DIAGNOSTIC MARKERS FOR BOVINE TUBERCULOSIS AND USES THEREOF
20200264193 ยท 2020-08-20
Assignee
Inventors
- Ting XIN (Beijing, CN)
- HONG JIA (Beijing, CN)
- XINTAO GAO (BEIJING, CN)
- Xiaoyu GUO (Beijing, CN)
- Yitong JIANG (Beijing, CN)
- Hongfei ZHU (Beijing, CN)
- Shaohua HOU (Beijing, CN)
- WEIDONG LIN (BEIJING, CN)
Cpc classification
G01N2800/52
PHYSICS
International classification
Abstract
The present invention provides diagnostic markers for Bovine tuberculosis and uses thereof. In the present invention, markers capable of differentiating Bovine tuberculosis negative or positive are obtained by screening with untargeted proteomic techniques and verifying with targeted proteomic techniques, which are IL-8, CRP. The diagnostic markers for Bovine tuberculosis provided in the present invention can identify whether the cattles to test are Bovine tuberculosis negative or positive, and whether positive tuberculosis cattles are at discharge period of bacteria. The diagnostic markers can be used in the preparation of kits or reagents for detecting Bovine tuberculosis, thus providing new detection targets for the diagnosis of Bovine tuberculosis, which is helpful to the prompt detection and elimination of tuberculosis cattles, also ensuring the comprehensive prevention and control of Bovine tuberculosis.
Claims
1. Diagnostic markers for Bovine tuberculosis, which are IL-8 and/or CRP.
2. A use of the diagnostic markers according to claim 1 in the preparation of diagnostic kits for Bovine tuberculosis.
3. The use according to claim 2, wherein when the concentration of IL-8 in plasma is 42 ng/ml, it is determined as Bovine tuberculosis positive; after PPD-B stimulation, when the concentration of IL-8 in plasma is <42 ng/ml, it is determined as Bovine tuberculosis negative.
4. The use according to claim 2, wherein when the concentration of IL-8 in plasma is greater than five times of that in tuberculosis negative cattles, it is determined as Bovine tuberculosis positive.
5. A use of the diagnostic markers according to claim 1 in the preparation of diagnostic kits for tuberculosis cattles at the discharge period of bacteria and tuberculosis cattles not at the discharge period of bacteria.
6. The use according to claim 5, wherein when the concentration of IL-8 in plasma is 42 ng/ml, it is determined as tuberculosis positive; when the concentration of IL-8 in plasma is <42 ng/ml, it is determined as tuberculosis negative; when the concentration of CRP in plasma is 790 ng/ml, it is determined as tuberculosis positive cattles at the discharge period of bacteria, when the concentration of CRP in plasma is <790 ng/ml, it is determined as cattles not at the discharge period of bacteria; when the concentration of IL-8 in plasma is 42 ng/ml, and the concentration of CRP in plasma is <790 ng/ml, it is determined as tuberculosis positive cattles not at the discharge period of bacteria.
7. The use according to claim 5, wherein the concentration of CRP in the plasma of tuberculosis cattles at the discharge period of bacteria is greater than 3 times of that in tuberculosis cattles not at the discharge period of bacteria and that in negative cattles.
8. The use according to claim 2, wherein the kits are ELISA kits.
9. The use according to claim 8, wherein the ELISA kits further contain stimulus, the stimulus is bovine tuberculin, avine tuberculin, CFP-10, ESAT-6 or PBS.
10. A diagnostic kit for tuberculosis cattles at the discharge period of bacteria and tuberculosis cattles not at the discharge period of bacteria, which contains detection reagents for detecting the expression level of IL-8 and/or CRP.
11. The use according to claim 4, wherein the kits are ELISA kits.
12. The use according to claim 6, wherein the kits are ELISA kits.
13. A use of the reagents for detecting the diagnostic markers according to claim 1 in the preparation of diagnostic kits for Bovine tuberculosis.
14. The use according to claim 13, wherein the kits are ELISA kits.
15. The use according to claim 13, wherein when the concentration of IL-8 in plasma is 42 ng/ml, it is determined as Bovine tuberculosis positive; after PPD-B stimulation, when the concentration of IL-8 in plasma is <42 ng/ml, it is determined as Bovine tuberculosis negative.
16. The use according to claim 15, wherein the kits are ELISA kits.
17. The use according to claim 13, wherein when the concentration of IL-8 in plasma is greater than five times of that in tuberculosis negative cattles, it is determined as Bovine tuberculosis positive.
18. A use of the reagents for detecting the diagnostic markers according to claim 1 in the preparation of diagnostic kits for tuberculosis cattles at the discharge period of bacteria and tuberculosis cattles not at the discharge period of bacteria.
19. The use according to claim 18, wherein when the concentration of IL-8 in plasma is 42 ng/ml, it is determined as tuberculosis positive; when the concentration of IL-8 in plasma is <42 ng/ml, it is determined as tuberculosis negative; when the concentration of CRP in plasma is 790 ng/ml, it is determined as tuberculosis positive cattles at the discharge period of bacteria, when the concentration of CRP in plasma is <790 ng/ml, it is determined as cattles not at the discharge period of bacteria; when the concentration of IL-8 in plasma is 42 ng/ml, and the concentration of CRP in plasma is <790 ng/ml, it is determined as tuberculosis positive cattles not at the discharge period of bacteria.
