NOVEL GENE FOR INCREASING PLANT BIOMASS AND USE THEREFOR

20200248198 ยท 2020-08-06

Assignee

Inventors

Cpc classification

International classification

Abstract

An object of the present invention is to identify a novel gene that effectively increases plant biomass and to provide said gene as well as techniques utilizing the same.

This invention provides a nucleic acid encoding a protein, wherein the protein comprises the amino acid sequence of SEQ ID NO:1 and an amino acid sequence having at least 25% identity or at least 75% similarity to the amino acid sequence of SEQ ID NO:7 or 11, and has an activity to increase plant biomass, as well as techniques utilizing the same.

Claims

1-27. (canceled)

28. A genetically modified plant comprising a recombinant expression construct which artificially overexpresses a nucleic acid encoding a protein in said genetically modified plant, wherein the protein comprises: a region comprising the amino acid sequence of SEQ ID NO:1, and wherein the protein has at least 40% identity or at least 75% similarity to the amino acid sequence of SEQ ID NO:7 or 11, and wherein the overexpression of the nucleic acid encoding the protein results in an increase in plant biomass in said genetically modified plant as compared to a control plant of the same species lacking said recombinant expression construct.

29. The genetically modified plant according to claim 28, wherein the amino acid sequence of SEQ ID NO: 1 is set forth in the amino acid sequence of SEQ ID NO:2.

30. The genetically modified plant according to claim 28, wherein the protein comprises the amino acid sequence of any of SEQ ID NOs:3 to 5.

31. The genetically modified plant according to claim 28, wherein the nucleic acid is obtained from a monocotyledonous plant or a dicotyledonous plant, and wherein the genetically modified plant is a monocotyledonous plant.

32. A method for increasing plant biomass, comprising the step of transforming a plant with a recombinant expression construct which artificially overexpresses a nucleic acid encoding a protein into said transformed plant, wherein the protein comprises: a region comprising the amino acid sequence of SEQ ID NO:1, and wherein the protein has at least 40% identity or at least 75% similarity to the amino acid sequence of SEQ ID NO:7 or 11, and wherein the overexpression of the nucleic acid encoding the protein results in an increase in plant biomass in said transformed plant as compared to a control plant of the same species lacking said recombinant expression construct.

33. The method according to claim 32, wherein the amino acid sequence of SEQ ID NO:1 is the amino acid sequence of SEQ ID NO:2.

34. The method according to claim 32, wherein the protein comprises the amino acid sequence of any of SEQ ID NOs:3 to 5.

35. The method according to claim 32, wherein the nucleic acid is obtained from a monocotyledonous plant or a dicotyledonous plant, and wherein the transformed plant is a monocotyledonous plant.

36. A method for preparing a plant with increased biomass, comprising the step of introducing a nucleic acid encoding a protein into a plant, wherein the protein comprises: the amino acid sequence of SEQ ID NO:1, and an amino acid sequence having at least 40% identity or at least 75% similarity to the amino acid sequence of SEQ ID NO:7 or 11, and has an activity to increase plant biomass.

37. The method according to claim 36, wherein the amino acid sequence of SEQ ID NO:1 is the amino acid sequence of SEQ ID NO:2.

38. The method according to claim 36, wherein the protein comprises the amino acid sequence of any of SEQ ID NOs:3 to 5.

39. The method according to a claim 36, wherein the nucleic acid is a nucleic acid derived from a monocotyledonous plant or a dicotyledonous plant, and wherein the plant is a monocotyledonous plant.

40. A recombinant expression construct comprising a nucleic acid encoding a protein and a heterologous promoter operably linked to the nucleic acid, wherein the protein comprises: a region comprising the amino acid sequence of SEQ ID NO:1, and wherein the protein has at least 40% identity or at least 75% similarity to the amino acid sequence of SEQ ID NO:7 or 11, and wherein the overexpression of the nucleic acid encoding the protein results in an increase in plant biomass in a plant transformed with said recombinant expression construct as compared to a control plant of the same species lacking said recombinant expression construct.

41. The recombinant expression construct according to claim 40, wherein the amino acid sequence of SEQ ID NO:1 is the amino acid sequence of SEQ ID NO:2.

42. The recombinant expression construct according to claim 40, wherein the protein comprises the amino acid sequence of any of SEQ ID NOs:3 to 5.

