Non-standard insulin analogues

10745458 ยท 2020-08-18

Assignee

Inventors

Cpc classification

International classification

Abstract

An insulin analogue comprises a B-chain polypeptide containing a cyclohexanylalanine substitution at position B24 and optionally containing additional amino-acid substitutions at positions A8, B28, and/or B29. A proinsulin analogue or single-chain insulin analogue contains a B domain containing a cyclohexanylalanine substitution at position B24 and optionally contains additional amino-acid substitutions at positions A8, B28, and/or B29. The analogue may be an analogue of a mammalian insulin, such as human insulin. A nucleic acid encoding such an insulin analogue is also provided. A method of lowering the blood sugar of a patient comprises administering a physiologically effective amount of the insulin analogue or a physiologically acceptable salt thereof to a patient. A method of semi-synthesis using an unprotected octapeptide by means of modification of an endogenous tryptic site by non-standard amino-acid substitutions.

Claims

1. An insulin analogue comprising the insulin B-chain polypeptide containing a cyclohexanylalanine substitution at position B24, relative to wild type insulin.

2. The insulin analogue of claim 1, additionally comprising a substitution at position B29 selected from the group consisting of norleucine, aminobutyric acid, aminopropionic acid, ornithine, diaminobutyric acid, and diaminopropionic acid.

3. The insulin analogue of claim 1, wherein the insulin B-chain polypeptide additionally comprises a substitution at position B28.

4. The insulin analogue of claim 3, wherein the insulin B-chain polypeptide comprises substitutions at both positions B28 and B29.

5. The insulin analogue of claim 4, wherein the insulin B-chain polypeptide additionally comprises an insulin A-chain polypeptide containing a Glu substitution at position A8.

6. The insulin analogue of claim 5, wherein the insulin B-chain polypeptide additionally comprises a paired substitution selected from a Lysine substitution at position B28 with a Proline substitution at position B29, or an Aspartic acid substitution at position B28 with a Proline substitution at position B29.

7. The insulin analogue of claim 1, wherein the B-chain polypeptide comprises amino acid residues 1-24 of SEQ ID NO: 4.

8. The insulin analogue of claim 7, wherein the amino acid at position 10 of SEQ ID NO: 4 is His.

9. The insulin analogue of claim 7, wherein the amino acid at position 10 of SEQ ID NO: 4 is Asp.

10. The insulin analogue of claim 1, wherein the B-chain polypeptide comprises SEQ ID NO: 12, wherein the residue at position 2 of SEQ ID NO: 12 is cyclohexanylalanine.

11. A nucleic acid encoding the insulin analogue according to claim 1.

12. An expression vector comprising the nucleic acid of claim 11.

13. A host cell transformed with the expression vector of claim 12.

14. A method of lowering the blood sugar of a patient comprising administering a physiologically effective amount of the insulin analogue according to claim 1 or a physiologically acceptable salt thereof to the patient.

15. The method of claim 14, wherein the insulin analogue or a physiologically acceptable salt thereof additionally comprises one or more of: i. a glutamic acid substitution at position A8, ii. a lysine substitution at position B28 and iii. a proline substitution at position B29.

16. The method of claim 15, wherein the insulin analogue or a physiologically acceptable salt thereof comprises at least two of: i. a glutamic acid substitution at position A8, ii. a lysine substitution at position B28 and iii. a proline substitution at position B29.

17. The method of claim 14, wherein the insulin analogue or a physiologically acceptable salt thereof comprises amino acid residues 1-24 of SEQ ID NO:4.

18. The method of claim 17, wherein the amino acid at position 10 of SEQ ID NO: 4 is His.

19. The method of claim 17, wherein the amino acid at position 10 of SEQ ID NO: 4 is Asp.

20. The method of claim 14, wherein the insulin analogue or a physiologically acceptable salt thereof comprises SEQ ID NO:12, wherein the residue at position 2 of SEQ ID NO:12 is cyclohexanylalanine.

Description

BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS

(1) FIG. 1A is a schematic representation of the sequence of human proinsulin (SEQ ID NO:1) including the A- and B-chains and the connecting region shown with flanking dibasic cleavage sites (filled circles) and C-peptide (open circles).

(2) FIG. 1B is a structural model of proinsulin, consisting of an insulin-like moiety and a disordered connecting peptide (dashed line).

(3) FIG. 1C is a schematic representation of the sequence of human insulin indicating the position of residue B24 in the B-chain. The top sequence is insulin A-chain which is SEQ ID NO: 2 and the bottom sequence is insulin B-chain which is SEQ ID NO: 3.

(4) FIG. 1D is a ribbon model of an insulin monomer showing aromatic residue of Phe.sup.B24 in relation to the three disulfide bridges. The adjoining side chains of Leu.sup.B15 (arrow) and Phe.sup.B24 are shown. The A- and B-chain chains are otherwise shown in light and dark gray, respectively, and the sulfur atoms of cysteines as circles.

(5) FIG. 1E is a space-filling model of insulin showing the Phe.sup.B24 side chain within a pocket at the edge of the hydrophobic core.

(6) FIG. 2A is a series of ball and stick (top) and space-filling (bottom) representations of Phenylalanine (Phe).

(7) FIG. 2B is a series of ball and stick (top) and space-filling (bottom) representations of Cyclohexanylalanine (Cha).

(8) FIG. 3A is a view of a structural model depicting wild-type insulin monomer as extracted from the crystal structure of the T.sub.6 zinc insulin hexamer (Protein Databank accession code 4INS).

(9) FIG. 3B is a view of a structural model of wild-type insulin dimer as extracted from the crystal structure of the T.sub.6 zinc insulin hexamer (Protein Databank accession code 4INS).

(10) FIG. 3C is a view of a structural model predicting the fit of Cyclohexanylalanine at position B24 in a variant insulin monomer.

(11) FIG. 3D is a view of a structural model predicting the fit of Cyclohexanylalanine at position B24 in a variant insulin dimer.

(12) FIG. 4 is a graph showing the results of receptor-binding studies of insulin analogues. Relative activities for the B isoform of the insulin receptor (IR-B) are determined by competitive binding assay in which receptor-bound .sup.125I-labeled human insulin is displaced by increasing concentrations of human insulin (.circle-solid., SEQ ID NOS: 2 and 3) or its analogues: KP-insulin (.box-tangle-solidup., SEQ ID NOS: 2 and 20) and Cha.sup.B24-KP-insulin (.Math., SEQ ID NOS: 2 and 6).

(13) FIG. 5A provides 2D .sup.1H-NMR NOESY spectra of DKP-insulin recorded at 700 MHz at 32 C. and pD 7.0, including TOCSY spectrum of aromatic region (left) and NOESY spectrum (right) providing inter-proton contacts between aromatic protons (vertical axis) and aliphatic protons (horizontal axis). Arrow indicates characteristic upfield shift of Leu.sup.B15 methyl resonance due to ring current of Phe.sup.B24 The disorder of Phe.sup.B25 on the surface of an insulin monomer by contrast attenuates its ring-current effects.

(14) FIG. 5B is a 2D .sup.1H-NMR NOESY spectra of Cha.sup.B24-DKP-insulin (SEQ ID NOS: 2 and 21) recorded at 700 MHz at 32 C. and pD 7.0, including TOCSY spectrum of aromatic region (left) and NOESY spectrum (right) providing inter-proton contacts between aromatic protons (vertical axis) and aliphatic protons (horizontal axis). Resonance assignments are as indicated. Empty box highlights absence of ring-current-shifted resonances due to non-aromatic nature of Cha.sup.B24.

