THERAPEUTIC TREM-1 PEPTIDES

Abstract

A polypeptide comprising one or more sequences derived from CDR2 or CDR3 of a TREM-1 protein, characterised by the ability to treat, ameliorate, or lessen the symptoms of conditions including sepsis, septic shock or sepsis-like conditions and IBD.

Claims

1. An isolated peptide or a derivative thereof, which is capable of acting as antagonist of the TREM-1 protein as defined by SEQ ID NO.2, comprising SEQ ID NO. 22 or at least 3 amino acids from SEQ ID NO. 23, wherein: (a) the polypeptide consists of: (i) a contiguous sequence of 5 to 29 amino acids from SEQ ID NO: 2; or (ii) a contiguous sequence of 5 to 29 amino acids from SEQ ID NO: 2 in which one amino acid is substituted conservatively with another amino acid; or (b) the polypeptide consists of an amino acid sequence having at least 80% sequence identity to SEQ ID NOS: 3, 4, 6 or 7; wherein the derivatives of the polypeptides of (a) or (b) are modified by glycosylation, acetylation, pegylation, phosphorylation, amidation, or derivatization by protecting or blocking groups.

2. An isolated polynucleotide encoding the peptide or derivative thereof of claim 1.

3. A vector comprising the polynucleotide of claim 2.

4. A method of treating sepsis, septic shock, or an inflammatory disorder in a subject in need thereof comprising administering to the subject the peptide or derivative thereof of claim 1.

5. An isolated polypeptide consisting of SEQ ID NO: 19 or SEQ ID NO: 7.

6. An isolated polynucleotide encoding the polypeptide of claim 5.

7. A vector comprising the polynucleotide of claim 6.

8. A method of treating sepsis, septic shock, or an inflammatory disorder in a subject in need thereof comprising administering to the subject the polypeptide of claim 5.

9. An isolated peptide or derivative thereof, which is capable of acting as an antagonist of the TREM-1 protein as defined by SEQ ID NO. 1, comprising the amino acid sequence of SEQ ID NO. 20 or at least 3 amino acids of SEQ ID NO. 21, wherein: (a) the peptide consists of: (i) a contiguous sequence of 5 to 29 amino acids from SEQ ID NO: 1; or (ii) a contiguous sequence of 5 to 29 amino acids from SEQ ID NO: 1 in which one amino acid is substituted conservatively with another amino acid; or (b) the peptide consists of an amino acid sequence having at least 80% sequence identity to SEQ ID NOs: 16, 17, 18 or 19; and wherein the derivatives of the peptides of (a) or (b) are modified by glycosylation, acetylation, pegylation, phosphorylation, amidation, or derivatization by protecting or blocking groups.

10. An isolated polynucleotide encoding the peptide or derivative thereof of claim 9.

11. A vector comprising the polynucleotide of claim 10.

12. A method of treating sepsis, septic shock, or an inflammatory disorder in a subject in need thereof comprising administering to the subject the peptide or derivative thereof of claim 9.

13. The method of claim 12, wherein the disorder comprises inflammatory bowel disease (IBD).

14. The method of claim 12, wherein the peptide or derivative thereof consists of: (a) a contiguous sequence of 5 to 29 amino acids from SEQ ID NO: 1; or (b) a contiguous sequence of 5 to 29 amino acids from SEQ ID NO: 1 in which one amino acid is substituted conservatively with another amino acid; and wherein the derivatives of the peptides of (a) or (b) are modified by glycosylation, acetylation, pegylation, phosphorylation, amidation, or derivatization by protecting or blocking groups.

15. The method of claim 12, wherein the peptide or derivative thereof consists of an amino acid sequence having at least 80% sequence identity to SEQ ID NOs: 16, 17, 18 or 19; and wherein the derivatives of the peptide are modified by glycosylation, acetylation, pegylation, phosphorylation, amidation, or derivatization by protecting or blocking groups.

16. The method of claim 15, wherein the peptide consists of an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 19.

17. The method of claim 15, wherein the peptide consists of an amino acid sequence having the sequence of SEQ ID NOs: 16, 17, 18 or 19, or which differs from said sequence by one or more conservative amino acid modifications.

18. The method of claim 17, wherein the peptide consists of an amino acid having the sequence of SEQ ID NO: 19, or which differs from said sequence by one or more conservative modifications.

19. The method of claim 12, wherein the peptide consists of a contiguous sequence of 5 to 29 amino acids from SEQ ID NO. 1.

20. The method of claim 12, wherein the peptide or derivative comprises at least 3 amino acids from SEQ ID NO. 21, wherein the at least 3 amino acids from SEQ ID NO. 21 are selected from the group consisting of QPP, QPPK (SEQ ID NO: 24), and QPPKE (SEQ ID NO. 21).

Description

[0092] The present invention will now be described with reference to the following non-limiting examples, with reference to the figures, in which:

[0093] FIG. 1A. shows a sequence alignment of TREM-1 and TREM-2 family members. Human TREM-1 (SEQ ID NO:1) was aligned with mouse TREM-1 (SEQ ID NO:2) and human and mouse TREM-2 (SEQ ID NO:26 and 27, respectively in order of appearance) using version 1.74 of CLUSTAL W. Secondary structure assignments correspond to the published human TREM-1 structure (arrows for -strands and cylinder for a helices) (Radaev et al. (2003) Structure (Camb). December; 11(12):1527-35). Residues involved in homo-heterodimer formation are shown in white on black background. Cysteine making disulfide bonds conserved for V-type Ig fold are in bold. Gaps are indicated with (), identical residues with (*), similar with (: or.). An extended region of similarities between human and mouse TREM1 sequences is shown in boxes on grey background. TREM-1 peptide sequences used in the Examples herein are indicated underlined.

[0094] FIG. 1B. shows a ribbon diagram of the published TREM-1 homodimeric structure (Kelker, et al. (2004) J Mol Biol. September 24; 342(4): 1237-48). Postulated binding sites that comprise the antibody equivalent Complementarity Determining Regions (CDRs) are in red.

[0095] FIG. 2. shows that administration of TREM-1 peptides, 1 hour before LPS, reduces death induced by endotoxaemia. BALB/c mice (10 per group) were injected intraperitoneally with 200 g LPS. The TREM-1 peptides P1, P2, P3, or P5 (200 l of a 300 M solution per mouse) were injected intraperitoneally 1 hour before LPS. Viability of mice was monitored twice a day for 7 days. Statistical analysis was performed by Logrank test. Data from control mice represent cumulative survival curves from two independent experiments performed under identical conditions.

[0096] FIG. 3. shows that TREM-1 peptide P1 is able to effectively reduce death induced by endotoxaemia when injected at 4 hours after LPS. BALB/c mice (10 per group) were injected intraperitoneally with 200 g LPS. TREM-1 peptide P1, 200 l of a 300 M solution per mouse was injected intraperitoneally 1 hour before or 4 hours after LPS. Viability of mice was monitored twice a day for 7 days. Statistical analysis was performed with the Logrank test. Data from control mice represent cumulative survival curves from two independent experiments performed under identical conditions.

[0097] FIG. 4. shows that administration of TREM-1 peptides, 4 hours after LPS, reduces death induced by endotoxaemia. BALB/c mice (10 per group) were injected intraperitoneally with 200 g LPS. P1 peptide, 200 l of a 150, 300 and 600 M solution per mouse (dots) or P3, 200 l of a 600 M solution per mouse (filled squares) were injected intraperitoneally 4 hours after LPS. Viability of mice was monitored twice a day for 7 days. Statistical analysis was performed with the Logrank test.

[0098] FIG. 5. shows that TREM-1 peptide P1 protects against cecal ligation and puncture (CLP). CLP was induced in C57BL/6 mice (15 per group) as described in Materials and Methods. P1 peptide (empty dots) or P3 peptide (filled squares) (200 l of a 600 M solution per mouse) were injected intraperitoneally 5 and 24 hours after CLP induction. Viability of mice was monitored twice a day for 10 days. Statistical analysis was performed with the Logrank test.

[0099] FIG. 6. shows that P1, P2 and P5 peptides, but not P3 peptide, inhibit the binding of soluble TREM-1/IgG1 to TREM-1 Ligand positive peritoneal exudate cells. Cytofluorimetric analysis of peritoneal exudate cells with 2 g/ml of mouse TREM-1/hIgG1 in the presence of a 500 M solution per mouse (thin line), 100 M solution per mouse (dotted line) or absence (thick line) of the peptides is shown. The grey histogram represents immunostaining with human IgG1 as a control.

[0100] FIG. 7A. shows the release of sTREM-1 from cultured monocytes after stimulation with LPS with and without proteases inhibitor. LPS stimulation induced the appearance of a 27-kD protein that was specifically recognized by an anti-TREM-1 mAb (inset). sTREM-1 levels in the conditioned culture medium were measured by reflectance of immunodots. Data are shown as mean SD (n=3).

[0101] FIG. 7B. shows expression of TREM-1 mRNA in monocytes. Cultured monocytes were stimulated with LPS (1 g/mL) for 0, 1 and 16 hours as indicated. LPS induced TREM-1 mRNA production within 1 hour.

