme and n transgenes each encoding a polypeptide of interest, by homologous recombination between: a1) a replication deficient baculovirus genome in which n genes essential for viral replication are non-functional and which comprises one or more transgene(s), each encoding a protein maturation enzyme, and a2) n transfer vectors each comprising: i) a nucleotide sequence enabling to restore the function of one of the n non-functional genes essential for viral replication, ii) one of the n transgenes encoding a polypeptide of interest, the set of nucleotide sequences i) of the n transfer vectors being capable of restoring the replication of the replication deficient baculovirus genome, n being an integer at least equal to 2; and b) Generating a recombinant baculovirus in an insect cell which comprises the recombinant baculovirus genome obtained at step a).

    20. Method according to claim 19, wherein a replication deficient baculovirus genome of step a1) is prepared, in a bacterial cell, by homologous recombination between: a replication deficient baculovirus genome in which n genes essential for viral replication are non-functional, and one or more nucleotide sequence(s) each comprising one or more transgene(s) each encoding a protein maturation enzyme.

    21. Method according to claim 19, wherein the genes essential for viral replication are selected from the group consisting of: 1629 (ORF9), Pk1 (ORF10), lef-1 (ORF14), ORF34, lef-11 (ORF37), p47 (ORF40), lef8 (ORF50), DNAJ domain (ORF51), ORF53, vp1054 (ORF54), Lef-9 (ORF62), DNA Pol (ORF65), lef-3 (ORF67), ORF73, ORF75, ORF81, p95 (ORF83), vp39 (ORF89), lef-4 (ORF90), p33 (ORF92), helicase (ORF95), vp80 (ORF104), ORF106-107, odv-ec43 (ORF109), gp64/67 (ORF128), ORF132, ORF133, odv-ec27 (ORF144), ORF146, ie1 (ORF147), and lef-2 (ORF6).

    22. Method according to claim 19, wherein the n non-functional genes essential for viral replication are each adjacent to a gene not essential for viral replication.

    23. Method according to claim 22, wherein the gene not essential for viral replication is selected from the group consisting of: Ph (ORF 8), ORF11, ORF13, egt (ORF15), v-ubiquitin (ORF35), 39K (ORF36), ORF38, p43 (ORF39), lef-12 (ORF41), pcna (ORF49), ORF52, ORF55, Fp (ORF61), ORF63, gp37 (ORF64), ORF68, ORF72, ORF74, ORF82, cg30 (ORF88), ORF91, pif-4 (ORF96), he65 (ORF105), ORF108, ORF110, cathepsin (ORF127), p24 (ORF129), pp34 (ORF131), ORF134, ORF145, odv-e56 (ORF148), and ORF5.

    24. Method according to claim 19, wherein the n transgenes encoding a polypeptide each recombine at the locus of a gene not essential for viral replication adjacent to a non-functional gene essential for viral replication.

    25. Method according to claim 19, wherein the protein maturation enzyme is selected from the group consisting of: a signal peptidase, a furin, a proprotein convertase, a glycosyltransferase, a glycosidase, a chaperone protein, an isomerase disulphide, an acyltransferase, a methyltransferase, a hydroxylase, a transglutaminase, a farnesyltransferase, a geranylgeranyl-transferase, a N-myristoyltransferase, a palmityltransferase, a protein, a phosphatase, a transpeptidase, a carboxylase, and a ubiquitin ligase.

    26. Method according to claim 20, wherein the transgene(s) encoding a protein maturation enzyme each recombine at the locus of a gene not essential for viral replication, preferably at the locus of a gene not essential for viral replication non-adjacent to a non-functional gene essential for viral replication.

    27. Method according to claim 26, wherein the gene not essential for viral replication is selected from the group consisting of: ptp (ORF1), ctx (ORF3), ORF4, ORF7, odv-e26 (ORF16), ORF17, ORF18, ORF19, ARIF-1 ORF20-21, pif2 (ORF22), protein F (ORF23), iap1 (ORF27), lef6 (ORF28), ORF29, ORF30, sod (ORF31), fgf (ORF32), gta (ORF42), ORF43, ORF44, ORF45, odv-e66 (ORF46), ORF47, ORF56, ORF57, chaB-like (ORF58/59), chaB-like (ORF60), mtase (ORF69), hcf-1 (ORF70), iap2 (ORF71), ORF86, ORF87, ORF111, ORF114, pif3 (ORF115), ORF116, ORF117, pif1 (ORF119), ORF120, ORF121, ORF122, pk2 (ORF123), ORF124, lef7 (ORF125), chitinase (ORF126), gp16 (ORF130), p35 (ORF135), p26 (ORF136), p10 (ORF137), p74 (ORF138), ORF149, ORF150, ie2 (ORF151), pe38 (ORF153) and ORF154.

    28. Method according to claim 19, wherein the insect cell is selected from the group consisting of: Sf9, Sf21, Tn5-b14, lepidoptera cell lines sensitive to the baculovirus AcMNPV, lines Sf21.

    29. Method according to claim 20, wherein the bacterial cell is E. coli selected from DH10B and EL350.

    30. Method according to claim 19, wherein the replication deficient baculovirus genome is obtained from a baculovirus genome selected from or derived from the genome of one of the following baculovirus: BmNPV, AcMNPV, ApNPV, BsSNPV, CfMNPV, EoSNPV, HaNPV, HzNPV, LdMNPV, MbMNPV, OpMNPV, SIMNPV, SeMNPV and TeNPV.

    31. Method according to claim 19, wherein n is an integer ranging from 2 to 31.

    32. Recombinant baculovirus or recombinant baculovirus genome, susceptible to be obtained by the production method according to claim 19, comprising: a) One or more transgene(s) each encoding a protein maturation enzyme, and b) n nucleotide sequences of formula (I): [transgene encoding a polypeptide of interest]-[spacer nucleotide sequence]-[gene essential for functional viral replication] (I), said spacer nucleic acid sequence being constituted of 0 to 600 pb, said gene essential for functional viral replication being selected from the group consisting of: 1629 (ORF9), Pk1 (ORF10), lef-1 (ORF14), ORF34, lef-11 (ORF37), p47 (ORF40), lef8 (ORF50), DNAJ domain (ORF51), ORF53, vp1054 (ORF54), Lef-9 (ORF62), DNA Pol (ORF65), lef-3 (ORF67), ORF73, ORF75, ORF81, p95 (ORF83), vp39 (ORF89), lef-4 (ORF90), p33 (ORF92), helicase (ORF95), Vp80 (ORF104), ORF106-107, odv-ec43 (ORF109), gp64/67 (ORF128), ORF132, ORF133, odv-ec27 (ORF144), ORF146, ie1 (ORF147), and lef-2 (ORF6); and n being an integer at least equal to 2.

    33. Recombinant baculovirus or recombinant baculovirus genome according to claim 32, wherein said recombinant baculovirus or recombinant baculovirus genome do not comprise n genes not essential for viral replication chosen from the group consisting of: Ph (ORF 8), ORF11, ORF13, egt (ORF15), v-ubiquitin (ORF35), 39K (ORF36), ORF38, p43 (ORF39), lef-12 (ORF41), pcna (ORF49), ORF52, ORF55, Fp (ORF61), ORF63, gp37 (ORF64), ORF68, ORF72, ORF74, ORF82, cg30 (ORF88), ORF91, pif-4 (ORF96), he65 (ORF105), ORF108, ORF110, cathepsin (ORF127), p24 (ORF129), pp34 (ORF131), ORF134, ORF145, odv-e56 (ORF148), and ORF5.

    34. Set of homologous recombination elements comprising: a) a replication deficient baculovirus genome in which n genes essential for viral replication are non-functional and which comprises one or more transgene(s) each encoding a protein maturation enzyme; b) n transfer vectors each comprising: i) a nucleic acid sequence enabling to restore the function of one of the n non-functional genes essential for viral replication, ii) a transgene encoding a polypeptide of interest, n being an integer at least equal to 2.

    35. Cell comprising a recombinant baculovirus or a recombinant baculovirus genome according to claim 32.

    36. Use of a recombinant baculovirus or a recombinant baculovirus genome according to claim 32 for the production of n polypeptides of interest.

    37. The method according to claim 28, wherein the insect cell is Sf9.

    38. The method according to claim 30, wherein the replication deficient baculovirus genome is obtained from a baculovirus genome selected from or derived from AcMNPV.

    39. The method according to claim 31, wherein n is equal to or greater than 3.

    40. A cell comprising a set of homologous recombination elements according to claim 34.

    41. Use of a cell according to claim 35 for the production of n polypeptides of interest.

    Description

    FIGURES

    [0198] FIG. 1 is a diagram which illustrates the steps of preparation of BacMid1.

    [0199] Caption:

    [0200] ORF: open reading frame

    [0201] Polyhedrin or PH: baculovirus gene encoding polyhedrin: gene not essential for viral replication.

    [0202] ORF603: baculovirus gene encoding the protein 603, non-essential gene.

    [0203] ORF1629: baculovirus gene encoding the protein 1629: gene essential for viral replication

    [0204] pVT: plasmid transfer vector.

    [0205] Mini-F: origin of bacterial replication.

    [0206] Kan.sup.R: bacterial expression cassette expressing the kanamycin resistance gene.

    [0207] Amp.sup.R: bacterial expression cassette expressing the ampicillin resistance gene.

    [0208] Recombination fragment: fragment of DNA containing the expression cassette to integrate in the target DNA. This fragment has flanking regions on either side of the expression cassette to be able to target specifically the region that will undergo homologous recombination via Red Recombinase.

    [0209] FIG. 2 is a diagram which illustrates the step of partial deletion of the gene encoding viral DNA polymerase, the gene dna pol for the preparation of BacMid2.

    [0210] Caption:

    [0211] gp37: baculovirus gene encoding glycoprotein gp37, gene not essential for viral replication. gp37 252 aa: gene gp37 deleted from the region encoding the 252 N-terminal amino acids.

    [0212] DNAPol: baculovirus gene encoding viral DNA polymerase, gene essential for viral replication.

    [0213] DNAPol466 aa: dna pol gene deleted from the region encoding the 466 C-terminal amino acids.

    [0214] Hygro.sup.R: bacterial expression cassette expressing the hygromycin resistance gene.

    [0215] Recombination fragment: fragment of DNA containing the expression cassette to integrate in the target DNA. This fragment has flanking regions on either side of the expression cassette to be able to target specifically the region that will undergo homologous recombination via Red Recombinase.

    [0216] FIG. 3 is a diagram which illustrates the step of partial deletion of the gene encoding gp64 for the preparation of BacMid3.

    [0217] Caption:

    [0218] Chit: baculovirus gene encoding chitinase, gene not essential for viral replication.

    [0219] Cath: baculovirus gene encoding viral cathepsin, gene not essential for viral replication.

    [0220] gp64: baculovirus gene encoding viral glycoprotein gp64, gene essential for viral replication.

    [0221] gp64188 aa: gene gp64 deleted from the region encoding the 188 C-terminal amino acids.

    [0222] Zeo.sup.R: bacterial expression cassette expressing the zeocin resistance gene.

    [0223] Recombination fragment: fragment of DNA containing the expression cassette to integrate in the target DNA. This fragment has flanking regions on either side of the expression cassette to be able to target specifically the region that will undergo homologous recombination via Red Recombinase.

    [0224] FIG. 4 is a diagram which illustrates the transfer vector pVT/gp37 and its use with BacMid2 for the generation of a recombinant baculovirus genome comprising a transgene X.

    [0225] Caption:

    [0226] pVT: plasmid transfer vector.

    [0227] gp37: baculovirus gene encoding the glycoprotein gp37, gene not essential for viral replication.

    [0228] DNAPol: baculovirus gene encoding viral DNA polymerase, gene essential for viral replication.

    [0229] DNAPol.466 aa: dna pol gene deleted from the region encoding the 466 C-terminal amino acids.

    [0230] Exogenous gene: transgene of interest.

    [0231] P: viral or cellular promoter which controls the expression of the transgene.

    [0232] Hygro.sup.R: bacterial expression cassette expressing the hygromycin resistance gene.

    [0233] FIG. 5 is a diagram which illustrates the construction and the use of the transfer vector PH pVT/PH with BacMid2 and for the generation of a recombinant baculovirus genome comprising a transgene X.

    [0234] Caption:

    [0235] pVT/PH: polyhedrin transfer vector plasmid.

    [0236] PH: all or part of the baculovirus gene encoding polyhedrin, gene not essential for viral replication.

    [0237] ORF603: baculovirus gene encoding protein 603, non-essential gene.