(15) FIG. 5C is a 2D .sup.1H-NMR NOESY spectra of Cha.sup.B25-DKP-insulin (SEQ ID NOS: 2 and 22) recorded at 700 MHz at 32 C. and pD 7.0, including TOCSY spectrum of aromatic region (left) and NOESY spectrum (right) providing inter-proton contacts between aromatic protons (vertical axis) and aliphatic protons (horizontal axis). Resonance assignments are as indicated. Arrow indicates characteristic upfield shift of Leu.sup.B15 methyl resonance due to ring current of Phe.sup.B24.

(16) FIG. 6A is a graph showing the results of receptor-binding studies of wild type human insulin (.square-solid., SEQ ID NOS: 2 and 3), KP-insulin (.circle-solid., SEQ ID NOS: 2 and 20), Cha.sup.B24-KP-insulin (.box-tangle-solidup., SEQ ID NOS: 2 and 6) or Glu.sup.A8-Cha.sup.B24-KP-insulin (.Math., SEQ ID NOS: 19 and 6) using isolated insulin receptor (isoform B).

(17) FIG. 6B is a graph showing the results of receptor-binding studies of wild type human insulin (.square-solid., SEQ ID NOS: 2 and 3), KP-insulin (.circle-solid., SEQ ID NOS: 2 and 20), Cha.sup.B24-KP-insulin (.box-tangle-solidup., SEQ ID NOS: 2 and 6) or Glu.sup.A8-Cha.sup.B24-KP-insulin (.Math., SEQ ID NOS: 19 and 6) using human IGF-1 receptor.

DETAILED DESCRIPTION OF THE INVENTION

(18) The present invention is directed an insulin analogue that provides a more rapid rate of hexamer disassembly where the analogue then maintains at least a portion of biological activity of the corresponding unmodified insulin or insulin analogue.

(19) The present invention pertains to non-standard modifications at position B24 to improve the properties of insulin with respect to rapidity of absorption following subcutaneous injection. In one instance the non-standard amino acid lacks aromaticity and its associated asymmetric distribution of partial positive and negative charges as demonstrated by substitution of the non-planar aliphatic ring system of cyclohexanylalanine. Loss of planarity in a non-aromatic ring system is associated with a change in its topographical contours and an increase in side-chain volume (FIG. 2B) relative to phenylalanine (FIG. 2A).

(20) In one embodiment, the present invention provides an insulin analogue that provides more rapid hexamer disassembly by substitution of phenylalanine at position B24 by a non-standard amino acid. In one particular embodiment the more rapid hexamer disassembly is directed by substitution of cyclohexanylalanine at position B24. The present invention is not limited, however, to human insulin and its analogues. It is also envisioned that these substitutions may also be made in animal insulins such as porcine, bovine, equine, and canine insulins, by way of non-limiting examples.

(21) It has also been discovered that Cha.sup.B24-KP-insulin (SEQ ID NOS: 2 and 4), when formulated in Lilly Diluent and following subcutaneous injection in a male Lewis rat rendered diabetic by streptozotocin, will direct a reduction in blood glucose concentration with a potency similar to that of KP-insulin in the same formulation.

(22) In addition or in the alternative, the insulin analogue of the present invention may contain a non-standard amino-acid substitution at position 29 of the B chain, which is lysine (Lys) in wild-type insulin. In one particular example, the non-standard amino acid at B29 is norleucine (Nle). In another particular example, the non-standard amino acid at B29 is ornithine (Orn).

(23) Furthermore, in view of the similarity between human and animal insulins, and use in the past of animal insulins in human patients with diabetes mellitus, it is also envisioned that other minor modifications in the sequence of insulin may be introduced, especially those substitutions considered conservative. For example, additional substitutions of amino acids may be made within groups of amino acids with similar side chains, without departing from the present invention. These include the neutral hydrophobic amino acids: Alanine (Ala or A), Valine (Val or V), Leucine (Leu or L), Isoleucine (Ile or I), Proline (Pro or P), Tryptophan (Trp or W), Phenylalanine (Phe or F) and Methionine (Met or M). Likewise, the neutral polar amino acids may be substituted for each other within their group of Glycine (Gly or G), Serine (Ser or S), Threonine (Thr or T), Tyrosine (Tyr or Y), Cysteine (Cys or C), Glutamine (Glu or Q), and Asparagine (Asn or N). Basic amino acids are considered to include Lysine (Lys or K), Arginine (Arg or R) and Histidine (His or H). Acidic amino acids are Aspartic acid (Asp or D) and Glutamic acid (Glu or E). Unless noted otherwise or wherever obvious from the context, the amino acids noted herein should be considered to be L-amino acids.

(24) Standard amino acids may also be substituted by non-standard amino acids belong to the same chemical class. By way of non-limiting example, the basic side chain Lys may be replaced by basic amino acids of shorter side-chain length (Ornithine, Diaminobutyric acid, or Diaminopropionic acid). Lys may also be replaced by the neutral aliphatic isostere Norleucine (Nle), which may in turn be substituted by analogues containing shorter aliphatic side chains (Aminobutyric acid or Aminopropionic acid).

(25) In one example, the insulin analogue of the present invention contains three or fewer conservative substitutions other than the cyclic aliphatic substitution of the present invention.

(26) As used in this specification and the claims, various amino acids in insulin or an insulin analogue may be noted by the amino-acid residue in question, followed by the position of the amino acid, optionally in superscript. The position of the amino acid in question includes the A- or B chain of insulin where the substitution is located. Thus, Phe.sup.B24 denotes a phenylalanine at the twenty-fourth amino acid of the B chain of insulin. Unless noted otherwise or wherever obvious from the context, the location of substitutions should be understood to be relative to and in the context of human insulin. Aromatic and non-aromatic rings differ in planarity, reflecting the presence (Phe) or absence (Cha) of 7E electrons as illustrated in front and side views of Phenylalanine (FIG. 2A) relative to Cyclohexanylalanine (FIG. 2B).

(27) Although not wishing to be constrained by theory, the present invention envisions that modifications at B24 that alter the weakly polar character of the ring system and/or enlarge its topographical contours would more readily be accommodated in the insulin monomer than at the dimer interface and so be associated with accelerated disassembly. In particular, because the dimer interface is characterized by multiple aromatic-aromatic interactions involving Phe.sup.B24 and six other aromatic rings (Tyr.sup.B16, Phe.sup.B25, Tyr.sup.B26, and their symmetry-related partners), the present invention further envisions that loss of aromaticity at position B24 would in general accelerate the disassembly of insulin hexamers and further accelerate the disassembly of variant hexamers containing destabilizing mutations elsewhere in the dimer- or trimer interface. Although the three-dimensional structure of a Cha.sup.B24 variant of human insulin has not been determined, insight may be gained from rigid-body modeling based on the crystal structure of wild-type insulin (FIG. 3). A molecular model depicting the packing of Cha.sup.B24 within an insulin monomer is shown in FIG. 3C relative to the wild-type Phe.sup.B24 as shown in FIG. 3A. A molecular model depicting the packing of Cha.sup.B24 within an insulin dimer interface is shown in FIG. 3D relative to the wild-type Phe.sup.B24 as shown in FIG. 3A.