43. A recombinant expression vector comprising the recombinant expression construct according to claim 40.

44. A transgenic host cell comprising the recombinant expression vector according to claim 43.

45. A transgenic plant cell comprising the recombinant expression vector according to claim 43.

46. The transgenic plant cell according to claim 45, wherein the nucleic acid is obtained from a monocotyledonous plant or a dicotyledonous plant, and wherein the transgenic plant cell is a monocotyledonous plant cell.

47. A method for screening for a plant with increased biomass, comprising the steps of: (1) measuring the expression levels of a protein or a nucleic acid encoding the protein in test and wild-type plants, wherein the protein comprises: the amino acid sequence of SEQ ID NO:1, and an amino acid sequence having at least 40% identity or at least 75% similarity to the amino acid sequence of SEQ ID NO:7 or 11, and has an activity to increase plant biomass; (2) comparing the expression levels obtained at step (1); and (3) selecting the test plant whose expression level is higher than that in the wild-type plant.

48. The method according to claim 47, wherein the amino acid sequence of SEQ ID NO:1 is the amino acid sequence of SEQ ID NO:2.

49. The method according to claim 47, wherein the protein comprises the amino acid sequence of any of SEQ ID NOs:3 to 5.

50. The method according to claim 47, wherein the nucleic acid is a nucleic acid derived from a monocotyledonous plant or a dicotyledonous plant, and wherein the plant is a monocotyledonous plant.

51. A method for verifying a plant with increased biomass, comprising the steps of: (1) measuring the expression levels of a protein or a nucleic acid encoding the protein in test and wild-type plants, wherein the protein comprises: the amino acid sequence of SEQ ID NO:1, and an amino acid sequence having at least 40% identity or at least 75% similarity to the amino acid sequence of SEQ ID NO:7 or 11, and has an activity to increase plant biomass; (2) comparing the expression levels obtained at step (1); and (3) confirming that the expression level in the test plant is higher than that in the wild-type plant.

52. The method according to claim 51, wherein the amino acid sequence of SEQ ID NO:1 is the amino acid sequence of SEQ ID NO:2.

53. The method according to claim 51, wherein the protein comprises the amino acid sequence of any of SEQ ID NOs:3 to 5.

54. The method according to claim 51, wherein the nucleic acid is a nucleic acid derived from a monocotyledonous plant or a dicotyledonous plant, and wherein the plant is a monocotyledonous plant.

55. The genetically modified plant according to claim 28, wherein expression level of the nucleic acid is higher than that in a wild-type plant.

Description

DESCRIPTION OF EMBODIMENTS

[0054] (1) Nucleic Acid and Protein

[0055] In the present invention, the bil7 (Brz-insensitive-long-hypocotyl 7) gene is used as a nucleic acid that contributes to an increase in plant biomass. The bil7 gene is a gene that is involved in brassinosteroid signaling and which was discovered in a mutant whose hypocotyl elongates even in the presence of brassinazole (Brz), a brassinosteroid biosynthesis inhibitor; and this gene can be found in various species of plants. Although the nucleotide sequence of the bil7 gene and the amino acid sequence of a protein encoded by said gene (i.e., BIL7 protein) vary among different species of plants, the protein of the present invention has a common motif consisting of the amino acid sequence of SEQ ID NO:1 as shown below.

TABLE-US-00001 SEQIDNO:1: Ala-Pro-Pro-Ser-Ser-Pro-Ala-Ser-X1-X2-X3-Ser-X4- X5-X6-Ser-X7-X8-X9-X10-Pro-X11-Gly-Pro-Tyr-Ala- X12-Glu-X13-X14-X15-Val-X16-Pro-Pro-Val-Phe-Ser- X17-X18-X19-Thr-X20-Pro-Ser-X21-Ala-Pro-X22-Thr- Pro-Pro-X23-Pro-Ser-Ser-Pro-X24-Val-Pro-X25-Ala- X26-Pro-X27-Ser-Pro-X28-Ser-Pro
(where X1 represents Phe or Tyr; X2 represents Phe, Leu, Thr or Ala; X3 represents Gln, Pro, His or Asn; X4 represents Glu, Gly, Asp, Ala or Met; X5 represents Pro, Gly, Leu or Ala; X6 represents Pro, Ala, Thr or Ser; X7 represents Ala, Ile, Val, Ser, or Thr; X8 represents Thr, Val, Ser or Ala; X9 represents Gln or His; X10 represents Ser or Thr; X11 represents 15 to 30 amino acid residues; X12 represents His or Asn; X13 represents Thr or Pro; X14 represents Gln or Ala; X15 represents Leu or Pro; X16 represents Ser or Thr; X17 represents Thr or Ala; X18 represents Tyr or Phe; X19 represents Thr, Ile or Pro; X20 represents Glu or Ala; X21 represents Ser or Thr; X22 represents Ile, Val, Tyr or Phe; X23 represents 3 to 15 amino acid residues; X24 represents Glu or Asp; X25 represents Phe or Tyr; X26 represents 20 to 50 amino acid residues; X27 represents Gly, Glu or Asp; and X28 represents 5 or 6 amino acid residues.)