[0102] FIG. 8A. shows the release of cytokines and sTREM-1 from cultured monocytes. For cell activation, primary monocytes were cultured in 24-well flat-bottom tissue culture plates in the presence of LPS (1 g/mL). In some experiments this stimulus was provided in combination with P5 (10 to 100 ng/mL), control peptide (10 to 100 ng/mL) or rIL-10 (500 U/mL). To activate monocytes through TREM-1, an agonist anti-TREM-1 mAb (10 g/mL) was added as indicated. Cell-free supernatants were analysed for production of TNF-, IL-1 and sTREM-1 by ELISA or immunodot. All experiments were performed in triplicate and data are expressed as means (SEM). [0103] a: Media [0104] b: P5 10 ng/mL [0105] c: Anti-TREM-1 [0106] d: LPS [0107] e: LPS+Anti-TREM-1 [0108] f: LPS+P5 10 ng/mL [0109] g: LPS+P5 50 ng/mL [0110] h: LPS+P5 100 ng/mL [0111] is LPS+IL10

[0112] FIG. 8B. shows the effect of P5 on NFB activation. Monocytes were cultured for 24 hours in the presence of E. coli LPS (O111:B4, 1 g/mL), anti-TREM-1 mAb (10 g/mL) and/or P5 (100 ng/mL) as indicated and the levels of NFB p50 and p65 were determined using an ELISA-based assay. Experiments were performed in triplicate and data are expressed as means of optical densities (SEM).

[0113] FIG. 9. shows accumulation of sTREM-1 in serum of LPS-treated mice. Male Balb/C mice (20 to 23 g) were treated with LPS (LD.sub.50, intraperitoneally). Serum was assayed for sTREM-1 by immunodot. Serum sTREM-1 was readily detectable 1 hour after LPS administration and was maintained at a plateau level from 4 to 6 hours.

[0114] FIG. 10A. shows that P5 pre-treatment protects against LPS lethality in mice. Male Balb/C mice (20 to 23 g) were randomly grouped (10 mice per group) and treated with an LD.sub.100 of LPS. P5 (50 g or 100 g ) or control vector was administered 60 min before LPS.

[0115] FIG. 10B. shows that delayed administration of P5 protects LPS lethality in mice. Male Balb/C mice (20 to 23 g) were randomly grouped (8 mice per group) and treated with an LD.sub.100 of LPS. P5 (75 g) or control vector was administered 4 or 6 hours after LPS as indicated.

[0116] FIG. 10C. shows that administration of agonist TREM-1 mAb is lethal to mice. Male Balb/C mice (20 to 23 g) were randomly grouped (8 mice per group) and treated with a combination of an LD.sub.50 of LPS+control vector, LD.sub.50 of LPS+anti-TREM-1 mAb (5 g) or LD.sub.100 of LPS+control vector as indicated. Control vector and anti-TREM-1 mAb were administered 1 hour after LPS injection.

[0117] FIG. 11A. shows that P5 partially protects mice from CLP-induced lethality. Male Balb/C mice (20 to 23 g) were randomly grouped and treated with normal saline (n=14) or the control peptide (n=14, 100 g) or with P5 (100 g) in a single infection at HO (n=18), H+4 (n=18) or H+24 (n=18). The last group of mice (n=18) was treated with repeated injections of P5 (100 g) at H+4, H+8 and H+24.

[0118] FIG. 11B. shows the does effect of P5 on survival. Mice (n=15 per group) were treated with a single injection of normal saline or 10 g, 20 g, 50 g, 100 g or 200 g of P5 at HO after the CLP and monitored for survival.

[0119] FIG. 12. shows that P5 has no effect on bacterial counts during CLP. Mice (5 per group) were killed under anaesthesia at 24 hours after CLP. Bacterial counts in peritoneal lavage fluid and blood were determined and results are expressed as CFU per mL of blood and CFU per mouse for the peritoneal lavage.

[0120] FIG. 13A and FIG. 13B show TNF- and IL-1 plasma concentration evolution, respectively, after LPS (15 mb/kg) administration in rats.

[0121] *p<0.05 P5-treated vs Control animals

[0122] p<0.05 P5-treated vs P1-treated animals

[0123] FIG. 14 shows Nitrite/Nitrate concentrations evolution after LPS (15 mg/kg) administration in rats. *p<0.05 P5-treated vs Control and P1-treated animals.

[0124] FIG. 15 shows mean arterial pressure evolution during caecal ligation and puncture-induced peritonitis in rats.

[0125] *p<0.05 vs Control animals

[0126] FIG. 16 shows TNF- plasma concentration evolution during caecal ligation and puncture-induced peritonitis in rats.

[0127] *p<0.05 P5-treated vs Control animals

[0128] .sup.p<0.05 P1-treated vs Control animals

[0129] .sup.$p<0.05 P5 vs P1-treated animals

[0130] FIG. 17 shows Nitrite/Nitrate concentration evolution during caecal ligation and puncture-induced peritonitis in rats.

[0131] *p<0.05 P5 and P1-treated vs Control animals

[0132] FIG. 18 shows that hP5 efficiently protects mice from LPS induced septic shock (see Example 5). Septic shock was induced in male Balb/c mice (n=15/group) with 200 mg of LPS as described in Material and Methods. hP5 peptide or control were administered at the following time points: 1 h, 0 h, +1 h +4 h. Mortality was followed twice a day for 7 days. Data were analysed using GraphPad Prism Survival curve analysis. Log-rank (Mantel-Cox) test showed a statistically significant difference between the two curves (p=0.0003).

[0133] FIG. 19. shows the results for male C57BL/6 mice (n=15/group) that were subject to Cecal Ligation and Puncture as described in Example 6 and treated with hP5 peptide or scrambled peptide control at the following time points: 1 h, 0 h, +4 h and +24 h. Mortality was followed twice a day for 10 days. Data were analyzed using GraphPad Prism Survival curve analysis.

[0134] FIG. 20. Disease Activity Index (DAI). Colitis was induced by oral administration of DSS (see Example 7). Upon colitis induction, mice (n=8) were daily treated either with hP5 or its scrambled control peptide. Animal weight, haemoccult or presence of gross blood and stool consistency were used to determine the DAI score as indicated in Example 7. *(grey)=DSS+hP5 versus DSS+scrambled peptide; *(black)=DSS+hP5 vs DSS+vehicle; ***p0.001, **p0.01, *p0.05.

[0135] FIG. 21. Body weight loss. Colitis was induced by oral administration of DSS (see Example 7). Upon colitis induction, mice were daily treated either with hP5 or its scrambled control peptide. Weight was daily measured and percentage of weight loss versus day 0 was calculated. *(grey)=DSS+hP5 versus DSS+scrambled peptide; *(black)=DSS+hP5 vs DSS+vehicle; ***p0.001, **p0.01.

[0136] FIG. 22. Haemoccult or presence of gross blood in the feces. Colitis was induced by oral administration of DSS (see Example 7). Upon colitis induction, mice were daily treated either with hP5 or its scrambled control peptide. Haemoccult or presence of gross blood was detected and score assigned as measured and score assigned at the indicated time points as described in. Example 7. *(grey)=DSS+hP5 versus DSS+scrambled peptide; *(black)=DSS+hP5 vs DSS+vehicle; ***p0.001, **p0.01, *p0.05.

[0137] FIG. 23. Extent of diarrhea. Colitis was induced by oral administration of DSS (see Example 7). Upon colitis induction, mice were daily treated either with hP5 or its scrambled control peptide. Stool consistency was measured and score assigned at the indicated time points as described in Example 7. *(grey)=DSS+hP5 versus DSS+scrambled peptide; *(black)=DSS+hP5 vs DSS+vehicle; ***p0.001, **p0.01, *p0.05.

[0138] FIG. 24. Shortening of the colon. Colitis was induced by oral administration of DSS (see Example 7). Upon colitis induction, mice were daily treated either with hP5 or its scrambled control peptide. At day 11 mice were euthanized and the colon length of each mouse measured from the anus to the end of the cecum. ***p0.001, **p0.01, *p0.05.

EXAMPLE 1

TREM-1 Peptides Protect Mice From Death by Septic Shock

[0139] TREM-1 peptides matching the following criteria were synthesized: i) highest homology between human and mouse TREM-1 and lowest homology with TREM-2. ii) peptides spanning the Complementarity Determining Regions (CDRs) of TREM-1. According to the published crystal structure of TREM-1, and in analogy with antibodies, these residues are likely to be involved in cognate ligand recognition (Radaev et al. (2003) Structure (Camb). December; 11(12):1527-35 & Kelker, et al. (2004) J Mol Biol. September 24; 342(4):1237-48) (see FIG. 1A and FIG. 1B). One peptide (P1) was designed in the CDR2 region and three peptides (P2, P4 and P5) in the CDR3 region. A fourth peptide (P3) was designed in the neck region connecting the V-type immunoglobulin (Ig)-like domain (Ig-V) to the transmembrane domain. No peptide was designed in the CDR1 region due to high sequence homology between TREM-1 and TREM-2.

