Vaccine
10744192 ยท 2020-08-18
Assignee
Inventors
- Michael Christopher Fontaine (Edinburgh, GB)
- David George Emslie Smith (Edinburgh, GB)
- Julie Lydia Fitzpatrick (Edinburgh, GB)
- William Donachie (Edinburgh, GB)
- Anita Dorota Jaglarz (Edinburgh, GB)
Cpc classification
A61P1/04
HUMAN NECESSITIES
A61P43/00
HUMAN NECESSITIES
A61K2039/55572
HUMAN NECESSITIES
A61K39/0002
HUMAN NECESSITIES
A61K39/05
HUMAN NECESSITIES
G01N2469/10
PHYSICS
A61K39/39
HUMAN NECESSITIES
A61K39/118
HUMAN NECESSITIES
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
A61K2039/55561
HUMAN NECESSITIES
A61P33/02
HUMAN NECESSITIES
International classification
A61K39/09
HUMAN NECESSITIES
A61K39/00
HUMAN NECESSITIES
A61K39/05
HUMAN NECESSITIES
A61K39/118
HUMAN NECESSITIES
Abstract
The invention is based upon the identification of a number of antigens derived from a species of the genus Streptococcus, which are cross reactive and which may serve as the basis of useful compositions and tests and procedures capable of identifying and/or detecting Streptococcus sp in samples.
Claims
1. A method of raising a protective anti-Streptococcus uberis immune response in an animal, said method comprising the step of administering to the animal, an amount of a Streptococcus uberis antigen having the amino acid sequence of SEQ ID NO: 4 and a Streptococcus uberis antigen having the amino acid sequence of SEQ ID NO: 2 sufficient to induce the protective anti-Streptococcus uberis immune response.
2. The method of claim 1, wherein the Streptococcus uberis antigens are administered to the animal together with an adjuvant.
3. The method of claim 1, wherein the immune response is a response which is protective against the development of diseases caused or contributed to by S. uberis and/or against mastitis.
4. The method of claim 1, wherein the animal is a human, porcine, bovine, piscine, caprine and/or ovine animal.
Description
EXAMPLE 1
Materials, Methods & Results
(1) Bacterial Strains and Culture Conditions
(2) The reference strain, Streptococcus uberis 0140J (ATCC BAA-854) was used in this study, in addition to a further 69 S. uberis clinical isolates derived from cases of bovine and ovine mastitis from distinct farms within the UK, Italy and the USA, and comprised strains which either persisted or were cured following antibiotic therapy. For routine culture, bacteria were propagated in Brain Heart Infusion (BHI) broth or agar. Bacteria for inclusion in proteomic analyses were propagated in a defined medium to provide a suitable growth environment lacking medium-derived peptides that would interfere with a mass spectrometric approach. Irrespective of the medium used, cultures were incubated static at 37 C.
(3) Analysis of S. uberis Cell-Wall and Cell-Wall-Associated Proteins
(4) Twenty S. uberis strains, including the reference strain, were assessed in a proteomic analysis to identify putatively conserved proteins. Bacteria were propagated in 50 ml volumes to late exponential growth-phase; growth curves for each strain had been generated in a prior experiment, whereby growth was measured in the defined medium over time (data not shown). Bacterial cells were harvested by centrifugation at 30,000g for 20 m and washed twice with ice-cold PBS. Subsequently, in microcentrifuge tubes, the bacterial pellets were carefully re-suspended in 0.5 ml of PBS containing 40% (w/v) sucrose, 1 mM DTT and 20 g sequencing grade modified trypsin (Promega). Proteolytic digestion of cells to liberate cell-wall and cell-wall-associated proteins was carried out for 2 h at 37 C. with gentle shaking. Subsequently, the digestion mixtures were centrifuged at 30,000g for 10 m to pellet cells, and each supernatant was transferred to a fresh microcentrifuge tube. Incubation of supernatants was continued overnight at 37 C., then each was filtered through a 0.45 m Spin-X centrifuge tube filter (Corning) and stored in a refrigerator until required.