(28) The phenylalanine at B24 is an invariant amino acid in functional insulin and contains an aromatic side chain. The biological importance of Phe.sup.B24 in insulin is indicated by a clinical mutation (Ser.sup.B24) causing human diabetes mellitus. As illustrated in FIGS. 1D and 1E, and while not wishing to be bound by theory, Phe.sup.B24 is believed to pack at the edge of a hydrophobic core at the classical receptor binding surface. The models are based on a crystallographic protomer (2-Zn molecule 1; Protein Databank identifier 4INS). Lying within the C-terminal -strand of the B-chain (SEQ ID NO: 3 residues 24-28), Phe.sup.B24 adjoins the central a-helix (SEQ ID NO: 3 residues 9-19). In the insulin monomer one face and edge of the aromatic ring sit within a shallow pocket defined by Leu.sup.B15 and Cys.sup.B19; the other face and edge are exposed to solvent (FIG. 1E). This pocket is in part surrounded by main-chain carbonyl and amide groups and so creates a complex and asymmetric electrostatic environment with irregular and loose steric borders. In the insulin dimer, and within each of the three dimer interfaces of the insulin hexamer, the side chain of Phe.sup.B24 packs within a more tightly contained spatial environment as part of a cluster of eight aromatic rings per dimer interface (Tyr.sup.B16, Phe.sup.B24, Phe.sup.B25, Tyr.sup.B26 and their dimer-related mates). Irrespective of theory, substitution of the aromatic ring of Phe.sup.B24 by a cyclic aliphatic ring of the same number of carbon atoms, but differing in its volume, stereo-electronic properties, and lack of planarity, provides an opportunity to preserve general hydrophobic packing within the dimer interface of the insulin hexamer while imposing distinct spatial packing constraints and perturbing the asymmetric electrostatic environment of the wild-type aromatic ring.

(29) The present invention pertains to a non-standard modification at position B24 to improve the properties of insulin or insulin analogues with respect to rapidity of absorption following subcutaneous injection. In one instance the non-standard amino acid lacks aromaticity and its associated asymmetric distribution of partial positive and negative charges as demonstrated by substitution of the non-planar aliphatic ring system of Cyclohexanylalanine. Loss of planarity in a non-aromatic ring system is associated with a change in topographical contours and an increase in side-chain volume (FIG. 2B) relative to phenylalanine (FIG. 2A). In other instances the non-standard amino-acid substitution at B24 is accompanied by a non-standard substitution at position B29 or by three or fewer standard substitutions elsewhere in the A- or B chains.

(30) It is envisioned that the substitutions of the present invention may be made in any of a number of existing insulin analogues. For example, the cyclic aliphatic side chain (Cha) substitution at position B24 provided herein may be made in insulin analogues such as insulin Lispro ([Lys.sup.B28, Pro.sup.B29]-insulin, herein abbreviated KP-insulin), insulin Aspart (Asp.sup.B28-insulin), other modified insulins or insulin analogues, or within various pharmaceutical formulations, such as regular insulin, NPH insulin, lente insulin or ultralente insulin, in addition to human insulin. Insulin Aspart contains an Asp.sup.B28 substitution and is sold as Novalog whereas insulin Lispro contains Lys.sup.B28 and Pro.sup.B29 substitutions and is known as and sold under the name Humalog. These analogues are described in U.S. Pat. Nos. 5,149,777 and 5,474,978, the disclosures of which are hereby incorporated by reference herein. These analogues are each known as fast-acting insulins.

(31) The amino-acid sequence of human proinsulin is provided, for comparative purposes, as SEQ ID NO: 1.

(32) TABLE-US-00001 (humanproinsulin) SEQIDNO:1 Phe-Val-Asn-Gln-His-Leu-Cys-Gly-Ser-His-Leu-Val- Glu-Ala-Leu-Tyr-Leu-Val-Cys-Gly-Glu-Arg-Gly-Phe- Phe-Tyr-Thr-Pro-Lys-Thr-Arg-Arg-Glu-Ala-Glu-Asp- Leu-Gln-Val-Gly-Gln-Val-Glu-Leu-Gly-Gly-Gly-Pro- Gly-Ala-Gly-Ser-Leu-Gln-Pro-Leu-Ala-Leu-Glu-Gly- Ser-Leu-Gln-Lys-Arg-Gly-Ile-Val-Glu-Gln-Cys-Cys- Thr-Ser-Ile-Cys-Ser-Leu-Tyr-Gln-Leu-Glu-Asn-Tyr- Cys-Asn

(33) The amino-acid sequence of the A chain of human insulin is provided as SEQ ID NO: 2.

(34) TABLE-US-00002 (humanAchain) SEQIDNO:2 Gly-Ile-Val-Glu-Gln-Cys-Cys-Thr-Ser-Ile-Cys-Ser- Leu-Tyr-Gln-Leu-Glu-Asn-Tyr-Cys-Asn

(35) The amino-acid sequence of the B chain of human insulin is provided as SEQ ID NO: 3.

(36) TABLE-US-00003 (humanBchain) SEQIDNO:3 Phe-Val-Asn-Gln-His-Leu-Cys-Gly-Ser-His-Leu-Val- Glu-Ala-Leu-Tyr-Leu-Val-Cys-Gly-Glu-Arg-Gly-Phe- Phe-Tyr-Thr-Pro-Lys-Thr

(37) The amino-acid sequence of a B chain of human insulin may be modified with a substitution of a Cyclohexanylalanine (Cha) at position B24. An example of such a sequence is provided as SEQ. ID. NO 4.

(38) TABLE-US-00004 SEQIDNO:4 Phe-Val-Asn-Gln-His-Leu-Cys-Gly-Ser-Xaa.sub.4-Leu-Val- Glu-Ala-Leu-Tyr-Leu-Val-Cys-Gly-Glu-Arg-Gly-Xaa.sub.1- Phe-Tyr-Thr-Xaa.sub.2-Xaa.sub.3-Thr [Xaa.sub.1isCha;Xaa.sub.2isAsp,Pro,Lys,orArg;Xaa.sub.3 isLys,Pro,orAla;andXaa.sub.4isHisorAsp]

(39) Substitution of a Cha at position B24 may optionally be combined with non-standard substitutions at position B29 as provided in SEQ. ID. NO 5.

(40) TABLE-US-00005 SEQIDNO:5 Phe-Val-Asn-Gln-His-Leu-Cys-Gly-Ser-Xaa.sub.3-Leu-Val- Glu-Ala-Leu-Tyr-Leu-Val-Cys-Gly-Glu-Arg-Gly-Xaa.sub.1- Phe-Tyr-Thr-Pro-Xaa.sub.2-Thr [Xaa.sub.1isCha;Xaa.sub.2isAsp,Pro;Xaa.sub.2isOrnithine, Diaminobutyricacid,Diaminoproprionicacid, Norleucine,Aminobutricacid,orAminoproprionic acid;andXaa.sub.3isHisorAsp]

(41) Further combinations of other substitutions are also within the scope of the present invention. It is also envisioned that the substitutions and/or additions of the present invention may also be combined with substitutions of prior known insulin analogues. For example, the amino-acid sequence of an analogue of the B chain of human insulin containing the Lys.sup.B28 and Pro.sup.B29 substitutions of insulin Lispro, in which the Cha.sup.B24 substitution may also be introduced, is provided as SEQ ID NO: 6.