[0140] Thus, the following peptides of the TREM-1 protein were ordered from and were synthesized and purified by the Protein and Peptide Chemistry Facility, Institute of Biochemistry, University of Lausanne:

TABLE-US-00004 P1 (CDR267-89) LVVTQRPFTRPSEVHMG [SEQID KFTLKH NO:3] P2 (CDR3114-136) VIYHPPNDPVVLFHPVR [SEQID LVVTKG NO:4] P3 (neckregion TTTRSLPKPTAVVSSPG [SEQID 168-184) NO:5] P4 (CDR3103-123) LQVTDSGLYRCVIYHPP [SEQID NDPV NO:6] P5 (CDR3103-119) LQVTDSGLYRCVIYHPP [SEQID NO:7] P1sc* (P1scrambled LTPKHGQRSTHVTKFRV [SEQID seq.) FEPVML NO:8] P5sc* (P5scrambled TDSRCVIGLYHPPLQVY [SEQID seq.) NO:9] *This is a control peptide and indeed does not protect

[0141] In the experiments of this example, the peptides were administered in a volume of 200 l of the solution molarity indicated. To assess the ability of TREM1-peptides to protect mice from LPS-induced endotoxaemia, the Inventors administered peptides P1, P2, P3 and P5 (300 M) 1 hour before a lethal dose of lipopolysaccharide (LPS) (FIG. 2). Lethality was monitored over time and compared with animals that had received control injections of vehicle alone. P5 injection confers maximal protection, with 90% of the animals still alive 7 days after LPS injection, as compared with 10% of control mice (p<0.001). 60% of the P I-treated mice and 50% of the P2 treated mice survived endotoxaemia as compared with 10% of control mice (p<0.01 and p<0.05 respectively). Interestingly, all P3-treated mice died within 4 days after LPS injection. These results indicate that peptides containing sequences of the extracellular portion of TREM-1 corresponding to the putative ligand binding site (CDR2 and CDR3) can protect mice from lethal shock.

[0142] In order to investigate whether TREM-1 peptide treatment could be delayed until after the administration of LPS, the Inventors injected the peptides at 4 hours after LPS injection. Only in the case of P1, this delayed treatment conferred significant protection against a lethal dose of LPS (FIG. 3). 80% of the mice injected with P1 4 hours after LPS survived endotoxaemia compared to 60% of mice treated 1 h before LPS and 10% of mice treated with vehicle alone (p<0.001 and p<0.01 respectively). Thus, P1 is effective even when injected after the outbreak of endotoxaemia. No late death occurred over one week, indicating that P1 did not merely delay the onset of LPS lethality, but provided lasting protection. P1 administration conferred maximal protection (80%) when administered at 600 M (p<0.01) and the level of protection dropped to 50% at 300 M (p<0.05) and further down to 30% at 150 M as compared to 20% of control mice, indicating a dose dependent effect of P1 (FIG. 4). The Inventors then investigated whether P1 protects against septic shock in the CLP model (Cecal Ligation and Puncture is a widely used experimental model of sepsis). Mice treated with two doses of P1 at 5 and 24 hours after CLP were protected from death as compared to control treated mice (p=0.0791) although the difference was not statistically significant. 40% of the mice injected with P1 at 5 days after CLP survived compared to 5% of mice treated with P3 peptide. At 10 days after CLP, the treated mice were still alive, indicating that P1 did not merely delay mortality, but provided lasting protection (FIG. 5).

EXAMPLE 2

TREM-1 Peptide P1 Inhibits Binding of Soluble Mouse TREM-1/IgG to TREM-1 Ligand Positive Cells

[0143] Among TREM-1 derived peptides tested in CLP, peptides P1, P2 and P5 demonstrate a protective activity. A possible mechanism of action could be the ability of TREM-1 derived peptide to interfere with TREM-1/TREM-1 ligand interaction. To address this question the Inventors performed competition experiments on TREM-1 ligand positive cells: PEC (Peritoneal Exudate Cells) from CLP treated mice.

[0144] Peritoneal exudate cells (PEC) from mice suffering from a caecal ligation and puncture (CLP)-induced peritonitis were subjected to flow cytometry analysis after incubation with a PE-conjugated anti-human IgG1 (Jackson Immunoresearch, Bar Harbor, USA). Competition with TREM-1 peptides was performed by pre-incubating cells with the indicated concentrations of peptides for 45 minutes on ice before adding mTREM-1-IgG1.

[0145] As shown in FIG. 6, the P1 peptide, derived from the CDR2 region of mTREM-1, and the P2 and P5 peptides spanning the CDR3 region inhibit TREM-1 interaction with its ligand in a dose dependent manner. Conversely the P3 peptide, derived from the neck region of TREM-1 connecting the IgG like portion to the transmembrane domain was ineffective.

EXAMPLE 3

[0146] Additional Studies on the Modulation of the Inflammatory Response in Murine Sepsis by TREM-1 Peptide P5

[0147] Methods

Preparation of Monocytes from Peripheral Blood

[0148] Ten mL of peripheral blood samples were collected on EDTA-K from 5 healthy volunteer donors originating from laboratory staff. After dilution in RPMI (Life Technologies, Grand Island, N.Y.) v/v, blood was centrifuged for 30 min at room temperature over a Ficoll gradient (Amersham Pharmacia, Uppsala, Sweden) to isolate PBMC. The cells recovered above the gradient were washed and counted. In order to deplete the suspensions of lymphocytes, cells were then plated in 24-well flat-bottom tissue culture plates (Corning, Corning, N.Y.) at a concentration of 510.sup.6/mL and allowed to adhere during 2 hours at 37 C. The resulting lymphocyte suspension was discarded and the adhering monocytic cells were maintained in a 5% CO2 incubator at 37 C. in complete medium (RPMI 1640, 0.1 mM sodium pyruvate, 2 mM Penicillin, 50 g/mL Streptomycin; Life Technologies) supplemented with 10% FCS (Invitrogen, Cergy, France).

TREM-1 Peptide

[0149] Using the human TREM-1 sequence in Gen-Bank, accession # AF287008 and the mouse TREM-1 sequence # AF241219, a peptide P5 (LQVTDSGLYRCVIYHPP; [SEQ ID NO:7]; was chemically synthesized as a C-terminally amidated peptide (Pepscan Systems, Lelystad, The Netherlands). The correct peptide was obtained in greater than 99% yield and with measured mass of 1961 Da versus a calculated mass of 1962 Da and was homogeneous after preparative purification, as confirmed by mass spectrometry and analytic reversed phase-high performance liquid chromatography. A peptide P5sc containing the same amino-acids than P5 but in a different sequence order (TDSRCVIGLYHPPLQVY; [SEQ ID NO:9]) was similarly synthesized and served as control peptide.

In Vitro Stimulation of Monocytes

[0150] For activation, monocytes were cultured in the presence of E. coli LPS (O111:64, 1 g/mL, Sigma-Aldrich, La Verpilliere, France). Cell viability was assessed by trypan blue exclusion and by measuring lactate dehydrogenase release. In some experiments, this stimulus was given in combination with TNF- (5 to 100 ng/mL, R&D Systems, Lille, France), IL-1 (5 to 100 ng/mL, R&D Systems), rIFN- (up to 100 U/mL, R&D Systems), rIL-10 (500 U/mI, R&D Systems) or up to 100 ng/mL of P5 or control peptide.

[0151] In order to activate monocytes through TREM-1, an anti-TREM-1 agonist monoclonal antibody (R&D Systems) was added as follows: flat-bottom plates were precoated with 10 g/mL anti-TREM-1 per well. After thorough washing in phosphate buffered saline (PBS), the monocyte suspensions were added at a similar concentration as above. Some experiments were performed in the presence of protease inhibitors (PMSF and Protease Cocktail Inhibitor; Invitrogen). Cell-free supernatants were assayed for the production of TNF- and IL-1 by ELISA according to the recommendations of the manufacturer (BD Biosciences, San Diego, USA). To address the effect of P5 on NF-B activity in monocytes, an ELISA-based assay was performed (BD Mercury Transfactor Kit, BD Biosciences). Monocytes were cultured for 24 hours in the presence of E. coli LPS (O111:64, 1 g/mL), and/or an agonist anti-TREM-1 monoclonal antibody (10 g/mL), and/or P5 (100 ng/mL). Whole-cell extracts were then prepared and levels of NF-B p50 and p65 were determined according to the recommendations of the manufacturer. All experiments were performed in triplicate and data are expressed as means (SEM).

Identification and Quantitation of sTREM-1 Release

[0152] Primary monocytes suspensions were cultured as described above. The cells were treated with E. coli LPS (O111:64, 1 g/mL) for 24 hours at 37 C. Cell-conditioned medium was submitted to Western-blotting using an anti-TREM-1 monoclonal antibody (R&D Systems) in order to confirm the presence of 27 kDa material recognized by anti-TREM-1. Soluble TREM-1 levels were measured by assessing the optical intensity of bands on immunodots by means of a reflectance scanner and the Quantity One Quantitation Software (Bio-Rad, Cergy, France) as reported elsewhere (18). Soluble TREM-1 concentration from each sample was determined by comparing the optical densities of the samples with reference to standard curves generated with purified TREM-1. All measurements were performed in triplicate. The sensitivity of this technique allows the detection of sTREM-1 levels as low as 5 pg/mL.