[0056] In the aforementioned amino acid sequence, X11 preferably represents 17 to 29 amino acid residues, more preferably 20 to 26 amino acid residues; X23 preferably represents 3 to 12 amino acid residues, more preferably 8 to 12 amino acid residues; X26 preferably represents 23 to 49 amino acid residues, more preferably 23 to 30 amino acid residues; and X28 preferably represents 5 amino acid residues.

[0057] The plant having BIL7 protein comprising the aforementioned common motif is not particularly limited, and can be exemplified by Arabidopsis thaliana (thale cress), Glycine max (soybean), Oryza sativa (rice), Zea mays (corn), Raphanus sativus (radish), Populus trichocarpa (poplar), Vitis vinifera (grape), and Physcomitrella patens. The nucleotide sequences of mRNAs (and cDNAs) encoding BIL7 proteins and the amino acid sequences of BIL7 proteins in different species of plants have been identified and registered under the Genbank accession numbers as shown in the table below.

TABLE-US-00002 TABLE 1 mRNA (or cDNA) Coding region Protein Arabidopsis thaliana NM_105049 182 to 1258 NP_564816 (Ver. NM_105049.4) (Ver. NP_564816.1) (SEQ ID NO: 6) (SEQ ID NO: 7) Glycine max XM_003538647 193 to 1431 XP_003538695 (Ver. XM_003538647.2) (Ver. XP_003538695.1) (SEQ ID NO: 8) (SEQ ID NO: 9) Oryza sativa NM_001055090 416 to 1702 NP_001048555 (Ver. NM_001055090.1) (Ver. NP_001048555.1) (SEQ ID NO: 10) (SEQ ID NO: 11) Zea mays NM_001149669 359 to 1651 NP_001143141 (Ver. NM_001149669.2) (Ver. NP_001143141.1) (SEQ ID NO: 12) (SEQ ID NO: 13) Raphanus sativus AJ550021 REGION: complement 1 to 1029 CAZ40337 (join(101320_102240, 102502_102609)) (Ver. CAZ40337.1) (Ver. AJ550021.2) (SEQ ID NO: 15) (SEQ ID NO: 14) Populus trichocarpa XM_002318173 298 to 1821 XP_002318209 (Ver. XM_002318173.2) (Ver. XP_002318209.1) (SEQ ID NO: 16) (SEQ ID NO: 17) Vitis vinifera XM_002272286 177 to 1523 XP_002272322 (Ver. XM_002272286.2) (Ver. XP_002272322.1) (SEQ ID NO: 18) (SEQ ID NO: 19) Physcomitrella patens XM_001756821 1 to 4092 XP_001756873 (Ver. XM_001756821.1) (Ver. XP_001756873.1) (SEQ ID NO: 20) (SEQ ID NO: 21)

[0058] The BIL7 protein having the aforementioned common motif also includes homologs of BIL7 proteins from different species of plants. For example, there are three homolog proteins of A. thaliana BIL7, and the mRNA (and cDNA) nucleotide sequences and amino acid sequences for those homologs have been registered under the Genbank accession numbers as shown in the table below.