(42) TABLE-US-00006 SEQIDNO:6 Phe-Val-Asn-Gln-His-Leu-Cys-Gly-Ser-His-Leu-Val- Glu-Ala-Leu-Tyr-Leu-Val-Cys-Gly-Glu-Arg-Gly-Xaa.sub.1- Phe-Tyr-Thr-Lys-Pro-Thr [Xaa.sub.1isCha]

(43) Similarly, the amino-acid sequence of an analogue of the B chain of human insulin containing the Asp.sup.B28 substitution of insulin Aspart, in which the Cha.sup.B24 substitution may also be introduced, is provided as SEQ ID NO: 7.

(44) TABLE-US-00007 SEQIDNO:7 Phe-Val-Asn-Gln-His-Leu-Cys-Gly-Ser-His-Leu-Val- Glu-Ala-Leu-Tyr-Leu-Val-Cys-Gly-Glu-Arg-Gly-Xaa.sub.1- Phe-Tyr-Thr-Asp-Lys-Thr [Xaa.sub.1isCha]

(45) A Cha.sup.B24 substitution may also be introduced in combination with other insulin analogue substitutions such as analogues of human insulin containing His substitutions at residues A4, A8 and/or B1 as described more fully in International Application No. PCT/US07/00320 and U.S. application Ser. No. 12/160,187, now U.S. Pat. No. 8,343,914, the disclosures of which are incorporated by reference herein. For example, the Cha.sup.B24 substitution may be present with His.sup.A8 and/or His.sup.B1 substitutions in a single-chain insulin analogue or proinsulin analogue having the amino-acid sequence represented by SEQ ID NO: 8,

(46) TABLE-US-00008 SEQIDNO:8 Xaa.sub.1-Val-Asn-Gln-His-Leu-Cys-Gly-Ser-His-Leu-Val- Glu-Ala-Leu-Tyr-Leu-Val-Cys-Gly-Glu-Arg-Gly-Xaa.sub.8- Phe-Xaa.sub.2-Thr-Xaa.sub.3-Xaa.sub.4-Thr-Xaa.sub.5-Gly-Ile-Val-Xaa.sub.6- Gln-Cys-Cys-Xaa.sub.7-Ser-Ile-Cys-Ser-Leu-Tyr-Gln-Leu- Glu-Asn-Tyr-Cys-Asn;

(47) wherein Xaa.sub.1 is His or Phe; wherein Xaa.sub.2 is Tyr or Phe, Xaa.sub.3 is Pro, Lys, or Asp; wherein Xaa.sub.4 is Lys or Pro; wherein Xaa.sub.6 is His or Glu; wherein Xaa.sub.7 is His or Thr; wherein Xaa.sub.5 is 0-35 of any amino acid or a break in the amino-acid chain; and wherein Xaa.sub.8 is Cha; and further wherein at least one substitution selected from the group of the following amino-acid substitutions is present: Xaa.sub.1 is His; and Xaa.sub.7 is His; and

(48) Xaa.sub.6 and Xaa.sub.7 together are His.

(49) A Cyclohexanylalanine substitution at B24 and/or two amino acid addition may also be introduced into a single-chain insulin analogue as disclosed in U.S. patent application Ser. No. 12/419,169, now U.S. Pat. No. 8,192,957, the disclosure of which is incorporated by reference herein.

(50) In still another embodiment, the B-chain insulin analogue polypeptide contains a Lysine at position B3, Glutamic acid at position B29, and Cyclohexanylalanine at position B24 as provided as SEQ ID NO: 9.

(51) TABLE-US-00009 SEQIDNO:9 Phe-Val-Lys-Gln-His-Leu-Cys-Gly-Ser-His-Leu-Val- Glu-Ala-Leu-Tyr-Leu-Val-Cys-Gly-Glu-Arg-Gly-Xaa.sub.1- Phe-Tyr-Thr-Pro-Glu-Thr.

(52) Wherein Xaa.sub.1 is Cyclohexanylalanine.

(53) Cyclohexanylalanine was introduced within an engineered insulin monomer of native activity, designated KP-insulin, which contains the substitutions Lys.sup.B28 (K) and Pro.sup.B29 (P). These two substitutions on the surface of the B-chain are believed to impede formation of dimers and hexamers but be compatible with hexamer assembly in the presence of zinc ions and a phenolic preservative. KP-insulin is the active ingredient of Humalog, currently in clinical use as a rapid-acting insulin analogue formulation. The sequence of the B-chain polypeptide for this variant of KP-insulin is provided as SEQ ID NO: 6. Cyclohexanylalanine was also introduced at position B24 (SEQ ID NO: 21), and separately at position B25 (SEQ ID NO: 22) as a control analogue, within an engineered insulin monomer of enhanced activity, designated DKP-insulin, which contains the substitution Asp.sup.B10 (D) in addition to the KP substitutions Lys.sup.B28 (K) and Pro.sup.B29 (P) in accordance with the general scheme provided in SEQ. ID. NO 4. Cha.sup.B24 was also introduced into non-standard human insulin analogues containing either Ornithine or Norleucine at position B29 in accordance with the general scheme provided in SEQ. ID. NO 5.

(54) Analogues of KP-insulin and DKP-insulin were prepared by trypsin-catalyzed semi-synthesis and purified by high-performance liquid chromatography (Mirmira, R. G., and Tager, H. S., 1989. J. Biol. Chem. 264: 6349-6354.) This protocol employs (i) a synthetic octapeptide representing residues (N)-GF*FYTKPT (including modified residue (F*) and KP substitutions (underlined); SEQ ID NO: 12) and (ii) truncated analogue des-octapeptide[B23-B30]-insulin or, in the case of DKP-insulin analogues, Asp.sup.B10-des-octapeptide[B23-B30]-insulin (SEQ ID NO: 10). Because the octapeptide differs from the wild-type B23-B30 sequence (GF*FYTPKT; SEQ ID NO: 11) by interchange of Pro.sup.B28 and Lys.sup.B29 (italics), protection of the lysine c-amino group is not required during trypsin treatment. In brief, des-octapeptide (15 mg) and octapeptide (15 mg) were dissolved in a mixture of dimethylacetamide/1,4-butandiol/0.2 M Tris acetate (pH 8) containing 10 mM calcium acetate and 1 mM ethylene diamine tetra-acetic acid (EDTA) (35:35:30, v/v, 0.4 mL). The final pH was adjusted to 7.0 with 10 L of N-methylmorpholine. The solution was cooled to 12 C., and 1.5 mg of TPCK-trypsin was added and incubated for 2 days at 12 C. An additional 1.5 mg of trypsin was added after 24 hr. The reaction was acidified with 0.1% trifluoroacetic acid and purified by preparative reverse-phase HPLC (C4). Mass spectrometry using matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF; Applied Biosystems, Foster City, Calif.) in each case gave expected values (not shown). The general protocol for solid-phase synthesis is as described (Merrifield et al., 1982. Biochemistry 21: 5020-5031). 9-fluoren-9-yl-methoxy-carbonyl (F-moc)-protected phenylalanine analogues were purchased from Chem-Impex International (Wood Dale, Ill.).

(55) The above protocol was also employed to prepare analogues of human insulin containing Ornithine or Norleucine at position B29 and to introduce Cha.sup.B24 in these respective contexts. The method of preparation of these analogues exploits non-standard amino-acid substitutions at position 29 to eliminate the tryptic site ordinarily present within the C-terminal octapeptide of the B chain (i.e., between Lys.sup.B29 and Thr.sup.B30) while maintaining a Proline at position 28. Pro.sup.B28 contributes to the stability of the dimer interface within the insulin hexamer, and so this method of preparation provides near-isosteric models of wild-type insulin in which other modifications may conveniently be incorporated without the need for cumbersome side-chain protection.