TREM-1 RT-PCR

[0153] Total mRNA was extracted from primary monocytes cultured in the presence of LPS using a TRIzol reagent (Invitrogen), and reverse transcribed using Superscript RT II (Invitrogen) to generate cDNA. RT-PCR conditions then used for all reactions were 94 C., 30 s/65 C., 30 s/68 C., 1 min for 30 cycles. Amplification was performed with 2.5 mM MgCl2, 0.2 mM dNTP, 2.0 U Taq polymerase, and 20 pM 5 and 3 oligonucleotide primers (Proligos, Paris, France).

[0154] The sequences of the 5 and 3 primer pairs used were the following:

TABLE-US-00005 forTREM-1(17) [SEQIDNO:10] TTGTCTCAGAACTCCGAGCTGC; and [SEQIDNO:11] GAGACATCGGCAGTTGACTTGG; forTREM-1sv(19) [SEQIDNO:12] GGACGGAGAGATGCCCAAGACC; and [SEQIDNO:13] ACCAGCCAGGAGAATGACAATG; for-actin(usedashousekeepingamplicon) [SEQIDNO:14] GGACGACATGGAGAAGATCTGG; and [SEQIDNO:15] ATAGTAATGTCACGCACGATTTCC;

[0155] PCR products were run on agarose gels and visualized by ethidium bromide staining.

LPS-Induced Endotoxinemia in Mice

[0156] After approval by the local ethical committee, male Balb/C mice (20 to 23 g) were randomly grouped and treated with E. coli LPS intraperitoneally (i.p.) in combination with P5 (in 500 l normal saline) or control vector before or after LPS challenge. In some experiments, 5 g of an anti TREM-1 monoclonal antibody was administered i.p. one hour after LPS injection. The viability of mice was examined every hour, or animals were sacrificed at regular intervals. Serum samples were collected by cardiac puncture and assayed for TNF- and IL-1 by ELISA (BD Biosciences), and for sTREM-1 levels by immunodot.

CLP Polymicrobial Sepsis Model

[0157] Male Balb/C mice (7 to 9 weeks, 20 to 23 g) were anaesthetized by i.p. administration of ketamine and xylazine in 0.2 mL sterile pyrogen-free saline. The caecum was exposed through a 1.0 cm abdominal midline incision and subjected to a ligation of the distal half followed by two punctures with a G21 needle. A small amount of stool was expelled from the punctures to ensure patency. The caecum was replaced into the peritoneal cavity and the abdominal incision closed in two layers. After surgery all mice were injected s.c. with 0.5 ml of physiologic saline solution for fluid resuscitation and s.c. every 12 h with 1.25 mg (i.e. 50 g/g) of imipenem. The animals were randomly grouped and treated with normal saline (n=14), the control peptide (n=14, 100 g) or P5 (100 g) in a single injection at HO (n=18), H+4 (n=18) or H+24 (n=18). The last group of mice (n=18) was treated with repeated injections of P5 (100 g) at H+4, H+8 and H+24. All treatments were diluted into 500 l of normal saline and administered i.p. The Inventors next sought to determine the effect of various doses of P5. For this purpose, mice (n=15 per group) were treated with a single injection of normal saline or 10 g, 20 g, 50 g, 100 g or 200 g of P5 at HO after the CLP and monitored for survival. Five additional animals per group were killed under anaesthesia 24 hours after CLP for the determination of bacterial count and cytokines levels. Peritoneal lavage fluid was obtained using 2 mL RPMI 1640 (Life Technologies) and blood was collected by cardiac puncture. Concentrations of TNF- and IL-1 in the serum were determined by ELISA (BD Biosciences). For the assessment of bacterial counts, blood and peritoneal lavage fluid were plated in serial log dilutions on tryptic soy supplemented with 5% sheep blood agar plates. After plating, tryptic soy agar plates were incubated at 37 C. aerobically for 24 hours, and anaerobically for 48 hours. Results are expressed as CFU per mL of blood and CFU per mouse for the peritoneal lavage.

Statistical Analyses

[0158] Serum sTREM-1 and cytokines levels were expressed as mean (SD).The protection against LPS lethality by P5 was assessed by comparison of survival curves using the Log-Rank test. All statistical analyses were completed with Statview software (Abacus Concepts, Berkeley Calif.) and a two-tailed P<0.05 was considered significant.

[0159] Results

[0160] A Soluble Form of TREM-1 is Released from Cultured Human Monocytes After Stimulation with E. coli LPS

[0161] To identify the potential release of sTREM-1 in vitro, the Inventors stimulated human monocytes with LPS and analyzed the conditioned culture medium by SDS-PAGE. LPS stimulation induced the appearance of a 27-kDa protein in a time-dependent manner (FIG. 7A). Western blotting analysis revealed that this protein was specifically recognized by a monoclonal antibody directed against the extra-cellular domain of TREM-1 (FIG. 7A). Cell viability was unaffected at LPS concentrations that induced the presence of sTREM-1 in conditioned medium, indicating that TREM-1 release was not due to cell death. Similarly, treatment of monocytes with protease inhibitors did not affect TREM-1 release (FIG. 7A). TREM-1 mRNA levels were increased upon LPS treatment (FIG. 7B) whereas TREM-1sv mRNA levels remained undetectable. This suggests that TREM-1 release is likely to be linked to an increased transcription of the gene and unrelated to TREM-1sv expression. Stimulation of monocytes for 16 hours with TNF- (5 to 100 ng/mL) or IL-1 (5 to 100 ng/mL) induced very small TREM-1 release in a cytokine dose-dependent manner. Stimulation with IFN- did not induce TREM-1 release, even at concentrations of up to 100 U/mL.

[0162] LPS Associated Release of Pro-Inflammatory Cytokines is Attenuated by P5

[0163] Significant TNF- and IL-1 production was observed in the supernatant of monocytes cultured with LPS. TNF- and IL-13 production was even higher for cells cultured with both TREM-1 mAb and LPS as compared with those cultured with mAb or LPS alone (FIG. 8A).

[0164] The inducible release of pro-inflammatory cytokines was significantly lower after LPS stimulation when the medium was supplemented with P5 or IL-10. P5 reduced, in a concentration-dependent manner, the TNF- and IL-1 production from cells cultured with LPS or with LPS and mAb and simultaneously increased the release of sTREM-1 from cells cultured with LPS. The control peptide displayed no action on cytokines or sTREM-1 release (data not shown). In striking contrast, IL-10 totally inhibited the release of both TREM-1 and inflammatory cytokines (FIG. 8A). Both LPS and TREM-1 mAb induced a strong activation of monocytic NF-B p50 and p65 and combined administration of LPS and TREM-1 mAb lead to a synergistic effect. P5 inhibited the NF-B activation induced by the engagement of TREM-1 but did not alter the effect of LPS (FIG. 8B).

[0165] Serum sTREM-1 Levels of LPS-Treated Mice are Increased

[0166] In order to determine whether sTREM-1 was released systemically during endotoxemia in mice, the Inventors measured serum sTREM-1 levels after LPS administration. Serum sTREM-1 was readily detectable 1 hour after administration of an LD.sub.50 dose of LPS and was maintained at peak plateau levels from 4 to 6 hours after LPS treatment (FIG. 9).

[0167] TREM-1 Peptide P5 Protects Endotoxemic Mice from Lethality

[0168] Mice treated by a single dose of P5 60 min before a lethal dose (LD.sub.100) of LPS were prevented from death in a dose-dependent manner (FIG. 10A). In order to investigate whether P5 treatment could be delayed until after the administration of LPS, the Inventors injected P5 beginning 4 or 6 hours after LPS injection. This delayed treatment up to 4 hours conferred significant protection against a LD.sub.100 dose of LPS (FIG. 10B). No late death occurred over one week, indicating that P5 did not merely delay the onset of LPS lethality, but provided lasting protection. Control mice all developed lethargy, piloerection, and diarrhoea before death. By contrast, P5-treated mice remained well groomed and active, had no diarrhoea, and were lively. To clarify the mechanism by which P5 protected mice from LPS lethality, the Inventors determined the serum levels of TNF-, IL-1 and sTREM-1 of endotoxemic mice at 2 and 4 hours. As compared to controls, pre-treatment by 100 g of P5 reduced cytokines levels by 30% and increased sTREM-1 levels by 2 fold as shown in Table 4:

TABLE-US-00006 TABLE 4 Serum concentrations of TNF-, IL-1 and sTREM-1 in endotoxemic mice. TNF- (ng/mL) IL-1 (ng/mL) sTREM-1 (ng/mL) H2 H4 H2 H4 H2 H4 Control 3.3 1.0 0.4 0.1 0.3 0.1 1.5 0.2 249 48 139 8 P5 (100 g) 2.4 0.5 0.1 0.1 0.2 0.1 0.9 0.2 475 37 243 28

[0169] Engagement of TREM-1 is Lethal to Mice

[0170] To further highlight the role of TREM-1 engagement in LPS-mediated mortality, mice were treated with agonist anti-TREM-1 mAb in combination with the administration of an LD.sub.50 dose of LPS. This induced a significant increase in mortality rate from 50% to 100% (FIG. 10C).

