NEMATODE RESISTANCE

20200248195 ยท 2020-08-06

Assignee

Inventors

Cpc classification

International classification

Abstract

The invention is in the field of agriculture, in particular in the field of crop protection, more particularly in the field of providing nematode resistance to plants. A method for producing a plant having improved nematode resistance, particularly to root-knot nematodes and/or cyst nematodes, is disclosed, as well as a plant produced by such method.

Claims

1-43. (canceled)

44. A method for producing a plant having improved nematode resistance compared to a control plant, comprising the step of impairing in the plant at least one of i) the expression and/or the activity of a WRKY32 polypeptide; and ii) the expression of a WRKY32 polynucleotide encoding the WRKY32 polypeptide, wherein the WRKY32 polypeptide is a transcription factor protein belonging to the WRKY32 family that comprises two WRKY domains and is capable of binding to at least one W-box polynucleotide consensus sequence.

45. The method according to claim 44, wherein the WRKY32 polypeptide is an endogenous polypeptide and/or the WKRY32 polynucleotide is an endogenous polynucleotide.

46. The method according to claim 44, wherein the WRKY32 polypeptide is a polypeptide comprising an amino acid sequence having at least 80% sequence identity to the amino acid sequence of any one of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8 and 15, and/or wherein the WRKY32 polynucleotide has at least 80% sequence identity with the nucleotide sequence of any one of SEQ ID NO: 9, 10, 11, 13 and 14.

47. The method according to claim 44, wherein the method further comprises the step of regenerating said plant.

48. The method according to claim 44, wherein the expression of said polypeptide and/or polynucleotide is impaired in at least the roots of said plant.

49. The method according to claim 44, wherein at least one of i) the expression and/or activity of the WRKY32 polypeptide; and ii) the expression of the WRKY32 polynucleotide is impaired by modifying the WRKY32 polynucleotide.

50. The method according to claim 49, wherein the modification of the WRKY32 polynucleotide comprises an insertion, a deletion or a substitution of at least one nucleotide in the polynucleotide.

51. A method according to claim 44, wherein the expression and/or activity of the WRKY32 polypeptide and/or expression of the WRKY32 polynucleotide is impaired using gene silencing or gene knock out.

52. A plant, plant part, rootstock, seed or cell, wherein expression and/or activity of a WRKY32 polypeptide and/or expression of a WRKY32 polynucleotide is impaired, wherein the WRKY32 polypeptide is a transcription factor protein belonging to the WRKY32 family that comprises two WRKY domains and is capable of binding to at least one W-box polynucleotide consensus sequence.

53. The plant, plant part, rootstock, seed or cell according to claim 52, wherein the WRKY32 polypeptide is an endogenous polypeptide and/or the WKRY32 polynucleotide is an endogenous polynucleotide.

54. The plant, plant part, rootstock, seed or cell according to claim 52, wherein the WRKY32 polypeptide is a polypeptide comprising an amino acid sequence having at least 80% sequence identity to the amino acid sequence of any one of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8 and 15, and/or wherein the WRKY32 polynucleotide has at least 80% sequence identity with the nucleotide sequence of any one of SEQ ID NO: 9, 10, 11, 13 and 14.

55. A plant, plant part, rootstock, seed or cell, obtained by the method of claim 44.

56. The plant, plant part, rootstock, seed or cell according to claim 52, comprising a modified WRKY32 polynucleotide.

57. The plant, plant part, rootstock, seed or cell according to claim 56, wherein said modification preferably comprises the insertion, deletion or substitution of at least one nucleotide in said polynucleotide.

58. The plant, plant part, rootstock, seed or cell according to claim 52, wherein expression and/or activity of the WRKY32 polypeptide and/or expression of the WRKY32 polynucleotide is impaired by gene silencing or gene knock out.

59. A progeny of the plant, plant part, rootstock, seed or cell according to claim 52.

60. A modified WRKY32 polynucleotide encoding a WRKY32 polypeptide, comprising one or more modifications resulting in impaired expression or activity of the WKRY32 polypeptide and/or impaired expression of a WRKY32 polynucleotide, wherein the WRKY32 polypeptide is a transcription factor protein belonging to the WRKY32 family that comprises two WRKY domains and is capable of binding to at least one W-box polynucleotide consensus sequence.

61. The modified WRKY32 polynucleotide according to claim 60, wherein the WKRY32 polynucleotide is an endogenous polynucleotide.

62. The modified WRKY32 polynucleotide according to claim 60, wherein the WRKY32 polynucleotide has at least 80% sequence identity with the nucleotide sequence of any one of SEQ ID NO: 9, 10, 11, 13 and 14.