    [0238] ORF1629: baculovirus gene encoding protein 1629, gene essential for viral replication.

    [0239] Exogenous gene: transgene of interest.

    [0240] P: viral or cellular promoter which controls the expression of the transgene.

    [0241] Kan.sup.R: bacterial expression cassette expressing the kanamycin resistance gene.

    [0242] Mini-F: origin of bacterial replication.

    [0243] FIG. 6 is a diagram which illustrates the construction and the use of the transfer vector pVT/gp37C with BacMid2 for the generation of a recombinant baculovirus genome comprising the heavy chain of an antibody.

    [0244] Caption:

    [0245] pVT: plasmid transfer vector.

    [0246] pVT/gp37-C1: plasmid transfer vector specific to the heavy chain of an immunoglobulin.

    [0247] C1: DNAc encoding the constant domain 1 of a human immunoglobulin.

    [0248] VH: DNAc encoding the variable domain of the heavy chain of an immunoglobulin.

    [0249] DNAPol: baculovirus gene encoding viral DNA polymerase, gene essential for viral replication.

    [0250] DNAPol466 aa: DNAPol gene deleted from the region encoding the 466 C-terminal amino acids.

    [0251] P: viral or cellular promoter which controls the expression of the transgene.

    [0252] Hygro.sup.R: bacterial expression cassette expressing the hygromycin resistance gene.

    [0253] PS: DNAc encoding a signal sequence (secretion of the heavy chain).

    [0254] FIG. 7 is a diagram which illustrates the construction and the use of the transfer vector pVT/PHC with BacMid2 for the generation of a recombinant baculovirus genome comprising the light chain of an antibody.

    [0255] Caption:

    [0256] ORF603: baculovirus gene encoding protein 603.

    [0257] ORF1629: baculovirus gene encoding protein 1629: gene essential for viral replication.

    [0258] Mini-F: origin of bacterial replication.

    [0259] pVT: plasmid transfer vector.

    [0260] pVT/PH-C: plasmid transfer vector specific to the light chain of an immunoglobulin.

    [0261] C: DNAc encoding the kappa constant domain of a human immunoglobulin.

    [0262] VL: DNAc encoding the variable domain of the light chain of an immunoglobulin.

    [0263] P: viral or cellular promoter which controls the expression of the transgene.

    [0264] Kan.sup.R: bacterial expression cassette expressing the kanamycin resistance gene.

    [0265] PS: DNAc encoding a signal sequence (secretion of the light chain).

    [0266] FIG. 8 is a diagram which illustrates the construction of the vector pVT/Chit-Cath and its use with BacMid3 and the generation of a recombinant baculovirus genome comprising a transgene.

    [0267] Caption:

    [0268] pVT Chit/Cath: plasmid transfer vector capable of recombining at the locus of the region comprising the 2 non-essential genes, ChiA encoding chitinase and Cath encoding cathepsin. gp64188 aa: gp64 gene, essential gene, deleted from the region encoding the 188 C-terminal amino acids.

    [0269] Exogenous gene: transgene of interest.

    [0270] P: viral or cellular promoter which controls the expression of the transgene.

    [0271] Zeo.sup.R: bacterial expression cassette expressing the zeocin resistance gene.

    [0272] FIG. 9 is A) analysis by Southern blot of the genome of 3 purified independent recombinant baculoviruses, generated during the same transfection, and B) analysis of the recombinant antibodies after purification on Protein A Sepharose (GE Healthcare).

    [0273] Caption:

    [0274] A: analysis of the organisation of the genomes of 3 independent recombinant baculoviruses expressing the antibodies 13B8II. These baculoviruses were isolated from a single transfection experiment. The hybridizations carried out respectively with a probe specific to the constant region of the kappa light chain: probe C and a probe specific to the constant region of the heavy chain gamma 1: probe C1 demonstrates a correct and identical organisation of the 3 recombinant viruses.

    [0275] B. Analysis by electrophoresis in polyacrylamide gel (SDS, 2-mercaptoethanol) and silver staining of the purified recombinant antibodies. The antibodies secreted in the culture medium of cells infected with the recombinant baculovirus were purified on a Protein A Sepharose column.

    [0276] PC1: Plasmid control, plasmid containing the gene of the kappa light chain,

    [0277] PC2: Plasmid control, plasmid containing the gene of the heavy chain 1, R1-3, recombinant baculovirus 1, 2 and 3,

    [0278] MW: size marker.

    [0279] FIG. 10 is the analysis by Southern blot of the genome of a triple recombinant virus expressing the proteins M, HA and NA of the flu virus.

    [0280] Caption:

    [0281] M: gene of the flu virus encoding the matrix protein.

    [0282] HA: gene of the flu virus encoding hemagglutinin.

    [0283] NA: gene of the flu virus encoding neuraminidase.

    [0284] bp: size of the DNA fragments expressed in pairs of bases.

    [0285] FIG. 11 is a diagram which illustrates in A the structure of the bispecific antibodies and in B the analysis by electrophoresis in polyacrylamide gel of the bispecific antibodies purified on protein A Sepharose column.

    [0286] Caption:

    [0287] A: Diagrammatical representation of the structure of the bispecific antibodies. L1: light chain of the antibodies 1; L2, light chain of the antibodies 2.

    [0288] B: Purified bispecific antibodies, analysed by electrophoresis on polyacrylamide gel. The proteins were revealed by silver staining. (1) electrophoresis under reducing conditions (SDS, 2-mercaptoethanol). (2) electrophoresis under non-reducing conditions. H: heavy chain of the antibodies, L: light chain of the antibodies, H2L4: composition of the bispecific antibodies: 2 fused heavy chains bound by 4 disulphide bridges at the level of 2 hinge regions+4 light chains (2 chains L1+2 chains L2) paired in a specific manner to the corresponding regions VH1-CH1 and VH2-CH1.

    [0289] FIG. 12 is a representation of glycan structures bound to the glycoproteins synthesised by (A) human cells and (B) lepidoptera cells.

    [0290] FIG. 13 is a representation of a human immunoglobulin (IgG). The asparagine residue 297, (Asn297) bound to an N-glycan is represented by a lozenge. The nature of this N-glycosylation, like the presence of galactose and sialic acid, may be an important element of the structure of the antibodies since it enables a modulation of certain effector activities, for example ADCC and CDC.

    [0291] FIG. 14 is a representation of the different steps necessary for the construction of a BacMid2/MPT (MPT: Post Translational Modification) that is to say a BacMid2 of which the genome comprises a transgene each encoding a glycan biosynthesis enzymeor more generally a BacMid2 of which the genome comprises one or more transgene(s) each encoding a protein maturation enzyme.

    [0292] FIG. 14 specifically exemplifies the integration of a transgene encoding GNT-II in the intergenic region orf35 (v-ubi)-orf36 (39k) (IG35/36) of BacMid2.

    [0293] Two expression cassettes were successively inserted into the region IG35/36 cloned beforehand in a plasmid pUC (i) a viral expression cassette, composed of an early viral promoter (see Table 2) and the gene encoding GNT-II and (ii) a bacterial expression cassette controlling the zeocin resistance gene (Zeo.sup.R). A recombination fragment containing the 2 cassettes was generated by digestion of the above plasmid by 2 restriction endonucleases.

    [0294] The latter was introduced into the bacterium EL350/BacMid2 by electroporation. A homologous recombination took place via Red Recombinase between the flanking regions of the recombination fragment and the DNA of BacMid2 enabling the integration of the 2 expression cassettes. The recombinant bacteria thus obtained were selected with zeocin then the gene encoding the resistance to this antibiotic was eliminated from the DNA of the bacmid by simple digestion/reparation/religation. The bacmid obtained, called BacMid2-GNTII, was re-introduced by electroporation into a bacterium EL350 (EL350/BacMid2-GNT-II).

    [0295] FIG. 15 shows BacMid2-fur and BacMid2Gal-Fur.

    [0296] A and B: Control of the genomic organisation of BacMids BacFur and BacGal-Fur. A. The DNA of the 2 bacmids was digested by EcoRI, the fragments generated were separated on agarose gel at 1% then stained with ethidium bromide. B. The DNA was transferred onto a nylon membrane according to the Southern technique. The membranes were incubated with a probe specific to the gene fur expressed by the Sf9 cell.

    [0297] Caption:

    [0298] A, Agarose gel stained with ethidium bromide, Well 1: restriction profile EcoRI of BacMid2Gal-Fur, Well 2: Restriction profile EcoRI of BacMid2-Fur. B. Southern blot, Well 1: restriction profile EcoRI of BacMid2Gal-Fur, Well 2: restriction profile EcoRI of BacMid2-Fur.

    [0299] C and D: two recombinant viruses co-expressing the polyprotein Pr55Gag and gp160 of the virus HIV-1 were constructed one from BacMid2 and the other from BacMid2-Fur. The Sf9 cells were infected for 48 hours with the different viruses and the proteins secreted in the culture supernatant were concentrated or not with a solution of Retro Concentin Virus Precipitation (SBI, reference RV100A-1) then deposited on a polyacrylamide gel at 10% under denaturing and reducing conditions then analysed by Western blot. C. The proteins were revealed with an anti-gp120 antibody (reference Ab21179, Abcam). D. The proteins were revealed with an anti-Pr55.sup.Gag antibody (reference. 63917, Abcam).

    [0300] Caption:

    [0301] BACWT: wild baculovirus, BACgp160/Gag/Fur: triple-recombinant baculovirus expressing gp160 and polyprotein Pr55.sup.Gag of HIV-1 as well as the furin of the cell Sf9 BACgp160/Gag: double-recombinant baculovirus expressing gp160 and polyprotein Pr55Gag of HIV-1, BACgp120: mono-recombinant baculovirus expressing gp120 of HIV-1, BACGag: mono-recombinant baculovirus expressing polyprotein Pr55.sup.Gag of HIV-1.

    [0302] FIG. 16 is a representation of the principle of use of BacMid2-Gal (BacGal) for the generation of double- or mono-recombinant baculovirus genomes.

    [0303] A. Generation of a double-recombinant baculovirus genome.

    [0304] The 2 transgenes of interest are cloned in their respective transfer vector, pVT/PH targeting the couple GNE/GE PH/1629 and pVT/gp37 targeting the couple GNE/GE gp37/DNAPol. The Sf9 cells are transfected with 2 pVT and DNA of BacMid2-Gal. During homologous recombination, the 2 transgenes of interest are integrated in the genome of BacMid2-Gal whereas simultaneously the non-functional genes 1629 and dnapol borne by BacMid2-Gal are replaced by a functional copy. These events will have for consequence the elimination of the origin of bacterial replication and the generation of an infectious recombinant baculovirus genome. Recombinant baculoviruses are then produced and secreted in the culture medium, then cloned by the phage plaque assay method.

    [0305] B. Generation of a mono-recombinant baculovirus genome.

    [0306] The gene of interest is cloned in the transfer vector pVT/gp37. The Sf9 cells are transfected with pVT/gp37 comprising a transgene, pVT/PH not containing transgene and DNA of BacMid2-Gal. During homologous recombination, there is repair of the bacmid in the 2 loci and thus generation of infectious baculovirus.

    [0307] Caption:

    [0308] GE: Essential gene

    [0309] GNE: Non-essential gene

    [0310] pVT/PH: Transfer vector which targets the couple GNE/GE PH/1629

    [0311] pVT/gp37: Transfer vector which targets the couple GNE/GE gp37/DNAPol

    [0312] DNA Pol.sup.NF: Gene encoding non-functional viral DNA polymerase

    [0313] DNA Pol.sup.F: Gene encoding functional viral DNA polymerase

    [0314] 1629.sup.NF: Gene encoding the non-functional protein 1629

    [0315] 1629.sup.F: Gene encoding the functional protein 1629

    [0316] 1,4 GalT: 1,4 galactosyltransferase

    [0317] GNT-II: N acetylglucosaminyltransferase II

    [0318] Kan.sup.R: kanamycin resistance gene

    [0319] mini-F: origin of bacterial replication

    [0320] PH: polyhedrin gene

    [0321] FIG. 17 is a representation of the principle of the preparation of a double-recombinant baculovirus genome expressing a galactosylated antibody. The Sf9 cells are transfected with pVT/H (see FIG. 6), pVT/L (see FIG. 7) and DNA of BacMid2-Gal. During homologous recombination, the transgenes encoding the heavy and light chains are integrated in the genome of BacMid2-Gal whereas simultaneously the non-functional genes 1629 and dnapol borne by BacMid2-Gal are replaced by a functional copy, making the baculovirus genome infectious. Recombinant baculoviruses are then produced, secreted in the culture medium then cloned by the phage plaque assay method.