[0171] P5 Protects Mice from CLP-Induced Lethality

[0172] To investigate the role of P5 in a more relevant model of septic shock, the Inventors performed CLP experiments (FIG. 11A). The control groups comprised mice injected with normal saline or with the control peptide. In this model of polymicrobial sepsis, P5 still conferred a significant protection against lethality even when administered as late as 24 hours after the onset of sepsis. Interestingly, repeated injections of P5 had the more favourable effect on survival (P<0.01). There was a dose response effect of P5 on survival (FIG. 11B) and cytokine production (Table 5). P5 had no effect on bacterial clearance (FIG. 12).

TABLE-US-00007 TABLE 5 Serum concentrations of TNF-, IL-1 and sTREM-1 at 24 hours after CLP. TNF- (pg/mL) IL-1 (pg/mL) sTREM-1 (ng/mL) Control peptide 105 12 841 204 52 3 Control saline 118 8 792 198 35 5 P5 10 g 110 11 356 62 43 8 P5 20 g 89 10 324 58 58 8 P5 50 g 24 6 57 11 93 10 P5 100 g 20 3 31 3 118 12 P5 200 g 21 7 37 8 158 13

[0173] Sepsis exemplifies a complex clinical syndrome that results from a harmful or damaging host response to severe infection. Sepsis develops when the initial, appropriate host response to systemic infection becomes amplified, and then dysregulated (4, 5). Neutrophils and monocyte/macrophages exposed to LPS, for instance, are activated and release such pro-inflammatory cytokines as TNF- and IL-1. Excessive production of these cytokines is widely believed to contribute to the multi-organ failure that is seen in septic patients (20-23).

[0174] TREM-1 is a recently identified molecule involved in monocytic activation and inflammatory response (12, 14). It belongs to a family related to NK cell receptors that activate downstream signalling events. The expression of TREM-1 on PNNs and monocytes/macrophages has been shown to be inducible by LPS (16, 17).

[0175] As described herein, the Inventors demonstrate that a soluble form of TREM-1 was released from cultured human monocytes after stimulation with E. coli LPS. Such a soluble form was also detectable in the serum of endotoxemic mice as early as 1 hour after LPS challenge. This is consistent with the implication of TREM-1 in the very early phases of the innate immune response to infection (14, 15, 24). The mechanism by which sTREM-1 is released is not clearly elucidated but seems to be related to an increased transcription of the TREM-1 gene. Nevertheless, although incubation with a protease inhibitor cocktail does not alter the sTREM-1 release, cleavage of the surface TREM-1 from the membrane cannot be totally excluded. Interestingly, stimulation of human monocytes with such pro-inflammatory cytokines as TNF-, IL-1 or IFN- induced very small sTREM-1 release unless LPS was added as a co-stimulus. The expression of an alternative mRNA TREM-1 splice variant (TREM-1sv) has been detected in monocytes that might translate into a soluble receptor (18) upon stimulation with cell wall fraction of Mycobacterium bovis BCG but not LPS (25). This was confirmed in this study as i) LPS did not increase the level of mRNA TREM-1sv in monocytes and ii) only a 27-kDa protein was released by monocytes upon LPS stimulation and not the 17.5-kDa variant.

[0176] Although its natural ligand has not been identified (13, 14), engagement of TREM-1 on monocytes with an agonist monoclonal antibody resulted in a further enhancement of pro-inflammatory cytokines production, while P5 induced a decrease of these syntheses in a concentration-dependent manner, and IL-10 completely suppressed it.

[0177] Inflammatory cytokines, and especially TNF-, are considered to be deleterious, yet they also possess beneficial effects in sepsis (5) as shown by the fatal issue of peritonitis in animals with impaired TNF- responses (9-11). Moreover, in clinical trials, the inhibition of TNF- increased mortality (8). Finally, the role of TNF- in the clearance of infection has been highlighted by the finding that sepsis is a frequent complication in rheumatoid arthritis patients treated with TNF- antagonists (26).

[0178] The mechanism by which P5 modulates cytokine production is not yet clear. P5 comprises the complementary determining region (CDR)-3 and the F strand of the extracellular domain of TREM-1. The latter contains a tyrosine residue mediating dimerization. Radaev et al postulated that TREM-1 captures its ligand with its CDR-equivalent loop regions (27). P5 could thus impair TREM-1 dimerization and/or compete with the natural ligand of TREM-1. Moreover, the increase of sTREM-1 release from monocytes mediated by P5 could prevent the engagement of membrane TREM-1, sTREM-1 acting as a decoy receptor, as in the TNF- system (28, 29).

[0179] Activation of the transcription factor NF-B is a critical step in monocyte inflammatory cytokine production after exposure to bacterial stimuli such as LPS (30, 31). Among the various NF-B/Rel dimers, the p65/p50 heterodimer is the prototypical form of LPS-inducible NF-B in monocytes (32). P5 abolishes the p65/p50 NF-B over-activation induced by the engagement of TREM-1. This might at least partially explain the effects of P5 on cytokine production and the protection from lethality shown here to occur when the peptide was injected one hour before LPS-induced septic shock, or even up to 4 hours after.

[0180] Endotoxemia is simple to achieve experimentally, but imperfectly suited to reproduce human sepsis, while polymicrobial sepsis induced by CLP is a more complex but better model, including the use of fluid resuscitation and antibiotics. The latter was thus also used in this study, and confirmed the dose-dependent protection provided by P5, even when administered as late as 24 hours after the onset of sepsis. The favourable effect of P5 was however unrelated to an enhanced bacterial clearance.

[0181] One difficulty in the use of immunomodulatory therapies is that it is not possible to predict the development of sepsis, and, thus, patients receiving those treatments frequently already have well-established sepsis (6). Since P5 appeared to be effective even when injected after the outbreak of sepsis, it could thus constitute a realistic treatment (24, 33).

[0182] By contrast, engagement of TREM-1 by an agonist anti-TREM-1 monoclonal antibody mediated a dramatic increase of mortality rate in LPS-challenged mice: this further underscores the detrimental effect of TREM-1 engagement during septic shock.

[0183] Experimental septic shock reproduces human sepsis only in part. Indeed, our group recently showed that significant levels of sTREM-1 were released in the serum of critically ill patients with sepsis patients (34), the highest levels being observed in patients who survived. This is consistent with our experimental findings indicating that the more important sTREM-1 release, the more favourable is the outcome, and thus sustains, at least theoretically, the potential value of soluble TREM peptides as post-onset sepsis therapy.

[0184] TREM-1 appears to be a crucial player in the immediate immune response triggered by infection. In the early phase of infection, neutrophils and monocytes initiate the inflammatory response owing to the engagement of pattern recognition receptors by microbial products (3, 4). At the same time, bacterial products induce the up-regulation and the release of sTREM-1. Upon recognition of an unknown ligand, TREM-1 activates signalling pathways which amplify these inflammatory responses, notably in monocytes/macrophages. The modulation of TREM-1 signalling reduces, although without complete inhibition, cytokine production and protects septic animals from hyper-responsiveness and death. Modulation of TREM-1 engagement with such a peptide as P5 might be a suitable therapeutic tool for the treatment of sepsis, particularly because it seems to be active even after the onset of sepsis following infectious aggression.

EXAMPLE 4

Haemodynamic Studies in LPS Treated and Septic Rats Treated with P1 and P5

[0185] The role of TREM-1 peptides in further models of septic shock, was investigated by performing LPS and CLP (caecal ligation and puncture) experiments in rats.

[0186] Materials and Methods

[0187] LPS-Induced Endotoxinemia

[0188] Animals were randomly grouped (n=10-20) and treated with Escherichia coli LPS (O111:64, Sigma-Aldrich, Lyon, France) i.p. in combination with the TREM-1 or scrambled peptides.

[0189] CLP Polymicrobial Sepsis Model

[0190] The procedure has been described in details elsewhere (see Mansart, A. et al. Shock 19:3844 (2003)). Briefly, rats (n=6-10 per group) were anesthetized by i.p. administration of ketamine (150 mg/kg). The caecum was exposed through a 3.0-cm abdominal midline incision and subjected to a ligation of the distal half followed by two punctures with a G21 needle. A small amount of stool was expelled from the punctures to ensure potency. The caecum was replaced into the peritoneal cavity and the abdominal incision closed in two layers. After surgery, all rats were injected s.c. with 50 mL/kg of normal saline solution for fluid resuscitation. TREM-1 or scrambled peptides were then administered as above.

[0191] Haemodynamic Measurements in Rats

[0192] Immediately after LPS administration as well as 16 hours after CLP, arterial BP (systolic, diastolic, and mean), heart rate, abdominal aortic blood flow, and mesenteric blood flow were recorded using a procedure described elsewhere (see Mansart, A. et al. Shock 19:3844 (2003)). Briefly, the left carotid artery and the left jugular vein were cannulated with PE-50 tubing. Arterial BP was continuously monitored by a pressure transducer and an amplifier-recorder system (IOX EMKA Technologies, Paris, France). Perivascular probes (Transonic Systems, Ithaca, N.Y.) wrapped up the upper abdominal aorta and mesenteric artery, allowed to monitor their respective flows by means of a flowmeter (Transonic Systems). After the last measurement (4.sup.th hour during LPS experiments and 24.sup.th hour after CLP), animals were sacrificed by an overdose of sodium thiopental i.v.

