NANOPARTICLES FOR SELECTIVE DEATH OF CANCER CELLS THROUGH FERROPTOSIS, METHOD OF PREPARING THE SAME, AND USE OF THE NANOPARTICLES

20200261498 ยท 2020-08-20

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided are nanoparticles for the selective death of cancer cells through ferroptosis and a method of preparing the same. More particularly, the nanoparticles are in a form in which a cancer cell-targeting hydrogel and iron particles are bound and aggregated, and are selectively accumulated in cancer cells, and thus exhibit an effective cancer cell killing effect through ferroptosis, and accordingly, are expected to exhibit high therapeutic effects due to less side effects.

Claims

1. A method of treating cancer comprising administering a pharmaceutical composition comprising an active ingredient, nanoparticles comprising iron and a cancer cell-targeting hydrogel to a subject in need thereof.

2. The method of claim 1, wherein the nanoparticles are in a form in which an iron cation and an anion of the cancer cell-targeting hydrogel are bound and aggregated.

3. The method of claim 1, wherein the cancer cell-targeting hydrogel comprises any one or more selected from the group consisting of hyaluronic acid, carboxymethyl cellulose, alginates, chitosan, collagen, gelatin, and carboxycellulose.

4. The method of claim 1, wherein the nanoparticles have a diameter of about 50 nm to about 200 nm.

5. The method of claim 1, wherein the nanoparticles induce cancer cell death through ferroptosis.

6. The method of claim 1, wherein the cancer comprises any one or more selected from the group consisting of breast cancer, colorectal cancer, rectal cancer, lung cancer, colon cancer, thyroid cancer, oral cancer, pharyngeal cancer, laryngeal cancer, cervical cancer, brain cancer, ovarian cancer, bladder cancer, kidney cancer, liver cancer, pancreatic cancer, prostate cancer, skin cancer, tongue cancer, uterine cancer, gastric cancer, bone cancer, and blood cancer.

7. A method of preparing nanoparticles comprising an iron and a cancer cell-targeting hydrogel, the method comprising: (a) preparing a hydrogel solution by dissolving a cancer cell-targeting hydrogel; and (b) adding an iron to the hydrogel solution and stirring the resulting solution.

8. The method of claim 7, wherein process (b) is performed using a co-precipitation method.

9. The method of claim 7, wherein process (b) is performed using a pre-gel method.

10. The method of claim 7, wherein process (b) is performed by sequentially adding an aqueous FeCl.sub.24H.sub.2O solution while stirring and adding an aqueous FeCl.sub.26H.sub.2O solution while stirring.

11. The method of claim 7, further comprising separating and purifying the nanoparticles prepared after process (b).

12. The method of claim 7, wherein the cancer cell-targeting hydrogel comprises any one or more selected from the group consisting of hyaluronic acid, carboxymethyl cellulose, alginates, chitosan, collagen, gelatin, and carboxycellulose.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0027] The above and other objects, features and advantages of the present disclosure will become more apparent to those of ordinary skill in the art by describing in detail exemplary embodiments particular with reference to the accompanying drawings, in which:

[0028] FIG. 1A is a schematic view illustrating a mechanism of iron/hyaluronic acid nanoparticles;

[0029] FIG. 1B is a schematic view illustrating a preparation method of iron/hyaluronic acid nanoparticles according to the present disclosure;

[0030] FIG. 2A illustrates the results of measuring the size of iron/hyaluronic acid nanoparticles according to an embodiment of the present disclosure;

[0031] FIG. 2B illustrates the absorption spectrum analysis results of iron/hyaluronic acid nanoparticles according to an embodiment of the present disclosure;

[0032] FIG. 2C illustrates the results of observing iron/hyaluronic acid nanoparticles according to an embodiment of the present disclosure under a scanning electron microscope and a transmission electron microscope;

[0033] FIG. 2D illustrates the results of confirming components included in iron/hyaluronic acid nanoparticles according to an embodiment of the present disclosure by energy dispersive spectroscopy;

[0034] FIG. 2E illustrates the results of confirming bound iron particles in iron/hyaluronic acid nanoparticles according to an embodiment of the present disclosure by X-ray diffraction analysis;

[0035] FIG. 2F illustrates the results of confirming the amount of bound iron particles in iron/hyaluronic acid nanoparticles according to an embodiment of the present disclosure by inductively coupled plasma atomic emission spectroscopy;

[0036] FIG. 2G illustrates the results of confirming the surface charge of iron/hyaluronic acid nanoparticles according to an embodiment of the present disclosure by zeta potential;

[0037] FIG. 2H illustrates the results of confirming the pH stability of iron/hyaluronic acid nanoparticles according to an embodiment of the present disclosure by the size of nanoparticles;

[0038] FIG. 2I illustrates the results of confirming the stability of iron/hyaluronic acid nanoparticles according to an embodiment of the present disclosure by the size of nanoparticles and polydispersity;

[0039] FIG. 3A illustrates the results of confirming the anticancer effect of iron/hyaluronic acid nanoparticles according to an embodiment of the present disclosure in human fibroblasts;