(56) Circular dichroism (CD) spectra were obtained at 4 C. and/or 25 C. using an Aviv spectropolarimeter (Weiss et al., Biochemistry 39: 15429-15440). Samples contained ca. 25 M DKP-insulin or analogues in 50 mM potassium phosphate (pH 7.4); samples were diluted to 5 M for guanidine-induced denaturation studies at 25 C. To extract free energies of unfolding, denaturation transitions were fitted by non-linear least squares to a two-state model as described by Sosnick et al., Methods Enzymol. 317: 393-409. In brief, CD data (x), where x indicates the concentration of denaturant, were fitted by a nonlinear least-squares program according to

(57) ( x ) = A + B e ( - G H 2 O 0 - mx ) / RT 1 + e - ( G H 2 O 0 - mx ) / RT
where x is the concentration of guanidine and where .sub.A and .sub.B are baseline values in the native and) unfolded states. Baselines were approximated by pre- and post-transition lines .sub.A(x)=.sub.A.sup.H.sup.2.sup.O+m.sub.Ax and .sub.B(x)=.sub.B.sup.H.sup.2.sup.O+m.sub.Bx. The m values obtained in fitting the variant unfolding transitions are lower than the m value obtained in fitting the wild-type unfolding curve. To test whether this difference and apparent change in G.sub.u result from an inability to measure the CD signal from the fully unfolded state, simulations were performed in which the data were extrapolated to plateau CD values at higher concentrations of guanidine; essentially identical estimates of G.sub.u and m were obtained.

(58) Relative activity is defined as the ratio of the hormone-receptor dissociation constants of analogue to wild-type human insulin, as measured by a competitive displacement assay using .sup.125I-human insulin. Microtiter strip plates (Nunc Maxisorb) were incubated overnight at 4 C. with AU5 IgG (100 l/well of 40 mg/ml in phosphate-buffered saline). Binding data were analyzed by a two-site sequential model. Data were corrected for nonspecific binding (amount of radioactivity remaining membrane associated in the presence of 1 M human insulin. In all assays the percentage of tracer bound in the absence of competing ligand was less than 15% to avoid ligand-depletion artifacts. Representative data are provided in FIG. 4.

(59) To assess hypoglycemic potencies of KP-insulin (or DKP-insulin) analogues relative to KP-insulin or wild-type insulin in vivo, male Lewis rats (mean body mass 300 grams) were rendered diabetic by treatment with streptozotocin. (This model provides a probe of potency but not degree of acceleration of pharmacokinetics as (i) wild-type insulin, KP-insulin, and Asp.sup.B28-insulin exhibit similar patterns of effects of blood glucose concentration and (ii) these patterns are unaffected by the presence of absence of zinc ions in the formulation at a stoichiometry sufficient to ensure assembly of insulin hexamers.) Protein solutions containing wild-type human insulin, insulin analogues, or buffer alone (protein-free sterile diluent obtained from Eli Lilly and Co.; composed of 16 mg glycerin, 1.6 mg meta-cresol, 0.65 mg phenol, and 3.8 mg sodium phosphate PH 7.4.) were injected subcutaneously, and resulting changes in blood glucose were monitored by serial measurements using a clinical glucometer (Hypoguard Advance Micro-Draw meter). To ensure uniformity of formulation, insulin analogues were each re-purified by reverse-phase high-performance liquid chromatography (rp-HPLC), dried to powder, dissolved in diluent at the same maximum protein concentration (300 g/mL) and re-quantitative by analytical C4 rp-HPLC; dilutions were made using the above buffer. Rats were injected subcutaneously at time t=0 with 20 g insulin in 100 l of buffer per 300 g rat. This dose corresponds to ca. 67 g/kg body weight, which corresponds in international units (IU) to 2 IU/kg body weight. Dose-response studies of KP-insulin indicated that at this dose a near-maximal rate of glucose disposal during the first hour following injection was achieved. Five rats were studied in the group receiving Cha.sup.B24-KP-insulin (SEQ ID NOS: 2 and 6), and five different rats were studied in the control group receiving KP-insulin (SEQ ID NOS: 2 and 20); these rats were randomly selected from a colony of 30 diabetic rats. The two groups exhibited similar mean blood glucose concentrations at the start of the experiment. Blood was obtained from clipped tip of the tail at time 0 and every 10 minutes up to 90 min. The efficacy of insulin action to reduce blood glucose concentration was calculated using the change in concentration over time (using least-mean squares and initial region of linear fall) divided by the concentration of insulin injected. The initial rate of change in blood glucose concentration in the group receiving KP-insulin was 127.124.6 mg/dl/h (meanstandard error of the mean); the initial rate of change in the group receiving Cha.sup.B24-KP-insulin was 113.521.7 mg/dl/h. Any differences were not statistically significant. These data thus suggest that the biological potency of Cha.sup.B24-KP-insulin is equivalent to that of KP-insulin in a zinc hexamer formulation.

(60) The kinetic stability of insulin analogue hexamers was assessed at 25 C. relative to that of the wild-type human insulin hexamer as a cobalt (Co.sup.2+) complex in the presence of 2.2 cobalt ions per hexamer and 50 mM phenol in a buffer consisting of 10 Tris-HCl (pH 7.4). The assay, a modification of the procedure of Beals et al. (Birnbaum, D. T., Kilcomons, M. A., DeFelippis, M. R., & Beals, J. M. Assembly and dissociation of human insulin and Lys.sup.B28, Pro.sup.B29-insulin hexamers: a comparison study. Pharm Res. 14, 25-36 (1997)), employs optical absorbance at 500-700 nm to monitor the R.sub.6-hexamer-specific d-d transitions characteristic of tetrahedral cobalt ion coordination. Although the solution at equilibrium contains a predominance of cobalt insulin hexamers or cobalt insulin analogue hexamers, this equilibrium is characterized by opposing rates of insulin assembly and disassembly. To initiate the assay, the solution is made 2 mM in ethylene-diamine-tetra-acetic acid (EDTA) to sequester free cobalt ions. The time course of decay of the R.sub.6-specific absorption band on addition of EDTA provides an estimate of the rate of hexamer disassembly. Whereas wild-type insulin (SEQ ID NOS: 2 and 3) exhibited a time constant of 41951 seconds, KP-insulin (SEQ ID NOS: 2 and 20) exhibited a time constant of 11413 seconds in accordance with its accelerated pharmacokinatics. Strikingly, the time constant for Cha.sup.B24-KP-insulin (SEQ ID NOS: 2 and 6) was found to be 495 seconds, predicting a further acceleration of pharmacokinetics in human patients. Stated differently, Cha.sup.B24-KP-insulin is almost as accelerated in its disassembly relative to KP-insulin, as KP-insulin is accelerated relative to wild type human insulin.

(61) The far-ultraviolet circular dichroism (CD) spectrum of the Cha.sup.B24 analogue is similar to those of the parent analogues. Modified B24 residues were introduced within the context of KP-insulin (SEQ ID NO: 6), DKP-insulin (SEQ ID NO: 21), and non-standard analogues of human insulin in which Lys.sup.B29 was substituted by Ornithine or Norleucine (SEQ ID NO: 5). Activity values shown are based on ratio of hormone-receptor dissociation constants relative to human insulin; the activity of human insulin is thus 1.0 by definition. Standard errors in the activity values were in general less than 25%. Free energies of unfolding (G.sub.u) at 25 C. were estimated based on a two-state model as extrapolated to zero denaturant concentration. Lag time indicates time (in days) required for initiation of protein fibrillation on gentle agitation at 30 C. in zinc-free phosphate-buffered saline (pH 7.4).