20. The use according to claim 18, wherein the concentration of CRP in the plasma of tuberculosis cattles at the discharge period of bacteria is greater than 3 times of that in tuberculosis cattles not at the discharge period of bacteria and that in negative cattles.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
DESCRIPTION OF THE EMBODIMENTS
[0033] The present invention will be further explained below in conjuction with specific embodiments. These embodiments are only used to illustrate the invention, while not limit the scope of the invention. Bovine tuberculin (PPD-B) and purified avine tuberculin (PPD-A) are purchased from The Sixth Factory of Harbin Pharmaceutical Group Co., Ltd. Recombinant proteins ESAT-6-CFP-10, CFP-10, and ESAT-6 are prepared by Tuberculosis and Animal Epidemics Diagnosis Laboratory of Beijing Animal Husbandry and Veterinary Research Institute in Chinese Academy of Agricultural Sciences, and have been published in the document Xin T, Jia H, Ding J, Li P, Yang H, Hou S, Yuan W, Guo X, Wang H, Liang Q, Li M, Wang B, Zhu H.2013. Assessment of a protein cocktail-based skin test for Bovine tuberculosis in a double-blind field test in cattle. Clin Vaccine Immunol 20:482-90.
Embodiment 1 Detection and Collection of Clinical Samples Involved in the Present Invention
[0034] 1. Tuberculin Skin Test:
[0035] The tuberculin skin test is performed according to Diagnostic Criteria for Bovine Tuberculosis (GB/T 18645-2002). The cattle is shaved at of the neck, and intradermally injected with 0.1 mL purified bovine tuberculin (PPD-B, 250 IU/dose). Skin thicknesses at the injection sites are measured by the same operator with a vernier caliper before injection and 72 h after injection respectively, and the skin thickness difference is calculated. When the skin thickness difference is greater than or equal to 4 mm, the cattle is tuberculosis positive; when the skin thickness difference is smaller than 2 mm, it is determined as tuberculosis negative; when the skin thickness difference is between 2 mm and 4 mm, it is determined as suspected, the skin test needs to be performed once again 60 days after the first detection, and if the skin thickness difference is greater than or equal to 2 mm at the second detection, then it is determined as tuberculosis positive.
[0036] 2. CFP-10/ESAT-6/TB10.4-Based Skin Test:
[0037] The cattle is shaved at of the neck, and intradermally injected with 0.1 mL recombinant protein CFP-10/ESAT-6/TB10.4 (the concentration of the recombinant protein is 0.5 mg/ml, the ratio of CFP-10, ESAT-6 and TB10.4 is 1:1:1). Skin thicknesses at the injection site are measured by the same operator with a vernier caliper before injection and 72 h after injection respectively, and the skin thickness difference is calculated. When the skin thickness difference is greater than or equal to 2 mm, the cattle is tuberculosis positive; when the skin thickness difference is smaller than 2 mm, then it is determined as tuberculosis negative.
[0038] 3. Interferon Gamma Release Assay:
[0039] 10 ml of heparin lithium anti-coagulant blood is harvested and transferred to the laboratory at room temperature (224 C.) within 16 hours. The anti-coagulant blood is firstly added onto a 24-well tissue culture plate at 1.5 ml per well. Each well is aseptically added with purified bovine tuberculin (PPD-B), purified avian tuberculin (PPD-A), and PBS each 100 l, blended with shaking and then incubated in a incubator at 37 C. and C02 for 20 to 24 hours. 200 l of upper plasma is sucked up carefully and transferred into a 1.5 ml centrifuge tube, ready for use (the plasma can be stored at 2 to 8 C. for 7 days, and can be stored at 20 C. for several months). Following the instruction of bovine IFN- detection kit (purchased from Prionics Co.), OD.sub.450 nm values for PPD-B, PPD-A and PBS stimulated samples are marked as OD.sub.450 nm (PPD-B), OD.sub.450 nm (PPD-A), OD.sub.450 nm (PBS), respectively. When OD.sub.450 nm (PPD-B)OD.sub.450 nm (PPD-A)0.1 and OD.sub.450 nm (PPD-B)OD.sub.450 nm (PBS)0.1, it is determined as Bovine tuberculosis positive, while when OD.sub.450 nm (PPD-B)OD.sub.450 nm (PPD-A)<0.1 or OD.sub.450 nm (PPD-B)OD.sub.450 nm (PBS)<0.1, it is determined as Bovine tuberculosis negative.
[0040] 4. CFP-10-ESAT-6-Based Interferon Gamma Release Assay:
[0041] ml of heparin lithium anti-coagulant blood is harvested and transferred to the laboratory at room temperature (224 C.) within 16 hours. The anti-coagulant blood is firstly added onto 24-well tissue culture plates at 1.5 ml per well. Each well is aseptically added with recombinant protein ESAT-6-CFP-10 (CE, 20 g/ml, endotoxin<10 EU/mg) and PBS each 100 l, blended with shaking and then incubated in a incubator at 37 C. and CO.sub.2 for 20 to 24 hours. 200 pd of upper plasma is sucked up carefully and transferred into a 1.5 ml centrifuge tube, ready for use (the plasma can be stored at 2 to 8 C. for 7 days, and can be stored at 20 C. for several months). Following the instruction of bovine IFN- detection kit (purchased from Prionics Co.), OD.sub.450 nm values for ESAT-6-CFP-10 and PBS stimulated samples are marked as OD.sub.450 nm (CE) and OD.sub.450 nm (PBS), respectively. When OD.sub.450 nm (CE)OD.sub.450 nm (PBS)0.1, it is determined as Bovine tuberculosis positive, while when OD.sub.450 nm (CE)OD.sub.450 nm (PBS)<0.1, it is determined as Bovine tuberculosis negative.