[0040] FIG. 3B illustrates the results of confirming the anticancer effect of iron/hyaluronic acid nanoparticles according to an embodiment of the present disclosure in a human breast cancer cell line;

[0041] FIG. 3C illustrates the results of confirming the anticancer effect of iron/hyaluronic acid nanoparticles according to an embodiment of the present disclosure in a human colon cancer cell line;

[0042] FIG. 3D illustrates the results of confirming the anticancer effect of iron/hyaluronic acid nanoparticles according to an embodiment of the present disclosure in a human lung cancer cell line;

[0043] FIG. 3E illustrates the results of confirming the anticancer effect of iron/hyaluronic acid nanoparticles according to an embodiment of the present disclosure in a human ovarian cancer cell line;

[0044] FIG. 4 illustrates the results of confirming the anticancer effect of iron/hyaluronic acid nanoparticles according to an embodiment of the present disclosure using a live/dead viability/cytotoxicity kit, wherein scale bars indicate 100 m;

[0045] FIG. 5A illustrates the effect of iron/hyaluronic acid nanoparticles according to an embodiment of the present disclosure on the secretion of reactive oxygen species using a microscope;

[0046] FIG. 5B illustrates the results of quantifying fluorescence values of images acquired using the microscope;

[0047] FIG. 6 illustrates the results of confirming the cell death mechanism of iron/hyaluronic acid nanoparticles according to an embodiment of the present disclosure by real time-polymerase chain reaction (RT-PCR), wherein * denotes P<0.05, ** denotes P<0.01, *** denotes P<0.001;

[0048] FIG. 7A illustrates the results of confirming the optimal concentrations of compounds for inhibition assay according to an embodiment of the present disclosure, wherein * denotes P<0.05, ** denotes P<0.01, *** denotes P<0.001;

[0049] FIG. 7B illustrates the results of confirming the cell death mechanism of iron/hyaluronic acid nanoparticles according to an embodiment of the present disclosure by inhibition assay;

[0050] FIG. 8 illustrates the results of confirming whether iron particles of iron/hyaluronic acid nanoparticles according to an embodiment of the present disclosure migrate into cells by Prussian blue staining;

[0051] FIG. 9 illustrates the results of measuring a change in tumor volume according to treatment with iron/hyaluronic acid nanoparticles according to an embodiment of the present disclosure, wherein * denotes P<0.05, ** denotes P<0.01, *** denotes P<0.001;

[0052] FIG. 10A illustrates the results of photographing changes in tumor volume according to treatment with iron/hyaluronic acid nanoparticles according to an embodiment of the present disclosure, and FIG. 10B illustrates the results of measuring the weights of acquired tumors, wherein * denotes P<0.05, ** denotes P<0.01, *** denotes P<0.001;

[0053] FIG. 11 illustrates the results of confirming the accumulation of iron/hyaluronic acid nanoparticles according to an embodiment of the present disclosure in cancer cells by MRI; and

[0054] FIG. 12 illustrates the results of confirming the cancer cell killing effect of iron/hyaluronic acid nanoparticles according to an embodiment of the present disclosure by H&E staining, wherein scale bars indicate 50 m, and the right views are enlarged views of box portions shown in the left views.

DETAILED DESCRIPTION OF EXEMPLARY EMBODIMENTS

[0055] Reference will now be made in detail to embodiments, examples of which are illustrated in the accompanying drawings, wherein like reference numerals refer to like elements throughout. In this regard, the present embodiments may have different forms and should not be construed as being limited to the descriptions set forth herein. Accordingly, the embodiments are merely described below, by referring to the figures, to explain aspects.

[0056] As a result of having conducted intensive studies on nanoparticles exhibiting low toxicity in normal cells and inducing cell death through cancer cell-specific ferroptosis, the inventors of the present disclosure confirmed that nanoparticles consisting of iron particles and a hydrogel are specifically delivered to increase the concentration of iron ion inside a cancer cell, thereby exhibiting a cancer cell killing effect through ferroptosis.

[0057] The term prevention as used herein means all actions that inhibit diseases such as cancer or delay the onset thereof via administration of a composition according to the present disclosure.

[0058] The term treatment as used herein means all actions that alleviate or beneficially change symptoms due to cancer or the like via administration of a concentration according to the present disclosure.

[0059] The term individual as used herein refers to a subject to which the composition of the present disclosure may be administered, but the subject is not limited.