63. A modified WRKY32 polypeptide encoded by the modified WRKY32 polynucleotide according to claim 60, wherein the polypeptide is modified to have reduced activity by the insertion, deletion or substitution of at least one nucleotide in the WRKY32 polynucleotide.

Description

BRIEF DESCRIPTION OF THE FIGURES

[0136] FIG. 1 shows the number of root knots on the roots caused by infection with M. incognita in plants wherein the expression of Solyc07g005650 gene was silenced compared to a control plant.

[0137] FIG. 2 shows the number of root knots on the roots caused by infection of M. incognita in Arabidopsis plants wherein the wrky32 gene was disrupted compared to a control plants.

[0138] FIG. 3 shows the number of developed females per plant caused by Heterodera schachtii infection in Arabidopsis plants wherein the wrky32 gene was disrupted compared to a control plants.

SEQUENCE LISTING

[0139] SEQ ID NO: 1 Solanaceae consensus WRKY32 protein sequence

[0140] SEQ ID NO: 2 Brassicaceae consensus WRKY32 protein sequence

[0141] SEQ ID NO: 3 Cucurbitaceae consensus WRKY32 protein sequence

[0142] SEQ ID NO: 4 Fabaceae consensus WRKY32 protein sequence

[0143] SEQ ID NO: 5 Rosaceae consensus WRKY32 protein sequence

[0144] SEQ ID NO: 6 Poaceae consensus WRKY32 protein sequence

[0145] SEQ ID NO: 7 Solanum consensus WRKY32 protein sequence

[0146] SEQ ID NO: 8 Solanum lycopersicum WRKY32 protein sequence

[0147] SEQ ID NO: 9 Solanum consensus WRKY32 coding nucleic acid sequence

[0148] SEQ ID NO: 10 Solanum lycopersicum WRKY32 genomic nucleic acid sequence

[0149] SEQ ID NO: 11 Solanum lycopersicum WRKY32 coding nucleic acid sequence

[0150] SEQ ID NO: 12 Solanum lycopersicum WRKY32 RNAi sequence

[0151] SEQ ID NO: 13 Arabidopsis thaliana WRKY32 genomic nucleic acid sequence

[0152] SEQ ID NO: 14 Arabidopsis thaliana coding nucleic acid sequence

[0153] SEQ ID NO: 15 Arabidopsis thaliana protein sequence

EXAMPLES

Example 1

[0154] Nematode Disease Assays in Solanum lycopersicum

[0155] In order to test nematode resistance in tomato (S. lycopersicum) plants, we investigated if impaired expression or alteration of the WRKY32 protein encoded by the Solyc07g005650 gene resulted in reduced disease symptoms by root-knot nematode infection.

Test Group

[0156] In order to test the effect of reduced expression of Solyc07g005650 gene on the ability of the nematode M. incognita to infest the tomato (S. lycopersicum) plants, an experiment was performed whereby S. lycopersicum roots were transfected with an RNAi vector construct designed to silence the Solyc07g005650 gene, the RNAi having the sequence CTGACATGCCAGTACCCAAAAAACGTCATGGTCCACCGAGTGCACCTCTTATTGCTGCT ACTGCCCCTGCTTCCGTAACCACTATGCATGCTAACAAACCCGAACCCCTACAACATCAA AAATCGACCACACAATGGTCCGTGGACAAAGAAGGTGAGTTGACTGGTGAGAAATTGGA TGTTGGAGGAGAAAAAGCAATGG. Rhizobium rhizogenes-mediated transfection of tomato roots was visually aided by the presence of DS-red (used as fluorescent marker) on the same plasmid.

Control Group

[0157] The control group consisted of tomato (S. lycopersicum) plants, which were transformed with the vector construct but which was devoid of the RNAi designed to silence the Solyc07g005650 gene.

[0158] Following successful transfection with the vector construct as defined above, plants from both experimental groups (i.e. 3-week-old sand-grown tomato plants) were infected with 500 J2s of M. incognita per plant. Infection of tomato roots by M. incognita was determined 5 weeks post infection.

[0159] The number of root-knots caused by M. incognita was determined in both experimental groups (i.e. test and control groups). In the test group, roots, which were successfully transfected were identified by determining the presence of DS-red fluorescence in the roots using a binocular, see hatched bar in FIG. 1). Roots which were not successfully transfected in the test group plant did not show any DS-red fluorescent signal, see black bar In FIG. 1. Such roots served as an internal control within the test group plants.

[0160] The number of root-knots formed was also determined in the control group plants i.e. plants that were transfected with the control vector (i.e. lacking RNAi designed to silence the Solyc07g005650 gene) using the same procedure as above. The results obtained for each experimental group were compared. The results are shown in FIG. 1.