[0193] Biological Measurements

[0194] Blood was sequentially withdrawn from the left carotid artery. Arterial lactate concentrations and blood gases analyses were performed on an automatic blood gas analyser (ABL 735, Radiometer, Copenhagen, Denmark). Concentrations of TNF- and IL-1 in the plasma were determined by an ELISA test (Biosource, Nivelles, Belgium) according to the recommendations of the manufacturer. Plasmatic concentrations of nitrates/nitrites were measured using the Griess reaction (R&D Systems, Abingdon, UK).

[0195] Statistical Analyses

[0196] Results are expressed as meanSD. Between-group comparisons were performed using Student' t tests. All statistical analyses were completed with Statview software (Abacus Concepts, CA) and a two-tailed P<0.05 was considered significant.

[0197] Results

[0198] Endotoxinemia Model

[0199] Following LPS administration, arterial pressures, aortic and mesenteric blood flows dropped rapidly in control animals (scrambled peptides treated rats) while the heart rate remained unchanged (Table 6). The decrease of arterial pressures and aortic blood flow was delayed until the second hour in TREM-1 peptide treated animals with significantly higher values by that time than in control animals. There was no difference between P1 and P5 treated groups. By contrast, none of these two peptides had any effect on the decrease of the mesenteric blood flow (Table 6).

[0200] Arterial pH remained constant over time until the fourth hour after LPS injection where it severely dropped in the control group only (Table 6). The significant arterial lactate level elevation present in control animals after the third hour was abolished by the TREM-1 peptides (Table 6). There was no difference between P1 and P5 with regard to pH, arterial bicarbonate and lactate concentrations.

[0201] As expected, a peak of TNF- plasmatic concentration was induced by LPS between 30 minutes and 1 hour after injection followed by a progressive decline thereafter (FIG. 13A). P1 peptide injection had no effect on this production, while P5 attenuated TNF- production by 30%.

[0202] P1 delayed the IL-1 peak until the third hour after LPS injection, but without attenuation. By contrast, P5 strongly reduced IL-1 release (FIG. 13B).

[0203] Nitrite/nitrate concentrations increased rapidly after LPS administration in control and P1 treated animals but remained stable upon P5 treatment (FIG. 14).

TABLE-US-00008 TABLE 6 Hemodynamic parameters during LPS-induced endotoxinemia Heart Aortic Mesenteric Rate MAP blood flow blood flow Lactate (bpm) (mmHg) (mL/min) (mL/min) pH (mmol/L) Control H0 486 13 123 21 45 7 13.6 3.4 7.31 0.03 3.3 0.8 H1 522 16 103 25 25 8 .sup.a 9.6 3.3 7.28 0.03 4.2 0.3 H2 516 13 98 23 12 5 .sup.a,b 8.0 3.7 7.29 0.03 5.9 0.6 H3 490 20 78 8 .sup.a,b 8 3 .sup.a,b 5.8 1.1 7.26 0.01 7.9 1.8 .sup.a,b H4 510 18 67 9 .sup.a,b 6 1 .sup.a,b 4.1 0.8 7.03 0.10 .sup.a,b 11.5 0.7 .sup.a,b P1 H0 464 25 116 10 49 11 12.0 3.7 7.32 0.04 2.7 0.1 H1 492 26 119 14 39 12 .sup.a 10.5 1.7 7.29 0.04 4.9 1.1 H2 492 26 113 21 26 14 .sup.a 7.7 2.7 7.30 0.01 5.0 0.9 H3 480 30 97 29 .sup.a 22 8 .sup.a 5.0 1.0 7.26 0.06 5.7 0.7 .sup.a H4 480 20 92 7 .sup.a 16 6 .sup.a 4.8 0.9 7.26 0.08 .sup.a 7.9 1.7 .sup.a P5 H0 474 49 115 16 48 9 12.8 6.4 7.33 0.04 3.4 1.5 H1 498 26 99 22 32 8 11.4 2.7 7.28 0.06 5.4 1.4 H2 510 42 101 18 23 4 .sup.b 9.2 1.9 7.32 0.07 5.5 1.6 H3 517 62 93 21 .sup.b 20 7 .sup.b 6.0 0.8 7.29 0.11 5.9 1.7 .sup.b H4 510 26 89 10 .sup.b 15 6 .sup.b 5.0 1 .0 7.28 0.12 .sup.b 7.4 1.8 .sup.b .sup.a p < 0.05 P1 vs Controls .sup.b p < 0.05 P5 vs Controls

CLP Model

[0204] As the severity of the Inventors' model was at its highest 16 to 20 hours after the completion of the CLP, the Inventors chose to investigate animals by the 16.sup.th hour. Importantly, there were no deaths before this time point. Although all animals were fluid resuscitated, none received antibiotics in order to strictly consider the role of the peptides.

[0205] There was a dramatic decline in arterial pressure in the control animals over time, and by H24 systolic, diastolic and mean arterial pressures were 587 mmHg, 254 mmHg and 382 mmHg respectively. This decrease was almost totally abolished with P1 or P5 treatment with no significant difference between H16 and H24 (FIG. 15). There was no difference between P1 and P5 treated rats.

[0206] TREM-1 peptides also prevented the aortic and mesenteric blood flows decrease observed in control animals (Table 7). The protective effect on mesenteric blood flow alterations was even higher under P5 treatment. The relative preservation of blood flows was not related to an increased heart rate, since the latter was rather slower than in control animals (Table 7).

[0207] The progressive metabolic acidosis that developed in control rats was attenuated by the P1 peptide, and almost abrogated by P5. The same protective trend was observed for arterial lactate elevation with a more pronounced effect of P5 (Table 7).

TABLE-US-00009 TABLE 7 Hemodynamic and selected biochemical parameters during CLP polymicrobial sepsis Heart Aortic Mesenteric Rate blood flow blood flow Bicarbonate Lactate (bpm) (mL/min) (mL/min) pH (mmol/L) (mmol/L) Control H16 516 44 .sup.a,b 38 10 10.6 3.0 .sup.b 7.31 0.07 .sup.b 6.9 2.7 4.7 1.5 .sup.b H20 543 35 .sup.a,b 9 11 .sup.a,b 4.3 1.5 .sup.b 7.23 0.05 .sup.a,b 12.0 5.6 .sup.a,b 8.5 1.4 .sup.a,b H24 480 20 14 9 .sup.a,b 2.5 0.7 .sup.b 7.17 0.01 .sup.a,b 10.3 3.3 .sup.a 10.8 1.9 .sup.a,b P1 H16 462 16 .sup.a 41 12 13.5 7.2 7.32 0.04 16.8 4.4 4.9 0.4 H20 480 30 .sup.a 28 17 .sup.a 5.3 3.0 .sup.c 7.31 0.18 .sup.a 16.0 5.4 .sup.b 5.3 1.1 .sup.a,c H24 420 30 22 16 .sup.a 4.5 2.1 .sup.c 7.24 0.06 .sup.a,c 11.2 0.8 .sup.c 6.8 0.9 .sup.a,c P5 H16 460 17 .sup.b 41 14 15.3 3.5 .sup.b 7.35 0.01 .sup.b 18.6 2.0 3.3 0.4 .sup.b H20 500 17 .sup.b 31 5 .sup.b 11.0 6.9 .sup.b,c 7.34 0.01 .sup.b 18.0 0.9 .sup.a 3.6 0.9 .sup.b,c H24 510 20 28 8 .sup.b 8.5 3.5 .sup.b,c 7.36 0.01 .sup.b,c 17.1 0.9 .sup.a,c 4.9 1.1 .sup.b,c .sup.a p < 0.05 P1 vs Controls .sup.b p < 0.05 P5 vs Controls .sup.c p < 0.05 P5 vs P1

[0208] Both P1 and P5 induced a decrease in TNF- production, again with a stronger effect of P5. By H20, plasmatic TNF- was almost undetectable under P5 treatment whereas it remained elevated in the other groups of animals (FIG. 16).

[0209] Nitrite/nitrate concentrations were increased in control animals but remained at a low level in both TREM-1 peptides treated groups (FIG. 17).

[0210] A protective action of both P5 and P1 on hemodynamics was thus observed in septic rats. Both arterial pressure and blood flows were preserved, independently of heart rate. Moreover, modulation of TREM-1 signalling reduced, although not completely, cytokine production and protected septic animals from hyper-responsiveness. The fact that the cytokine production was not totally inhibited is a crucial point. Indeed, although inflammatory cytokines such as TNF- are considered deleterious, they also display beneficial effects in sepsis as underlined by the fatal issue of peritonitis models in animals with impaired TNF- responses.

[0211] The activation of iNOS observed during septic shock leads to the production of large amount of NO that partly explains some of the peripheral vascular disorders (notably vasodilation and hypotension). On the myocardium itself, most of the action of NO is mediated by an activation of the soluble guanylate-cyclase responsible for the production of cGMP which impairs the effect of cytosolic calcium on contraction. Cyclic GMP is also able to stimulate the activity of some phosphodiesterases. The subsequent decrease of intracellular cAMP levels could explain the ability of NO to attenuate the effects of beta adrenergic stimulation. The preservation of arterial pressure could therefore be partly explained by a lessened production of NO, as reflected by the lower concentrations of plasma nitrite/nitrate in TREM-1 peptides treated animals.