(62) The baseline thermodynamic stability of KP-insulin, as inferred from a two-state model of denaturation at 25 C., is 3.00.1 kcal/mole. CD-detected guanidine denaturation studies indicate that the Cha.sup.B24 substitution is associated with a small decrement in thermodynamic stability in the context of KP-insulin (G.sub.u 0.30.2 kcal/mole) and in the context of DKP-insulin (G.sub.u 0.40.2 kcal/mole). Nonetheless, the physical stability of the Cha.sup.B24 KP analogue was found to be similar to or greater than that of KP-insulin as evaluated in triplicate during incubation in 300 M phosphate-buffered saline (PBS) at pH 7.4 at 30 C. under gentle agitation. The samples were observed for 20 days or until signs of precipitation or frosting of the glass vial were observed. Whereas the three tubes of KP-insulin became cloudy in 10, 13, and 16 days, respectively, the three tubes of Cha.sup.B24-KP-insulin became cloudy in 13, 15, and 20 days. These data exhibit a trend toward greater resistance to physical degradation by the Cha.sup.B24 analogue.

(63) Dissociation constants (K.sub.d) were determined as described by Whittaker and Whittaker (2005. J. Biol. Chem. 280: 20932-20936), by a competitive displacement assay using .sup.125I-Tyr.sup.A14-insulin (kindly provided by Novo-Nordisk) and the purified and solubilized insulin receptor (isoform B or A) in a microtiter plate antibody capture assay with minor modification; transfected receptors were tagged at their C-terminus by a triple repeat of the FLAG epitope (DYKDDDDK; SEQ ID NO:23) and microtiter plates were coated by anti-FLAG M2 monoclonal antibody (Sigma). The percentage of tracer bound in the absence of competing ligand was less than 15% to avoid ligand-depletion artifacts. Binding data were analyzed by non-linear regression using a heterologous competition model (Wang, 1995, FEBS Lett. 360: 111-114) to obtain dissociation constants. Results are provided in Table 1 (Cha.sup.B24 KP-insulin analogue (SEQ ID NOS: 2 and 6) relative to KP-insulin (SEQ ID NOS: 2 and 20)) and Table 2 (Cha.sup.B25-DKP-insulin (SEQ ID NOS: 2 and 22) relative to DKP-insulin (SEQ ID NOS: 2 and 4); dissociation constants are provided in units of nanomolar. (The two studies were conducted on different dates with different preparations of insulin receptor (IR isoform B; IR-B) and IGF receptor (IGF-1R) and so are tabulated independently.) The Cha.sup.B24 modification of KP-insulin reduces IR-B receptor-binding affinities by between twofold and threefold; such small reductions are typically associated with native or near-native hypoglycemic potencies in vivo as demonstrated herein in diabetic Lewis rats. No significant increase was observed in the cross-binding of Cha.sup.B24-KP-insulin to IGF-1R. The Cha.sup.B24 modification of DKP-insulin reduces IR-B receptor-binding affinities by less than twofold; a trend toward increased cross-binding to IGF-1R was observed near the limit of statistical significance. Cha.sup.B24-DKP-insulin was not tested in rats. The affinity of Cha.sup.B25-DKP-insulin for IR-B was markedly impaired (binding to IR-B decreased by more than tenfold) in accordance with classical structure-activity relationships in insulin. The distinct site-specific effects of a Phe.fwdarw.Cha substitution (well tolerated at B24 but not at B25) presumably reflect the different structural roles of these aromatic side chains at the hormone-receptor interface.

(64) TABLE-US-00010 TABLE 1 Binding of Insulin Analogues to Insulin Receptor and IGF Receptor Protein IR-B binding IGF-1R binding insulin 0.045 0.007 nM 5.1 0.8 nM KP-insulin 0.093 0.012 nM 5.0 0.6 nM Cha.sup.B24-KP-insulin 0.171 0.022 nM 4.3 0.7 nM (SEQ ID NOS: 2 and 6) IR-B, B isoform of the insulin receptor; IGF-1R, Type 1 IGF receptor

(65) TABLE-US-00011 TABLE 2 Binding of Insulin Analogues to Insulin Receptor and IGF Receptor Protein IR-B binding IGF-1R binding DKP-insulin 0.020 0.003 nM 3.1 0.51 nM Cha.sup.B24-DKP-insulin 0.032 0.005 nM 1.4 0.22 nM (SEQ ID NOS: 2 and 6) Cha.sup.B25-DKP-insulin 0.350 0.050 nM ND (SEQ ID NOS: 2 and 22) IR-B, B isoform of the insulin receptor. ND, not determined.

(66) The binding affinities of analogues containing the non-standard amino acids Ornithine or Norleucine at position B29 were similarly tested, both with and without a Cha substitution at B24. Results are provided in Table 3 as a percentage of the binding affinity of human insulin for human insulin receptor isoform A (hIR-A), human insulin receptor isoform B (hIR-B), and human IGF receptor (hIGF-1R); asterisks indicate values indistinguishable from 100% (wild-type) given experimental error. Whereas Orn.sup.B29 has similar binding affinities for each receptor as wild-type insulin (asterisks), Nle.sup.B29 confers a small decrease in affinity for hIR-B and IGF-1R relative to wild type insulin. An analogue containing Orn.sup.B29 in combination with Cha.sup.B24, however, had decreased binding affinity for both isoforms of insulin receptor and slightly increased affinity for hIGF-1R (possibly non-significant given experimental error). The Cha.sup.B24, Nle.sup.B29 analogue had similar binding affinity for hIGF-1R as the Nle.sup.B29 only analogue, but had decreased binding affinity for hIR-B. We highlight the modesty of these changes in affinity as the observed range of in vitro hIR affinities are in each case in accordance with expected in vivo hypoglycemic potencies similar to those of wild-type insulin (i.e., as tested in a rat model); similarly, the range of in vitro IGF-1R affinities are within the range of relative affinities exhibited by insulin analogs in current clinical use. These data provide evidence that substitutions Orn.sup.B29 and Nle.sup.B29 have utility in semi-synthetic insulin formulations intended for therapeutic use, either alone or in combination with second-site modifications such as Cha.sup.B24.

(67) TABLE-US-00012 TABLE 3 Relative Binding Affinity of Insulin Analogues to Insulin Receptor and IGF Receptor Protein hIR-A binding hIR-B binding hIGF-1R binding Insulin 100 100 100 Cha.sup.B24, Nle.sup.B29 50 36 62 (SEQ ID NOS: 2 and 5) Cha.sup.B24, Orn.sup.B29 58 53 134* (SEQ ID NOS: 2 and 5) Nle.sup.B29 ND 67 61 (SEQ ID NOS: 2 and 24) Orn.sup.B29 95* 105* 115* (SEQ ID NOS: 2 and 24) hIR-A, A isoform of human insulin receptor; hIR-B, B isoform of human insulin receptor; hIGF-1R, human IGF receptor; ND, not determined; percent errors are in general less than 20% of the values given. Asterisks indicate values whose 95% confidence intervals include 100 and so may be indistinguishable from wild-type.