[0042] 5. Nested PCR Detection on Nasal Swab Secretion:
[0043] To a sterile tube is charged with 2 to 4 ml of sterile PBS. A flocking swab is stretched into the nasal cavity of a cattle and turned for 5 to 8 circles, and then immediately put into the sterile tube, with the tip of the swab being immerged in PBS. The tip of the swab is broken off, the lid is screwed on tightly, and the tube is kept at low temperature. It is centrifuged at 13000 r/min for 15 mins at 4 C., discarding the supernatant. A genome is extracted with a bacterial genome extraction kit (purchased from TAKARA Co.) and cryopreserved at 20 C. ready for use. With the extracted genomic DNA as the template, a specific target sequence (372 bp) of mpb70 gene in Mycobacterium tuberculosis comples is amplified with M70F and M70R, the reaction system is: DDW 19 L, 2PCR Mix 25 L, M70F (10 M) 2 L, M70R (10 M) 2 L, genomic DNA template 2 L.
[0044] The reaction conditions of PCR amplification are: predegeneration at 94 C. for 5 mins; degeneration at 94 C. for 45 s, annealing at 60 C. for 30 s, extension at 72 C. for 45 s, 30 cycles; and extension at 72 C. for additional 5 mins. 1 l of PCR products are respectively taken as the template of the second run of PCR reaction, of which the 50 L PCR reaction system is: DDW 20 L, 2PCR Mix 25 L, M22F (10 M) 2 L, M22R (10 M) 2 L, and PCR product template 1 L. The second run of PCR is amplified with touch down cyclic parameters.
TABLE-US-00001 TABLE1 Names,SequencesandAmplificationPro- ductSizesofNestedPCRPrimers Ampli- fied Primer Fragment Name PrimerSequence (bp) M70F GAACAATCCGGAGTTGACAA 372 (SEQIDNO.1) M70R AGCACGCTGTCAATCATGTA (SEQIDNO.2) M22F GCTGACGGCTGCACTGTCGGGC 208 (SEQIDNO.3) M22R CGTTGGCCGGGCTGGTTTGGCC (SEQIDNO.4)
[0045] 6. Detection is performed using the method of the above steps 1-4 to screen tuberculosis positive cattles and tuberculosis negative cattles, and tuberculosis cattles are grouped into PCR positive cattles and PCR negative cattles using the method of the above step 5.
TABLE-US-00002 TABLE 2 Clinical Sample Grouping PCR Positive PCR Negative Tuberculosis Tuberculosis Tuberculosis Negative Cattle Cattle Cattle Detection Method (bTB.sub.PCR-P) (bTB.sub.PCR-N) (NC) Tuberculin Skin Test + + CFP-10/ESAT-6/ + + TB10.4-based Skin Test Interferon Gamma + + Release Assay CFP-10-ESAT-6-based + + Interferon Gamma Release Assay Nested PCR Detection + on Nasal Swab Secretion
[0046] 7. Sample Collection and Preparation:
[0047] 10 ml of venous blood is harvested from a cattle aseptically, and injected into a heparin lithium anticoagulant blood collection tube (10 ml). The anti-coagulant blood is added onto a 24-well tissue culture plate at 1.5 ml/well. Each well is aseptically added with purified bovine tuberculin (PPD-B), purified avian tuberculin (PPD-A), PBS, and recombinant protein ESAT-6-CFP-10 (CE, 20 g/ml, endotoxin<10 EU/mg) each 100 l, blended with shaking and then incubated in a incubator at 37 C. and CO.sub.2 for 20 to 24 hours. The upper plasma is sucked up carefully, transferred into a 1.5 ml centrifuge tube, and cryopreserved at 80 C. ready for use.
Embodiment 2 Screening on Molecular Markers
[0048] 1. Sample pretreatment: 20 PCR positive tuberculosis cattles (bTB.sub.PCR-P), 20 PCR negative tuberculosis cattles (bTB.sub.PCR-N) and 20 tuberculosis negative cattles (NC) identified in Embodiment 1 are randomly screened. Take the bTB.sub.PCR-P group as an example, every 10 plasma samples are mixed at equal volumes, becoming two biological repetitive plasma mixed samples (bTB.sub.PCR-P P1 is the plasma mixed sample of cattles Nos. 1-10, and bTB.sub.PCR-P P2 is the plasma mixed sample of cattles Nos. 11-20). Following this method, a plasma mixed sample of bTB.sub.PCR-N (bTB.sub.PCR-N P1 and bTB.sub.PCR-N P2) and NC group (NC P1 and NC P2) is prepared.