(5) Mass Spectrometric Analysis
(6) Peptide mixtures were cleaned using a C5-Reversed Phase HPLC column. Subsequently, filtered samples were subjected to liquid chromatography-electrospray ionisation-tandem mass spectrometry (LC-ESI-MS/MS) analysis. Liquid chromatography was performed using an UltiMate 3000 nano-HPLC system (Dionex) comprising a WPS-3000-well plate micro auto-sampler, a FLM-3000 flow manager and column compartment, a UVD-3000 UV detector, an LPG-3600 dual-gradient micro-pump and an SRD-3600 solvent rack controlled by Chromeleon chromatography software (Dionex: www1.dionex.com). A micro-pump flow rate of 246 l min.sup.1 was used in combination with a cap-flow splitter cartridge, affording a 1/82 flow split and a final flow rate of 3 l min.sup.1 through a 5 cm200 m ID monolithic reversed-phase column (Dionex/LC Packings) maintained at 50 C. Samples of 1-4 l were applied to the column by direct injection. Peptides were eluted by the application of a 15 min linear gradient from 8-45% solvent B (80% (w/v) acetonitrile, 0.1% (v/v) formic acid) and directed through a 3 nl UV detector flow cell. LC was interfaced directly with an Esquire HCTplus 3-D high capacity ion trap mass spectrometer (Bruker Daltonics) via a low-volume (50 l min.sup.1 maximum) stainless steel nebuliser (Agilent) and ESI. Parameters for tandem MS analysis were set as previously described (Batycka et al., Rapid Communications in Mass Spectrometry, vol. 20, issue 14, pp. 2074-2080, 2006).
(7) Deconvoluted MS/MS data was submitted to an in-house server running MASCOT (MATRIX SCIENCE), and searched against the fully-annotated S. uberis 0140J genome sequence (NC 012004) using the MASCOT search algorithm. To this end, the fixed- and variable-modifications selected were carbamidomethyl (C) and oxidation (M) respectively, and mass tolerance values for MS and MS/MS were set at 1.5 Da and 0.5 Da respectively. Molecular weight search (MOWSE) scores attained for individual protein identifications were inspected manually and considered significant only if two or more peptides were matched for each protein and identified peptide contained an unbroken b or y ion series of a minimum of four amino acid residues. An in-house software programme was used to process raw MASCOT data and generate non-redundant lists of proteins identified in each of the cell-wall sub-cellular fractions of the 20 S. uberis strains. Proteins which were present in 50% or greater of the 20 strains (Table 4a) were considered putative candidate antigens for vaccine development and were subjected to further study.
(8) Assessing Carriage of Candidate Antigen-Encoding Genes Among a Larger Panel of Strains
(9) To further appraise the conservation of proteins identified by mass spectrometry, PCR was used to determine the presence/absence of protein-coding sequences within the genomes of the larger panel of S. uberis strains. Genomic DNA of 69 S. uberis strains (including those strains assessed by mass spectrometry) was extracted from overnight cultures using the DNeasy Blood & Tissue Extraction Kit (Qiagen) as per the manufacturer's instructions for hard to lyse Gram-positive bacteria. Oligonucleotide primer pairs (Table 5) were designed to allow PCR amplification of each of the target genes. PCR was conducted using Taq PCR MasterMix Kit (Qiagen), as per the manufacturer's instructions. Following PCR, amplicons were visualised over UV light following electrophoresis through 1% (w/v) agarose gels containing GelRed. In all cases a PCR product was observed, indicative of the antigen encoding gene being present in each of the analysed strains. Subsequently, selected PCR products were analysed further by sequencing to confirm the identity of the amplified sequences (data not shown).
(10) Based upon the results of proteomic and genomic screening, 4 conserved targets were identified (Tables 4a, 5 and 6) and chosen for further assessment as candidate vaccine antigens.