    [0322] Caption:

    [0323] GE: Essential gene

    [0324] GNE: Non-essential gene

    [0325] pVT/PH: Transfer vector which targets the couple GNE/GE PH/1629

    [0326] pVT/gp37: transfer vector which targets the couple GNE/GE gp37/DNAPol

    [0327] DNA Pol.sup.NF: Gene encoding non-functional viral DNA polymerase

    [0328] DNA Pol.sup.F: Gene encoding functional viral DNA polymerase

    [0329] 1629.sup.NF: Gene encoding the non-functional protein 1629

    [0330] 1629.sup.F: Gene encoding the functional protein 1629

    [0331] 1,4 GalT: 1,4 galactosyltransferase

    [0332] GNT-II: N acetylglucosaminyltransferase II

    [0333] Kan.sup.R: kanamycin resistance gene

    [0334] mini-F: origin of bacterial replication

    [0335] PH: polyhedrin gene

    [0336] FIG. 18 represent an analysis by Western blot and lectin blot of antibodies produced by a Sf9 cell infected with a recombinant baculovirus generated from BacMid2 or BacMid2-Gal. These human antibodies (the recombinant antibodies 13B8II have a constant human domain) or mouse antibodies not having glycosylation in their paratope, the analyses thus reveal the nature of the N-glycosylation which is borne by their constant domain.

    [0337] Caption:

    [0338] A and B. Western blot. A: the membrane was incubated with a sheep anti-human IgG whole antibody peroxidase conjugated (reference NA933V, GE Healthcare). B: The membrane was incubated with a sheep anti-mouse IgG whole antibody peroxidase conjugated (reference NA931V, GE Healthcare).

    [0339] A. Well 1: Fetuin (61-68 kDa), supplied in the Dig Glycan Differentiation kit from Roche, this 2,3 and 2,6 sialylated protein constitutes the positive control for analyses with lectin blot whether for SNA, MAA or diCBMA. According to the supplier, the molar mass (*) of this protein varies between 68 and 61 kDa, Well 2: Recombinant antibodies 13B8II/BacGal, Well 3: Recombinant antibody 13B8II/BacMan,

    [0340] B. Well 1: Recombinant mouse antibody/BacGal, Well 2: Recombinant mouse antibody/BacMan,

    [0341] C. Lectin blot. The membrane was incubated in the presence of RCA.sub.120 conjugated with biotin. The presence of lectin was revealed as described in example 17.

    [0342] Well: Fetuin (61-68 kDa) Well 2: Recombinant mouse antibody/BacMan, Well 3: Recombinant mouse antibody/BacGal, Well 4: Recombinant antibody 13B8II/BacMan, Well 5: Recombinant antibody 13B8II/BacGal.

    [0343] FIG. 19 is a diagram which describes the use of BacMid2-Sia for the preparation of multi-recombinant baculovirus genomes and the construction of a second generation of new BacMidSia, BacMidSia6-II. In FIG. 19A, the transgenes 1 and 2 are cloned respectively in pVT/PH targeting the couple GNE/GE PH/1629 and in pVT/gp37 targeting the couple GNE/GE gp37/DNAPol. The genome of BacMid-Sia is equipped with all the genes necessary for 2,3 sialylation [2,3 sialyltransferase] (BacMid2-Sia3 or BacSia3) or 2,6 sialylation [2,6 sialyltransferase] (BacMid2-Sia6 or BacSia6 and BacMid2Sia6-II or BacSia6-II) or 2,3+2,6 sialylation [2,3 sialyltransferase+2,6 sialyltransferase] (BacMid2-Sia3/6 or BacSia3/6) and 2 genes necessary for the biosynthesis of the sugar nucleotide CMP-NeuAC. The Sf9 cells are transfected with 2 pVT and the DNA of one of the BacMid-Sia. During homologous recombination, the 2 transgenes are integrated in the genome of BacMid2-Sia whereas, simultaneously, the non-functional genes 1629 and dnapol borne by BacMid2-Sia are replaced by a functional copy, making the baculovirus genome infectious. Recombinant baculoviruses are then produced and secreted in the culture medium then cloned by the phage plaque assay method.

    [0344] Caption:

    [0345] GE: Essential gene

    [0346] GNE: Non-essential gene

    [0347] pVT/PH: Transfer vector which targets the couple GNE/GE PH/1629

    [0348] pVT/gp37: Transfer vector which targets the couple GNE/GE gp37/DNAPol

    [0349] DNA Pol.sup.NF: Gene encoding non-functional viral DNA polymerase

    [0350] DNA Pol.sup.F: Gene encoding functional viral DNA polymerase

    [0351] 1629.sup.NF: Gene encoding the non-functional protein 1629

    [0352] 1629.sup.F: Gene encoding the functional protein 1629

    [0353] 1,4 GalT: 1,4 galactosyltransferase

    [0354] GNT-II: N acetylglucosaminyltransferase II

    [0355] 2,3 ST: 2,3 sialyltransferase

    [0356] 2,6 ST: 2,6 sialyltransferase

    [0357] Kan.sup.R: kanamycin resistance gene

    [0358] mini-F: origin of bacterial replication

    [0359] PH: polyhedrin gene

    [0360] FIG. 19B is the analysis by Southern blot of the genome of 2 clones of BacMid2Sia6-II of which the construction is described in example 14.

    [0361] Caption:

    [0362] a: Analysis of the electrophoretic profile of digestion by EcoRI of 2 clones of BacMid2Sia6-II (1 and 2) in comparison with BacMid2-GNTII-1,4GT-CMPNeuAcS-NeuAcS (T) shows that the integration of the cassette ST6GalI in the region Pif1 generates 2 fragments EcoRI of 3122pb and 6138pb.

    [0363] b: The hybridisation carried out with a probe specific to ST6GalI makes it possible to verify the marking of the 2 fragments EcoRI of 3122pb and 6138pb and the control plasmid (PC), plasmid containing the ST6GalI gene and demonstrates a correct and identical organisation of the 2 BacMids obtained.

    [0364] MW: Smart Ladder (Eurogentec)

    [0365] FIG. 20 represents the analysis by Western blot and lectin blot of the glycosylation of the viral protein gp64 expressed by different viruses generated from different Bacmids. The glycoprotein gp64 is the major glycoprotein of the baculovirus, it is located on the surface of the baculovirus. It has been shown that this glycoprotein is capable of being galactosylated and sialylated. The cells were infected with the different recombinant viruses. The baculoviruses secreted in the culture supernatant were sedimented then taken up by a lysis buffer to be analysed by Western blot then by lectin blot.

    [0366] A. Western blot. The membrane was incubated with the antibodies anti-gp64 AcV5 (reference SC65499, Santa Cruz Biotechnology)

    [0367] B and C: Lectin blot. B. The membrane was incubated in the presence of SNA, lectin which specifically recognises 2,6 bound sialic acids (C) the lectin di-CBM40 which recognises 2,3 bound sialic acids and to a lesser extent 2,6 bound sialic acids.

    [0368] Caption:

    [0369] Fet: Fetuin

    [0370] Mq: Molecular weight markers

    [0371] ST3: Virus generated from the bacmid BacSia3

    [0372] ST6: Virus generated from the bacmid BacSia6

    [0373] ST3/6: Virus generated from the bacmid BacSia3/6

    [0374] Man: Virus generated from BacMid2

    [0375] FIG. 21 represent the analysis by Western blot and lectin blot of the recombinant protein X produced thanks to a recombinant baculovirus generated from BacSia6. This protein being soluble, the analyses below were carried out on the purified protein. After electrophoresis in polyacrylamide gel then transfer onto a membrane, the protein was incubated in the presence either of a specific antibody for analysis by Western blot (A) or a lectin specific for lectin blot, SNA (B), or MAA (C).

    [0376] Caption:

    [0377] Well 1, the protein X was produced after infection of the Sf9 cells with a recombinant baculovirus generated from BacMid2. Well 2, the protein X was produced after infection of the Sf9 cells with a recombinant baculovirus generated from BacSia6. Well 3, commercially available Protein X produced in CHO cells. The presence of lectin was revealed as described in example 17. MW: Molecular weight marker (Pre-stained marker, Biolabs reference P7706).

    [0378] FIG. 22 represent the analysis by Western blot and lectin blot of the protein VSVg produced thanks to a recombinant baculovirus generated from BacSia6. The protein VSVg being membranal, the analyses were carried out on pellets of infected Sf9 cells.

    [0379] A and B: Analysis of the protein VSVg.

    [0380] A. Western blot, after electrophoresis in polyacrylamide gel then transfer onto a membrane, the proteins were incubated in the presence of a specific antibody directed against VSVg (mouse antibodies peroxidase conjugated, reference A5977 Sigma).

    [0381] Caption:

    [0382] Well 1, Fetuin, Well 2, and 3, Sf9 cells infected with a recombinant baculovirus expressing the protein VSVg generated from BacSia6 (Well 2) or Bacmid2 (Well 3).

    [0383] B. Lectin blot. The proteins transferred onto a nitrocellulose membrane were placed in the presence of lectin SNA (Sambucus nigra agglutinin) specific to residues of 2,6 bound sialic acids. The presence of lectin was revealed as described in example 17.

    [0384] C and D. Analysis of the viral protein gp64.

    [0385] We also verified that the recombinant baculovirus expressing sialylated VSVg was also bearing a sialylated gp64. To do so, the baculoviruses secreted in the culture supernatant were sedimented then taken up by a lysis buffer to be analysed by Western blot then by lectin blot. C. Western blot, gp64 was revealed with a specific antibody (antibodies anti-gp64 AcV5, reference SC65499, Santa Cruz Biotechnology). D. Lectin blot. In the presence of lectin SNA as described in example 17.

    [0386] Caption:

    [0387] Well 1, Fetuin, Wells 2, and 3, particles of baculovirus prepared from the culture supernatants of cells infected with the recombinant baculovirus expressing protein VSVg and generated from BacMid2-Sia6 (Well 2) or a Bacmid2 (Well 3).

    EXAMPLES

    [0388] Examples 1 to 3 are relative to the construction of replication deficient baculoviruses, in which 1, 2 or 3 genes respectively are non-functional.

    [0389] Examples 4 and 5 describe the generation of recombinant baculoviruses having integrated 2 or 3 transgenes, respectively.

    [0390] Examples 6 to 8 are relative to the use of these recombinant baculoviruses having integrated 2 or 3 transgenes for the production of proteins of interest.

    [0391] Examples 9 to 15 describe the construction of recombinant baculoviruses comprising transgenes encoding for protein maturation enzymes.

    [0392] Examples 16 to 19 demonstrate that proteins of interest produced thanks to the baculoviruses of examples 9 to 15 have satisfactory maturation and/or glycosylation.

    Example 1: Construction of a Replication Deficient Baculovirus Genome in which 1 Gene Essential for Viral Replication is Non-Functional (BacMid1)

    [0393] BacMid1 has the deletion of a gene essential for viral replication, the gene 1629.

    [0394] 1. Integration of the Origin of Bacterial Replication in a Genome of the Baculovirus

    [0395] This operation is carried out in the insect cell.

    [0396] The origin of bacterial replication Mini-F was introduced into the polyhedrin locus of the baculovirus genome AcMNPV by homologous recombination in insect Sf9 cells (Spodoptera frugiperda). To do so, the cells were transfected with (i) a transfer vector PH (pVT/Mini-F-Kan.sup.R) in which the sequence of the gene ph was replaced by a fragment of DNA bearing the Mini-F+a bacterial expression cassette conferring kanamycin resistance (Kan.sup.R), and (ii) a baculovirus genome AcMNPV (baculovirus isolated from the lepidoptera Autographa californica). The baculovirus generated were purified by the phage plaque assay technique then characterised in order to confirm that they had indeed integrated the Mini-F and the expression cassette Kan.sup.R. A baculovirus was selected and was next transferred into the bacterium E. coli EL350, thus generating a first BacMid (BacMid0, non-deficient for viral replication in insect cells).

    [0397] 1. Deletion of the Essential Gene 1629

    [0398] A bacterial expression cassette conferring ampicillin resistance (Amp.sup.R) and having on 5 and 3 the restriction site MauBIsite absent from the baculovirus genome AcMNPV was integrated downstream of the bacterial expression cassette Kan.sup.R by homologous recombination in the bacterium E. coli EL350. In the course of this recombination, a fragment of DNA encoding the 27 C-terminal amino acids of the protein 1629 was deleted, making the protein 1629 non-functional (BacMid0/amp.sup.R). The ampicillin resistance gene was next eliminated after digestion by MauBI then religation, thus generating BacMid1. The genome of the baculovirus (i.e. BacMid1) is then deficient for replication in insect cells, because a gene essential for viral replication (i.e. the gene encoding the protein 1629) is non-functional. The bacteria containing BacMid1 are called hereafter bacteria E. coli EL350/BacMid1..

