CELL STRAIN FOR REDUCING PRODUCTION OF REPLICATION COMPETENT ADENOVIRUS, AND CONSTRUCTION METHOD AND USE THEREOF

20200255862 ยท 2020-08-13

    Inventors

    Cpc classification

    International classification

    Abstract

    Provided are a cell strain HEK293.CS for reducing the production of a replication competent adenovirus, and a construction method and the use thereof. HEK293.CS is a safe adenovirus-producing cell line constructed by knocking out a gene fragment homologous to the Ad5 adenovirus E1 gene in HEK293 and providing a template plasmid to replace said gene fragment with a non-homologous sequence that stabilizes the expression of the E1 gene. Compared with the unmodified HEK293 cell strain, HEK293.CS shows no decrease in growth ability and virus production ability, but does not produce a detectable RCA. HEK293.CS can be used for the mass culture of a recombinant human type 5 adenovirus, and reducing the probability of RCA production in the manufacture process of drugs such as vaccines and antibodies.

    Claims

    1. A cell strain for reducing the production of replication competent adenovirus, wherein it is a cell strain HEK293.CS, and in the cell strain HEK293.CS a non-coding region of the cell strain HEK293 E1 gene is replaced with a heterologous control element.

    2. The cell strain for reducing replication competent adenovirus production according to claim 1, wherein in the cell strain HEK293.CS the ITR and E1A Promoter sequences of the cell strain HEK293 E1 gene is replaced with a heterologous control element.

    3. The cell strain for reducing replication competent adenovirus production according to claim 2, wherein the heterologous control element is PGK Promoter, and the base sequence of the PGK promoter is represented by the sequence of SEQ ID NO:1 in the Sequence Listing.

    4. A method for constructing a cell strain for reducing the production of replication competent adenovirus according to claim 1, wherein the specific steps are as follows: (1) designing, synthesizing, and annealing to obtain four sgRNAs, which are designated as sgRNA1, sgRNA2, sgRNA3, and sgRNA4; (2) preparing a PX462.V2.0 plasmid containing Cas9n enzyme, and digesting the plasmid with Bsal; (3) ligating the four double-stranded sgRNAs obtained in the step (1) respectively to the plasmid recovering from the gel of the enzymatic cleavage in step (2); (4) preparing a homologous template repair plasmid, adding a left homologous arm PSG4 sequence and a right homologous arm Ad5 sequence to both ends of the PGK Promoter, and ligating the synthesized sequence to PUC57 vector plasmid; (5) co-transfecting the four plasmids obtained in step (3) together with the homologous repair plasmid in step (4) into HEK293 cells, and a preliminary modified cell strain is obtained by antibiotic screening and monoclonal purification; with identification, if there is no complete replacement in the modified cell strain, the transfection and screening are continued until the ITR and E1A Promoter of E1 gene in the HEK293 cell strain are completely replaced with a PGK Promoter, i.e., a modified cell line is obtained.

    5. The method for constructing a cell strain for reducing the production of replication competent adenovirus according to claim 4, wherein the method for designing and synthesizing sgRNA1, sgRNA2, sgRNA3, and sgRNA4 in the step (1) includes: screening a sgRNA targeting site, designing and synthesizing sgRNA1T, sgRNA1B, sgRNA2T, sgRNA2B, sgRNA3T, sgRNA3B, sgRNA4T, and sgRNA4B; annealing sgRNA1T with sgRNA1B, sgRNA2T with sgRNA2B, sgRNA3T with sgRNA3B, and sgRNA4T with sgRNA4B respectively, so as to form double-stranded sgRNA1, sgRNA2, sgRNA3, and sgRNA4.

    6. The method for constructing a cell strain for reducing the production of replication competent adenovirus according to claim 4, wherein the screening marker used in step (1) is puromycin.

    7. The method for constructing a cell strain for reducing the production of replication competent adenovirus according to claim 4, wherein it is identified by gene sequencing that there is a complete replacement in the cell line modified in step (5), and it is determined by a biological test method that the modified cell line does not produce detectable RCA.

    8. A method for manufacturing a vaccine or antibody, wherein a cell strain according to claim 1 is used for reducing the production of replication competent adenovirus.

    9. The method according to claim 8, wherein the adenovirus is a recombinant human type 5 adenovirus.

    10. A modified cell or a passage cell thereof, wherein the ITR and E1A Promoter sequence (abbreviated as ITR+E1A Promoter) of E1 gene in the cell or its passage cell is replaced with a heterologous control element, and the sequence of the heterologous control element is less than 35% similar to that of the ITR+E1A Promoter, wherein the cell is from a group consisting of: a HEK293 cell, a 911 cell, a pTG6559 cell, and a N52.E6 cell.