[0049] 2. Extraction of high-abundant proteins: As IgG, BSA, etc. in plasma account for more than 85% of the total proteins, which may affect the detection of low-abundant proteins, so high-abundant protein extraction kits (purchased from Bio-Rad Co.) are used to extract high-abundant proteins from plasma samples. The extraction effects of high-abundant proteins are detected with SDS-PAGE, and a Bradford protein quantification kit is used to detect the concentration of proteins. It is shown from the results that high-abundant proteins are successfully extracted from 6 plasma samples (bTB.sub.PCR-P P1, bTB.sub.PCR-P P2, bTB.sub.PCR-N P1, bTB.sub.PCR-N P2, NC P1 and NC P2) (as shown in
[0050] 3. Enzyme digestion and desalination of proteins: 100 g proteins are taken and adjusted the volume to 100 l with a solution of triethylammonium bicarbonate (TEAB), then diluted with 500 l of NH.sub.4HCO.sub.3 at 50 mM, and digested with 2 g trypsin solution at 37 C. overnight, and then acidified with an equal volume of 0.1% formic acid (FA); a Strata-X C18 column is taken out and activated with 1 ml methanol, and equilibrated with 1 ml of 0.1% FA; the above acidified enzymatic hydrolyzates are added into the Strata-X C18 column, and filtered serially for 3 times, then the Strata-X C18 column is washed with 0.1% FA+5% acetonitrile serially for 2 times; the Strata-X C18 column is eluted by adding 1 ml of 0.1% FA+80% acetonitrile for one time, and 1 ml of liquid is collected into a new centrifugal tube; the liquid is freezed and dried, and then redissolved with 20 l of TEAB at 0.5 M.
[0051] 4. iTRAQ LC-MS/MS Detection: Following the instruction, 8-plex markers are employed, which are specifically as follows: bTB.sub.PCR-P Group: 113, 114; bTB.sub.PCR-N: 115, 116; NC: 117, 118. After being marked, 6 plasma samples to be detected are mixed at equal parts respectively. The mixed samples are divided into 16 components, detected by mass spectrometry with AB SCIEX nanoLC_MS/MS (Triple TOF 5600plus), and data search and identification are performed with Proteinpilot V4.5. Proteins of which the unused score1.3 (i.e, level of confidence above 95%), containing at least one unique peptide segment, are considered as confident proteins. The average of ratios between every two replicate samples is normalized by the median to be the difference factor of samples to be compared, and the minimum value in p-values of one-sample Student's t test between every two replicate samples is utilized as the significance difference test p value among samples to be compared. When the difference factor reaches 1.5 folds and above (that is, up_regulate1.5 and down_regulate0.67), and its p-value0.05, it is considered as significantly differential protein. It is shown from the results that there are 719 proteins identified from the plasma sample, of which 531 proteins have been identified more than two peptide segments. According to the multiples and functions of identified differential proteins, 15 plasma proteins are screened to be identified with parallel reaction monitoring (PRM) (see Table 3). According to the results of iTRAQ and PRM detection, proteins with consistent results which can be used for the diagnosis of Bovine tuberculosis are screened for ELISA verification.
TABLE-US-00003 TABLE 3 Differential proteins in plasma after PPD-B stimulation idendified by iTRAQ and PRM Fold-changes in iTRAQ Fold-changes in PRM Protein bTB.sub.PCR-P/ bTB.sub.PCR-N/ bTB/ bTB.sub.PCR-P/ bTB.sub.PCR-P/ bTB.sub.PCR-N/ bTB/ bTB.sub.PCR-P/ ID Name NC NC NC bTB.sub.PCR-N NC NC NC bTB.sub.PCR-N A8DBT6 Monocyte 5.49 4.39 4.67 1.8 1.67 1.74 1.08 differential antigen CD14 C4T8B4 C-Reactive 0.08 0.41 11.36 1.67 0.57 1.12 2.92 Protein (CRP) F1MM86 Complement 6 5.87 4.23 4.78 1.63 1.2 1.2 1.2 1 F1MMK9 Protein AMBP 4.14 2.71 3.23 1.19 1 1.1 1.18 (AMBP) G3LUN8 IL-8 9.98 8.59 8.77 2.81 2.42 2.62 1.16 G3X6N3 Transferrin 11.47 4.42 7.51 8.96 2.02 1.35 1.68 1.5 (TF) G3X6Y4 Osteomodulin 8.87 12.35 9.99 (OMD) O02659 Mannose 6.97 3.46 4.93 2.34 binding protein C (MBL) O77482 Interleukin- 5.4 6.79 5.76 receptor antagonist protein (IL1RN) P07224 Protein S 5.86 4.71 1.52 (PROS) Q011G2 EGF fibrinoid 12.56 11.94 11.58 1.53 2.56 2.04 0.6 extracellular matrix protein (EFEMP2) Q2KIF2 Interieukin- 7.96 6.2 2.49 1.26 1.2 1.23 1.05 receptor antagonist protein (IL1RN) Q2KIX7 Protein HP-25 9.73 3.1 6.06 10.07 homolog 1 Q5E9C0 Ras 0.33 0.23 0.2 0.68 0.44 0.3 Suppressor Protein 1 (RSU1) Q5GN72 -1-acid 12.68 4.2 7.97 11.84 1.32 1.32 1.32 1 glycoprotein (agp)
Embodiment 3 Verification on Molecular Markers of the Invention
[0052] 1. PRM identification of differential proteins: Samples are treated following the process of Embodiment 2. Upon DDA detection, a targeted analytic strategy of mass spectrometry PRM is utilized to add the peptide segments of the identified target proteins into the inclusion list of the mass spectrometry acquisition method, allowing the mass spectrometry to collect data against these specific peptide segments, and performing relative quantitative analysis by extracting fragment ion information (results see Table 4). According to iTRAQ and PRM identification results (see Table 3), the contents of IL-8, agp and TF in plasma of tuberculosis cattles are more than 1.3 times of those in plasma of healthy cattles, while the content of CRP in plasma of tuberculosis cattles at the discharge period of bacteria is more than 2 times of that in plasma of tuberculosis cattles not at the discharge period of bacteria, and the detection results between iTRAQ and PRM are coincident. Therefore, plasma proteins IL-8, CRP, agp, and TF are screened, together with IL-17A and IP-10 reported in literature, to be detected by an ELISA method.