[0212] The decrease in inflammatory cytokine production could partly explain the effect noted on blood flows. Indeed, although the list of potential cytokine mediators of myocardial depression is long, TNF- and IL-1 have been shown to be good candidates Both these latter cytokines depressed myocardial contractility in vitro or ex vivo. Moreover, the neutralization or removal of TNF- or IL-1 from human septic serum partly abrogates the myocardial depressant effect in vitro and in vivo. Although P1 and P5 had an identical action on blood flows and arterial pressure during endotoxinemia, their action on cytokine production differed with only a slight effect of P1 on plasma TNF- and IL-1 concentrations. The protective role of the TREM-1 peptides could therefore be only partly related to their action on cytokine release, or involve redundant pathways.

[0213] The modulation of the TREM-1 pathway by the use of small synthetic peptides had beneficial effects on haemodynamic parameters during experimental septic shock in rats, along with an attenuation of inflammatory cytokine production.

[0214] In summary, these data show that the TREM-1 peptides of the invention 1) efficiently protect subject animals from sepsis-related hemodynamic deterioration; 2) attenuate the development of lactic acidosis; 3) modulate the production of such pro-inflammatory cytokines as TNF- and IL-1 and 4) decrease the generation of nitric oxide. Thus TREM-1 peptides are potentially useful in the restoration of haemodynamic parameters in patients with sepsis, septic shock or sepsis-like conditions and therefore constitute a potential treatment for the aforesaid conditions.

Example 5: hP5 Activity in a Murine Model of Sepsis: Endotoxin-Induced Septic Shock.

[0215] The activity of human P5 (hP5) was investigated in a murine model. hP5 differs from mP5 according to ClustalW comparison as set our below:

TABLE-US-00010 Length Length SeqA Name (aa) SeqB Name (aa) Score 1 hP5 17 2 mP5 17 82 hP5 LQVEDSGLYQCVIYQPP 17 mP5 LQVTDSGLYRCVIYHPP 17 ********:****:**

[0216] For the experiment, male BALB/c mice (19-21 g) were randomly grouped (15 mice per group) and injected intraperitoneally (i.p.) with 200 microg of LPS from E. coli 0111:64 (Sigma). A blinded investigator performed all injections. 200 microliters of TREM-1 peptides dissolved in water 10% DMSO, 9% Solutol were administered intraperitoneally at 1 h, 0 h, +1 h, +4 h prior and after LPS injection. Viability of treated mice was monitored twice a day for 7 days.

[0217] To then assess the ability of hP5 peptide to protect mice from LPS-induced endotoxaemia, the inventors administered at 1 h, 0 h, +1 h, +4 h prior and after LPS injection a lethal dose of lipopolysaccharide (LPS) (FIG. 18). Lethality was monitored overtime and compared with animals that had received vehicle alone. hP5 injection confers high protection, with 80% of the animals still alive 7 days after LPS injection, as compared with no survivors in the control group (p<0.0003). The human P5 peptide shows >80% identity with mP5.

[0218] The results summarised in FIG. 18 clearly demonstrate that the human P5 protects mice from lethal shock.

Example 6 hP5 Activity in a Murine Model of Sepsis: Cecal Ligation and Puncture Model

[0219] For the experiment the mice underwent a standardized preparation for laparotomy (anaesthesia with 2% inhaled isoflurane in oxygen, shaving with animal clippers, alcohol scrub). A 1 cm incision was made on the midline. The cecum was exposed and will be tightly ligated at 50-80% over its base with a 4-0 silk suture avoiding bowel obstruction. The cecum was then punctured once with a 23 G needle. The cecum was gently squeezed until feces be just visible through the puncture, and placed again in the abdominal cavity. The incision was thereafter be closed with a 4-0 silk. 200 l of hP5 or its scrambled peptide control were freshly dissolved in water 10% DMSO, 9% solutol and injected intraperitoneally with a 22 G needle at the following time points: 1, 0, +4, +24. No fluid resuscitation was administered. Survival and Moribundity were observed twice a day for 10 days.

[0220] The Inventors then analysed whether hP5 protects against septic shock in the CLP model. Mice treated with four doses of hP5 at 1 h, 0 h, +4 h and +24 hours after CLP were protected from death as compared to control treated mice. At 72 hours after CLP, 73.3% of the mice injected with hP5 survived compared to 60% of mice treated with scrambled peptide. At 10 days after CLP, 66.6% of the hP5 treated mice were still alive compared to 60% of the control group, suggesting that hP5 could provide lasting protection (FIG. 19).

Example 7 The Human TREM-1 Peptide P5 (hP5) Attenuates Established Intestinal Inflammation in the DSS Colitis Model

[0221] The purpose of this example is to identify, characterize and document the therapeutic potential of the TREM-1 derived peptide hP5, in an experimental model of colitis in mice.

[0222] On day 0 of the study, the water supply was removed and replaced with 3% Dextran Sulfate Sodium (DSS) From day 0 to day 6, this solution was the only source of fluids. Water was administered for the rest of the experiment (day 7-11). Healthy controls received water only.

[0223] From day 3 to day 10 mice were treated with either hP5, or a sequence-scrambled control peptide. Peptides were dissolved in DMSO at 10 mg/ml and stored at +4 C. Before administration, the stock solution was diluted 1:10 in water 10% Solutol HS 15 (BASF). Final vehicle concentrations: 1& DMSO, 10% solutol in water. 200 l of these freshly prepared solutions of hP5, its scrambled control or vehicle were injected intraperitoneally with a 25 G needle.

[0224] Animals were weighted daily and monitored on days 3, 4, 5, 6, 7 and 10 for rectal bleeding and stool consistency. For each group, the disease activity index (DAI) was determined by evaluating changes in weight, stool consistency and presence of gross blood during the study, as described below:

TABLE-US-00011 Weight loss Blood in Score (%) Stool consistency stool 0 <1 Normal Negative 1 1-4.9 Soft +/ 2 5-9.9 Mixed (soft and liquid) + 3 10-15 Liquid ++ 4 >15 Diarrhea (liquid stools that Gross adhere to the anus) bleeding

[0225] Scoring System for the Disease Activity Index (DAI). Individual scores for each parameter are added and then divided by three to give a DAI score for each mouse.

[0226] To determine the presence of occult blood in stool, a pea-sized stool sample was placed on a slide. Then two drops of reagent (Hemocult Sensa, Beckman Coulter) were placed onto the stool sample on the slide and a change of colour was observed. The presence of occult blood was graded using a score of 0 for no colour; 1 for a very light blue (+/) colour taking over 30 seconds to appear, 2 for a blue colour developing in 30 seconds or more (+); 3 for an immediate change in colour (++) and 4 for gross blood observable on the slide.

[0227] On day 11 mice were euthanized by cervical dislocation to allow colon length evaluation. An incision was done in the abdomen to expose the colon. The stool in the colon was removed flushing with saline. The entire colon from cecum to anus was removed and the length was measured and reported as colon length (cm).

[0228] Data were analyzed using GraphPad Prism. Results are given as means standard error of the mean. The BW score, stool score and blood score were analyzed using two-way ANOVA test, Bonferroni post test. Colon length was analysed using one-way ANOVA, Dunn's post test. * P0.05; **P0.01; *** P0.001

[0229] mP5 is a mTREM-1 derived peptide whose efficacy has been proven in several models of sepsis. In this study, the investigators have tested the efficacy of the human orthologue of mP5, compared to its scrambled peptide control, in the above described DSS-induced colitis model. All peptides were administered in a therapeutic fashion, 3 days after initiation of DSS treatment.

[0230] In all animals, body weight, haemoccult or presence of gross blood and stool consistency were monitored. Bloody stools were observed from day 3 onwards, loose stools and weight loss appeared beginning from day 4-5. These comprehensive functional measures, that were somewhat analogous to clinical symptoms observed in human IBD, are summarized by the Disease Activity Index, as shown in FIG. 20. This scoring method, validated by repeated studies, showed minimum variations and correlates well with more specific measures of inflammation.

[0231] None of the control animals showed disease activity. DAI peaked at day 5-6 and regressed upon DSS removal. As soon as colitis was established (day 5), hP5 administration significantly ameliorated stool consistency (FIG. 23) and colon bleeding (FIG. 22), as shown by approximately a 50% DAI inhibition, when compared to mice treated with DSS+vehicle or DSS+scrambled peptide (1.950.170 vs. 2.920.054, p0.001 or 3.000.088, p0.001, respectively).

[0232] Protection lasted during the whole treatment. Notably at day 10, in the hP5-treated group both stool score and hemoccult were normal (FIGS. 23 and 22), while the groups treated with DSS+vehicle and DSS+scrambled peptide still showed clinical signs of inflammation (blood score: DSS+hP5=0.430.202 vs DSS+vehicle=1.250.164; p0.01; DSS+hP5=0.430.202 vs DSS+scrambled peptide=1.750.250; p0.001. Stool score: DSS+hP5=0.710.474 vs DSS+vehicle=1.750.250 p0.05; DSS+hP5=0.710.474 vs DSS+scrambled peptide=2.380.324; p0.001).