TABLE-US-00003 TABLE 2 mRNA (or cDNA) Coding region Protein Arabidopsis thaliana NM_124622 227 to 1543 NP_200056 homolog 1 (Ver. NM_124622.4) (Ver. NP_200056.1) (SEQ ID NO: 22) (SEQ ID NO: 23) Arabidopsis thaliana NM_118694 384 to 1733 NP_194292 homolog 2 (Ver. NM_118694.4) (Ver. NP_194292.2) (SEQ ID NO: 24) (SEQ ID NO: 25) Arabidopsis thaliana NM_106316 374 to 1669 NP_177792 homolog 3 (Ver. NM_106316.4) (Ver. NP_177792.1) (SEQ ID NO: 26) (SEQ ID NO: 27)

[0059] The protein of the present invention is characterized not only by comprising the aforementioned common motif, but also by further comprising an amino acid sequence having at least 25% identity or at least 75% similarity to the amino acid sequence of SEQ ID NO:7 or 11, relative to BIL7 protein of A. thaliana or O. sativa. In this invention, the aforementioned common motif (i.e., the amino acid sequence of SEQ ID NO:1) is included by an amino acid sequence having at least 25% identity or at least 75% similarity to the amino acid sequence of SEQ ID NO:7 or 11 (in other words, the aforementioned common motif (i.e., the amino acid sequence of SEQ ID NO:1) is contained (present) as part of an amino acid sequence having at least 25% identity or at least 75% similarity to the amino acid sequence of SEQ ID NO:7 or 11).

[0060] As referred to herein, the identity in amino acid sequence refers to an identity in amino acid sequence between two proteins of interest, and is expressed by the proportion (%) of amino acid residues matched in the best amino acid sequence alignments produced using a mathematical algorithm known in the art. The identify in amino acid sequence can be determined by visual inspection and mathematical calculation, and can be calculated using a tool known to those skilled in the art, such as homology search program (e.g., BLAST, FASTA), sequence alignment program (e.g., ClustalW)), or genetic information processing software (e.g., GENETYX). The identity in amino acid sequence, as referred to herein, can be specifically determined using the phylogeny analysis program, ClustalW, which is published on the website of DDBJ (DNA Data Bank of Japan) (http://clustalw.ddbj.nig.ac.jp/index.php?lang=ja) in its default configuration (Version 2.1; Alignment type: slow; DNA Weight Matrix: Gonnet; GAP OPEN: 10; GAP EXTENSION: 0.1).

[0061] The protein of the present invention can comprise an amino acid sequence having an identity of at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% with respect to the amino acid sequence of SEQ ID NO:7 or 11.

[0062] The identities between A. thaliana BIL7 protein and each of its homologs are 41% (homolog 1), 43% (homolog 2) and 28% (homolog 3). Thus, in one preferred embodiment, the protein of the present invention comprises an amino acid sequence having an identity of at least 25%, at least 30%, or at least 40% with respect to the amino acid sequence of SEQ ID NO:7. The identities between A. thaliana BIL7 protein and each of G. max, O. sativa and Z. mays BIL7 proteins are 44% (G. max BIL7), 41% (O. sativa BIL7) and 40% (Z. mays BIL7). Thus, in one preferred embodiment, the protein of this invention comprises an amino acid sequence having at least 40% identity to the amino acid sequence of SEQ ID NO:7. The identities between O. sativa BIL7 protein and each of G. max and Z. mays BIL7 proteins are 42% (G. max BIL7) and 85% (Z. mays BIL7). Thus, in one preferred embodiment, the protein of this invention comprises an amino acid sequence having an identity of at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 85% with respect to the amino acid sequence of SEQ ID NO:11.

[0063] As referred to herein, the similarity in amino acid sequence refers to a similarity in amino acid sequence between two proteins of interest, and is expressed by the proportion (%) of amino acid residues matched, and amino acid residues similar, in the best amino acid sequence alignments produced using a mathematical algorithm known in the art. The similarity in amino acid sequence is expressed by the relationship between amino acid residues similar in physicochemical properties; for example, in different amino acid groups, such as aromatic amino acids (Phe, Tyr, Trp), hydrophobic amino acids (Asp, Glu), aliphatic amino acids (Ala, Leu, Ile, Val), polar amino acids (Asn, Gln), basic amino acids (Lys, Arg, His), acidic amino acids (Asp, Glu), hydroxyl group-containing amino acids (Ser, Thr), and short side chain amino acids (Gly, Ala, Ser, Thr, Met), the amino acids belonging to the same group are understood to be mutually similar amino acid residues. It is presumed that such similar amino acid residues do not affect the phenotype of a protein. Like the identity in amino acid sequence, the similarity in amino acid sequence can be determined by visual inspection and mathematical calculation, and can be calculated using a tool known to those skilled in the art, such as sequence similarity search program (e.g., BLAST, PSI-BLAST, HMMER) or genetic information processing software (e.g., GENETYX). The similarity in amino acid sequence, as referred to herein, can be specifically determined using GENETYX on the network, Ver. 11.1.3 (Genetyx Corporation), with Protein vs Protein Global Homology being configured by default (Unit size to compare is set to 2).