(11) Production of Recombinant Antigens
(12) Each of the genes were amplified by PCR (as previously) from S. uberis 0140J genomic DNA using oligonucleotide primers designed to include appropriate restriction endonuclease recognition sites to facilitate in-frame cloning into the expression plasmid (Table 6). For genes predicted to contain a secretion signal peptide-encoding sequence (as determined using SignalP V.3.0; Bendtsen et al. 2004), each forward primer was designed to anneal, in-frame, immediately after the predicted signal peptide-encoding sequence. PCR amplicons were initially cloned using the TOPO TA Cloning Kit (Life Technologies Corp.). Subsequently, the S. uberis genes were cleaved from the TOPO vector using the primer-encoded restriction endonuclease sites; digests were electrophoresed through 1% (w/v) agarose gels, and the desired fragments were excised and purified using the QIAquick Gel extraction Kit (Qiagen). Finally, each S. uberis gene was cloned into pET-15b expression plasmid (Novagen), to allow expression of each protein with an N-terminal 6 histidine (his) residue tag to facilitate downstream purification.
(13) TABLE-US-00006 TABLE 4a List of proteins conserved amongst isolates selected by proteomic analysis. Locus tag Protein Conservation (%) SUB0423 ferrichrome binding protein 80 SUB0604 elongation factor Tu 50 SUB0950 Lipoprotein 65 SUB1868 serine protease 100
(14) TABLE-US-00007 TABLE5 Oligonucleotideprimersused forscreeningS.uberisstrains. Target Sequence gene (5-to-3) SUB0423 Forwardprimer GTTCTAGGAGATTAGAATTCA (SEQIDNO:9) Reverseprimer TTTGGTTTGTGTCCGTCATAA (SEQIDNO:10) SUB0604 Forwardprimer AGTAAGGTAAAGTTAGACTGT ATTG(SEQIDNO:11) Reverseprimer AGTTGTCTGACTCTAATTGTT AATC(SEQIDNO:12) SUB0950 Forwardprimer GTTATTGGCCATAAGGCTA (SEQIDNO:13) Reverseprimer TAAGGTCGCTCCACATTT (SEQIDNO:14) SUB1868 Forwardprimer AGGTAATGCCGTGTCTA (SEQIDNO:15) Reverseprimer ATGAATCCGAGGTTGGTA (SEQIDNO:16)
(15) TABLE-US-00008 TABLE6 PCRamplificationofcandidate antigen-encodinggenes. Primersequence Restriction (5-to-3) Targetgene* Primername siteadded (SEQIDNOS:17-24) SUB0423 ferrichromebinding SUB0423_NSP_FX XhoI CGCGCGCTCGAGATGTCACAAAGCACAAAG protein YP_002561776 SUB0423_NSP_RB BamHI CGCGCGGGATCCCTAGTTGTGAGTTTTCTG SUB0604 elongationfactorTu SUB0604_FX XhoI CGCGCGCTCGAGATGGCAAAAGAAAAATAC YP_002561947 SUB0604_R BamHI CGCGCGGGATCCTTAAGCTTCGATTTCTGA SUB0950 lipoprotein SUB0950_NSP_FX XhoI CGCGCGCTCGAGATGGATAGCAAAGATGCT YP_002562276 SUB0950_NSP_RB BamHI CGCGCGGGATCCTTATTATTTTTCAGGAACTTT SUB1868 serineproteinase SUB_NSP_FN NdeI CGCGCGCATATGACAAATCTTAATAAC YP_002563137 SUB_NSP_RX XhoI CGCGCGCTCGAGTTATTTTTCTAAATCTTTGGT *Target genes are listed according to their locus tag within the S. uberis 0140J genome (accession number NC 012004), and the name and accession number of the products they encode.