    11. The cell or a passage cell thereof according to claim 10, wherein the cell or its passage cell contains 1 copy or more copies of the ITR+E1A Promoter, part or all copies of the ITR+E1A Promoters are replaced with heterologous control elements.

    12. The cell or a passage cell thereof according to claim 10, wherein the heterologous control element is a promoter that initiates E1A expression in the cell or its passage cell, and is less than 35%, 33%, 32%, 31%, 30%, 29%, 28%, 26%, 25%, 23%, 22% or 20% similar to the ITR+E1A Promoter sequence.

    13. The cell or a passage cell thereof according to claim 10, wherein the ITR+E1A Promoter sequence is the sequence represented by SEQ ID NO:2 or a homologous sequence thereof.

    14. The cell or a passage cell thereof according to claim 10, wherein the heterologous control element is from a group consisting of: a chicken -actin promoter, a CMV promoter, an HSV TK promoter, and a PGK promoter.

    15. The cell or a passage cell thereof according to claim 10, wherein the sequence of the heterologous control element is the sequence represented by SEQ ID NO:1.

    16. The cell or a passage cell thereof according to claim 10, wherein the cell is a HEK293.CS cell strain.

    17. A method for producing an adenovirus, wherein it comprises infecting the cell according to claim 10 or a passage cell thereof with an adenovirus.

    18. The method according to claim 17, wherein the adenovirus is Ad5 adenovirus.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0049] FIG. 1 is a specific target site map of ITR and E1A Promoter of E1 gene in the HEK293 cell modified by Crispr/Cas9n technology;

    [0050] FIG. 2 is a map of the homologous repair template plasmid;

    [0051] FIG. 3 shows a verification method for verifying the modified cell, determining whether the ITR and E1A Promoter are replaced;

    [0052] FIG. 4 is a graph showing the sequencing results of E1 gene in the HEK293.CS cell after transformation.

    DETAILED DESCRIPTION OF EMBODIMENTS

    [0053] The technical solutions of the present invention will be further described below in conjunction with particular embodiments.

    [0054] In the following examples, the replacement of the ITR+E1A Promoter sequence in the HEK293 cell with a PGK promoter is described as an illustrative example. Other heterologous control elements such as a chicken -actin promoter, a CMV promoter, and a HSV TK promoter have similar results to that of a PGK promoter.

    [0055] A method for modifying the HEK293 cell by Crispr/Cas9n technology, wherein it comprises a specific target site sequence for ITR and E1A Promoter of E1 gene in the HEK293 cell, the base sequence of the specific target site is represented by SEQ ID NO:2 of the Sequence Listing; the sgRNA oligonucleotide sequence specifically targeting to ITR and E1A Promoter (ITR+E1A Promoter sequence is represented by SEQ ID NO:2 of the Sequence Listing), and the base sequence is shown in Table 1; the designed and synthesized homologous repair template PGK Promoter as shown in FIG. 2, and the base sequence is represented by SEQ ID NO:1 of the Sequence Listing.

    TABLE-US-00001 TABLE1 sgRNAsequences Names Sequences sgRNA1top CACCGTTGTGACGTGGCGCGGGGCG,the strand sequencerepresentedbySEQIDNO:3 oftheSequenceListing sgRNA1bottom AAACCGCCCCGCGCCACGTCACAAC,the strand sequencerepresentedbySEQIDNO:4 oftheSequenceListing sgRNA2top CACCGCCACCCCCTCATTATCATAT,the strand sequencerepresentedbySEQIDNO:5 oftheSequenceListing sgRNA2bottom AAACATATGATAATGAGGGGGTGGC,the strand sequencerepresentedbySEQIDNO:6 oftheSequenceListing sgRNA3top CACCGCCTCCGAGCCGCTCCGACAC,the strand sequencerepresentedbySEQIDNO:7 oftheSequenceListing sgRNA3bottom AAACGTGTCGGAGCGGCTCGGAGGC,the strand sequencerepresentedbySEQIDNO:8 oftheSequenceListing sgRNA4top CACCGTACTCGCTGGCACTCAAGAG,the strand sequencerepresentedbySEQIDNO:9 oftheSequenceListing sgRNA4bottom AAACCTCTTGAGTGCCAGCGAGTAC,the strand sequencerepresentedbySEQID NO:10oftheSequenceListing