    [0399] FIG. 1 illustrates the steps of preparation of BacMid1.

    Example 2: Construction of a Replication Deficient Baculovirus Genome in which 2 Genes Essential for Viral Replication are Non-Functional (BacMid2)

    [0400] BacMid2 exhibits the deletion of 2 genes essential for viral replication, the gene 1629 and the gene encoding viral DNA polymerase (DNAPol). From BacMid1, the deletion of the gene DNAPol was carried out in the bacteria E. coli EL350/BacMid1 after electroporation of a recombination fragment of 4222 bp in which a part of the genes encoding gp37 (252 amino acids) and DNAPol (466 C-terminal amino acids) was deleted and replaced by a bacterial expression cassette enabling the production of hygromycin B phosphotransferase (Hygro.sup.R) thus conferring hygromycin resistance (Hygro.sup.R). The Hygro.sup.R gene was placed under the control of the bacterial promoter EM7 (derived from the commercially available vector pSelect-Hygro-mcs, Invitrogen), the terminator glms was introduced downstream of the Hygro.sup.R gene (Gay N. J. et al. Biochem J., 1986, 234, 111-117). The bacteria containing BacMid2 (E. coli EL350/BacMid2) were selected for their hygromycin resistance. The baculovirus genome (i.e. BacMid2) is deficient for replication in insect cells, because two genes essential for viral replication (i.e. the gene encoding the protein 1629 and the gene encoding DNAPol) are non-functional. FIG. 2 is a diagram which illustrates the step of deletion of a part of the gene DNAPol for the preparation of BacMid2.

    [0401] Note: It is possible to use BacMid2 to produce a single protein (see Example 4). It suffices to have two transfer vectors, one providing the transgene and all or part of the deleted essential gene 1 and the other providing the wild gene corresponding to the deleted essential gene 2. The two deleted genes are repaired during homologous recombination.

    Example 3: Construction of a Replication Deficient Baculovirus Genome in which 3 Genes Essential for Viral Replication are Non-Functional (BacMid3)

    [0402] BacMid3 has the deletion of 3 essential genes, 1629, DNAPol and gp64.

    [0403] From BacMid2, the deletion of gene gp64 was carried out in the bacteria E. coli EL350/BacMid2 after electroporation of a recombination fragment of 3260pb in which the totality of the gene of the cathepsin plus 779 bp of the sequence encoding 259 amino acids of chitinase and a part of the gene of gp64, deletion of 566 bp encoding 188 amino acids, was replaced by a bacterial expression cassette conferring zeocin resistance (Zeo.sup.R) (Drocourt et al., Nucleic Acids Research, vol. 18no 13, 1990). The Zeo.sup.R gene derived from the commercially available plasmid pCR-Blunt (Invitrogen) was placed under the control of the bacterial promoter T5N25, derived from the phage T5 (Gentz and Sward, J. Bacteriology, vol. 164 no 1, 1985) and followed by the transcription terminator rrnBT1 (E. coli ribosomal RNA operon T1 terminator) (Kwon et al., J Biol. Chem., vol 274 no 41, 1999). The bacteria containing BacMid3 (E. coli EL350/BacMid3) were selected for their zeocin resistance. The baculovirus genome (i.e. BacMid3) is deficient for replication in insect cells, because three genes essential for viral replication (i.e. the gene encoding protein 1629 and the gene encoding DNAPol and the gene encoding gp64) are non-functional.

    [0404] FIG. 3 is a diagram which illustrates the step of deletion of gp64 for the preparation of BacMid3.

    Example 4: Use of BacMid2

    [0405] A transfer vector pVT/gp37 was constructed to be able to generate recombinant baculoviruses expressing 2 transgenes. To do so, the fragment EcoRI F of the baculovirus genome AcMNPV containing the gene gp37 and the gene DNAPol was cloned in a bacterial plasmid pUC, thus generating pUC/gp37.

    [0406] This plasmid was next modified in the following manner: a large part of the gene encoding gp37 was deleted (724pb), the ATG initiator was mutated and replaced by two unique restriction sites XbaI and AvrII enabling the integration of a transgene under control of the natural promoter of gp37. These modifications thus led to the transfer vector pVT/gp37 being obtained.

    [0407] The Sf9 cells were transfected by lipofection with the transfer vectors pVT/PH and pVT/gp37 loaded with the transgenes and DNA of BacMid2. The viruses generated after homologous recombination were cloned by the phage plaque assay method. The production of the recombinant protein was verified by a suitable method (e.g. for example ELISA, Western blot, enzymatic assay). The genome of the recombinant viruses was verified by Southern blot and the sequence of the transgene integrated in the viral genome was verified by sequencing after PCR amplification.

    [0408] FIG. 4 is a diagram which illustrates the transfer vector pVT/gp37 for the expression of a gene X (where X is a gene different from the gene encoding the heavy chain of an antibody).

    [0409] The genomes of recombinant baculoviruses generated after homologous recombination between BacMid2 and the transfer vectors no longer express gp37 (protein not essential for viral replication).

    [0410] In order that the viral DNA is repaired in the 2 loci of BacMid2, a second recombination must take place with a transfer vector PH loaded or not with a transgene. In all cases, the DNA of the baculovirus genome will be repaired and thus infectious.

    [0411] It will also be possible to use pVT/PH containing a wild sequence, that is to say containing the wild expression cassette (non-modified) leading to the production of polyhedrin. The pVT/PH could also be empty that is to say not contain transgene or polyhedrin gene.

    [0412] In the same way it will be possible to integrate the transgene in the locus PH. In this case, a pVT/gp37 not deleted (functional non-essential gene) or deleted totally or partially such as described in FIG. 4 will be used to repair the locus gp37/DNApol. It should be noted that the sequence of the gene gp37 which is present in pVT/gp37 described in FIG. 4, was modified, the ATG initiator (ATGi) was mutated and the gene gp37 was deleted from 240 amino acids, as explained hereafter:

    TABLE-US-00001 [00001]embedded image

    [0413] Direction of transcription of the gene

    [0414] Caption:

    [0415] Sequence of the gene in bold type

    [0416] ATG initiator underlined

    [0417] Polylinker XbaI/AvrII/BamHI in boxed section

    [0418] The nucleic sequence illustrated above is the sequence SEQ ID NO: 16

    [0419] FIG. 5 is a diagram which illustrates the construction and the use of the transfer vector PH pVT/PH for the expression of a transgene X (where X is a transgene different from the gene encoding a light chain of an antibody).

    [0420] Expression of the Heavy Chain of an Antibody.

    [0421] Construction of a specific pVT/gp37, pVT/gp37-C1

    [0422] This transfer vector contains the following expression cassette: [0423] Wild viral promoter P10 (SEQ ID NO:1) [0424] DNA sequence encoding a signal sequence of a human immunoglobulin (secretion sequence) [0425] 2 unique restriction sites for the cloning in phase of the variable region (VH) of the antibodies (region which gives the specificity of the antibodies) [0426] DNA sequence which encodes a constant region of epsilon, mu, or alpha human IgG (1.-4).

    [0427] FIG. 6 is a diagram which illustrates the construction and the use of the transfer vector pVT/gp37C1 for the expression of the heavy chain of an antibody.

    [0428] Expression of the Light Chain of an Antibody.

    [0429] Construction of a specific pVT/PH, pVT/PH-CL.

    [0430] This transfer vector contains the following expression cassette: [0431] Viral promoter P10 P10S1B (SEQ ID NO: 3) [0432] DNA sequence encoding a signal sequence of a human immunoglobulin (secretion sequence) [0433] 2 unique restriction sites for the cloning in phase of the variable region (VL) of the antibodies (region which gives the specificity of the antibodies) [0434] DNA sequence which encodes a constant region of light chain (CL) kappa () or lambda () of human IgG.

    [0435] FIG. 7 is a diagram which illustrates the construction and the use of the transfer vector pVT/PHC for the expression of the light chain of an antibody.

    Example 5: Use of BacMid3

    [0436] A transfer vector, pVT/Chit-Cath, was constructed to be able to generate genomes of recombinant baculoviruses expressing 3 transgenes.

    [0437] The fragment BstXI-XbaI derived from the regions EcoRI E and H of the baculovirus AcMNPV was cloned in a plasmid pUC. A deletion EcoNI-EcoRI of 1175 pb makes it possible to inactivate the genes encoding chitinase, non-essential, and cathepsin, also non-essential. The addition of a site XbaI between the sites EcoNI and EcoRI makes it possible to integrate a transgene. These modifications thus led to the transfer vector pVT/Chit-Cath being obtained.

    [0438] The Sf9 cells are transfected by lipofection with the transfer vectors pVT/PH, pVT/gp37 and pVT/chitCath loaded with the transgenes and the DNA of BacMid3. The viruses generated during homologous recombination were cloned by the phage plaque assay method. The production of the recombinant protein was controlled by a suitable method, ELISA, Western blot, enzymatic assay, etc., the genome of the recombinant viruses was controlled by Southern blot and the sequence of the transgene was controlled after PCR amplification.

    [0439] FIG. 8 is a diagram which illustrates the construction of the vector pVT/Chit-Cath and its homologous recombination with BacMid3.

    Example 6: Production of a Monoclonal Antibody Anti-CD4 (13B811) Using BacMid2

    [0440] The DNAc encoding the regions VH and VL of the antibodies were integrated respectively in the transfer vectors pVT/PH-C; and pVT/gp37-C1. Recombinant baculoviruses were generated after homologous recombination between 2 pVT and the DNA of BacMid2 of example 4:

    [0441] The DNAc encoding the region VL of the antibodies was introduced into pVTPH/Ck which recombines with the region PH/1629 of BacMid2,

    [0442] The DNAc encoding the region VH of the antibodies was cloned in pVT/gp37-C1 which recombines with the region gp37 of BacMid2.

    [0443] The Sf9 cells were transfected by lipofection with BacMid2 and the 2 transfer vectors obtained in example 4 then incubated for 4 days at 28 C. The culture supernatants were collected and the recombinant baculoviruses generated and secreted in the culture medium were cloned by the phage plaque assay technique.

    [0444] The organisation of the genome of the recombinant baculoviruses was controlled by Southern blot (see FIG. 9A) and the integrated transgenes (i.e. VL and VH) were verified after PCR amplification, cloning then sequencing. The recombinant antibodies secreted in the culture medium were purified on a Protein A Sepharose column (GE Healthcare) then analysed after migration in polyacrylamide gel and silver staining (FIG. 9B).

    Example 7: Use of BacMid3 for the Production of VLP (Virus-Like-Particle)

    [0445] Production of flu VLP

    [0446] To produce these VLPs, the 3 genes of the flu virus, M, HA and NA, were co-expressed.

    [0447] These 3 genes were integrated in the three transfer vectors necessary to recombine with the BacMid3 of example 5: The gene M was introduced into the transfer vector pVT/PH as described in FIG. 5.

    [0448] The gene HA was introduced into the transfer vector pVT/gp37 as described in FIG. 4.

    [0449] The gene NA was introduced into the transfer vector pVT/Chit/Cath as described in FIG. 8.

    [0450] The Sf9 cells were transfected by lipofection with BacMid3 and the 3 transfer vectors obtained above, then incubated for 4 days at 28 C. The recombinant baculoviruses generated then secreted in the culture supernatant were cloned by the phage plaque assay method.

    [0451] The organisation of the genomes of recombinant baculoviruses was controlled by Southern blot (see FIG. 10) and the integrated genes were verified after PCR amplification, cloning then sequencing. Southern blot was carried out on the genomic DNA of the recombinant virus expressing the 3 proteins HA, NA and M of the flu virus. This experiment, carried out with specific probes for these 3 genes, made it possible to detect the presence of DNAc encoding the 3 proteins in the recombinant baculovirus genome.

    Example 8: Use of BacMid3 for the Production of Bispecific Antibodies

    [0452] The bispecific antibody constructed according to the international application WO 2013/005194 is constituted of a heavy chain composed of the domains VH+CH1+CH2+CH3 of an antibody 1, N-terminal fused to the domains VH+CH1 of an antibody 2. Mutations introduced at the interface of the regions CL and CH1 of the antibodies 1 favour the correct pairings between the domains VL1 and VL2 of the light chains L1 and L2 which are produced separately and the corresponding domains VH1 and VH2. The production of this antibody necessitates the simultaneous production and in equal quantity of 3 chains, the fused heavy chain, the light chain L1 and the light chain L2.