[0064] The protein of the present invention can comprise an amino acid sequence having a similarity of at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least, or at least 99% with respect to the amino acid sequence of SEQ ID NO:7 or 11.

[0065] The similarities between A. thaliana BIL7 protein and each of G. max, O. sativa and Z. mays BIL7 proteins are 76% (G. max BIL7), 76% (O. sativa BIL7) and 75% (Z. mays BIL7). Thus, in one preferred embodiment, the protein of this invention comprises an amino acid sequence having at least 75% similarity to the amino acid sequence of SEQ ID NO:7. The similarities between O. sativa BIL7 protein and each of G. max and Z. mays BIL7 proteins are 83% (G. max BIL7) and 97% (Z. mays BIL7). Thus, in one preferred embodiment, the protein of this invention comprises an amino acid sequence having a similarity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 97% with respect to the amino acid sequence of SEQ ID NO:11.

[0066] Further, the protein of the present invention is characterized not only by comprising the aforementioned common motif and an amino acid sequence having a specified level of identity or similarity to the amino acid sequence of SEQ ID NO:7 or 11, but also by having an activity to increase plant biomass.

[0067] As referred to herein, the term plant biomass is meant to refer to the amount of the whole or part or a plant organ(s) of a plant, or a combination thereof. Examples of the whole or part or a plant organ(s) of a plant include whole plant, aboveground part, root, stem, leaf, fruit, seed, embryo, ovule, ovary, shoot apex, anther, pollen, or panicle. Among them, fruit, seed, panicle, root, stem, leaf, or anther is preferred. Examples of amount include number, size, length, width, weight, area, or volume. Thus, examples of biomass include, but are not limited to, whole plant weight, aboveground part weight (e.g., Upper-ground dry matter weight, yield, stem diameter, number of stems, culm length, plant height, leaf area, number of leaves, flag leaf length, leaf length, leaf width, number of rough rice, rough rice weight (e.g., 1000 fertile rough rice weight, whole weight of fertile rough rice), number of seeds, number of tillers, number of panicles, number of rough rice per panicle, number of fertile rough rice per panicle, percentage of fertile rough rice, panicle length, maximum panicle length, weight of one panicle, or panicle weight per plant. The term increase(d) means that any of the plant biomasses mentioned above increase alone or in combination.

[0068] The activity to increase plant biomass can be evaluated by, for example, using the biomass of the control (e.g., parent plant, non-transformant, wild-type plant) as an indicator for increase and comparing the biomass of a mature plant with that of the control. If an increase in plant biomass is observed as compared to the control, an introduced protein can be evaluated as having an activity to increase plant biomass. When the biomass is quantifiable, the quantified values are compared, and if an increase in biomass by, for example, at least 1%, at least 3%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least, or at least 70%, is observed, an introduced protein can be evaluated as having an activity to increase plant biomass.

[0069] In the present invention, the amino acid sequence of SEQ ID NO:1 can be the amino acid sequence of SEQ ID NO:2 as shown below. Examples of a plant having a protein comprising the amino acid sequence of SEQ ID NO:2 as a common motif include, but are not limited to, A. thaliana, G. max, O. sativa, and Z. mays. Also, homologs of BIL7 proteins from the aforementioned plants (e.g., homolog proteins of A. thaliana BIL7) are included by the protein having the amino acid sequence of SEQ ID NO:2.