[0060] In the present specification, the pharmaceutical composition may be in the form of capsules, tablets, granules, an injection, an ointment, powder, or a beverage, and the pharmaceutical composition may be used for humans. The pharmaceutical composition is not limited to the above examples, and may be formulated in the form of oral preparations such as powder, granules, capsules, tablets, an aqueous suspension, and the like, preparations for external application, suppositories, and sterile injection solutions, according to general methods. The pharmaceutical composition of the present disclosure may include a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier may be a binder, a lubricant, a disintegrant, an excipient, a solubilizing agent, a dispersant, a stabilizer, a suspension agent, a pigment, a flavoring, or the like in the case of oral administration, may be used in combination with a buffer, a preservative, an analgesic agent, a solubilizer, an isotonic agent, a stabilizer, or the like in the case of injections, and may be a base, an excipient, a lubricant, a preservative, or the like in the case of topical administration. Preparations of the pharmaceutical composition of the present disclosure may be formulated in a variety of ways by mixing with the above-described pharmaceutically acceptable carrier(s). For example, preparations for oral administration may be formulated in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, or the like, and preparations for injections may be formulated in unit dosage ampoules or in multiple dosage form. In addition, preparations of the pharmaceutical composition may be formulated in the form of solutions, suspensions, tablets, capsules, sustained release type preparations, or the like.

[0061] Meanwhile, examples of suitable carriers, excipients and diluents for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginates, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, micro-crystalline cellulose, polyvinylpyrrolidone, water, methylhydroxy benzoate, propylhydroxy benzoate, talc, magnesium stearate, mineral oil, and the like. In addition, the pharmaceutical composition may further include a filler, an anti-coagulant, a lubricant, a wetting agent, a flavoring, an emulsifier, a preservative, or the like.

[0062] Administration routes of the pharmaceutical composition according to the present disclosure include, but are not limited to, oral administration, intravenous administration, intramuscular administration, intraarterial administration, intramedullary administration, intradural administration, intracardiac administration, transdermal administration, subcutaneous administration, intraperitoneal administration, intranasal administration, intestinal administration, topical administration, sublingual administration, and rectal administration. The pharmaceutical composition may be administered orally or parenterally. The term parenteral as used herein is intended to include subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intrabursal, intrasternal, intradural, intralesional, and intracranial injections or injection techniques. The pharmaceutical composition of the present disclosure may also be administered in the form of a suppository for rectal administration.

[0063] The pharmaceutical composition of the present disclosure may vary depending on various factors including the activity of the used specific compound, age, body weight, general health, gender, diet, administration time, administration route, drug combination, and the severity of a particular disease to be prevented or treated, and a dosage of the pharmaceutical composition varies according to the condition and body weight of a patient, the severity of disease, drug form, administration route, and administration period, but may be appropriately selected by one of ordinary skill, and may range from about 0.0001 mg/kg/day to about 50 mg/kg/day or about 0.001 mg/kg/day to about 50 mg/kg/day. The pharmaceutical composition may be administered once or multiple times a day. The dosage is not intended to limit the scope of the present disclosure in any way. The pharmaceutical composition according to the present disclosure may be formulated into pills, sugar-coated tablets, capsules, a liquid, a gel, a syrup, a slurry, or a suspension.

[0064] Hereinafter, examples will be described to aid in understanding of the present disclosure. However, the following examples are provided only to facilitate the understanding of the present disclosure and are not intended to limit the scope of the present disclosure.

EXAMPLES

Example 1

Preparation of Iron/Hyaluronic Acid Nanoparticles

[0065] 5 mg of sodium hyaluronate was added to 50 mL of deionized water (DI) and stirred until hyaluronic acid was completely dissolved. 10 mL of deionized water to which 99.4 mg of FeCl.sub.24H.sub.2O was added to the solution in which hyaluronic acid was dissolved at a rate of 1 mL/min and stirred for 30 minutes, and then 10 mL of deionized water to which 149.1 mg of FeCl.sub.26H.sub.2O was added was added thereto at a rate of 1 mL/min and stirred for 1 hour. After adjusting the pH of the solution to 10 by adding 1.5 M ammonia water and stirring the solution for 30 minutes, a product was separated from the solution using a strong neodymium magnet. The separated product was washed several times with deionized water, and then impurities were cleanly removed by using a water sonicator and redispersed in 50 mL of 0.005 M HCl. The dispersed nanoparticles were purified by dialysis (MWCO 3.5K) for 24 hours to prepare Fe/hyaluronic acid nanoparticles (FHA NPs). The prepared FHA NPs were stored at 4 C.

[0066] A cancer cell killing mechanism of the FHA NPs is illustrated in FIG. 1A, and a method of preparing the nanoparticles is schematically illustrated in FIG. 1B. As illustrated in FIG. 1B, the FHA NPs according to the present disclosure are prepared such that, when mixing hyaluronic acid nanoparticles with a divalent Fe ion and a trivalent Fe ion to allow a reaction to occur therebetween, an Fe cation and a carboxyl group (COO.sup.) of hyaluronic acid are bound and aggregated, thereby forming a nano-sized conjugate.

Example 2

Analysis of FHA NPs

2.1. Size Analysis of FHA NPs

[0067] The size of the FHA NPs prepared in the same manner as in Example 1 was measured using dynamic light scattering (DLS). More specifically, the concentration of hyaluronic acid (HA) was adjusted to 0.005 wt %, 0.01 wt %, 0.05 wt %, or 0.5 wt % and FHA NPs were prepared using each concentration of HA, and the size of the prepared nanoparticles was measured using Zetasizer Nano ZS 3600 (Malvern Instruments). The results thereof are shown in FIG. 2A.