[0053] 2. ELISA Verification of molecular markers: 21 PCR positive tuberculosis cattles (bTB.sub.PCR-P), 21 PCR negative tuberculosis cattles (bTB.sub.PCR-N) and 19 tuberculosis negative cattles (NC) are randomly screened utilizing the method of steps 1-5 in Embodiment 1, and plasma 'samples are prepared for each cattle following the method of step 7 in Embodiment 1.
[0054] A commercial ELISA kit is used to detect Serotransferrin (TF), Alpha-1-acid glycoprotein (agp), C-reactive protein (Pentaxin, CRP), IL-8, IL-17 and IP-10 in plasma. It is shown from the results that after PPD-B stimulation, TF in plasma of bTBPcR-p Group is significantly higher than that of NC Group, while the level of TF in plasma of bTB.sub.PCR-N Group is similar to that of NC Group (see
[0055] It is shown from the above results that after PPD-B and CFP-10-ESAT-6 stimulation, IL-8 in plasma is capable of differentiating tuberculosis cattles from negative cattles, while after PPD-B stimulation, CRP is capable of differentiating tuberculosis cattles at the discharge period of bacteria from tuberculosis cattles not at the discharge period of bacteria. Therefore, M. bovis specific antigen (PPD-B, CE) induced IL-8 and CRP can be used for the diagnosis of Bovine tuberculosis, and can be used for differentiating tuberculosis cattles at the discharge period of bacteria from those not at the discharge period of bacteria.
[0056] 3. Determination of Cutoff Values in Detecting Bovine Tuberculosis with IL-8, CRP Induced by PPD-B
[0057] Skin test and interferon gamma release assay are the detection methods for Bovine tuberculosis recommended by OIE, while it has reported in recent researches that IL-17A and IP-10 also have the potential as the diagnostic markers for Bovine tuberculosis. Therefore, in the present invention, a tuberculin skin test, a CFP-10/ESAT-6/TB10.4-based skin test, an interferon gamma release assay, a CFP-10-ESAT-6-based interferon gamma release assay and a nested PCR detection method of nasal swab secretion are utilized to screen 21 PCR positive tuberculosis cattles (bTB.sub.PCR-P), 21 PCR negative tuberculosis cattles (bTB.sub.PCR-N), and 19 tuberculosis negative cattles.
[0058] 10 ml of venous blood is harvested from a cattle aseptically, and injected into a heparin lithium anticoagulant blood collection tube (10 ml). The anti-coagulant blood is added onto a 24-well tissue culture plate at 1.5 ml/well. Each well is aseptically added with purified bovine tuberculin (PPD-B), and CFP-10-ESAT-6 each 100 l, blended with shaking and then incubated in a incubator at 37 C. and CO.sub.2 for 20 to 24 hours. The upper plasma is sucked up carefully, transferred into a 1.5 ml centrifuge tube, and the concentrations of IFN-, IL-8, CRP, IP-10 and IL-17 in plasma are detected. Receiver operating characteristic curve is used for analyzing IL-8, IP-10 and IL-17 to differentiate cutoff values of tuberculosis positive cattles from those of negative cattles (comprising 42 tuberculosis positive cattles and 19 negative cattles), and CRP is analyzed to differentiate cutoff values of tuberculosis cattles at the discharge period of bacteria from those not at the discharge period of bacteria (comprising 21 tuberculosis cattles at the discharge period of bacteria and 21 cattles not at the discharge period of bacteria).
[0059] It is shown from the results that, when differentiating tuberculosis positive cattles from negative cattles with PPD-B as the stimulus, AUC of IL-8 is higher than those of IP-10 and IL-17, and when a specificity of 100% is selected, the sensitivity of detection can up to 96.62%, while when the specificities of IP-10 and IL-17 are 100%, the sensitivities of detection are only 52.38% and 28.57%, respectively. When CFP-10-ESAT-6 is used as the stimulus, AUC of IL-8 is 0.9561, the specificity is 100%, the sensitivity is 85.71%, and the detection effect is inferior to the detection effect with PPD-B as the stimulus. When differentiating tuberculosis cattles at the discharge period of bacteria from those not at the discharge period of bacteria, AUC of CRP is 1, and when the specificity is 100%, the sensitivity of detection can up to 100%. Therefore, IL-8 and CRP induced with PPD-B have more potential as molecular markers for Bovine tuberculosis than IL-8 induced with IP-10, IL-17 as well as CFP-10-ESAT-6.