TABLE-US-00004 SEQIDNO:2: Ala-Pro-Pro-Ser-Ser-Pro-Ala-Ser-Phe-X29-X30-Ser- X31-X32-X33-Ser-X34-X35-X36-X37-Pro-X38-Ser-X39- X40-X41-X42-Gly-Pro-Tyr-Ala-X43-Glu-Thr-Gln-X44- Val-X45-Pro-Pro-Val-Phe-Ser-X46-X47-X48-Thr-Glu- Pro-Ser-X49-Ala-Pro-X50-Thr-Pro-Pro-X51-Pro-Ser- Ser-Pro-X52-Val-Pro-X53-Ala-X54-Pro-X55-Ser-Pro- X56-Leu-X57-Ser-Pro
(where X29 represents Phe, Leu or Thr; X30 represents Gln, His, Pro or Asn; X31 represents Glu, Gly, Asp or Ala; X32 represents Pro, Gly or Leu; X33 represents Pro, Ala, Thr or Ser; X34 represents Ala, Val, Ile or Thr; X35 represents Thr, Ala, Val or Ser; X36 represents Gln or His; X37 represents Ser or Thr; X38 represents 10 to 25 amino acid residues; X39 represents Ile, Val, Ala or Met; X40 represents Phe or Tyr; X41 represents Ala or Thr; X42 represents Ile, Val or Thr; X43 represents His or Asn; X44 represents Leu or Pro; X45 represents Ser or Thr; X46 represents Thr or Ala; X47 represents Tyr or Phe; X48 represents Thr or Ile; X49 represents Ser or Thr; X50 represents Ile, Phe or Tyr; X51 represents 3 to 15 amino acid residues; X52 represents Glu or Asp; X53 represents Phe or Tyr; X54 represents 20 to 35 amino acid residues; X55 represents Gly, Glu or Asp; X56 represents 3 to 5 amino acid residues; and X57 represents Ile or Arg.)

[0070] In the aforementioned amino acid sequence, X38 preferably represents 12 to 21 amino acid residues, more preferably 15 to 21 amino acid residues; X51 preferably represents 3 to 12 amino acid residues, more preferably 8 to 12 amino acid residues; X54 preferably represents 23 to 35 amino acid residues, more preferably 23 to 30 amino acid residues; and X56 preferably represents 3 or 4 amino acid residues, more preferably 3 amino acid residues.

[0071] The protein of the present invention may also comprise the amino acid sequence of SEQ ID NO:3 as shown below. The aforementioned amino acid sequence of SEQ ID NO:1 or 2 is included by the amino acid sequence of SEQ ID NO:3 (in other words, the amino acid sequence of SEQ ID NO:1 or 2 is contained (present) as part of the amino acid sequence of SEQ ID NO:3). Also, the amino acid sequence of SEQ ID NO:3 is included by an amino acid sequence having at least 25% identity or at least 75% similarity to the amino acid sequence of SEQ ID NO:7 or 11 (in other words, the amino acid sequence of SEQ ID NO:3 is contained (present) as part of an amino acid sequence having at least 25% identity or at least 75% similarity to the amino acid sequence of SEQ ID NO:7 or 11). Examples of a plant having a protein comprising the amino acid sequence of SEQ ID NO:3 as a common motif include, but are not limited to, A. thaliana and O. sativa.