    [0453] The DNAc encoding the light chain L1 was introduced into the transfer vector pVT/PH as described in FIG. 5.

    [0454] The DNAc encoding the light chain L2 was introduced into the transfer vector pVT/gp37 as described in FIG. 4.

    [0455] The DNAc encoding the fused heavy chain was introduced into the transfer vector pVT/Chit-Cath as described in FIG. 8.

    [0456] FIG. 11 is a diagram which illustrates in A the structure of the bispecific antibodies and in B the analysis by electrophoresis in polyacrylamide gel of the bispecific antibodies purified on Protein A Sepharose column (GE Healthcare).

    Example 9: Construction of BacMid2-Fur Enabling the Generation of Recombinant Baculoviruses Correctly Expressing Matured Mannosylated Proteins

    [0457] The general principle that was used to introduce into the bacmids the genes enabling to optimise post translational modifications of the proteins (BacMid2/MPT (MPT: Post-Translational Modification) is described in FIG. 14 and detailed in example 10. When several genes are necessary, they are integrated in an iterative manner in regions or genes not essential for replication of the virus. Table 2 below describes the integration sites and the nature of the genes integrated in the different bacmids which were constructed.

    TABLE-US-00002 TABLE 2 Promoter used to Name of the gene involved control the expression in post translational modification Integration site in Origin of the RNA polymerase Origin of the the viral genome promoter used Gene gene Reference Intergenic v-ubi P9 promoter of JcNDV Cellular GNT-II Human Tan et al. (orf35)/39k (orf36) 1995 pos. 29226 egt (orf15) pos. 12786 Promoter of the gene Cellular and 1,4GalTI Bovine d'Agostaro Integration in the gp64 of OpMNPV viral et al. 1989 gene egt iap2 (orf71) pos. 61222 Promoter of the gene Cellular CMP NeuAc synthase Human Munster et Integration in the gene ie1 of CfMNPV al. 1998 iap2 and deletion of Promoter of the gene Cellular NeuAc synthase Human Lawrence 335nt (112 aa) of iap2 ie1 of LdMNPV et al. 2000 Intergenic orf51/orf52 Promoter of the Cellular ST3GalIV Human Kitagawa and pos. 44298 gene ie1 of WSSV Paulson, 1994 Promoter of the gene Cellular ST6GalI Human Grundmann ie1 of WSSV et al. 1990 Promoter of the gene Cellular ST3GalIV + ST6GalI Human actin 3 of B. mori and promoter of the gene ie1 of WSSV pif1 (Orf119) pos. 100697 Promoter of the gene Cellular ST6GalI Human Integration in the place of ie1 of WSSV the gene pif1 which is entirely deleted chit/cath (orf126/orf127) Synthetic promoter P10S1 Viral Sf9-fur Lepidoptera Cieplik et pos. 106160 Deletion of Cell Sf9 al. 1998 787nt of chit(263 aa N-terminal) and 342nt of cath (114 aa N-terminal) Numbering of the bases conforming to the sequence of the virus AcMNPV filed in GenBank under the reference NC_001623, Autographa californica nucleopolyhedrosis genome, complete sequence

    [0458] Caption of table 2: the genes involved in the elaboration of the post-translational modifications (example: glycosylation, endoproteolytic cleavage) were inserted into non-essential genes/regions of the bacmids. Except in the case of the over-expression of cellular furin which is produced under the control of a strong late promoter P1051, the promoters used to control the expression of these genes are early so as to produce these enzymes before the biosynthesis of the proteins of interest that will be expressed under the control of late promoters.

    [0459] BacMid2-Fur was constructed from the BacMid2 obtained in example 2. The gene encoding furin of the lepidoptera cell Sf9 (fur) was cloned downstream of a synthetic late promoter P1051 of sequence:

    TABLE-US-00003 (SEQIDNO:17) 5-ATAAGTATTTTAATCTTTTCGTTTGTATATTAATTAAAATACTATAC TGTATAAAAAAACCTATAAATATCCCGGATTATTCATACCGTCCCACCAT CGGGCGTACGCCACC-3.

    [0460] The gene fur was integrated in the chitinase-cathepsin locus. The transfer vector, pVT/Chit-Cath of which the construction is described in example 5 was used. The expression cassette comprising the gene fur under control of the synthetic promoter P1051 was introduced at the unique site XbaI of the pVT/Chit-Cath (position 106160 in the genome of the baculovirus), to give the plasmid pVT/Chit-Cath-Fur. The gene fur was cloned in the same direction as the inactivated cathepsin gene.

    [0461] A bacterial expression cassette zeocin resistance (Zeo.sup.R) composed as follows: [Bacterial promoter T5N25-Zeo.sup.R-terminator rmBT1] containing a site Bsu36I on either side was cloned at the site EcoRI of pVT/Chit-Cath-Fur, to give the plasmid pVT/Chit-Cath-Fur-Zeo.sup.R. This second cassette enables the expression of the gene Zeo.sup.R and thus confers on the bacterium bearing this plasmid zeocin resistance.

    [0462] The recombination fragment of 5927 pb was prepared after digestion of the plasmid pVT/Chit-Cath-Fur-Zo.sup.R by BglII thus generating flanking regions for the homologous recombination of 652 pb and 704 pb on either side of the fragment. After electroporation in the bacterium EL350/BacMid2, the bacteria were selected on zeocin. As described in FIG. 14, the bacterial expression cassette Zo.sup.R was eliminated by digestion Bsu36I, repair then ligation.

    [0463] BacMid2/Fur was thus obtained. The genomes of these new BacMids were controlled by Southern (FIG. 15) then by sequencing of the integrated gene fur.

    Example 10: Construction of BacMid2-Gal Enabling the Generation of Recombinant Baculoviruses Expressing Galactosylated Proteins

    [0464] BacMid2-Gal was constructed from the BacMid2 obtained in example 2. The DNAc encoding 2 glycosyltransferases missing in lepidoptera cells and necessary for the biosynthesis of galactosylated glycans, human N-acetylglucosaminyltransferase II (GNT-II) (EC 2.4.1.143, Accession no NM_002408.3) and bovine 1,4 galactosyltransferase (1,4GalT) (EC 2.4.1.38, Accession no NM_177512.2) were introduced into non-essential genes or regions of BacMid2 by homologous recombination. In order that the enzymatic activities of 1,4GalT and GNT-II are expressed before the synthesis of the transgene(s) of interest encoding a polypeptide of interest, the transgenes encoding GNT-II and 1,4GalT were cloned downstream of early viral promoters such as described in table 2.

    [0465] FIG. 14 illustrates in a general manner the different steps necessary for the construction of a BacMid comprising one or more transgene(s) each encoding a protein maturation enzyme BacMid2/MPT. In particular, in FIG. 14, the transgene encoding the protein maturation enzyme is the gene encoding GNTII (gene GNTII).

    [0466] The addition of transgenes encoding respectively GNT-II and 1,4GalT was carried out in an iterative manner in BacMid2.

    [0467] Insertion of the transgene GAIT-II

    [0468] This transgene was introduced in position 29226 of the viral genome by homologous recombination between orf35 (v-ubi) and orf36 (39k) designated intergenic region IG35/36. In order to be able to insert the expression cassette in the genome of BacMid, the unique sites for cloning XbaI (italics) and Bsu36I (underlined) were integrated by PCR in the region IG35/36 with the following primers:

    TABLE-US-00004 antisenseig35/36 (SEQIDNO:7) 5-CCTGGTAATTTTTGACCACGG-3(position28806inthe viralgenome) and Sensemutig35/36 (SEQIDNO:6) 5-GCCTTAGGTCTAGAGTATATTTAATGGTTTTTATTATTGTTATTATT AATACCCTCC-3then Antisensemutig35/36 (SEQIDNO:5) 5-CTCTAGACCTAAGGCATAAAAGTTTTTTATTTAATCTGACATATTTG TATCTTGTGTATTATCGC-3 and Senseig35/36 (SEQIDNO:4) 5-CGCAGCAATTCCAGCGAGC-3(position29657inthe viralgenome)

    [0469] The PCR fragment obtained of 861 bp was cloned in a plasmid pGEMTeasy and controlled by sequencing, to give the plasmid pGEM-IG35/36.

    [0470] Two expression cassettes were introduced into the above plasmid pGEM-IG35/36.

    [0471] A viral expression cassette, composed as follows [Promoter P9 of the densovirusJcNDVtransgene encoding GNTIIstop TkpA] was inserted at the level of the site XbaI, to give the plasmid pGEM-IG35/36-GNTII. The Promoter P9 of the densovirus JcNDV is described in Shirk P D, Bossin H, Furlong R B, Gillett J L. Regulation of Junonia coenia densovirus P9 promoter expression. Insect Mol Biol. 2007 October; 16(5):623-33. Epub 2007 Aug. 22.

    [0472] The bacterial expression cassette zeocin resistance (Zeo.sup.R) (obtained from the commercially available plasmid pCRBlunt, InVitrogen) composed as follows: [Bacterial promoter T5N25-Zeo.sup.R-terminator rrnBT1] was cloned at the level of the site Bsu36I. This second cassette enables the expression of the Zeo.sup.R gene and thus will confer on the bacterium bearing it zeocin resistance, to give the plasmid pGEM-IG35/36-GNTII-Zeo.sup.R. The bacterial promoter T5N25 is described in Gentz R, Bujard H. Promoters recognized by Escherichia coli RNA polymerase selected by function: highly efficient promoters from bacteriophage T5. J Bacteriol. 1985 October; 164(1):70-7. The transcription terminator rrnBT1 is described in Kwon Y S, Kang C. Bipartite modular structure of intrinsic, RNA hairpin-independent termination signal for phage RNA polymerases. J Biol Chem. 1999 Oct. 8; 274(41):29149-55.

    [0473] The recombination fragment of 3493 bp<IG35/36-GNTII-Zeo.sup.R> obtained after digestion by EcoRI of the plasmid generated above pGEM-IG35/36-GNTII-Zeo.sup.R and having flanking regions for the homologous recombination of 420 bp and 428 pb on either side of the recombination fragment, was electrophoresed in the bacteria EL350/BacMid2. The bacteria containing BacMid2/GNTII-Zeo.sup.R (E. coli EL350/BacMid2/GNTII-Zeo.sup.R) were selected for their kanamycin, hygromycin and zeocin resistance. The DNA of 3 clones of Bacmid2/GNTII-Zeo.sup.R selected was extracted then the GNT-II and Zeo.sup.R genes inserted into the region IG35/36 were controlled by PCR then sequencing.

    [0474] The bacterial expression cassette flanked on either side of a site Bsu36I was next eliminated by simple digestion by Bsu36I, repair of the ends of the DNA with the DNA polymerase of Klenow then ligation of the plasmid on itself. It should be noted that the repaired sequence Bsu36I [5 CCTNATNAGG 3] was conserved in Bacmid2/GNTII thus generated after ligation of the plasmid. This sequence is thus present in the recombinant baculovirus and it may constitute a specific signature.

    [0475] The transgene encoding GNTII was cloned in the same direction as the gene 39K.

    [0476] BacMid2/GNTII was thus obtained then controlled as described above before being used for the insertion of the gene encoding 1,4GalT.

    [0477] Insertion of the gene 1,4GalT

    [0478] The transgene encoding 1,4GalT was integrated in the locus of the non-essential gene egt (Ecdysteroid glycosyltransferase, ORF15, position in the genome position 11426-12946 of the viral genome AcMNPV) of BacMid2/GNTII according to the general principle described above. The fragment PstI-BamHI of 5110 bp (position 9999 to 15110 in the viral genome of AcMNPV) containing the gene egt, was cloned beforehand in a plasmid pUC to give the plasmid pUC-EGT. Then, the viral expression cassette comprising the DNAc encoding bovine 1,4GalT under control of the promoter gp67 of OpMNPV was introduced into the gene egt by insertion (inactivation of the gene by insertion) at the unique site XbaI (position 12782 in the genome of the baculovirus) present in the sequence encoding the gene egt, to give the plasmid pUC-EGT-GalT. The transgene encoding 1,4GT was cloned in the same direction as the gene egt.

    [0479] An adaptor NsiI-Bsu36I-NsiI was next inserted in the site NsiI situated downstream of the gene 1,4GalT, which enabled the introduction of the bacterial expression cassette Zo.sup.R in Bsu36I generating the plasmid pUC-EGT-GalT-Zo.sup.R.