[0068] As shown in FIG. 2A, it was confirmed that the size of the nanoparticles prepared according to the concentration of HA was adjusted, and 0.01 wt % of HA was selected to prepare nanoparticles having an average diameter of 105.7 mm and a standard deviation of 13.3 nm, and then a subsequent experiment was conducted. The FHA NPs according to the present disclosure had an average diameter of 100 nm, and not only exhibited active targeting for CD44, but also exhibited a passive targeting effect through enhanced permeability and retention (EPR), from which it was confirmed that the FHA NPs were able to significantly enhance cancer cell-specific delivery capability.

2.2. Absorption Spectrum Analysis of FHA NPs

[0069] To analyze the electronic structural properties of the FHA NPs, an UV-visible absorption spectrum was measured using a microplate reader (Synergy H1, Hybrid reader, Bio Tek). More specifically, FHA NPs prepared in the same manner as in Example 1 were diluted to a concentration of 6.25 g/mL, 12.5 g/mL, 25 g/mL, 50 g/mL, 100 g/mL, or 200 g/mL and the absorption spectrum of each case was measured, and absorption spectra of HA, FeCl.sub.2, and FeCl.sub.3, which were used in the preparation of nanoparticles, as controls, were also measured. The results thereof are illustrated in FIG. 2B.

[0070] As shown in FIG. 2B, it was confirmed that the absorption value at each wavelength changes as the concentration of nanoparticles is increased. It was also confirmed that the absorption spectrum of the FHA NPs was different from the absorption spectrum of FeCl.sub.2 or FeCl.sub.3 used as the raw material.

2.3. Morphology and Surface Analysis of FHA NPs

[0071] The morphology of the FHA NPs was observed using an energy-filtering transmission electron microscope (TEM, LIBRA 120, Carl Zeiss) operating at an acceleration voltage of 120 kV, and the surfaces of the nanoparticles were observed using a field emission scanning electron microscope (FE-SEM, JSM-7800F Prime, JEOL Ltd.). More specifically, 5 L of 0.1 wt % nanoparticles prepared in the same manner as in Example 1 was placed on silver foil, dried in a vacuum chamber, and coated with platinum for observation using a SEM, and for TEM observation, 5 L of 0.1 wt % nanoparticles was placed on a TEM grid made of mesh copper, and then dried in a vacuum chamber and observed. Images acquired using a SEM and a TEM are shown in FIG. 2C.

[0072] As shown in FIG. 2C, it was confirmed that spherical nanoparticles having an average diameter of 100 nm were normally prepared.

[0073] In addition, the samples observed with a TEM were subjected to Energy Dispersive Spectrometry (EDS) to identify components included in the FHA NPs. The results thereof are shown in FIG. 2D.

[0074] As illustrated in FIG. 2D, iron components were observed in addition to TEM grid components. From the above results, it was confirmed that iron was bonded in the FHA NPs.

2.4. Iron Particle Analysis of FHA NPs

[0075] To confirm the state of bound iron particles in the FHA NPs, the FHA NPs were analyzed by X-ray diffraction (XRD) analysis using an X-ray diffractometer (Rigaku, SmartLab). Hyaluronic acid was used as a control. The results thereof are shown in FIG. 2E.

[0076] As illustrated in FIG. 2E, it was confirmed that the intensity shown at nanoparticle 2-theta values of 30.3, 35.8, 43.5, 53.9, 57.3, and 62.8 was consistent with Fe.sub.3O.sub.4. From the above result, it was confirmed that iron bound in the FHA NPs was Fe.sub.3O.sub.4.

[0077] In addition, the amount of iron particles bound in the FHA NPs was measured using an inductively coupled plasma-atomic emission spectroscope (ICP-AES, Optima 8300, Perkin-Elmer). The results thereof are shown in FIG. 2F.

[0078] As illustrated in FIG. 2F, it was confirmed that the amount of iron bound in the nanoparticles increased in proportion to the concentration of the FHA NPs, and a significant linear result of y=0.2919x+0.737 was shown. From the above results, it was confirmed that Fe.sub.3O.sub.4 was bound, at a uniform concentration, to hyaluronic acid particles of the FHA NPs prepared using the method of Example 1.

2.5. Surface Charge Measurement of FHA NPs

[0079] The surface charge of the FHA NPs was confirmed by measuring zeta potential. More specifically, 8 mg/mL of the FHA NPs were diluted 50-fold in 1 mL of a 0.005 M HCl solution with pH of 4, 1 mL of phosphate buffered saline (PBS) with pH of 7, or 1 mL of 0.005 M NaOH with pH of 10 to prepare samples, and the zeta potential of each sample was measured using the Zetasizer Nano ZS (Malvern Instruments), and an average value was calculated after three repeated measurements for each sample. The results thereof are shown in FIG. 2G.