(16) Preliminary appraisal of the expression of each of the 14 proteins was conducted). Following electrophoresis through polyacrylamide gels, recombinant products were excised and subjected to MALDI-ToF MS. Mass spectrometric data was searched against the fully-annotated S. uberis 0140J genome sequence (NC 012004) using the MASCOT search algorithm to confirm the identities of the recombinant proteins (data not shown). Subsequently, 4 were chosen (based on the level of expression) for assessment in a preliminary vaccination experiment.
(17) Up-Scaled Expression of Candidate Antigens
(18) The 4 antigens chosen for further study were (N.B. r prefix denotes recombinant product) rSUB423 (ferrichrome binding protein), rSUB604 (elongation factor Tu), rSUB950 (lipoprotein) and rSUB1868 (serine protease). The coding sequences of each of the 4 antigens, and the corresponding translated amino acid sequences are presented in Table 3 (above).
(19) Starter cultures of Escherichia coli BL21(DE3) containing each of the 4 recombinant plasmids were propagated in Lysogenic Broth (LB) containing 50 g/ml of carbenicillin, overnight at 37 C. with shaking. These were then used to inoculate 1 l volumes of LB (containing 50 g/ml of carbenicillin) in 5 l conical flasks. Cultures were shaken at 37 C. until an OD.sub.600nm of 0.6 was reached. Expression of the recombinant genes was induced by supplementation of cultures with IPTG to a final concentration of 1 mM; incubation was then continued as before for a further 1 h, then rifampicin was added to a final concentration of 150 g/ml and incubation was continued for a further 3 h. Cells were harvested by centrifugation at 12,000g for 15 m at 4 C., and cell pellets containing recombinant proteins were retained. Two of the recombinant proteins (rSUB950 and rSUB1868) remained soluble during expression and could be purified under native conditions. In contrast, the remaining proteins (rSUB423 and rSUB604) formed inclusion bodies during extraction and required purification under denaturing conditions.
(20) Protein Purification Under Native Conditions
(21) The cell pellets containing rSUB950 and rSUB1868 were re-suspended in 20 ml each of lysis buffer (1 BugBuster protein extraction reagent (Merck Millipore), 50 mM Tris HCl pH 8.0, 500 mM NaCl, 10 mM imidazole, 25 U/ml Benzonase enzyme (Merck Millipore) and 1 Complete EDTA-free protease inhibitor cocktail (Roche Applied Science)) and incubated at 37 C. for 60 min to allow cell lysis and degradation of nucleic acids. Cell lysates were centrifuged at 22,000g for 30 m at 4 C. to pellet cell debris. Then, recombinant proteins in the clarified supernatants were recovered by immobilized metal ion affinity chromatography (IMAC) using Ni-CAM resin (Sigma). For each protein, 212 ml Eco-Pac Chromatography Columns (Bio-Rad) were loaded with 2 ml (bed volume) resin and washed by gravity flow with 10 ml of Equilibration Buffer (50 mM Tris HCl pH 8.0, 500 mM NaCl, 10 mM imidazole, 1 Complete EDTA-free protease inhibitor cocktail). The outlet of each column was sealed, and for each clarified lysate, 10 ml was added to each of 2 columns prior to sealing the inlet of each column with Parafilm (VWR). Columns were incubated on a tube rotator, overnight at 4 C. After incubation, columns were drained by gravity flow, and washed with 85 ml of Wash Buffer (50 mM Tris HCl pH 8.0, 500 mM NaCl, 10 mM imidazole, 1 Complete EDTA-free protease inhibitor cocktail). The recombinant protein in each column, bound to the Ni-CAM resin via the N-terminal 6his tag, was eluted in 52 ml of Elution Buffer (50 mM Tris HCl pH 8.0, 500 mM NaCl, 250 mM imidazole, 1 Complete EDTA-free protease inhibitor cocktail). Subsequently, the eluate of equivalent proteins was pooled, and each protein was concentrated using Amicon Ultra-15, 10 kDa M.sub.r cut-off, centrifugal filter units, as per the manufacturer's instructions.