    [0480] The recombination fragment of 3128 bp was prepared after digestion of the above plasmid pUC-EGT-GalT-Zo.sup.R by SnaBI-NruI thus generating flanking regions for the homologous recombination of 474 bp and 866 pb on either side of the fragment. After electroporation in the bacterium EL350/BacMid2-GNTII, the bacteria were selected on zeocin. As previously, the bacterial expression cassette Zo.sup.R was eliminated by digestion Bsu36I, repair then ligation.

    [0481] BacMid2/GNTII/1,4GalT (also called BacMid2-Gal or BacGal) was thus obtained. The genome of BacMid2-Gal was controlled by Southern then sequencing of all the integrated genes.

    Example 11: Construction of BacMid2Gal-Fur Enabling the Generation of Recombinant Baculoviruses Correctly Expressing Matured Galactosylated Proteins

    [0482] BacMid2-Gal-Fur was constructed as described for BacMid2-Fur (Example 9).

    [0483] The bacteria EL350/BacMid2-Gal were electrophoresed with the recombination fragment of 5927 pb described in example 9, then selected on zeocin. As previously, the bacterial expression cassette Zo.sup.R was eliminated by digestion Bsu36I, repair then ligation. BacMid2Gal-Fur was thus obtained. The genome of the bacmid was controlled by Southern (FIG. 15) then sequencing of the new integrated gene.

    Examples 12: Construction of BacMid-Sia3 (or BacSia3)

    [0484] The transgenes encoding human CMPNeuAc synthase (CMPNeuAc synthase or CMPNeuAcS) (EC 2.7.7.43, accession no NM_018686.5), human NeuAc synthase (NeuAc Synthase or NeuAcS) (EC 2.5.1.56, accession no AF257466) and human 2,3 sialyltransferase (ST3), ST3GalIV (EC 2.4.99.4, accession no X74570) were inserted into BacMid2/GNTII-1,4GT in an iterative manner according to the general principle described in FIG. 14.

    [0485] Cloning of the Two Transgenes Encoding Respectively NeuAc Synthase and CMP NeuAc Synthase in Locus Iap2 of BacMid2-Gal.

    [0486] The Applicant chose to clone these two enzymes head to tail under the control of very early promoters, the promoter IE1 (immediate-early 1) of the baculovirus of Choristoreura fumiferana for the control of the expression of the gene CMP NeuAc synthase and that of the baculovirus of Lymantria dispar for the control of the expression of the gene NeuAc synthase (see Table 2)

    [0487] The region comprising the gene iap2 (ORF71) of the baculovirus AcMNPV (position in the genome 61016-61765) was amplified beforehand by double PCR with the following primers:

    TABLE-US-00005 Senseiap2 (SEQIDNO:8) 5-GATATTGTGTGCTCAATGTC-3(Position60736inthe viralgenome) AntisenseBstBI (SEQIDNO:9) 5-CCTAAGGTCTAGATTCGAATACGTGTGTCG-3then SenseBstBI (SEQIDNO:10) 5-CGAATCTAGACCTTAGGCCGCGGCTAAGCGTTAAACC-3 Antisenseiap2 (SEQIDNO:11) 5-CGATCACCGTCGCTGTCGTCTTC-3(Position61951in theviralgenome)

    [0488] These successive PCRs also made it possible (i) to integrate the unique sites Bsu36I (underlined above) and XbaI (double underlined above) and (ii) to delete a large part of the sequence encoding iap2, deletion of 335 bp/112 amino acids. The amplified fragment of 896 bp was cloned in a plasmid pGEM Teasy, to give the plasmid pGEM-IAP2.

    [0489] A viral expression cassette, composed as follows [Stop SV40-CMPNeuAc Synthase-Promoter IE1Cf-Promoter IE1Ld-NeuAc Synthase] was inserted at the site XbaI of pGEM-IAP2, to give the plasmid pGEM-iap2-CMPNeuAcS-NeuAcS.

    [0490] The bacterial expression cassette zeocin resistance (Zeo.sup.R) composed as follows: [Bacterial promoter T5N25-Zeo.sup.R-terminator rrnBT1] was cloned at site Bsu36I of pGEM-iap2-CMPNeuAcS-NeuAcS, to give the plasmid pGEM-iap2-CMPNeuAcS-NeuAcS-Zeo.sup.R. This second cassette enables the expression of the Zeo.sup.R gene and thus confers on the bacterium bearing this plasmid zeocin resistance.

    [0491] The recombination fragment [CMPNeuAc-NeuAcS-Zeo.sup.R] of 4548 pb was prepared after digestion of the plasmid pGEM-iap2-CMPNeuAcS-NeuAcS-Zeo.sup.R by the restriction endonuclease NotI which generates flanking regions for the homologous recombination of 486 bp and 396pb on either side of the fragment. The bacteria EL350/BacMid2-GNTII-1,4GT were electrophoresed with the recombination fragment thus generating BacMid2-GNTII-1,4GT-CMPNeuAcS-NeuAcS-Zo.sup.R. As previously, the zeocin resistance cassette was eliminated after digestion by Bsu36I, repair then religation. BacMid2-GNTII-1,4GT-CMPNeuAcS-NeuAcS was thus obtained.

    [0492] Cloning of the Transgene 2,3-Sialyltransferase IV (ST3GalIV) in the Intergenic Region Comprised Between orf51 and orf52 (IG51/52) of BacMid2-GNTII-B1,4GT-CMPNeuAcS-NeuAcS.

    [0493] This region located in the fragment EcoRI N of the baculovirus AcMNPV was isolated after amplification by double PCR with the following primers:

    TABLE-US-00006 SenseIG51/52 (SEQIDNO:12) 5-GGAAAACTTTCCGAAGACGAAC(position43814inthe viralgenome) and AntisenseXba/IG51/52 (SEQIDNO:13) 5-CCTAAGGTCTAGAGTGCCTTTTGTTTGCTATTTTGCGCCG-3 then SenseXba/IG51/52 (SEQIDNO:14) 5-CTCTAGACCTTAGGTCCGCGCTCTCCCACGC-3 and AntisenseIG51/52 (SEQIDNO:15) 5-GGTGCAGAACATAATGACGTGGCCTTAC(position44723 intheviralgenome)

    [0494] During these successive PCRs there is addition of 2 unique sites Bsu36I (underlined above) and XbaI (double underlined above) in the intergenic region ORF51/ORF52 which will enable integration of the expression cassette ST3 at site XbaI in position 44298 in the viral genome. The fragment obtained of 922 bp was cloned in a pGEM T easy (Promega), to give the plasmid pGEM-IG51/52.

    [0495] As for the other enzymes, ST3GalIV must be present in the cells before the glycoproteins of interest are expressed. We chose the promoter IE1 of the shrimp virus WSSV (White Spot Syndrome Virus) identified as being a functional cell promoter Sf9 of immediate-early type (See Table 2)(Liu et al., Virology, 2005; Liu et al. J of virology, 2007; Gao et al., J. Biotechnology, 2007).

    [0496] A viral expression cassette, composed as follows [promoter WSSV-5T3] was inserted at site XbaI of pGEM-IG51/52, to give the plasmid pGEM-IG51/52-5T3. ST3GalIV was cloned in the opposite direction of orf51.

    [0497] The bacterial expression cassette zeocin resistance (Zeo.sup.R) composed as follows: [Bacterial promoter T5N25-Zeo.sup.R-terminator rrnBT1] was cloned at site Bsu36I of pGEM-ORF51-ST3, to give the plasmid pGEM-IG51/52-ST3-Zeo.sup.R. This second cassette enables the expression of the Zeo.sup.R gene and thus confers on the bacterium bearing this plasmid zeocin resistance.

    [0498] A recombination fragment [ST3GalIV-Zeo.sup.R] of 2589 pb was generated from pGEM-IG51/52-ST3-Zeo.sup.R by digestion by the restriction endonuclease NotI. This digestion generated flanking regions for the homologous recombination of 498 bp and 411pb on either side of the expression cassette. Homologous recombination was carried out in the bacterium EL350/BacMid2-GNTII-1,4GT-CMPNeuAcS-NeuAcS, generating BacMid2-GNTII-1,4GT-CMPNeuAcS-NeuAcS-ST3 (or BacSia3). The genome of BacSia3 was controlled by Southern then sequencing of all the integrated genes.

    Example 13: Construction of BacMid-Sia6 (or BacSia6)

    [0499] Cloning of the Transgene 2,6-Sialyltransferase I (ST6GalI) in the Intergenic Region orf51/orf52 (IG51/52) of BacMid2-GNTII-1,4GT-CMPNeuAcS-NeuAcS.

    [0500] The method for cloning the gene encoding human 2,6 sialyltransferase, ST6GalI (EC 2.4.99.1, accession no X17247) is similar to that described in example 12 for the transgene encoding ST3GalIV, summarised as follows: [0501] a viral expression cassette, composed as follows [promoter WSSV-5T6] was inserted at site XbaI of pGEM-IG51/52, to give the plasmid pGEM-IG51/52-ST6. ST6GalI is cloned in the opposite direction to orf51 [0502] the bacterial expression cassette zeocin resistance (Zeo.sup.R) composed as follows: [Bacterial promoter T5N25-Zeo.sup.R-terminator rrnBT1] was cloned at site Bsu36I of pGEM-ORF51-5T6 generating the plasmid pGEM-IG51/52-ST6-Zeo.sup.R. This second cassette enables the expression of the Zeo.sup.R gene and thus confers on the bacterium bearing this plasmid zeocin resistance. [0503] A recombination fragment [ST6GalI-Zeo.sup.R] of 2825 pb was generated from pGEM-IG51/52-ST6-Zeo.sup.R by digestion by restriction endonuclease NotI. This digestion generated flanking regions for the homologous recombination of 498 bp and 411pb on either side of the expression cassette. The homologous recombination was carried out in the bacterium EL350/BacMid2-GNTII-1,4GT-CMPNeuAcS-NeuAcS, generating BacMid2-GNTII-1,4GT-CMPNeuAcS-NeuAcS-ST6 (or BacSia6). The genome of BacSia6 was controlled by Southern then sequencing of all the integrated genes.

    Example 14: Construction of BacMid-Sia6II (or BacSia6-II)

    [0504] a. Cloning of the Transgene 2,6-Sialyltransferase I (ST6GalI) in ORF119 (PIF1) of BacMid2-GNTII-1,4GT-CMPNeuAcS-NeuAcS.

    [0505] ORF119 (position in the genome 100699-102291), encoding PIF1, protein not essential for viral replication, is located in the fragment EcoRI E of the baculovirus AcMNPV. A fragment on either side of the gene was obtained after amplification by double PCR with the following primers:

    TABLE-US-00007 Sensepif1 (SEQIDNO:18) 5-GAATACAACGCCACATCTATTCCTAGTACAAC-3(position 100247intheviralgenome) and pif1bac5 (SEQIDNO:19) 5-CTAGAGGCGTTAACCTAAGGTACTTATTGGAGAATGTCCGAGTATTT TTG-3then pif1for3 (SEQIDNO:20) 5-CCTTAGGTTAACGCCTCTAGAACATGAGCATTTTAAAAGTTGTAGA AGCG-3 and RevPif1 (SEQIDNO:21) 5-CATTAACAATTACTACGGCGCATTTTGACCATC-3(position 102825intheviralgenome)

    [0506] These successive PCRs made it possible to eliminate the totality of ORF119, to integrate the unique sites Bsu36I (underlined above) and XbaI (double underlined above). The site XbaI will enable the integration of the expression cassette ST6 in position 100697 in the viral genome. The fragment obtained of 998 bp was cloned in a pGEM Teasy (Promega), to give the plasmid pGEM-PIF1.

    [0507] The viral expression cassette, described in example 12 [promoter WSSV-5T6] was inserted at site XbaI of pGEM-PIF1, to give the plasmid pGEM-PIF1-ST6. ST6GalI was cloned in the direction of pif1.

    [0508] The bacterial expression cassette zeocin resistance (Zeo.sup.R) composed as follows: [Bacterial promoter T5N25-Zeo.sup.R-terminator rrnBT1] was cloned at site Bsu36I of pGEM-PIF1-ST6, to give the plasmid pGEM-PIF1-ST6-Zeo.sup.R. This second cassette enables the expression of the Zeo.sup.R gene and thus confers on the bacterium bearing this plasmid zeocin resistance.