[0080] As illustrated in FIG. 2G, it was confirmed that a zeta potential of 30.59 mV and a standard deviation of 1.92 mV were shown at pH 4, a zeta potential of 16.1 mV and a standard deviation of 0.77 mV were shown at pH 7, and a zeta potential of 8.17 mV and a standard deviation of 1.29 mV were shown at pH 10. The zeta potential value is changed by binding due to the interaction between materials included in a nanostructure, and when the zeta potential is low, phenomena such as Ostwald ripening are prevented due to an increase in increased repulsion of particles so that stable nanoparticles that do not aggregate can be maintained. Thus, it was confirmed that the FHA NPs according to the present disclosure having a zeta potential of 30 mV were able to be stably present in a homogeneous state.

2.6. Stability Confirmation of FHA NPs

[0081] To primarily confirm the pH stability of the FHA NPs, the FHA NPs were diluted 50-fold in 3 mL of a 0.005 M HCl solution with pH of 4, 3 mL of PBS with pH of 7, or 3 mL of 0.005 M NaOH with pH of 10 to prepare samples, and the size of the nanoparticles was measured using the same method as that used in Example 2.1. The results thereof are shown in FIG. 2H.

[0082] As shown in FIG. 2H, the average diameter of the nanoparticles at pH 4 was maintained at 100 nm, whereas the diameter of the particles at pH 7 was significantly increased. In addition, the average particle of the nanoparticles at pH 10 was 150 nm, but the size distribution increased, from which it was confirmed that the stability of the nanoparticles was reduced. From the above results, it was confirmed that the FHA NPs could be stably stored in a 0.005 M HCl solution at pH 4.

[0083] To confirm whether the stability of the FHA NPs is maintained even during long-term storage, the nanoparticles added to a 0.005 M HCl solution with pH of 4 were stored for 180 days, and the diameter and polydispersity of the nanoparticles were investigated. The polydispersity was identified using a polydispersity index (PDI). The results thereof are shown in FIG. 2I.

[0084] As illustrated in FIG. 2I, it was confirmed that there was no significant change in the diameter and polydispersity of the FHA NPs for 180 days. From the above result, it was confirmed that the stability of the FHA NPs according to the present disclosure was maintained even during long-term storage.

[0085] From the above results, it was confirmed that, in the FHA NPs prepared using the method of Example 1, iron particles of Fe3O4 were uniformly bound to hyaluronic acid nanoparticles having an average diameter of 100 nm, and the FHA NPs exhibited excellent stability.

Example 3

Confirmation of Anticancer Effect of FHA NPs

[0086] 3.1. Confirmation of Anticancer Effect through CCK-8 Assay

[0087] To confirm the anticancer effect of the FHA NPs prepared using the same method as that used in Example 1, various kinds of cell lines were treated with the nanoparticles and cell viability was measured through CCK-8 assay. For use in experiments, human fibroblast cells (HFB), human breast adenocarcinoma cells (MCF7), human colon carcinoma cells (HCT116), human lung carcinoma cells (A549), and human ovarian cancer cells were purchased from the Korean Cell Line Bank, and the human fibroblasts were cultured in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin, and the cancer cell lines were cultured in RPMI 1640 supplemented with 10% FBS and 1% penicillin/streptomycin. To confirm cytotoxicity, the cell lines were added onto a 96-well plate at a density of 110.sup.4 cells per well and cultured for 24 hours. Then, the cultured cells were washed once with Dulbecco's PBS (DPBS) and treated with 6.25 g/mL, 12.5 g/mL, 25 g/mL, 50 g/mL, 100 g/mL, or 200 g/mL of an FHA NP suspension diluted with a serum-free medium, and after incubation at 37 C. for 1 hour, 3 hours, 6 hours, or 12 hours, 10 mL of a CCK-8 solution included in a cell counting kit-8 (CCK-8, EZ-Cytox, DoGen) was added to each well, followed by further incubation for 3 hours. Then, optical density (OD) at 450 nm of each well was measured using a microplate reader (Synergy H1, Hybrid reader, Bio Tek). Cell viability was calculated by substituting the measured OD values into the following equation. In the following equation, experiment denotes cells treated with the FHA NPs, and control denotes cells that were not treated with the FHA NPs. The results thereof are shown in FIGS. 3A to 3D.

[00001] Cell .Math. .Math. viability ( % ) = OD ( experiment ) - OD ( blank ) OD ( control ) - OD ( blank ) 100

[0088] As illustrated in FIG. 3A, it was confirmed that cell death was not induced in human fibroblasts, which are a normal cell line, even by treatment with a high concentration of 200 g/mL of the FHA NPs. In contrast, as illustrated in FIGS. 3B to 3E, it was confirmed that, the greater the concentration of the FHA NPs in cancer cells and the longer the treatment time, the greater the cell death.