[0233] We also monitored weight loss associated with the development of colitis. FIG. 21 represents the percentage of weight loss, expressed as a score. Mice started loosing weight at day 4 and the maximal weight loss was reached at day 8. hP5 treatment significantly reduced weight loss in comparison with DSS+scrambled, from day 8 on (day 10: hP5=2.000.436 vs DSS+scrambled pep. 3.500.189; p0.001). At day 11 mice were euthanized and the colon length of each mouse measured from the anus to the end of the cecum (FIG. 24). DSS-induced colon inflammation caused a 30% colon shortening when compared to naive animals. In the hP5-treated group, colon shortening was significantly ameliorated when compared to control group (hP5=7.410.237 vs DSS+vehicle=5.960.230; p0.05). In conclusion, blocking TREM-1 with a human TREM-1 derived peptide attenuates intestinal inflammation even when the peptide is administered after the appearance of the clinical signs of colitis. This finding indicates that the human TREM-1 -derived peptide efficiently blocks interaction of the mouse TREM-1 receptor with its endogenous ligand.

REFERENCES

[0234] 1. Aderem, A, and R. J. Ulevitch, R. J. 2000. Toll-like receptors in the induction of the innate immune response. Nature 406:782-786. [0235] 2. Thoma-Uszynski, S., S. Stenger, O. Takeuchi, M. T. Ochoa, P. A. Engele, P. A. Sieling, P. F. Barnes, M. Rollinghoff, P. L. Bolcskei, and M. Wagner. 2001. Induction of direct antimicrobial activity through mammalian Toll-like receptors. Science 291:1544-1549. [0236] 3. Medzhitov, R., and C Jr. Janeway. 2000. Innate immunity. N. Engl. J. Med. 343:338-344. [0237] 4. Cohen, J. 2002. The immunopathogenesis of sepsis. Nature 420:885-91. [0238] 5. Hotchkiss, R. S., and I. E. Karl. 2003. The pathophysiology and treatment of sepsis. N. Engl. J. Med. 348:138-50. [0239] 6. Vincent, J. L., Q. Sun, and M. J. Dubois. 2002. Clinical trials of immunomodulatory therapies in severe sepsis and septic shock. Clin. Infect. Dis. 34:1084-1093. [0240] 7. Riedemann, N. C., R. F. Guo, and P. Ward. 2003. Novel strategies for the treatment of sepsis. Nat. Med. 9:517-524. [0241] 8. Fisher, C. J. Jr., J. M. Agosti, S. M. Opal, S. F. Lowry, R. A. Balk, J. C. Sadoff, E. Abraham, R. M. Schein, and E. Benjamin. 1996. Treatment of septic shock with the tumor necrosis factor receptor:Fc fusion protein. The Soluble TNF Receptor Sepsis Study Group. N. Engl. J. Med 334:1697-702. [0242] 9. Echtenacher, B., W. Falk, D. N. Mannel, and P. H. Krammer. 1990. Requirement of endogenous tumor necrosis factor/cachectin for recovery from experimental peritonitis. J. Immunol. 145:3762-3766. [0243] 10. Echtenacher, B., K. Weigl, N. Lehn, and D. N. Mannel. 2001. Tumor necrosis factor-dependent adhesions as a major protective mechanism early in septic peritonitis in mice. Infect. Immun. 69:3550-5. [0244] 11. Eskandari, M. K., G. Bolgos, C. Miller, D. T. Nguyen, L. E. DeForge, and D. G. Remick. 1992. Anti-tumor necrosis factor antibody therapy fails to prevent lethality after cecal ligation and puncture or endotoxemia. J. Immunol. 148:2724-30. [0245] 12. Bouchon, A., J. Dietrich, and M. Colonna. 2000. Inflammatory responses can be triggered by TREM-1, a novel receptor expressed on neutrophils and monocytes. J. Immunol. 164:4991-4995. [0246] 13. Colonna, M., and F. Facchetti. 2003. TREM-1 (triggering receptor expressed on myeloid cells): a new player in acute inflammatory responses. J. Infect. Dis. 187 (Suppl):5297-301. [0247] 14. Colonna, M. 2003. TREMs in the immune system and beyond. Nat. Rev. Immunol. 6:445-453. [0248] 15. Nathan, C., and A. Ding. 2001. TREM-1: a new regulator of innate immunity in sepsis syndrome. Nat. Med. 7:530-2. [0249] 16. Bouchon, A., F. Facchetti, M. A. Weigand, and M. Colonna. 2001. TREM-1 amplifies inflammation and is a crucial mediator of septic shock. Nature 410:1103-1107. [0250] 17. Bleharski, J. R., V. Kiessler, C. Buonsanti, P. A. Sieling, S. Stenger, M. Colonna, and R. L. Modlin. 2003. A role for Triggering Receptor Expressed on Myeloid cells-1 in host defense during the early-induced and adaptive phases of the immune response. J. Immunol. 170:3812-3818. [0251] 18. Gibot, S., A. Cravoisy, B. Levy, M. C. Bene, G. Faure, and P. E. Bollaert. 2004. Soluble triggering receptor expressed on myeloid cells and the diagnosis of pneumonia. N. Engl. J. Med. 350:451-8. [0252] 19. Gingras, M. C., H. Lapillonne, and J. F. Margolin. 2001. TREM-1, MDL-1, and DAP12 expression is associated with a mature stage of myeloid development. Mol. Immunol. 38:817-24. [0253] 20. Dinarello, C. A. 1997. Proinflammatory and anti-inflammatory cytokines as mediators in the pathogenesis of septic shock. Chest 112 (suppl):521-9. [0254] 21. Bone, R. C., R. A Balk, F. B. Cerra, R. P. Dellinger, W. A. Knauss, R. M. Schein, and W. J. Sibbald. 1992. Definitions for sepsis and organ failure and guidelines for the use of innovative therapies in sepsis. The ACCP/SCCM Consensus Conference Committee. American in sepsis. The ACCP/SCCM Consensus Conference Committee. American College of Chest Physicians/Society of Critical Care Medicine. Chest 101:1644-55. [0255] 22. Warren, H. S. 1997. Strategies for the treatment of sepsis. N. Engl. J. Med. 336:952-3. [0256] 23. Stone, R. 1994. Search for sepsis drugs goes on despite past failures. Science 264:365-7. [0257] 24. Cohen, J. 2001. TREM-1 in sepsis. Lancet 358:776-8. [0258] 25. Begun, N. A., K. Ishii, M. Kurita-Taniguchi, M. Tanabe, M. Kobayashi, Y. Moriwaki, M. Matsumoto, Y. Fukumori, I. Azuma, K. Toyoshima, and T. Seya. 2004. Mycobacterium bovis BCG cell wall-specific differentially expressed genes identified by differential display and cDNA substraction in human macrophages. Infect. Immun. 12:937-48. [0259] 26. Keane, J., S. Gershon, R. P. Wise, E. Mirabile-Levens, J. Kasznica, W. D. Schwieterman, J. N. Siegel, and M. M. Braun. 2001. Tuberculosis associated with infliximab, a tumor necrosis factor alpha-neutralizing agent. N. Engl. J. Med. 345:1098-104. [0260] 27. Radaev, S., M. Kattah, B. Rostro, M. Colonna, and P. Sun. 2003. Crystal structure of the human myeloid cell activating receptor TREM-1. Structure 11:1527-35. [0261] 28. Lantz, M., U. Gullberg, and E. Nilsson. 1990. Characterization in vitro of a human tumor necrosis factor binding protein. A soluble form of tumor necrosis factor receptor. J. Clin. Invest. 86:1396-1401. [0262] 29. van Zee, K. J., T. Kohno, and E. Fischer. 1992. Tumor necrosis soluble receptors circulate during experimental and clinical inflammation and can protect against excessive tumor necrosis factor in vitro and in vivo. Proc. Natl. Acad. Sci. USA 89:4845-4853. [0263] 30. Collart, M. A., P. Baeuerle, and P. Vassalli. 1990. Regulation of tumor necrosis factor alpha transcription in macrophages. Involvement of four NFB motifs and constitutive and inducible form of NFB. Mol. Cell Biol. 10:1498-506. [0264] 31. Hiscott, J. M., J. J. Garoufalis, A. Roulston, I. Kwan, N. Pepin, J. Lacoste, H. Nguyen, G. Bensi, and M. Fenton. 1993. Characterization of a functional NFB site in the human IL-1P promoter: evidence for a positive autoregulatory loop. Mol. Cell Biol. 13:6231-40. [0265] 32. Urban, M. B., R. Schreck, and P.A. Baeuerle. 1991. NFB contacts DNA by a heterodimer of the p50 and p65 subunit. EMBO J. 10:1817-25. [0266] 33. Lolis, E., and R. Bucala. 2003. Therapeutic approaches to innate immunity: severe sepsis and septic shock. Nat. Rev. Drug. Discov. 2:635-45. [0267] 34. Gibot, S., M. N. Kolopp-Sarda, M. C. Bene, A. Cravoisy, B. Levy, G. Faure, and P. E. Bollaert. 2004. Plasma level of a triggering receptor expressed on myeloid cells-1: its diagnostic accuracy in patients with suspected sepsis. Ann. Intern. Med. 141:9-15. [0268] 35. Schenk M, Bouchon A, Seibold F, and Mueller C. 2007.