    [0509] A recombination fragment [ST6GalI-Zeo.sup.R] of 2903 pb was generated from pGEM-PIF1-ST6-Zeo.sup.R by digestion by the restriction endonuclease NotI. This digestion generated flanking regions for the homologous recombination of 498 bp and 411pb on either side of the expression cassette. The homologous recombination was carried out in the bacterium EL350/BacMid2-GNTII-1,4GT-CMPNeuAcS-NeuAcS, generating BacMid2-GNTII-1,4GT-CMPNeuAcS-NeuAcS-ST6-II (or BacSia6-II). The genome of BacSia6-II was controlled by Southern (FIG. 19B) then sequencing of all the integrated genes.

    Example 15: Construction of BacMid-Sia3/6 or BacSia3/6

    [0510] Head to Tail Cloning of the Transgenes ST6GalI and ST3GalIV in the Intergenic Region orf51/orf52 (IG51/52) in BacMid2-GNTII-1,4GT-CMPNeuAcS-NeuAcS.

    [0511] The cloning method is similar to that described in Examples 12 and 13 for the transgene encoding ST3GalIV and the transgene encoding ST6GalI, summarised as follows: [0512] a viral expression cassette comprising a transgene encoding ST6GalI and a transgene encoding ST3GalIV, composed as follows [ST6-promoter WSSV-actin promoter 3 B. mori-ST3-Stop actin 3] was inserted at site XbaI of pGEM-IG51/52, to give the plasmid pGEM-IG51/52-ST3/5T6. [0513] the bacterial expression cassette zeocin resistance (Zeo.sup.R) composed as follows: [Bacterial promoter T5N25-Zeo.sup.R-terminator rrnBT1] was cloned at site Bsu36I of pGEM-IG51/52-ST3/ST6, to give the plasmid pGEM-IG51/52-ST3/ST6-Zeo.sup.R. This second cassette enables the expression of the Zeo.sup.R gene and thus confers on the bacterium bearing this plasmid zeocin resistance.

    [0514] A recombination fragment [ST3/ST6-Zeo.sup.R] of 5008 pb was generated from pGEM-IG51/52-ST3/ST6-Zeo.sup.R by digestion by the restriction endonuclease NotI. This digestion generated flanking regions for the homologous recombination of 490 bp and 426pb on either side of the expression cassette. The homologous recombination was carried out in the bacterium EL350/BacMid2-GNTII-1,4GT-CMPNeuAcS-NeuAcS, to give BacMid2-GNTII-1,4GT-CMPNeuAcS-NeuAcS-ST3/ST6 (or BacSia3/6). The genome of BacSia3/6 was controlled by Southern then sequencing of all the integrated genes.

    Example 16: Use of BacMid2-Fur for the Production of Mature HIV1 Glycoprotein Gp160

    [0515] HIV1 gp160 must undergo a step of maturation in order that the virus is infectious and that the surface glycoproteins of the virus are organised into trimers. These structures are today considered as essential for the formation of epitopes of interest necessary for the elaboration of a vaccine against HIV-1. This maturation is carried out by cellular furin which is going to cleave gp160 into gp120+gp41. The production of gp160 in a recombinant form in general leads to a partially matured form and does so whatever the expression system.

    [0516] In order to obtain a completely matured gp160 we integrated the gene encoding furin of the Sf9 cell in the viral genome under the control of a very active promoter, a promoter P10-like called P1051 and constructed BacMid2-Fur (Example 9).

    [0517] From this bacmid, we constructed a double-recombinant virus expressing 2 proteins of HIV1, polyprotein Pr55Gag and gp160. The production of these 2 proteins leads to the secretion in the culture medium of virus-like-particles (VLP). In this experiment we concentrated (noted C and NC for non-concentrated) the VLP secreted with a solution of Retro Concentin Virus Precipitation (SBI, reference RV100A-1). The different samples obtained after infection with a wild virus BACWT or multi-recombinant viruses expressing gp160 and Pr55Gag (BAC/gp160/Gag), gp160 and Pr55Gag and furin (BAC/gp160/Gag) or mono-recombinant viruses like the virus BAC gp120 which expresses uniquely soluble gp120 and the virus BACGag which expresses uniquely the polyprotein Pr55Gag (BACGag) were analysed by Western blot with an antibody anti-gp120, Panel A (goat polyclonal antibodies directed against gp120 of HIV1, reference Ab21179, Abcam) or an antibody anti-Gag, Panel B (Anti-p55+p24+p17, Reference Ab63917, Abcam).

    [0518] As is shown in FIG. 15C, the activity of the cellular furin is not sufficient to mature the totality of the gp160 which is produced (Well BACgp160/Gag). Conversely, when there is over expression of this enzyme, there is a complete maturation of gp160 into gp120 (Well BACgp160/Gag/fur).

    Example 17: Use of BacMid2-Gal for the Production of Galactosylated Antibodies

    [0519] A terminal N-galactosylation being a characteristic of glycosylation of Asn297 situated in the constant domain of the IgG (FIGS. 12 and 13), the examples described below concern the production of recombinant antibodies.

    [0520] BacMid2-Gal was used like BacMid2 described previously (Examples 4 and 6) for the generation in a single step of a double recombinant baculovirus (FIGS. 16 and 17). As for BacMid2, co-transfection with BacMid2-Gal led to a very high content, close to 100%, of recombinant viruses (FIG. 9A).

    [0521] Insertion of Transgenes Encoding the Heavy and Light Chains of an Antibody.

    [0522] 1. Principle of the Generation of Recombinant Baculoviruses.

    [0523] DNAc encoding the variable regions VH and VL of the antibodies of interest were inserted into specific baculovirus transfer vectors (pVT) of the heavy and light chains of the antibodies, pVT/gp37-H (for cloning the variable region of the heavy chain) (FIG. 6) and pVT/PH-L (for cloning the variable region of the light chain) (FIG. 7). These vectors have been described in the article (Juliant et al., 2013). The Sf9 cells were next transfected with the 2 loaded pVT and DNA of BacMid2-Gal. Double-recombinant viruses co-expressing the heavy and light chains of antibodies were then produced in a single step (FIG. 17).

    [0524] 2. Construction of a Recombinant Virus Expressing a Galactosylated Antibody.

    [0525] Recombinant viruses expressing the same antibodies were produced from BacMid2 and BacMid2-Gal. The antibodies produced after infection of Sf9 cells with the recombinant virus derived from BacMid2 serves as control since they have an insect glycosylation, that is to say glycan motifs of paucimannosidic type and to a lesser proportion of oligomannosidic type (FIG. 12).

    [0526] Cloning in the Transfer Vectors.

    [0527] The fragments of DNAc encoding the variable regions of the heavy and light chains of the antibodies of interest were cloned in the respective transfer vectors (pVT/gp37-H and pVT/PH-L). In the course of this cloning, the complete genes encoding the 2 chains of antibodies are reconstituted (FIGS. 6 and 7).

    [0528] Generation and Cloning of the Recombinant Baculoviruses.

    [0529] The Sf9 cells were transfected by lipofection with the loaded pVT/gp37-H and pVT/PH-L and DNA of Bacmid2-Gal or BacMid2 (FIG. 17). After 7 days of infection at 28 C., the baculoviruses secreted in the culture supernatant were cloned by the phage plaque assay technique.

    [0530] Control of the Genomic Organisation of the Recombinant Viruses.

    [0531] Several baculoviral clones were selected, amplified and their genome extracted to be analysed by Southern blot. The genes encoding the heavy and light chains inserted into the baculoviral genome were also amplified by PCR then sequenced.

    [0532] Production and Purification of the Recombinant Antibodies.

    [0533] Sf9 cells suited to the growth in serum free medium were infected at a level of 3 PFU/cell. After 3 days of infection, the culture supernatant was collected and deposited on a Protein A Sepharose column (GE-Healthcare). The quality of the antibodies was verified after migration in polyacrylamide gel and silver staining.

    [0534] Analysis of Glycosylation by Lectin Blot.

    [0535] Principle of lectin blot: lectins are molecules that attach themselves specifically on glycan motifs. It is thus very simple to demonstrate the presence of a particular glycan bound to a protein after electrophoresis in polyacrylamide gel, transfer onto a nitrocellulose membrane and incubation of the membrane with a biotin conjugated lectin (example biotinylated lectin RCA.sub.120, reference B1085, Vector Laboratories) or with digoxigenin (example the lectins of the

    [0536] DIG Glycan Differentiation Kit, reference 11210238001, Roche). The presence of lectins is then detected indirectly thanks to an antibody directed against biotin or the digoxigenin itself peroxidase conjugated or with alkaline phosphatase. The presence of these enzymes is then detected thanks to their enzymatic activity which will generate either a brown red precipitate for peroxidase or a blue coloration for alkaline phosphatase.

    [0537] Experimentation

    [0538] The production of antibodies was controlled by Western blot. The proteins were separated by electrophoresis on a polyacrylamide gel at 10% in the presence of SDS and 2-mercaptoethanol then transferred onto a nitrocellulose membrane (Protran 0.45 m NC, GE Healthcare). The transfer of the proteins was verified after ponceau red staining. The membrane was incubated with (FIG. 18A) a sheep polyclonal antibody directed against human IgG and peroxidase conjugated (Reference NA933V, GE Healthcare) or (FIG. 18B) with a sheep polyclonal antibody directed against mouse IgG and peroxidase conjugated (Reference NA931V, GE Healthcare). The peroxidase was revealed by chemiluminescence with the SuperSignal West Pico Chemiluminescent Substrate System (reference: 34077, Thermo Scientific).

    [0539] Analysis by lectin blot (FIG. 18C). In this example, we used biotinylated lectin RCA.sub.120 (Ricinus communis agglutinin) which attaches itself specifically onto beta-galactosyl residues. The proteins were separated by electrophoresis on a polyacrylamide gel as described above for Western blot, transferred onto Protran 0.45 m NC membrane (GE Healthcare) then incubated in the presence of biotinylated RCA.sub.120. The lectin was revealed indirectly after incubation of the membrane with an anti-biotin antibody peroxidase conjugated (Goat antibodies, reference A4541, Sigma). Revelation was carried out in the presence of a chemiluminescent substrate (SuperSignal West Pico Chemiluminescent Substrate, Thermo Scientific)

    [0540] 3. Results

    [0541] Human (FIG. 18A) and mouse (FIG. 18B) recombinant antibodies were produced, purified on Protein A Sepharose (GE Healthcare) then analysed by Western blot (FIGS. 18A and B) and by lectin blot (FIG. 18C). FIGS. 18A and B indeed confirm the presence of human and mouse recombinant antibodies, Wells 2 and 3: Wells 4 and 5. FIG. 18C, shows that only the antibodieshuman or mouseproduced by cells infected with the recombinant baculoviruses generated from BacMid2-Gal are recognised by RCA.sub.120 (Wells 3 and 5). The antibodies produced during infection by the recombinant viruses derived from BacMid2 are not recognised by the lectin, Wells 2 and 4.

    [0542] These experiments clearly demonstrate that the BacGal virus is capable of complementing Sf9 cells to be able to produce galactosylated glycoproteins.

    Example 18: Use of BacMid-Sia3

    [0543] 1. Construction of a Recombinant Baculovirus Expressing its Alpha 2,3 Sialylated Glycoprotein Envelope Gp64.

    [0544] The activity of BacSia3 was controlled using as model protein the surface glycoprotein of the virus, gp64. Glycoprotein gp64 is the major glycoprotein of the baculovirus, it is involved in all the first steps of infection. It is located on the surface of the virus. It has been shown that this glycoprotein is capable of being galactosylated and sialylated (Jarvis et al. 1995). To do so, a recombinant virus was obtained by homologous recombination between BacMidSia3 and the empty transfer vectors pVTPH and pVT/gp37. The presence of 2,3 sialyl motifs was demonstrated thanks to a lectin blot carried out with lectin di-CBM40 described in the article (Ribeiro et al., 2016).

    [0545] Generation and Cloning of the Recombinant Baculoviruses.

    [0546] The Sf9 cells were transfected by lipofection with empty pVTPH and pVT/gp37 and DNA of Bacmid2 (control) or BacMid-Sia3 obtained in example 12 and according to the principle of FIG. 19A. After 7 days of infection at 28 C., the viruses secreted in the culture supernatant were cloned by the phage plaque assay technique. Four viral clones were selected, amplified and their genome extracted to be analysed by Southern blot. The gene inserted in the viral genome was amplified by PCR then sequenced.

    [0547] Analysis of Glycosylation by Lectin Blot.

    [0548] The lectin used in this example was biotinylated di-CBM40. The protocol that was used is similar to that which is described in example 17. After saturation, the membrane was incubated with diCBM40-Biotinylated lectin diluted 1/200 (5.7 g/ml) in TBS-T or with SNA-Dig lectin (Roche, Kit DIG Glycan Differentiation Kit) diluted 1/1000 in TBS-T. The revelation of the membranes was carried out as described in example 17. The presence of gp64 was controlled by Western blot in the presence of an anti-gp64 antibody (monoclonal mice antibodies AcV5 reference SC65499, Santa Cruz Biotechnology).