3.2. Confirmation of Anticancer Effect Using Live/Dead Viability/Cytotoxicity Kit

[0089] To reconfirm the anticancer effect of the FHA NPs prepared using the same method as that used in Example 1, the degree of cell death was examined using a Live/Dead viability/cytotoxicity kit (Invitrogen). More specifically, the cells treated with the FHA NPs in the same manner as in Example 3.1 were cultured for 12 hours, and then washed three times with a phosphate buffer solution. Then, the cells were treated with 2 mM Calcein AM and 4 M ethidium homodimer-1 (ethyl-D) and a reaction was allowed to occur therebetween for 30 minutes. Thereafter, the cells were observed using a laser scanning microscope (Carl Zeiss). The results thereof are shown in FIG. 4.

[0090] As shown in FIG. 4, through no red fluorescence being observed, it was confirmed that cell death was not induced in the fibroblasts, which are a normal cell line. In contrast, it was confirmed that, as the concentration of the treated FHA NPs increased, red fluorescence significantly increased in cancer cells.

[0091] From the above results, it was confirmed that the FHA NPs according to the present disclosure did not exhibit cytotoxicity in normal cells, while exhibiting a selective anticancer effect in cancer cells.

Example 4

Identification of Effect of FHA NPs on Secretion of Reactive Oxygen Species

[0092] To confirm the effect of the FHA NPs on the secretion of reactive oxygen species in cancer cells, cells treated with the FHA NPs in the same manner as in Example 3.1 were cultured for 12 hours, and then washed three times with a phosphate buffer solution. Subsequently, the cells were treated with 300 L of a CellROX orange oxidative stress reagent (Invitrogen) and incubated at 37 C. for 30 minutes, and then treated with 4,6-diamidino-2-phenylindole (DAPI, Sigma Aldrich) and further incubated for 5 minutes. Then, fluorescence was observed using a laser scanning microscope (Carl Zeiss), and red fluorescence images acquired through the microscope were quantified using FCS Express V3 software (De Novo Software). The results thereof are shown in FIGS. 5A and 5B.

[0093] As illustrated in FIG. 5A, it was confirmed that, while only the nuclei of blue fluorescence stained with DAPI were observed in fibroblasts, which are a normal cell line, red fluorescence, which indicates reactive oxygen species, was observed in the vicinity of the nuclei in cancer cell lines. It was also confirmed as illustrated in FIG. 5B that, as the concentration of the treated FHA NPs increased, red fluorescence values which indicate reactive oxygen species significantly increased. From the above results, it was confirmed that the FHA NPs increased the content of intracellular reactive oxygen species in cancer cells specifically.

Example 5

Confirmation of Cell Death Mechanism of FHA NPs

5.1. Confirmation of Cell Death Mechanism Using Real Time-Polymerase Chain Reaction (RT-PCR)

[0094] RT-PCR was performed to confirm the cell death mechanism of the FHA NPs. More specifically, cells treated with 200 g/mL of the FHA NPs in the same manner as in Example 3.1 were cultured for 12 hours, and then washed three times using a phosphate buffer solution. Subsequently, total RNA was isolated from the cells using TRIzol, and cDNA was synthesized using a cDNA synthesis kit (Maxime RT PreMix, Intron) using the isolated RNA as a template. Then, RT-PCR was performed in QuantStudio5 Real-Time PCR System (Applied Biosystems) using RealMOD Green SF 2X qPCR Mix (Intron). RT-PCR was performed at 95 C. for 10 minutes, and then the cycle of 95 C. for 15 seconds, 60 C. for 30 seconds, and 72 C. for 5 minutes was repeated 40 times, and the sequences of primers used in RT-PCR are shown in Table 1 below. The expression of the BCL2 associated X (BAX) gene was confirmed as a marker of apoptosis, the expression of the receptor-interacting serine/threonine-protein kinase 1 (RIPK1) gene was identified as a marker of necrosis, and the expression of the glutathione peroxidase 4 (GPX4) gene, which is a negative gene, was confirmed as a marker of ferroptosis. Each mRNA expression amount was quantified by the CT method compared to the expression level of -actin as a control, and the results thereof are shown in FIG. 6.

TABLE-US-00001 TABLE1 SEQ Primersequence ID Gene (5.fwdarw.3) NO: Bax ForwardPrimer: 1 AGGCGGCGGGCCCACCAGCTC ReversePrimer: 2 CATCAGCAAACATGTCAGCTG Ripk1 ForwardPrimer: 3 GGCATTGAAGAAAAATTTAGGC ReversePrimer: 4 TCACAACTGCATTTTCGTTTG GPX4 ForwardPrimer: 5 ACAAGAACGGCTGCGTGGTGAA ReversePrimer: 6 GCCACACACTTGTGGAGCTAGA -actin ForwardPrimer: 7 GTGGGCCGCTCTAGGCACCAA ReversePrimer: 8 CTTTAGCACGCACTGTAGTTTCTC

[0095] As illustrated in FIG. 6, it was confirmed that the apoptosis- or necrosis-related gene did not exhibit a significant difference in expression, but in the case of the GPX4 gene, which is a ferroptosis-related gene, gene expression was significantly reduced in cells treated with the FHA NPs. From the above results, it was confirmed that the FHA NPs according to the present disclosure induced the death of cancer cells through ferroptosis.