TABLE-US-00005 SEQIDNO:3: Met-X58-Ser-Gly-X59-Asn-X60-X61-Asp-Thr-X62-Asn- Ala-Ala-Ala-X63-Ala-Ile-X64-X65-X66-X67-X68-Arg- X69-Arg-Lys-Trp-X70-X71-X72-X73-Ser-X74-X75-X76- Cys-Phe-Gly-Ser-X77-X78-X79-X80-X81-Arg-Ile-X82- X83-X84-Val-Leu-Val-Pro-Glu-Pro-X85-Pro-Phe-X86- Ala-Pro-Pro-Ser-Ser-Pro-Ala-Ser-Phe-X87-Gln-Ser- X88-X89-X90-Ser-X91-X92-Gln-Ser-Pro-Val-Gly-X93- X94-Ser-Phe-Ser-Pro-Leu-X95-X96-Asn-X97-Pro-Ser- Ile-Phe-Ala-Ile-Gly-Pro-Tyr-Ala-His-Glu-Thr-Gln- Leu-Val-Ser-Pro-Pro-Val-Phe-Ser-X98-X99-Thr-Thr- Glu-Pro-Ser-X100-Ala-Pro-X101-Thr-Pro-Pro-X102- Ser-X103-X104-Leu-Thr-Thr-X105-Pro-Ser-Ser-Pro- Glu-Val-Pro-X106-Ala-X107-Leu-X108-X109-Ser-X110- Glu-X111-Gln-X112-Tyr-Gln-X113-X114-Pro-X115-Ser- Pro-X116-Gly-X117-Leu-Ile-Ser-Pro-Ser-X118-Ser- Gly-X119-X120-Ser-Pro-Phe-Pro-Asp-X121-Ser-X122- Phe-Pro-X123-Phe-X124-Val-X125-X126-Pro-Pro-Lys- X127-Leu-X128-Gly-X129-His-X130-Val-Ser-Phe-X131- Leu-X132-X133-X134-X135-Val-X136-Arg-Cys-X137- X138-X139-Lys-X140-Pro-X141-X142-Ser-X143-Asp- X144-Ser-Leu-X145-X146-X147-Lys-Glu-Phe-X148-Phe- X149-Val-X150-X151-X152-X153-X154-Ala-X155-X156- Lys-X157-Trp-Ser-Phe-Phe-Pro-Val-X158-Gln-X159- Gly
(where X58 represents Arg or Gln; X59 represents 3 to 10 amino acid residues; X60 represents Val or Ser; X61 represents Phe or Val; X62 represents Ile or Val; X63 represents Ser or Val; X64 represents Ala or Val; X65 represents Ser or Thr; X66 represents Ser or Ala; X67 represents Asp or Glu; X68 represents Asp or Ser; X69 represents 5 to 10 amino acid residues; X70 represents Trp or Ala; X71 represents Asn or Asp; X72 represents Arg or Trp; X73 represents Trp or Leu; X74 represents Leu or Val; X75 represents Leu or Tyr; X76 represents Lys or Phe; X77 represents Ser or Gln; X78 represents Arg or Lys; X79 represents Gln or Asn; X80 represents Arg or Gly; X81 represents Lys or Arg; X82 represents Gly or Ser; X83 represents Asn or His; X84 represents Ser or Ala; X85 represents 20 to 25 amino acid residues; X86 represents Ile or Val; X87 represents Phe or Leu; X88 represents Glu or Gly; X89 represents Pro or Gly; X90 represents Pro or Ala; X91 represents Ala or Ile; X92 represents Thr or Val; X93 represents Ile or Ala; X94 represents Leu or Pro; X95 represents Pro or Ser; X96 represents Cys or Pro; X97 represents 1 to 10 amino acid residues; X98 represents Thr or Ala; X99 represents Tyr or Phe; X100 represents Ser or Thr; X101 represents Ile or Phe; X102 represents 1 to 5 amino acid residues; X103 represents Ile or Val; X104 represents Tyr or His; X105 represents 0 to 5 amino acid residues; X106 represents Phe or Tyr; X107 represents Gln or Lys; X108 represents Phe or Leu; X109 represents Asn or Thr; X110 represents 10 to 20 amino acid residues; X111 represents Phe or Leu; X112 represents Phe or Ser; X113 represents Leu or Ile; X114 represents Pro or Tyr; X115 represents Gly or Glu; X116 represents Leu or Ile; X117 represents Gln or Arg; X118 represents 1 to 5 amino acid residues; X119 represents Pro or Thr; X120 represents Thr or Cys; X121 represents 1 to 10 amino acid residues; X122 represents Leu or Thr; X123 represents His or Ser; X124 represents Gln or Pro; X125 represents Ser or Arg; X126 represents Asp or Glu; X127 represents Leu or Ile; X128 represents 3 to 20 amino acid residues; X129 represents 10 to 30 amino acid residues; X130 represents 1 to 5 amino acid residues; X131 represents Asp or Glu; X132 represents Asp or Thr; X133 represents Ala or Val; X134 represents Asp or Glu; X135 represents His or Asp; X136 represents Ile or Ala; X137 represents Val or Leu; X138 represents Asp or Glu; X139 represents Gln or Lys; X140 represents 3 to 25 amino acid residues; X141 represents Glu or Arg; X142 represents Ala or Glu; X143 represents Ser or Asn; X144 represents 5 to 25 amino acid residues; X145 represents Gly or Arg; X146 represents Ser or Lys; X147 represents Asn or Ala; X148 represents Asn or Lys; X149 represents 5 to 15 amino acid residues; X150 represents Asp or Gly; X151 represents Glu or Ser; X152 represents His or Asp; X153 represents Arg or Trp; X154 represents Ser or Trp; X155 represents Ser or Asn; X156 represents Pro or Glu; X157 represents 5 to 15 amino acid residues; X158 represents Met or Ala; and X159 represents Ser or Pro.)