(22) Purification Under Denaturing Conditions
(23) Cell pellets containing inclusion bodies were initially treated according to the native extraction protocol. Subsequently, cell pellets containing inclusion bodies were suspended in 20 ml of native lysis buffer. Lysozyme was added to a final concentration of 1 kU/ml and digestion was carried out at room temperature for 15 min. After incubation, an equal volume of BugBuster reagent (diluted in distilled water) was added to the suspensions, which were mixed by vortexing for 1 min and centrifuged at 5,000g for 15 min at 4 C. to collect inclusion bodies. Inclusion body pellets were then washed a further 3 times with 1:10 diluted BugBuster, as previously. Finally, each inclusion body was dissolved in 20 ml of 8 M urea (pH 8.0) at room temperature for 15 m, and then centrifuged at 5,000g for 15 m at room temperature to pellet (remove) insoluble material. Subsequently, purification of each protein was performed using Ni-CAM resin, as described elsewhere except that the column buffers used for native purification were replaced with: Equilibration Buffer (0.1 M sodium phosphate, 8 M urea pH 8.0), Wash Buffer (0.1 M sodium phosphate, 8 M urea pH 6.3), and Elution Buffer (0.1 M sodium phosphate, 8 M urea pH 4.5).
(24) Size Exclusion High-Performance Liquid Chromatography (HPLC)
(25) Size exclusion HPLC was performed using a Superose 12 10/300GL column (GE Healthcare) pre-equilibrated with 1PBS, pH6.8 (for native, soluble proteins) or 8 M urea in 1PBS, pH6.8 (for denatured, insoluble proteins). Individual injections of 200 ml were applied to the column and proteins were resolved over a period of 60 m at a flow rate of 0.5 ml/m. The proteins that eluted from the column were monitored spectrophotometrically at a wavelength of 280 nm. For each protein, fractions of 1 ml were collected, and those corresponding to peaks of UV-absorbent material were examined for the presence of protein by SDS-PAGE and Coomassie Brilliant Blue staining. For each protein, eluted fractions observed to contain an enriched source of the protein of interest were pooled and concentrated by centrifugation with amicon ultra filters (10 kDa cut off).
(26) Each of the 4 recombinant proteins was subjected to MALD-TOF MS, and mass spectrometric data was searched against the fully-annotated S. uberis 0140J genome sequence (NC 012004) using the MASCOT search algorithm to confirm that the identities of the recombinant proteins were as expected (data not shown).
SUMMARY
(27) In order to facilitate the development of a new mastitis vaccine, we have conducted a study to identify those proteins which are produced by a diverse sub-set of the S. uberis population. The work was conducted with no prior assumption that any particular class of protein (e.g. putative virulence factor) would signify a better vaccine candidate than any other class of protein, but rather that conservation between species was of primary importance.
(28) Preliminary proteomic analysis of the cell-wall sub-cellular fraction of a number of diverse S. uberis strains allowed the identification of a panel of candidate antigens. Subsequently, the carriage of the genes encoding these antigens was assessed among a wider population of S. uberis strains. In so doing, the panel of candidate antigens was refined further, and proof of concept that these antigens could be used as vaccine(s) was obtained by production of recombinant derivatives of 4 of the proteins, and using these to successfully protect dairy cattle against mastitis following experimental heterologous challenge with S. uberis (see Example 2 below).
EXAMPLE 2
S. uberis Vaccines in Cattle
(29) Streptococcus uberis is Gram-positive bacterium, with a cell wall structure similar to Staphylococcus spp., as well as other streptococci such as S. agalactiae and S. dysgalactiae. Streptococcus uberis is the most common Streptococcus species isolated from cases of mastitis. The S. uberis is found in the udder, in the intestine, and on the cow's skin and teats, which is where most streptococci tend to be. The particularity of S. uberis is its extraordinary ability to contaminate the external environment, i.e. in the bedding or anywhere on an animal. The contamination can take place during milking or from subsequent contact with S. uberis elsewhere in the environment. The particular ecology of S. uberis makes it particularly difficult to fight against this bacterium.