(68) Two-dimensional .sup.1H-NMR spectra have been obtained of Cha.sup.B24 and Cha.sup.B25 analogues of DKP-insulin (FIG. 5). Whereas the spectrum of Cha.sup.B25-DKP-insulin is similar to that of DKP-insulin in accordance with past studies suggesting that the ensemble-averaged aromatic ring-current effects of Phe.sup.B25 are negligible in an insulin monomer, aliphatic substitution of Phe.sup.B24 leads to attenuation of Phe.sup.B24-related ring current effects. Qualitative interpretation of these spectra is nonetheless suggestive of native-like structures. Further evidence for native-like packing of Cha.sup.B24 was provided by the crystallization of [Cha.sup.B24, Orn.sup.B29]-insulin under conditions that routinely yields crystals of wild-type zinc insulin hexamers.

(69) Insulin analogues additionally containing a Cha.sup.B24 substitution in a Lys.sup.B28, Pro.sup.B29 analogue (SEQ ID NO: 6) were created with either a wild type A-chain (SEQ ID NO: 2) or an A-chain containing a Glu.sup.A8 substitution (SEQ ID NO: 19). The results of competitive displacement assays using .sup.125I-labeled insulin as a tracer assays for human insulin receptor isoform B and human type 1 insulin-like growth factor receptor (IGFR-1) are provided in FIGS. 6A and 6B, respectively. As shown in FIG. 6A, the affinities of Cha.sup.B24-KP-insulin (.box-tangle-solidup., SEQ ID NOS: 2 and 6) and Glu.sup.A8-Cha.sup.B24-KP-insulin (.Math., SEQ ID NOS: 19 and 6) are similar to that of KP-insulin (.circle-solid., SEQ ID NOS: 2 and 20). Similarly, cross-binding of Cha.sup.B24-KP-insulin and Glu.sup.A8-Cha.sup.B24-KP-insulin to IGFR-1 is within the margin of error for that of KP insulin (FIG. 6B).

(70) CD spectra of Cha.sup.B24-KP-insulin (SEQ ID NOS: 2 and 6) and Glu.sup.A8-Cha.sup.B24-KP-insulin (SEQ ID NOS: 19 and 6) resemble that of KP-insulin (SEQ ID NOS: 2 and 20). 2D .sup.1H-NMR spectra of Cha.sup.B24-KP-insulin retain native-like long-range NOEs but differ in pattern of chemical shifts in accord with the loss of the Phe.sup.B24 ring current. We measured the free energies of unfolding of Cha.sup.B24-KP-insulin and Glu.sup.A8-Cha.sup.B24-KP-insulin relative to KP-insulin in a zinc-free buffer at pH 7.4 and 25 C. (10 mM potassium phosphate and 50 mM KCl). This assay utilized CD detection of guanidine-induced denaturation as probed at 222 nm. Values of G.sub.u were estimated on the basis of a 2-state model. For Cha.sup.B24-KP-insulin a possible slight decrease in stability was seen that was within experimental error (G.sub.u 0.10.2 kcal/mole); for Glu.sup.A8-Cha.sup.B24-KP-insulin an increase was observed (G.sub.u 0.50.2 kcal/mole). This assay predicts resistance to chemical degradation similar to or greater than that of Humalog.

(71) The respective fibrillation lag times of KP-insulin (SEQ ID NOS: 2 and 20), Cha.sup.B24-KP-insulin (SEQ ID NOS: 2 and 6) and Glu.sup.A8-Cha.sup.B24-KP-insulin (SEQ ID NOS: 19 and 6) under monomeric conditions at 45 C. were investigated. The proteins were made 60 M in phosphate-buffered saline at pH 7.4 in the absence of zinc ions. Fibrillation was detected by enhancement of Thioflavin T (ThT) fluorescence and onset of cloudiness in the solution. Whereas KP-insulin (N=3 vials) formed fibrils within 2 days, Cha.sup.B24-KP-insulin (N=3 vials) formed fibrils on day 4; solutions of Glu.sup.A8-Cha.sup.B24-KP-insulin (N=2 vials) were formed fibrils on day 7. These data strongly suggest that the analogues provided by the claimed invention will exhibit physical stabilities at least as great as Humalog or greater.

(72) The EDTA sequestration assay described above was also used exploits these spectroscopic features as follows. At time t=0 a molar excess of EDTA is added to a solution of R.sub.6 insulin hexamers or insulin analog hexamers. Although EDTA does not itself attack the hexamer to strip it of metal ions, any Co.sup.2+ ions released in the course of transient hexamer disassembly become trapped by the chelator and thus unavailable for reassembly. The rate of disappearance of the blue color (the tetrahedral d-d optical transition at 574 nm of the R-specific insulin-bound Co.sup.2+) thus provides an optical signature of the kinetics of hexamer disassembly.

(73) Respective exponential dissociation curves yield half-lives of 41951 sec (wild-type insulin; SEQ ID NOS: 2 AND 3), 11313 sec (KP-insulin; SEQ ID NOS: 2 and 20), and 495 sec (Cha.sup.B24-KP-insulin; SEQ ID NOS: 2 and 6). These differences are dramatic. Similar findings were observed in recent studies of Glu.sup.A8-Cha.sup.B24-KP-insulin (SEQ ID NOS: 19 and 6); indeed, its half life was 50% shorter than that of Cha.sup.B24-KP-insulin, indicating that the stabilizing A-chain substitution Glu.sup.A8 (on the hexamer surface distant from the dimer interface) does not compromise, and may further accelerate, its rate of disassembly relative to Cha.sup.B24-KP-insulin. Because diffusion of zinc ions from the subcutaneous depot is analogous to in vitro sequestration of cobalt ions in the assay, these findings predict that Cha.sup.B24-KP-insulin and Glu.sup.m-Cha.sup.B24-KP-insulin will exhibit ultra-rapid PK/PD properties.

(74) Cha.sup.B24-KP-insulin (SEQ ID NOS: 2 and 6) was was tested in 2 pigs and exhibited similar potency (consistent with the rat studies) and a trend toward ultra-rapid PD. Late t.sub.1/2max values of 21111 (Humalog) and 17213 min (Cha.sup.B24-KP-insulin) were observed (p=0.20). Further, a 2-fold reduction was seen in the tail of insulin action (AUC above baseline infusion rate 4 mg/kg/min) between 3-5 hours post-injection which almost achieved statistical significance (p=0.07) despite the limited sample size.

(75) An individual pig whose response to Humalog was discovered to be unusually slow (initial time to half-maximal PD (initial t.sub.1/2max) 81 min) was used to test the PD of the Cha.sup.B24 analogues. Although a single individual, this pig was of potential interest as a model for the variability in PK/PD often observed among human patients in whom analogous half-maximal PD times as prolonged as 90 min have been documented. Remarkably, in this pig, Cha.sup.B24-KP-insulin (SEQ ID NOS: 2 and 6) and Glu.sup.A8-Cha.sup.B24-KP-insulin (SEQ ID NOS: 19 and 6) exhibited initial initial t.sub.1/2max times of 62 and 49 min, respectively; the more rapid PD of Glu.sup.A8-Cha.sup.B24-KP-insulin is in accordance with the EDTA sequestration assay.

(76) A method for treating a patient comprises administering an insulin analogue containing a Cha-substituted Phe or additional amino-acid substitutions in the A or B chain as known in the art or described herein. In one example, the Cha-substituted insulin analogue is an insulin analogue containing Cha at position B24 in the context of KP-insulin. In another example, Cha.sup.B24 is substituted within human insulin analogues containing non-standard modifications at position B29 (Ornithine or Norleucine). It is yet another aspect of the present invention that use of non-standard amino-acid substitutions enables a rapid and efficient method of preparation of insulin analogues by trypsin-mediated semi-synthesis using unprotected octapeptides.