TABLE-US-00004 TABLE 4 Determination of cutoff values Area 95% 95% Under Confidence Confidence Cut-off Curve Sensitivity Interval Specificity Interval Values Functions Detection (AUC) (%) (%) (%) (%) (ng/ml) Differentiating PPD-B-induced 0.9662 92.86 80.52-98.50 94.74 73.97-99.87 >32.57 tuberculosis IL-8 92.86 80.52-98.50 100 82.35-100.0 >43.05 positive CFP-10-ESAT-6- 0.9561 85.71 71.46-94.57 94.74 73.97-99.87 >21.9 cattles from induced IL-8 85.71 71.46-94.57 100.0 82.35-100.0 >29.42 negative PPD-B-induced 0.9500 52.38 36.42-68.00 95 75.13-99.87 >1.992 cattles IP10 52.38 36.42-68.00 100 83.16-100.0 >2.045 PPD-B-induced 0.8464 28.57 15.72-44.58 95 75.13-99.87 >1.767 IL-17A 28.57 15.72-44.58 100 83.16-100.0 >2.061 Differentiating PPD-B-stimulated 1.000 100 83.89-100.0 95.24 76.18-99.88 >701.3 tuberculosis CRP 100 83.89-100.0 100 83.89-100.0 >794.8 cattles at the discharge period of bacteria from tuberculosis cattles not at the discharge period of bacteria
[0060] 4. Correlation between IL-8, CRP and IFN-, IP-10, IL-17A: A spearman r method is utilized to detect the correlation of expression levels of cytokines. It is shown from the results that the expression level of IL-8 is significantly higher than those of IFN-, IP-10 and IL-17 (see
TABLE-US-00005 TABLE 5 Correlation analysis on expression levels of cytokines Correlation coefficient r of plama after PPD-B stimulation Cytokines IL-8 IFN- IP-10 IL-17A CRP IL-8 0.75* 0.63* 0.54* 0.38 IFN- 0.75* 0.63* 0.61* 0.24 IP-10 0.63* 0.63* 0.47* 0.43 IL-17A 0.54* 0.61* 0.47* 0.19 CRP 0.38* 0.24 0.43* 0.19 *p < 0.05
Embodiment 4 Construction of IL-8, CRP Detection Kit for Bovine Tuberculosis of the Invention
[0061] 1. Sample Collection and Preparation:
[0062] 10 ml of venous blood is harvested from a cattle aseptically, and injected into a heparin lithium anticoagulant blood collection tube, which is inverted gently for 3-5 times, and sent back to the laboratory at room temperature for 20 hours. The anti-coagulant blood is added onto a 24-well tissue culture plate at 1.5 ml/well. Each well is aseptically added with 100 l PPD-, blended with shaking gently and then incubated in a incubator at 37 C. and CO.sub.2 for 20 to 24 hours. The upper plasma is sucked up carefully, transferred into a 1.5 ml centrifuge tube, and cryopreserved at 80 C. ready for use.
[0063] 2. Preparation of IL-8, CRP monoclonal antibody-coated enzyme label plate: PBS (pH of 7.2-7.4) used for IL-8 monoclonal antibody is diluted to 2 g/ml, and added into odd rows of the enzyme label plate at 100 l/well; PBS (pH of 7.2-7.4) used for CRP monoclonal antibody is diluted to 2 g/ml, added into even rows of the enzyme label plate at 100l/well, and coated at 2-8 C. for 16 hours; on the next day, the coating liquid is discarded and pat dry, the plates are washed with a washing liquid at 250 l/well; the washing liquid is discarded, a confining liquid is added (1% BSA in PBST, pH at 7.2-7.4) at 200 l/well and confined at 2-8 C. for 12 hours; on the next day, the confining liquid is discarded and pat dry, the plates are washed with a washing liquid for 3 times at 250 l/well; the washing liquid is discarded and pat dry, packaged in aluminium foil bags and preserved at 2-8 C.
[0064] 3. Preparation of HRP-labelled mouse-anti-cattle IL-8, CRP monoclonal antibody: Following the instruction of EZ-Link Activated Peroxides Antibody Labeling Kit (Thermo Scientific Pierce #31497), mouse-anti-cattle IL-8 and CRP monoclonal antibodies are labelled with HRP respectively. The labelled monoclonal antibodies are diluted with PBS, the optimum dilution is determined by a sandwich ELISA method. A commercial enzyme-labelled antibody stabilizer from Thermo Co. (Item No. 37548) is added to formulate a 100 enzyme-labelled antibody stock solution, which is filtered over a 0.22 m filter membrane to remove bacteria, subpackaged in proper quantity aseptically, and preserved in dark at 2-8 C.
[0065] 4. Preparation of standard: The recombinantly expressed IL-8 at a concentration of 1 g/ml is diluted with a sample diluent (0.1% BSA in PBST, at pH 7.2-7.4) into 8 gradients (0, 1, 5, 10, 50, 100, 500, 1000 g/ml), and formulated 15 min before detection. The recombinantly expressed CRP at a concentration of 1 g/ml is diluted with a sample diluent (0.1% BSA in PBST, at pH 7.2-7.4) into 8 gradients (0, 6.25, 12.5, 25, 50, 100, 200, 400 ng/ml), and formulated 15 min before detection.
[0066] 5. Adding samples: Plasma after PPD-B stimulation is thawed, mixed by inverting gently, and diluted with a sample diluent (0.1% BSA in PBST, at pH 7.2-7.4) by 5 folds, 8 folds and 200 folds. Taking monoclonal antibody-coated plates (according to the number of samples, the plates can be used separately), the first row is added with diluted IL-8 standard, the second row is added with diluted CRP standard, the third and the fourth rows are added with diluted samples at 100 l/well, mixed sufficiently and scaled, and reacted in dark at room temperature (22-26 C.) for 60 minutes. The reaction plates are taken out, the reaction fluid is discarded, and each well is washed for 5 times by adding 250 l 1washing liquid, and pat dry at the last time. The operations of adding samples are shown as below:
TABLE-US-00006 TABLE 6 Schematic table showing adding samples IL-8 CRP Samples Standard Standard Samples Samples 1 1000 pg/ml 400 ng/ml 1-PPDB 20 1-PPDB 5 2 500 pg/ml 200 ng/ml 1-PPDB 200 1-PPDB 20 3 100 pg/ml 100 ng/ml 2-PPDB 20 2-PPDB 5 4 50 pg/ml 50 ng/ml 2-PPDB 200 2-PPDB 20 5 10 pg/ml 25 ng/ml 3-PPDB 20 3-PPDB 5 6 5 pg/ml 12.5 ng/ml 3-PPDB 200 3-PPDB 20 7 1 pg/ml 6.25 ng/ml Sample Sample Diluent Diluent 8 0 pg/ml 0 ng/ml
[0067] 6. Adding Enzyme-Labelled Antibody
[0068] 100HRP-anti-cattle IL-8 monoclonal antibody and 100HRP-anti-cattle CRP monoclonal antibody are diluted with enzyme-labelled antibody diluent (0.1% BSA in PBST, at pH 7.2-7.4) by 100 times respectively. The odd rows are added with anti-IL-8 antibodies, and the even rows are added with anti-CRP antibodies at 100 l/well, and reacted in dark at room temperature (22-26 C.) for 60 minutes. The reaction plates are taken out, the reaction fluid is discarded, and each well is washed for 5 times by adding 250 l 1washing liquid, and pat dry at the last time.