(30) Materials, Methods and Results
(31) Antigens
(32) The potential antigens, described above, were used for vaccination of cows against S. uberis. Specifically, the following antigens were selected for the study:
(33) SUB0423-ferrichrome binding protein
(34) SUB0604elongation factor Tu
(35) SUB0950lipoprotein
(36) SUB1868Serine protease
(37) The treatments were as follows:
(38) TABLE-US-00009 TABLE 13 Group Antigen Concentration Adjuvant T01 Saline N/A Saline: 0.85% NaCl T02 SUB0423 + SUB0604 75 ug/2 ml TXO: CpG 250 ug T03 SUB0950 + SUB1868 (SEQID NO: 8)/ Dextran DEAE T04 0423 + 0604 + 0950 + 100 mg/Oil 51% v/v 1868
(39) Animals were allotted at day 7 and vaccinated on days zero and 28. Calving occurred on day 49. Samples of blood and milk were taken on days zero, 7, 28, 35, 49, 63, 70, and 84. The cows were challenged on day 70.
(40) All calves were born alive in groups T2 and T4. One calf (out of 10) in T01 was still born. One calf (out of 10) in T03 died due to dystocia.
(41) The following milk quality scoring system was implemented to indicate severity of abnormal signs: 0=Normal 1=Flakes 2=Slugs/Clots 3=Stringy/Watery/Bloody
(42) The results of milk evaluation are summarized in Table 8 below:
(43) TABLE-US-00010 TABLE 14 Milk Appearance: At least 1 quarter with score equal or greater than 2? No Yes Total Number % Number % Number T01 1 14.3 6 85.7 7 T02 2 25 6 75 8 T03 1 11.1 8 88.9 9 T04 4 50 4 50 8
(44) The following udder evaluation scoring system was implemented: 0=Normal 1=Slight swelling 2=Moderate swelling 3=Severe
(45) The results of udder evaluation are summarized in Table 9 below:
(46) TABLE-US-00011 TABLE 15 Udder Evaluation: At least 1 quarter with score equal or greater than 2? No Yes Total Number % Number % Number T01 1 14.3 6 85.7 7 T02 2 25 6 75 8 T03 1 11.1 8 88.9 9 T04 4 50 4 50 8
(47) These results demonstrate that a combination antigen (as in T04) provides the best protection against mastitis, without affecting the calving of treated cows.
REFERENCES
(48) 1) HARDIE, J. M. 1986 Other streptococci. In Bergey's Manual of Systematic Bacteriology Vol. 2, ed. Sneath, P. H. A., Mair, N. S., Sharp, M. E. & Holt, J. G. pp. 1068-1071. Baltimore: Williams & Wilkins. 2) T. J. Coffey, G. D. Pullinger, R. Urwin, K. A. Jolley, S. M. Wilson, M. C. Maiden, J. A. Leigh First insights into the evolution of Streptococcus uberis: A multilocus sequence typing scheme that enables investigation of its population biology. Appl. Environ. Microbiol., 72 (2006), pp. 1420-1428 3). Williams A M, Collins M D. 1990. Molecular taxonomic studies on Streptococcus uberis types I and II. Description of Streptococcus parauberis sp. nov. J. Appl. Bacteriol. 68:485-490. 4). Nho S W, Hikima J, Cha I S, Park S B, Jang H B, del Castillo C S, Kondo H, Hirono I, Aoki T, Jung T S. 2011. Complete genome sequence and immunoproteomic analyses of the bacterial fish pathogen Streptococcus parauberis. Journal of Bacteriology. 193:3356-3366. 5) Altschul, S. F., Gish, W., Miller, W., Myers, E. W. & Lipman, D. J. (1990) Basic local alignment search tool. J. Mol. Biol. 215:403-410.