5.2. Confirmation of Cell Death Mechanism Using Inhibition Assay

[0096] To reconfirm whether the FHA NPs have a cancer cell killing effect through ferroptosis, inhibition assay was performed. It is known that -tocopherol, which is known as vitamin E, and Ferrostatin-1 inhibit lipid peroxidation and thus inhibit cell death, while RSL3 inactivates GPX4 to increase the expression of reactive oxygen species, thereby promoting lipid peroxidation to induce cell death. First, to confirm the effective concentration of each compound, cell viability was measured in the same manner as in Example 3.1. More specifically, cells were treated with 200 g/mL of the FHA NPs and each compound according to various concentrations and incubated for 12 hours, and then cell viability was measured using CCK-8. The results thereof are shown in FIG. 7A.

[0097] As illustrated in FIG. 7A, it was confirmed that ferrostatin-1 and vitamin E increased cell viability, whereas RSL3 reduced cell viability. The red dot at the left top of each graph denotes the viability of a control that was not treated with the FHA NPs. Through the above results, a subsequent experiment was carried out using ferrostatin-1 at a concentration of 4 g/mL, vitamin E at a concentration of 100 g/mL, and RSL3 at a concentration of 1 g/mL.

[0098] Each cell line was treated with a combination of 200 g/mL of the FHA NPs and each compound and incubated for 12 hours, and then cell viability was measured using CCK-8. Assuming that the viability of an experimental group treated with the FHA NPs alone is 100%, the viabilities of the other experimental groups were calculated. The results thereof are shown in FIG. 7B.

[0099] As illustrated in FIG. 7B, it was confirmed that, in cancer cell lines, cell viability was reduced in an experimental group treated with RSL3 alone, whereas cell viability was increased in an experimental group treated with both ferrostatin-1 and vitamin E. It was also confirmed that cell viability was significantly changed through an increase or decrease of the drugs.

[0100] From the above results, it was confirmed that the FHA NPs according to the present disclosure induced selective cancer cell death through ferroptosis.

Example 6

Confirmation of Iron Particle Migration of FHA NPs

[0101] To confirm whether iron particles of the FHA NPs migrate into cells, Prussian blue staining was performed. Prussian blue chelates iron ions when iron is contained in cells, thus showing a blue color. For Prussian blue staining, cells were treated with the FHA NPs in the same manner as in Example 3.1 and incubated for 12 hours. The cells were fixed by treatment with 4% paraformaldehyde and a reaction therebetween for 15 minutes, and the fixed cells were treated with 5 wt % Prussian blue (C.sub.6Fe.sub.2KN.sub.6.Math.H.sub.2O) (Sigma Aldrich) and 10% HCl and a reaction was allowed to occur for 30 minutes for staining. After washing three times with a phosphate buffer solution, the cells were stained with nuclear fast red (TCI) for 5 minutes, and washed again three times with a phosphate buffer solution. The washed cells were sequentially dehydrated using 10%, 90%, and 100% alcohol, and then treated with mounting medium and observed under a microscope. The results thereof are shown in FIG. 8.

[0102] As shown in FIG. 8, it was confirmed that, in the case of cancer cells, the amount of nanoparticles introduced into the cells was significantly increased according to the concentration of nanoparticles when treated with the FHA NPs, and the shape of the cells was not maintained such that a large number of cells whose cell membranes were broken by lipid peroxidation and cells whose forms were destroyed were observed. In contrast, it was confirmed that, in the case of normal cells, when treated with a high concentration of the FHA NPs, the nanoparticles could be partially introduced into the cells, but the shape of the cells was maintained the same. This was confirmed to be due to the fact that, in the case of normal cells, even though the FHA NPs were introduced into the cells, the expression of a receptor for releasing iron to the outside is normally operated, and thus the FHA NPs introduced into the cells are normally released to the outside, thus not inducing ferroptosis. From the above results, it was confirmed that the FHA NPs according to the present disclosure induced cancer cell-specific ferroptosis to induce the death of cancer cells.

Example 7

Confirmation of Anticancer Effect of FHA NPs

7.1. Confirmation of Tumor Growth Inhibitory Effect of FHA NPs

[0103] To determine whether the FHA NPs exhibit a tumor growth inhibitory effect in vivo, primary tumor animal models were prepared. More specifically, 4- to 5-week-old male sterile Balb/c mice (Dooyeol Biotech, Inc.) were purchased, were allowed to drink/eat adequate water and food, and subjected to an adaptation period in which the conditions of 251 C. and 12 hour light/dark cycles were maintained. Then, 2.510.sup.6 of A549 cells, which are a human lung cancer cell line, were subcutaneously injected into the left and right legs of each mouse, and then when the tumor size reached 450 mm.sup.3, the FHA NPs were injected into each mouse at a concentration of 8 mg/kg every 24 hours using a peritumoral injection method, and the volume size was measured at intervals of 2 days or 3 days. For tumor size measurement, the length and width of tumors were measured using a caliper and substituted into the following equation, and a phosphate buffer solution was used as a control instead of the FHA NPs and injected in the same manner as described above. All animal studies were conducted in accordance with the Institutional Animal Care and Use Committee (IACUC) guidelines. The results thereof are shown in FIG. 9.