[0069] 7. Colour-developing and stopping: A substrate colour-developing solution is added at 100 l/well, and reacted in dark at room temperature (22-26 C.) for 30 minutes, with timing started from adding the first well. Following the sequence of adding the substrate colour-developing solution, 50 l stop buffer is added into each well in turn, blended gently, and determined OD.sub.450 nm values by a microplate reader within 10 minutes.
[0070] 8. Data analysis: When OD.sub.450 nm of the blank control is <0.3, the results are valid. The average value of blank control is subtracted from OD.sub.450 nm readout of each well, with the difference between OD.sub.450 nm of standard and the blank control as the horizontal ordinate, and with the concentration of standard as the vertical coordinate, a linear regression curve of standard is plotted. The concentration of sample is calculated according to the difference between OD.sub.450 nm of the sample and the blank control, then multiplies by its dilution factor to be the concentration of IL-8 and CRP in plasma of this sample.
[0071] 9. Establishment of diagnostic criteria: 21 PCR positive tuberculosis cattles (bTB PCR-P), 21 PCR negative tuberculosis cattles (bTB.sub.PCR-N) and 19 tuberculosis negative cattles (NC) are screened according to the method of steps 1-5 in Embodiment 1. Heparin lithium anti-coagulant blood is harvested aseptically, and added onto a 24-well tissue culture plate at 1.5 ml per well. Each well is aseptically added with 100 l PPD-B (300 IU/ml), blended with shaking gently and then incubated in a incubator at 37 C. and C02 for 20 to 24 hours. The upper plasma is sucked up carefully and transferred into a 1.5 ml centrifuge tube, and the concentration of IL-8 in plasma is detected with the IL-8, CRP sandwich ELISA detection kit of the invention. An ROC analysis is performed on the concentration of IL-8 in plasma of tuberculosis cattles (including PCR positive and negative, 42) and control cattles (19) after PPD-B stimulation, to evaluate the threshold of detection on tuberculosis cattles; an ROC analysis is performed on the concentration of CRP in plasma of tuberculosis PCR-positive cattles and PCR negative cattles after PPD-B stimulation, to evaluate the threshold of detection on tuberculosis cattles at the discharge period of bacteria.
TABLE-US-00007 TABLE 7 ROC Analysis Area Under Curve Sensitivity 95% CI.sup.a Specificity 95% CI.sup.a Threshold Stimulus (AUC) (%) (%) (%) (%) (ng/ml) PPD-B-induced 0.9662 92.86 80.52-98.50 94.74 73.97-99.87 >30 IL-8 92.86 80.52-98.50 100 82.35-100.0 >42 PPD-B-induced 1.0000 100 83.89-100.0 95.24 76.18-99.88 >700 CKP 100 83.89-100.0 108 83.89-100.0 >790
[0072] It is shown from the results that, under PPD-B specific stimulation, IL-8 is capable of differentiating tuberculosis positive cattles from negative cattles, when the detection specificity is 100%, its detection sensitivity can up to 96.62%, and the AUC is 0.9662. When differentiating tuberculosis cattles at the discharge period of bacteria from those not at the discharge period of bacteria, the AUC of CRP is 1, and when the specificity is 100%, the detection sensitivity can up to 100%. (Table 7).
TABLE-US-00008 TABLE 8 Variance analysis Tuberculosis Tuberculosis cattles at cattles not at the discharge the discharge Detection period of period of Negative Factor Item bacteria bacteria cattles IFN- Mean value 7.330 7.731 0.329 Standard 5.734 5.755 0.220 deviation IL-8 Mean value 144.195 125.834 18.163 Standard 69.109 70.962 12.349 deviation CRP Mean value 1584.702 395.213 389.465 Standard 536.931 191.179 162.747 deviation
[0073] Diagnostic criteria: To guarantee the detection specificity of tuberculosis cattles, according to the analysis results of ROC, the detection specificity is set at 100%, the sensitivity is higher than 90%, when the concentration of IL-8 in plasma after PPD-B stimulation is 42 ng/ml, it is determined as tuberculosis positive; when the concentration of IL-8 in plasma after PPD-B is <42 ng/ml, it is determined as tuberculosis negative. When the concentration of CRP in plasma of tuberculosis positive cattles after PPD-B stimulation is 790 ng/ml, it is determined as cattles at the discharge period of bacteria, while when the concentration of CRP in plasma after PPD-B stimulation is <790 ng/ml, it is determined as cattles not at the discharge period of bacteria. Different sample sizes may affect the accuracy of detection threshold, however, the average concentration of IL-8 in plasma of tuberculosis cattles after PPD-B stimulation is greater than 5-6 times of that in tuberculosis negative cattles, significantly higher than in negative cattles; the concentration of CRP in plasma of tuberculosis cattles at the discharge period of bacteria after PPD-B stimulation is greater than 3-4 times of those in tuberculosis cattles not at the discharge period of bacteria and in negative cattles, significantly higher than in tuberculosis cattles not at the discharge period of bacteria and in negative cattles. Therefore, the difference in sample quantity has little effect on the overall range of the threshold.