    [0056] The above method for modifying the HEK293 cell by Crispr/Cas9n technology includes the following steps:

    [0057] S1. Designing and synthesizing a sgRNA specifically targeting to the ITR and E1A Promoter of E1 gene in the HEK293 cell, and annealing to form a double strand;

    [0058] S2. Constructing a double-stranded sgRNA into a PX462.V2.0 vector;

    [0059] S3. Designing and synthesizing a homologous repair template plasmid;

    [0060] S4. After mixing the sgRNA and the homologous repair template plasmid constructed in steps S2 and S3, they are transfected into the HEK293 cell, then screening a monoclonal cell strain in which E1 gene is successfully replaced, and its RCA forming ability after virus inoculation is detected.

    [0061] The final concentrations of PX462.V2.0-sgRNA and homologous repair template plasmid in step S4: PX462.V2.0-sgRNA1, PX462.V2.0-sgRNA2, PX462.V2.0-sgRNA3, and PX462.V2.0-sgRNA4 are respectively 20 ng/L, and the PGK Promoter repair template plasmid is 25 ng/L.

    [0062] A method for modifying E1 gene in the HEK293 cell by Crispr/Cas9n system, particularly it includes the following steps:

    [0063] (1) Selecting the target site of the ITR and E1 Promoter of E1 gene in the HEK293 cell, and designing the specific sequence of sgRNA by using software;

    [0064] (2) Designing and synthesizing sgRNA and homologous repair template plasmid, and cloning the sgRNA into the BbsI-digested vector backbone to obtain PX462. V2.0-sgRNA;

    [0065] (3) Mixing the obtained PX462.V2.0-sgRNA with the homologous repair template plasmid to the following final concentrations: PX462.V2.0-sgRNA1, PX462.V2.0-sgRNA2, PX462.V2.0-sgRNA3, and PX462.V2.0-sgRNA4 are respectively 20 ng/L, and the PGK Promoter repair template plasmid is 25 ng/L.

    [0066] (4) Transfecting the mixed PX462.V2.0-sgRNA and the homologous repair template plasmid into the HEK293 cell, and then the cell is subjected to resistance pressurization, thereby screening a gene-editing cell HEK293.CS in which the sequence of ITR and E1 Promoter of E1 gene is completely replaced.

    Example 1

    [0067] Constructing a Crispr/Cas9n System for the ITR and E1 Promoter of E1 Gene in the HEK293 Cell

    [0068] First, according to the HEK293 genomic sequence in NCBI, the ITR and E1 Promoter of E1 gene is selected as a target site to design sgRNA. The target site sequence is shown in FIG. 1, and the sgRNA sequence is shown in Table 1 above.

    [0069] Second, the construction of the specific sgRNA sequence of PX462.V2.0-sgRNA:

    [0070] (1) Designing and synthesizing the sgRNA that recognizes the ITR and E1 Promoter of E1 gene;

    [0071] (2) Annealing the synthesized sgRNA oligonucleotide in vitro;

    [0072] (3) Digesting PX462.V2.0 through the Bsal site and ligating it with sgRNA, then designating as PX462.V2.0-sgRNA.

    [0073] Finally, a homologous repair template plasmid is designed according to the target site sequence of the sgRNA.

    Example 2

    [0074] Cell Transfection

    [0075] HEK293 cells are inoculated at a density of 410.sup.5/well in a six-well plate, and transfected when they grow to 70%-90% (about 18-20 h) fusion rate. Transfecting the cells with 20 L of premixed PX462.V2.0-sgRNA and PGK Promoter template repair plasmid (the following final concentrations: PX462.V2.0-sgRNA1, PX462.V2.0-sgRNA2, PX462.V2.0-sgRNA3, PX462.V2.0-sgRNA4 are respectively 20 ng/L, and PGK Promoter Repair template plasmid is 25 ng/L) and 5 L of Lipo2000 transfection reagent, then adding SCR7 non-homologous recombination inhibitor (final concentration: 0.01 mM) after 12 h, and adding Puromycin (final concentration: 3 g/mL) after 36 h for screening.