[00002] V = Width 2 Length 2

[0104] As illustrated in FIG. 9, it was confirmed that the control injected with a phosphate buffer solution exhibited a significant increase in tumor size to 1500210 mm.sup.3 over time, whereas the tumor size was gradually reduced and significantly reduced to the size of 3223 mm.sup.3 in the case of the experimental group treated with the FHA NPs.

[0105] In addition, some of the mice on which the same experiment was conducted were euthanized at 0 hours, 12 hours, 24 hours, day 3, day 7, day 14, and day 21, and then tumors were obtained therefrom and the weights of the tumors were measured. The results thereof are shown in FIG. 10.

[0106] As illustrated in FIG. 10, it was confirmed that the control into which a phosphate buffer solution was injected exhibited an increase in tumor weight from 0.35 g to 1.4 g, whereas the experimental group into which the FHA NPs were injected exhibited a significant decrease in tumor weight from 0.35 g to 0.03 g.

[0107] From the above results, it was confirmed that the FHA NPs according to the present disclosure not only effectively inhibited tumor growth in vivo, but also exhibited a tumor therapeutic effect through cancer cell death.

7.2. Confirmation of Accumulation of FHA NPs in Cancer Tissue

[0108] It was examined by MRI whether the FHA NPs were normally accumulated only in cancer tissue in vivo. More specifically, the FHA NPs were injected into tumor animal models produced in the same manner as in Example 7.1 at a concentration of 8 mg/kg every 24 hours using a peritumoral injection method, and after 14 days, all tumors and normal tissues of the heart, spleen, liver, kidneys, and lungs were observed by MRI. MRI was performed using a Bruker Biospec 7T system (BioSpec 70/20 USR) using a 35 mm quadrature coil, and scanning parameters were identified as TR=200 ms, TE=10 ms, and a slice thickness of 1 mm. The results thereof are shown in FIG. 11.

[0109] As illustrated in FIG. 11, it was confirmed that, while no iron particles were observed in the heart, spleen, liver, kidneys, and lungs, a high concentration of iron particles were observed in tumor tissues of the experimental group into which the FHA NPs were injected. From the above results, it was confirmed that the FHA NPs according to the present disclosure did not affect other organs and exhibited a cancer tissue-specific effect.

7.3. Confirmation of Cancer Cell Killing Effect in Tumor Tissue of FHA NPs

[0110] To determine whether the FHA NPs exhibit a cancer cell killing effect in tumor tissue in vivo, histological analysis was performed. More specifically, tumor tissue obtained in the same manner as in Example 7.1 was fixed with 3.7% formaldehyde for 12 hours and stained by H&E staining. The results thereof are shown in FIG. 12.

[0111] As illustrated in FIG. 12, it was confirmed that, while no cell death was induced in the control into which a phosphate buffer solution was injected, and thus the nuclei of tumors was uniformly distributed, cell death was induced in tumor tissues of the experimental group into which the FHA NPs were injected and thus the number of nuclei was significantly reduced. From the above results, it was confirmed that the FHA NPs according to the present disclosure effectively exhibited a cancer cell killing effect in tumor tissue even in vivo.

[0112] From the above results, it was confirmed that the FHA NPs according to the present disclosure had a structure in which iron particles of Fe.sub.3O.sub.4 were uniformly bound to hyaluronic acid nanoparticles having an average diameter of 100 nm, and had excellent stability, thus enabling long-term stable storage. In addition, the FHA NPs do not affect normal cells or normal tissues, and are selectively accumulated in cells of cancer tissue to increase the concentration of iron particles in cancer cells and ROS, thereby inducing the selective death of cancer cells through ferroptosis, and thus exhibit a high cancer therapeutic effect due to less side effects, and accordingly, are expected to be effectively used for the treatment of various cancers.

[0113] As is apparent from the foregoing description, iron/hydrogel nanoparticles according to the present disclosure are harmless components included in the body, and are prepared only using iron and hydrogel particles without additional components, and thus can be stably used without toxicity. In addition, the iron/hydrogel nanoparticles of the present disclosure can be prepared using a simple method, and thus not only can be mass-produced, but also have high stability and thus enable long-term stable storage without aggregation, and accordingly, are a pharmaceutically superior preparation. In addition, the iron/hydrogel nanoparticles according to the present disclosure are specifically accumulated in cancer cells of cancer tissue, and the nanoparticles accumulated in cancer cells effectively induce cancer cell death through ferroptosis, and thus are expected to exhibit less side effects and high therapeutic effects in the treatment of various cancers.

[0114] The foregoing description of the present disclosure is provided for illustrative purposes only, and it will be understood by those of ordinary skill in the art to which the present disclosure pertains that the present disclosure may be easily modified into other particular forms without changing the technical spirit or essential characteristics of the present disclosure. Thus, the above-described embodiments should be construed as being provided for illustrative purposes only and not for purposes of limitation.