    [0549] 2. Results

    [0550] As shown in FIG. 20A, gp64 is detected in all the samples studied. In panel B, the SNA lectin which recognises very specifically 2,6 bound sialic acids bound to gp64 uniquely when it is produced with a virus that co-expresses ST6 (see Example 19) but does not bind to the gp64 which is produced during infection with a virus which co-expresses ST3.

    [0551] FIG. 20C, shows on the other hand that the lectin di-CBM40 indeed recognises the gp64 that was produced during infection with the virus producing ST3. There is no marking of mannosylated gp64 either which is produced when the cells are infected with a wild virus. A weaker but clear marking of gp64 having 2,6 bound sialic acids will however be noticed.

    [0552] These experiments clearly demonstrate that the virus BACSia3 is capable of complementing Sf9 cells to be able to produce 2,3 sialylated glycoproteins.

    Example 19: Use of BacMid-Sia6

    [0553] 1. Construction of a Recombinant Baculovirus Expressing a Recombinant Alpha 2,6 Sialylated Protein.

    [0554] The activity of BacSia6 was controlled using as model protein Glycoprotein G Vesicular Stomatitis virus, VSVg, the protein X and glycoprotein gp64 of the baculovirus.

    [0555] Generation and Cloning of the Recombinant Baculo Viruses.

    [0556] The DNAc fragment encoding the protein of interest was cloned in pVTPH according to the general principle described in FIG. 19A. The Sf9 cells were transfected by lipofection with loaded pVTPH, modified pVT/gp37 and DNA of Bacmid2 (control) or the BacMid-Sia6 obtained in example 13. After 7 days of infection at 28 C., the viruses secreted in the culture supernatant were cloned by the phage plaque assay technique. Four viral clones were selected, amplified and their genome extracted to be analysed by Southern blot. The genes inserted into the viral genome were amplified by PCR then sequenced.

    [0557] Production of Recombinant Proteins

    [0558] The proteins were produced as described in example 18.

    [0559] Analysis of Glycosylation by Lectin Blot.

    [0560] The presence of recombinant proteins was controlled by Western blot. After transfer of the proteins, the nitrocellulose membranes were incubated in the presence of different specific antibodies, anti-VSVg (mice monoclonal antibodies peroxidase conjugated, reference A5977, Sigma), anti-gp64 (mice monoclonal antibodies AcV5 reference SC65499, Santa Cruz Biotechnology). Revelation was carried out either directly as described in example 16 when the antibody is directly peroxidase conjugated or after incubation with a secondary antibody peroxidase conjugated (rabbit anti-mouse IgG serum peroxidase conjugated, reference A9044). The peroxidase was revealed by chemiluminescence with the ECL SuperSignal West Pico Chemiluminescent Substrate system (reference 34077, Thermo Scientific).

    [0561] The lectin that was used in this example was SNA (Sambuscus nigra agglutinin) which recognises 2,6 bound sialic acids. SNA was revealed as described in example 17.

    [0562] 2. Results

    [0563] a. Glycosylation of Protein X Expressed by the Recombinant Baculovirus Generated from BacSia6

    [0564] As shown by Western lot, FIG. 21A, when protein X was produced with a recombinant virus derived from BacMid2, its size is clearly less than that of the commercially available protein which was produced by mammal cells, here the CHO cell (compare Wells 1 and 3). Conversely, when it was produced with a recombinant baculovirus derived from BacSia6, protein X had a size comparable to that which was produced in CHO cells (compare Well 2 and Well 3).

    [0565] Analysis by lectin Blot, FIG. 21B, confirmed the presence of 2,6 bound sialic acids on this protein when it was produced with a recombinant baculovirus derived from BacSia6 (Well 2). Protein X was indeed recognised by SNA (revelation protocol described in example 17), thus explaining the increase in the molecular weight of protein X. This experiment also showed the absence of such a motif on the commercially available protein which was produced in CHO cells (Well 3), in fact the CHO line expresses uniquely a 2,3 sialyltransferase. Thus, as shown in FIG. 21C, protein X expressed in CHO (Well 3) was recognised by MAA (revelation protocol described in example 17) which is specific to 2,3 bound sialic acids, which is not the case of the protein which was expressed with the recombinant baculovirus derived from tBacSia6 (Well 2).

    [0566] b. Glycosylation of VSVg Expressed by the Recombinant Baculovirus Generated from BacSia6.

    [0567] VSVg being a membranal protein, we analysed the pellets of the infected cells. As shown in FIG. 22A (Wells 2 and 3), the protein VSVg was produced after infection of Sf9 cells with the 2 recombinant viruses whether they were derived from BacMid2 or BacSia6.

    [0568] Conversely, analysis by lectin blot with SNA (revelation protocol described in example 17) showed an intense marking of protein VSVg uniquely when it is expressed from the baculovirus derived from BacSia6 (FIG. 22B, Well 2). With protein VSVg produced after infection with the baculovirus derived from BacMid2 a non-specific marking (FIG. 22B, Well 3) only was noted. The positive control protein which is supplied with the glycan differentiation kit (Dig Glycan Differentiation Kit), fetuin, was very well marked by SNA (FIG. 22B, Well 1).

    [0569] c. Glycosylation of Gp64 of the Recombinant Baculovirus Generated from BacSia6.

    [0570] We also verified that the recombinant virus expressing sialylated VSVg (see above) was also bearing a sialylated gp64. To do so, the baculoviruses secreted in the culture supernatant were sedimented (35,000 rpm for 60 minutes, Beckman Optima LE-80K centrifuge, TI-70-1 rotor) then taken up by a lysis buffer to be analysed by Western blot then lectin blot. As previously, fetuin was used as positive marker for SNA (FIG. 22C and FIG. 22D, Well 1).

    [0571] FIG. 22C clearly shows the presence of gp64 in Wells 2 and 3. Like what we observed with VSVg, gp64 which was produced after infection with the virus derived from BacSia6 (Well 2) is the only one that is recognised by SNA (revelation protocol described in example 17) (FIG. 22D) thus confirming that gp64 is 2,6 sialylated. The presence of non-specific markings in Wells 2 and 3 (identical marking in both Wells) will also be noted.

    [0572] These experiments clearly demonstrate that the BacSia6 virus is capable of complementing Sf9 cells to be able produce 2,6 sialylated glycoproteins.

    Example 20: BacMid Sia6-II Virus

    [0573] We analysed the genome of BacMidSia6II by Southern blot to control its genomic organisation.

    [0574] As shown in FIG. 19B, the restriction profile and the hybridisation profile are compliant with the expected result. The gene of ST6 is thus well integrated in locus pif1.

    Example 21: Use of BacMid Sia3/6

    [0575] 1. Construction of a Recombinant Baculovirus Expressing a Recombinant Alpha 2,3 and Alpha 2,6 Sialylated Protein.

    [0576] The activity of BacSia3-6 was controlled using as model protein the surface glycoprotein of the virus, gp64. To do so, a recombinant virus was obtained by homologous recombination between BacMidSia3/6 and the empty transfer vectors pVTPH and pVT/gp37. The presence of 2,3 sialyl- and 2,6 sialyl-motifs was analysed by lectin blot carried out in the presence of lectin di-CBM40 which recognises 2,3 sialic acids and to a lesser extent 2,6 bound sialic acids and SNA which only recognises 2,6 bound sialic acids and not those which are 2,3 bound.

    [0577] Generation and Cloning of Recombinant Baculoviruses.

    [0578] Sf9 cells were transfected by lipofection with empty pVTPH and pVT/gp37 and DNA of Bacmid2 (control) or BacMid-Sia3/6 obtained in example 15. After 7 days of infection at 28 C., the viruses secreted in the culture supernatant were cloned by the phage plaque assay technique. Four viral clones were selected, amplified and their genome extracted to be analysed by Southern blot. The gene inserted in the viral genome was amplified by PCR then sequenced.

    [0579] Production of Recombinant Proteins

    [0580] The proteins were produced as described in example 17.

    [0581] Analysis of Glycosylation by Lectin Blot

    [0582] The analysis protocols were identical to those described in Examples 20, 21 and 22.

    [0583] 2. Results

    [0584] The gp64 produced by the GalSia3-6 virus is the only one which is recognised both by SNA (FIG. 20B) and by di-CBM40 (FIG. 20C), which clearly demonstrates that the 2 types of sialic acids are bound to gp64.

    [0585] These experiments clearly demonstrate that the BacSia3-6 virus is capable of complementing Sf9 cells to be able to produce 2,3 and 2,6 sialylated glycoproteins.

    REFERENCES

    Patents

    [0586] WO 01/12829

    [0587] WO 2013/005194

    BIBLIOGRAPHIC REFERENCES

    [0588] Palmberger D, Wilson I B, Berger I, Grabherr R, Rendic D. SweetBac: a new approach for the production of mammalianised glycoproteins in insect cells. PLoS One. 2012; 7(4):e34226. [0589] Chang G D, Chen C J, Lin C Y, Chen H C, Chen H. Improvement of glycosylation in insect cells with mammalian glycosyltransferases. J Biotechnol. 2003 Apr. 10; 102(1):61-71. [0590] Possee R D, Hitchman R B, Richards K S, Mann S G, Siaterli E, Nixon C P, Irving H, Assenberg R, Alderton D, Owens R J, King L A. Generation of baculovirus vectors for the high-throughput production of proteins in insect cells. Biotechnol Bioeng. 2008 Dec. 15; 101(6):1115-22. [0591] Tan J, D'Agostaro A F, Bendiak B, Reck F, Sarkar M, Squire J A, Leong P, Schachter H. The human UDP-N-acetylglucosamine: alpha-6-D-mannoside-beta-1,2-N-acetylglucosaminyltransferase II gene (MGAT2). Cloning of genomic DNA, localization to chromosome 14q21, expression in insect cells and purification of the recombinant protein. Eur J Biochem. 1995 Jul. 15; 231(2):317-28. [0592] D'Agostaro G, Bendiak B, Tropak M. Cloning of cDNA encoding the membrane-bound form of bovine beta 1,4-galactosyltransferase. Eur J Biochem. 1989 Jul. 15; 183(1):211-7. [0593] Munster A K, Eckhardt M, Potvin B, Mhlenhoff M, Stanley P, Gerardy-Schahn R. Mammalian cytidine 5-monophosphate N-acetylneuraminic acid synthetase: a nuclear protein with evolutionarily conserved structural motifs. Proc Natl Acad Sci USA. 1998 Aug. 4; 95(16):9140-5. [0594] Lawrence S M, Huddleston K A, Pitts L R, Nguyen N, Lee Y C, Vann W F, Coleman T A, Betenbaugh M J. Cloning and expression of the human N-acetylneuraminic acid phosphate synthase gene with 2-keto-3-deoxy-D-glycero-D-galacto-nononic acid biosynthetic ability. J Biol Chem. 2000 Jun. 9; 275(23):17869-77. [0595] Kitagawa H, Paulson J C. Cloning of a novel alpha 2,3-sialyltransferase that sialylates glycoprotein and glycolipid carbohydrate groups. J Biol Chem. 1994 Jan. 14; 269(2):1394-401. [0596] Grundmann U, Nerlich C, Rein T, Zettlmeissl G. Complete cDNA sequence encoding human beta-galactoside alpha-2,6-sialyltransferase. Nucleic Acids Res. 1990 Feb. 11; 18(3):667. [0597] Cieplik M, Klenk H D, Garten W. Identification and characterization of Spodoptera frugiperda furin: a thermostable subtilisin-like endopeptidase. Biol Chem. 1998 December; 379(12):1433-40. [0598] Juliant S, Lvsque M, Crutti P, Ozil A, Choblet S, Violet M L, Slomianny M C, Harduin-Lepers A, Cerutti M. Engineering the baculovirus genome to produce galactosylated antibodies in lepidopteran cells. Methods Mol Biol. 2013; 988:59-77. [0599] Jarvis D L, Finn E E. Biochemical analysis of the N-glycosylation pathway in baculovirus-infected lepidopteran insect cells. Virology. 1995 Oct. 1; 212(2):500-11. [0600] Ribeiro J P, Pau W, Pifferi C, Renaudet O, Varrot A, Mahal L K, Imberty A. Characterization of a high-affinity sialic acid-specific CBM40 from Clostridium perfringens and engineering of a divalent form. Biochem J. 2016 Jul. 15; 473(14):2109-18