[0161] FIG. 1 shows that in the test group (WRKY32 silenced), the roots that were successfully transfected (i.e., displayed DS-red fluorescent signal)) displayed about 90% fewer disease symptoms (root-knot) compared to the roots which were not transfected (i.e. displayed no DS-red fluorescent signal). Further, it was be observed that the (number of root-knots formed on the non-transfected roots in the test group was similar to that of the control group plants (i.e. both transfected and non-transfected roots). Moreover, it was observed that the plants of the test group displayed improved or greater nematode resistance than the plant of the control group (see hatched bar in FIG. 1).

[0162] In the control group, there was no significant difference in the number of root-knots on the transfected roots and non-transfected roots.

[0163] Overall, these results indicate that impairing (i.e. by silencing) the expression of the endogenous WRKY32 gene (Solyc07g005650 gene) in tomato (S. lycopersicum) plants causes increased or improved resistance to nematodes compared to control plants.

Example 2

[0164] Root-Knot Nematode Disease Assays in Arabidopsis thaliana

[0165] In order to test nematode resistance in Arabidopsis (A. thaliana) plants we investigated if impaired expression or alteration of the WRKY32 protein encoded by At4g30935 gene resulted in reduced disease symptoms by root-knot nematode (Meloidogyne incognita) infection.

Test Group

[0166] In order to assess the effect of impaired expression of At4g30935 gene (SEQ ID NO: 13 represents the genomic sequence; SEQ ID NO: 14 represents the coding sequence; SEQ ID NO: 15 represents the protein), on the ability of the nematode Meloidogyne incognita to infest A. thaliana plants, an experiment was performed whereby 10-days old plants of A. thaliana mutant line (SALK091352; Alonso et al, 2003, Science) containing T-DNA insertion in At4g30935 gene grown on sterile MS20/Gelrite medium in 6-well cell culture plates, were challenged with 200 sterile Meloidogyne incognita infective juveniles (J2s) per plant.

Control Group

[0167] The control group consisted of A. thaliana Col-0 wild type plants, ecotype that was used as a background to create a publicly available genome-wide collection of insertional mutants (Alonso et al, 2003, Science). Ten-days old plants grown on sterile MS20/Gelrite medium in 6-well cell culture plates, were challenged with 200 sterile Meloidogyne incognita infective juveniles (J2s) per plant.

[0168] The total number of root-knots caused by M. incognita was determined per plant in both experimental groups (i.e. test and control group) 5 weeks after inoculation with nematodes. FIG. 2 shows that in the test group (WRKY32 gene disruption) the roots displayed on average about 15% fewer root-knots compared to the roots of control group (Control). Further it was observed that the sizes of the root systems in the test group were similar to the root system sizes in the control roots.

[0169] Overall, these results indicate that knocking-out the expression of the At4g30935 gene in Arabidopsis thaliana caused improved resistance to root-knot nematodes compared to control plants.

Example 3

[0170] Beet-Cyst Nematode Disease Assays in Arabidopsis thaliana

[0171] In order to test nematode resistance in Arabidopsis (A. thaliana) plants we investigated if impaired expression or alteration of the WRKY32 protein encoded by At4g30935 gene resulted in reduced disease symptoms by beet cyst nematode (Heterodera schachtii) infection.

Test Group

[0172] In order to assess the effect of impaired expression of At4g30935 gene on ability of the nematode Heterodera schachtii to infest A. thaliana plants, an experiment was performed whereby 10-days old plants of A. thaliana mutant line (SALK_091352; Alonso et al, 2003, Science) containing T-DNA insertion in At4g30935 gene, grown on sterile KNOP/Daichin agar medium in 6-well cell culture plates, were challenged with 150 sterile H. schachtii infective juveniles (J2s) per plant.

Control Group

[0173] The control group consisted of A. thaliana Col-0 wild type plants, ecotype that was used as a background to create a publicly available genome-wide collection of insertional mutants (Alonso et al, 2003, Science). Ten-days old plants grown on sterile KNOP/Daichin agar medium in 6-well cell culture plates, were challenged with 150 sterile H. schachtii (IRS) infective juveniles (J2s) per plant.

[0174] The total number of developing H. schachtii females was determined per plant in both experimental groups (i.e. test and control group) 2 weeks after inoculation with nematodes. FIG. 3 shows that in the test group (WRKY32 gene disruption) the roots support development of on average about 51% fewer females compared to the roots of control group (Control). Further it was observed that the sizes of the root systems in the test group were similar to the root system sizes in the control roots.

[0175] Overall, these results indicate that knocking-out the expression of the At4g30935 gene in Arabidopsis thaliana caused improved resistance to beet cyst nematode compared to control plants.