(77) In still another example, the insulin analogue is administered by an external or implantable insulin pump. An insulin analogue of the present invention may also contain other modifications, such as a tether between the C-terminus of the B-chain and the N-terminus of the A-chain as described more fully in U.S. patent application Ser. No. 12/419,169, now U.S. Pat. No. 8,192,957, the disclosure of which is incorporated by reference herein.

(78) A pharmaceutical composition may comprise such insulin analogues and which may optionally include zinc. Zinc ions may be included in such a composition at a level of a molar ratio of between 2.2 and 3.0 per hexamer of the insulin analogue. In such a formulation, the concentration of the insulin analogue would typically be between about 0.1 and about 3 mM; concentrations up to 3 mM may be used in the reservoir of an insulin pump. Modifications of meal-time insulin analogues may be formulated as described for (a) regular formulations of Humulin (Eli Lilly and Co.), Humalog (Eli Lilly and Co.), Novalin (Novo-Nordisk), and Novalog (Novo-Nordisk) and other rapid-acting insulin formulations currently approved for human use, (b) NPH formulations of the above and other insulin analogues, and (c) mixtures of such formulations.

(79) Excipients may include glycerol, glycine, arginine, Tris, other buffers and salts, and anti-microbial preservatives such as phenol and meta-cresol; the latter preservatives are known to enhance the stability of the insulin hexamer. Such a pharmaceutical composition may be used to treat a patient having diabetes mellitus or other medical condition by administering a physiologically effective amount of the composition to the patient.

(80) A nucleic acid comprising a sequence that encodes a polypeptide encoding an insulin analogue containing a sequence encoding at least a B-chain of insulin with a Cyclohexanylalanine at position B24 is also envisioned. This can be accomplished through the introduction of a stop codon (such as the amber codon, TAG) at position B24 (residues 70-72 of SEQ ID NO: 15) in conjunction with a suppressor tRNA (an amber suppressor when an amber codon is used) and a corresponding tRNA synthetase, which incorporates a non-standard amino acid into a polypeptide in response to the stop codon, as previously described (Furter, 1998, Protein Sci. 7:419-426; Xie et al., 2005, Methods. 36: 227-238). The particular sequence may depend on the preferred codon usage of a species in which the nucleic-acid sequence will be introduced. The nucleic acid may also encode other modifications of wild-type insulin. The nucleic-acid sequence may encode a modified A- or B-chain sequence containing an unrelated substitution or extension elsewhere in the polypeptide or modified proinsulin analogues. For example, an A-chain containing a Glu.sup.A8 substitution may be utilized. The nucleic acid may also be a portion of an expression vector, and that vector may be inserted into a host cell such as a prokaryotic host cell like an E. coli cell line, or a eukaryotic cell line such as S. cereviciae or Pischia pastoris strain or cell line.

(81) For example, it is envisioned that synthetic genes may be synthesized to direct the expression of a B-chain polypeptide in yeast Piscia pastoris and other microorganisms. The nucleotide sequence of a B-chain polypeptide utilizing a stop codon at position B24 for the purpose of incorporating a Cyclohexanylalanine at that position may be either of the following or variants thereof:

(82) TABLE-US-00013 (a)withHumanCodonPreferences: (SEQIDNO:15) TTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCT AGTGTGCGGGGAACGAGGCTAGTTCTACACACCCAAGACC (b)withPichiaCodonPreferences: (SEQIDNO:16) TTTGTTAACCAACATTTGTGTGGTTCTCATTTGGTTGAAGCTTTGTACTT GGTTTGTGGTGAAAGAGGTTAGTTTTACACTCCAAAGACT

(83) Similarly, a full length pro-insulin cDNA having human codon preferences and utilizing a stop codon at position B24 for the purpose of incorporating Cyclohexanylalanine at that position may have the sequence of SEQ. ID NO. 17.

(84) TABLE-US-00014 (SEQIDNO:17) TTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAG CTCTCTACCTAGTGTGCGGGGAACGAGGCTAGTTCTACAC ACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGTGGGG CAGGTGGAGCTGGGCGGCGGCCCTGGTGCAGGCAGCCTGC AGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCAT TGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAG CTGGAGAACTACTGCAACTAG

(85) Likewise, a full-length human pro-insulin cDNA utilizing a stop codon at position B24 for the purpose of incorporating a Cyclohexanylalanine at that position and having codons preferred by P. pastoris may have the sequence of SEQ ID NO: 18.

(86) TABLE-US-00015 (SEQIDNO:18) TTTGTTAACCAACATTTGTGTGGTTCTCATTTGGTTGAAG CTTTGTACTTGGTTTGTGGTGAAAGAGGTTAGTTTTACAC TCCAAAGACTAGAAGAGAAGCTGAAGATTTGCAAGTTGGT CAAGTTGAATTGGGTGGTGGTCCAGGTGCTGGTTCTTTGC AACCATTGGCTTTGGAAGGTTCTTTGCAAAAGAGAGGTAT TGTTGAACAATGTTGTACTTCTATTTGTTCTTTGTACCAA TTGGAAAACTACTGTAACTAA

(87) Other variants of these sequences, encoding the same polypeptide sequence, are possible, given the synonyms in the genetic code.

(88) Based upon the foregoing disclosure, it should now be apparent that insulin analogues provided will carry out the objects set forth hereinabove. Namely, these insulin analogues exhibit enhanced rates of disassembly of insulin hexamers while maintaining at least a fraction of the biological activity of wild-type insulin. It is, therefore, to be understood that any variations evident fall within the scope of the claimed invention and thus, the selection of specific component elements can be determined without departing from the spirit of the invention herein disclosed and described.

(89) The following literature is cited to demonstrate that the testing and assay methods described herein would be understood by one of ordinary skill in the art. Furter, R., 1998. Expansion of the genetic code: Site-directed p-fluoro-phenylalanine incorporation in Escherichia coli. Protein Sci. 7:419-426. Merrifield, R. B., Vizioli, L. D., and Boman, H. G. 1982. Synthesis of the antibacterial peptide cecropin A (1-33). Biochemistry 21: 5020-5031. Mirmira, R. G., and Tager, H. S. 1989. Role of the phenylalanine B24 side chain in directing insulin interaction with its receptor: Importance of main chain conformation. J. Biol. Chem. 264: 6349-6354. Sosnick, T. R., Fang, X., and Shelton, V. M. 2000. Application of circular dichroism to study RNA folding transitions. Methods Enzymol. 317: 393-409. Wang, Z. X. 1995. An exact mathematical expression for describing competitive binding of two different ligands to a protein molecule FEBS Lett. 360: 111-114. Weiss, M. A., Hua, Q. X., Jia, W., Chu, Y. C., Wang, R. Y., and Katsoyannis, P. G. 2000. Hierarchiacal protein un-design: insulin's intrachain disulfide bridge tethers a recognition -helix. Biochemistry 39: 15429-15440. Whittaker, J., and Whittaker, L. 2005. Characterization of the functional insulin binding epitopes of the full length insulin receptor. J. Biol. Chem. 280: 20932-20936. Xie, J. and Schultz, P. G. 2005. An expanding genetic code. Methods. 36: 227-238.