    Example 3

    [0076] Screening Verification

    [0077] The method shown in FIG. 3 is used to verify whether E1 gene in the HEK293.CS cell is completely replaced, and it includes extracting the genome of the modified cell. If a band can be obtained by amplification through the ProF/AdR primer pair, it is proved that there are original sequences replaced by PGK Promoters. If a fragment can be obtained by amplification through the YSF/R primer pair, it is proved that the original sequence is still present in the replaced cell, and the replacement is not performed completely. Only when a band can be obtained by amplification through the ProF/AdR primer pair, but a band cannot be obtained by amplification through the YSF/R primer pair, it is proved that the ITR and E1A Promoter in the HEK293 cell is completely replaced with a PGK Promoter. If the sequencing result of the fragments amplified by the YZF/R primer pair proves a pure PGK Promoter sequence, it is further proved that the original sequence is completely replaced.

    [0078] The validation primers are shown in Table 2. It can be seen from the sequencing results in FIG. 4 that the ITR and E1 Promoter in the HEK293.CS cell has been completely replaced with a PGK Promoter.

    TABLE-US-00002 TABLE2 Primersequencesfordetection Names Sequences ProF TCTCGCACATTCTTCACGTC,thesequencerepre- sentedbySEQIDNO:11oftheSequence Listing AdR CGTTAACCACACACGCAATC,thesequencerepre- sentedbySEQIDNO:12oftheSequence Listing YSF CTGCTTCGCCGAGTCTAAC,thesequencerepresented bySEQIDNO:13oftheSequenceListing YSR CCACATCCGTCGCTTACA,thesequencerepresented bySEQIDNO:14oftheSequenceListing YZF CTGTTCCAGAAGCCCTAT,thesequencerepresented bySEQIDNO:15oftheSequenceListing YZR ACACCTCCGTGGCAGATA,thesequencerepresented bySEQIDNO:16oftheSequenceListing

    Example 4

    [0079] Detection of the Virus-Producing Ability

    [0080] HEK293 and HEK293.CS cells are separately inoculated into 10 cm cell culture dishes, each kind of cells are respectively infected with Ad5-EBOV (GP) and Ad5-TB (Ag85A) viruses having a MOI (multiplicity of infection) of 10. The infected cells are harvested on the third day, at that time most of the cells are lysed and floated, indicating that the viruses are replicated. After harvesting the cells and the supernatant, the viruses are released from the lysed cells after three cycles of repeated freezing/thawing, and the cell debris is removed by centrifugation, followed by purification through column chromatography. The ratio of virus particles/cells is given as a measure of the cell productivity for the growth of different viruses through dividing the total virus particles by the number of cells at the time of infection, thereby determining the virus-producing ability of the cells before and after the transformation. Table 3 shows that the yields of the adenoviral vectors produced by HEK293 or HEK293.CS cells are nearly equivalent.

    TABLE-US-00003 TABLE 3 Comparison of virus-producing ability of the HEK293 cell and that of the HEK293.CS cell after transformation Yields of the viruses (IFU/ml) Viruses HEK293 cell HEK293.CS Ad5-EBOV (GP) (3 0.02) 10.sup.9 (2.1 0.01) 10.sup.9 Ad5-TB (Ag85A) (3 0.03) 10.sup.9 .sup.(3 0.02) 10.sup.9

    Example 5

    [0081] RCA Detection

    [0082] 310.sup.10 or 310.sup.11 purified Ad5-GP virus particles after the propagation of HEK293 or HEK293.CS are used, and RCA is detected by using the existing biological test method (Quality control of clinical grade gene therapy products of recombinant adenovirus. [J]. Zhang Xiaozhi, Lin Hong, Yang Xiaoyan, et al. Chinese Medical Journal, 2004, 84 (10), 849-852.) Zhang Xiaozhi et al., Chinese Journal of Medicine, 2004). The detection results are shown in Table 4. It can be seen from Table 4, when the sample size is 310.sup.10 VP, one RCA can be detected in the Ad5-GP viruses propagated in HEK293 cells, and when the sample size is increased to 310.sup.11 VP, 13 RCAs are detected in the Ad5-GP viruses propagated in HEK293 cells, but no RCA is detected in the two sample sizes of the Ad5-GP viruses propagated in HEK293.CS cells.

    TABLE-US-00004 TABLE 4 Comparison of the RCA formation ability of the HEK293 cell and that of the HEK293.CS cell after transformation The cell for The number of RCAs in The number of RCAs in producing viruses 3 10.sup.10 viruses 3 10.sup.11 viruses HEK293 1 13 HEK293.CS 0 0

    [0083] The above detailed description of the cell strain for reducing the production of the replication competent adenovirus and construction method and use thereof referring to the Examples are illustrative and not limiting, and several examples can be listed according to the limited scope, therefore the variations and modifications within the spirit of the invention should fall into the protection scope of the invention.