Embodiment 5 Clinical Evaluation on the Bovine Tuberculosis IL-8, CRP Detection Kit of the Invention
[0074] At a cattle camp, 84 cattles are detected by the tuberculin skin test of Embodiment 1. 10 ml of venous blood is harvested from a cattle aseptically, and injected into a heparin lithium anticoagulant blood collection tube, which is inverted gently for 3-5 times, and sent back to the laboratory at room temperature for 20 hours. The anti-coagulant blood is added onto a 24-well tissue culture plate at 1.5 ml/well. Each well is aseptically added with purified bovine tuberculin (PPD-B), purified avian tuberculin (PPD-A), and PBS each 100 l, blended with shaking and then incubated in a incubator at 37 C. and CO.sub.2 for 20 to 24 hours. 200 l of upper plasma is sucked up carefully and transferred into a 1.5 ml centrifuge tube, ready for use (the plasma can be stored at 2 to 8 C. for 7 days, and can be stored at 20 C. for several months). Following the instruction of bovine IFN- detection kit (purchased from Prionics Co.), PPD-B, PPD-A and PBS stimulation samples are detected. The concentrations of IL-8 and CRP in plasma after PPD-B stimulation are detected with the kit constructed in the Embodiment 4 of the invention. Following the nested PCR detection method used for the nasal swab secretion in Embodiment 1, nasal swabs are harvested from each cattle and detected.
TABLE-US-00009 TABLE 9 IL-8, CRP Detection Kit for Bovine Tuberculosis Positive Negative Tuberculin skin test and Positive 34 (A) 1 (C) Interferon gamma release assay Negative 1 (B) 49 (D)
[0075] Sensitivity of IL-8, CRP detection method for Bovine tuberculosis relative to tuberculin skin test and interferon gamma release assay=A/(A+C)100%=97%
[0076] Specificity of IL-8, CRP detection method for Bovine tuberculosis relative to tuberculin skin test and interferon gamma release assay=D/(B+D)100%=98%
[0077] Coincidence rate between IL-8, CRP detection method for Bovine tuberculosis and tuberculin skin test and interferon gamma release assay=(A+D)/(A+B+C+D)100%=97.65%
[0078] Positive Cattles: There are 35 cattles determined as double positive by detection with interferon gamma release assay and tuberculin skin test;
[0079] Negative Cattles: There are 50 cattles determined as double negative by detection with interferon gamma release assay and tuberculin skin test.
[0080] It is shown from the experimental results that: Coincidence rate between IL-8, CRP detection method for Bovine tuberculosis of the invention and the traditional interferon gamma release assay and tuberculin skin test can up to 97.65%, the sensitivity of detection can up to 97%, and the specificity reaches 98%. These test data indicate that the IL-8, CRP detection method for Bovine tuberculosis has high sensitivity and specificity, and can be used for differentiating tuberculosis positive cattles from negative cattles.
TABLE-US-00010 TABLE 10 IL-8, CRP Detection Kit for Bovine Tuberculosis Positive Negative Nested PCR detection Positive 13 (A) 1 (C) for nasal swab secretion Negative 0 (B) 21 (D)
[0081] Sensitivity of IL-8, CRP detection method for Bovine tuberculosis relative to nested PCR detection for nasal swab secretion=A/(A+C)100%=93%
[0082] Specificity of IL-8, CRP detection method for Bovine tuberculosis relative to nested PCR detection for nasal swab secretion=D/(B+D)100%=100%
[0083] Coincidence rate between IL-8, CRP detection method for Bovine tuberculosis and nested PCR detection for nasal swab secretion=(A+D)/(A+B+C+D)100%=97.14%
[0084] Positive Cattles: There are 35 cattles determined as double positive by detection with interferon gamma release assay and tuberculin skin test;
[0085] Tuberculosis cattles at the discharge period of bacteria: There are 14 cattles determined as positive by detection with nested PCR detection for nasal swab secretion;
[0086] Tuberculosis cattles not at the discharge period of bacteria: There are 21 cattles determined as positive by detection with nested PCR detection for nasal swab secretion.
[0087] It is shown from the experimental results that: Coincidence rate between IL-8, CRP detection method for Bovine tuberculosis and nested PCR detection for nasal swab secretion can up to 97.14%, the sensitivity of detection can up to 93%, and the specificity reaches 100%. These test data indicate that the IL-8, CRP detection method for Bovine tuberculosis has high sensitivity and specificity, and can be used for differentiating tuberculosis cattles at the discharge period of bacteria from tuberculosis cattles not at the discharge period of bacteria.
[0088] The above descriptions are only preferred embodiments of the invention. It should be noted to persons with ordinary skills in the art that several improvements and modifications can be made without deviating from the technical principle of the invention. These improvements and modifications should also be considered as the protection scope of the invention.