[0072] In the aforementioned amino acid sequence, X59 preferably represents 4 to 7 amino acid residues; X69 preferably represents 8 to 10 amino acid residues; X85 preferably represents 21 to 22 amino acid residues; X97 preferably represents 2 to 7 amino acid residues; X102 preferably represents 2 to 4 amino acid residues; X105 preferably represents 0 to 2 amino acid residues; X110 preferably represents 10 to 17 amino acid residues; X118 preferably represents 2 to 3 amino acid residues; X121 preferably represents 3 to 8 amino acid residues; X128 preferably represents 5 to 18 amino acid residues; X129 preferably represents 13 to 28 amino acid residues; X130 preferably represents 1 to 2 amino acid residues; X140 preferably represents 5 to 24 amino acid residues; X144 preferably represents 7 to 22 amino acid residues; X149 preferably represents 8 to 11 amino acid residues; and X157 preferably represents 4 to 11 amino acid residues.

[0073] The protein of the present invention may also comprise the amino acid sequence of SEQ ID NO:4 as shown below. The aforementioned amino acid sequence of SEQ ID NO:1 or 2 is included by the amino acid sequence of SEQ ID NO:4 (in other words, the amino acid sequence of SEQ ID NO:1 or 2 is contained (present) as part of the amino acid sequence of SEQ ID NO:4). Also, the amino acid sequence of SEQ ID NO:4 is included by an amino acid sequence having at least 75% identity or at least 75% similarity to the amino acid sequence of SEQ ID NO:7 or 11 (in other words, the amino acid sequence of SEQ ID NO:4 is contained (present) as part of an amino acid sequence having at least 25% identity or at least 75% similarity to the amino acid sequence of SEQ ID NO:7 or 11). Examples of a plant having a protein comprising the amino acid sequence of SEQ ID NO:4 as a common motif include, but are not limited to, A. thaliana and G. max.

TABLE-US-00006 SEQIDNO:4: Met-Arg-X160-Gly-Ala-Asn-Gly-X161-Asn-Asn-X162- X163-X164-Thr-Ile-Asn-Ala-Ala-Ala-X165-X166-Ile- Ala-Ser-X167-X168-X169-Arg-Leu-X170-Gln-X171-X172- Pro-X173-X174-X175-Lys-X176-X177-Trp-X178-Asn- X179-X180-Ser-X181-X182-X183-Cys-Phe-Gly-X184- X185-X186-X187-Arg-X188-Arg-Ile-Gly-X189-X190-Val- Leu-Val-Pro-Glu-X191-X192-X193-X194-X195-X196- X197-Asn-X198-Thr-X199-Ile-X200-X201-X202-X203- Phe-X204-Ala-Pro-Pro-Ser-Ser-Pro-Ala-Ser-Phe-X205- X206-Ser-Glu-Pro-Pro-Ser-X207-X208-Gln-Ser-Pro- X209-X210-Ile-Leu-Ser-X211-X212-Pro-X213-Ser-Ile- Phe-Ala-Ile-Gly-Pro-Tyr-Ala-His-Glu-Thr-Gln-Leu- Val-Ser-Pro-Pro-Val-Phe-Ser-Thr-X214-Thr-Thr-Glu- Pro-Ser-X215-Ala-Pro-X216-Thr-Pro-Pro-X217-Thr- Thr-Pro-Ser-Ser-Pro-Glu-Val-Pro-Phe-Ala-Gln-Leu- X218-X219-X220-Asn-X221-X222-X223-X224-X225-X226- X227-X228-X229-Phe-X230-Tyr-X231-Phe-X232-X233- Tyr-Gln-Leu-X234-Pro-Gly-Ser-Pro-X235-Gly-Gln-Leu- Ile-Ser-Pro-X236-Ser-X237-X238-X239-Ser-Pro-Phe- Pro-Asp-X240-Ser-Leu-X241-X242-X243-Phe-Gln-X244- X245-Asp-X246-Ser-X247-X248-X249-X250-Gly-X251- X252-Thr-Pro-X253-Gln-X254-X255-X256-X257-Pro- X258-X259-X260-Val-Ser-X261-X262-X263-X264-Ala- X265-X266-Val-X267-X268-Cys-Val-X269-Lys-Leu-X270- Thr-X271-X272-Pro-X273-Glu-X274-X275-Ser-Asp-X276- Glu-X277-X278-X279-His-X280-Lys-Glu-Phe-Asn-Phe- X281-X282-X283-Glu-X284-Leu-X285-X286-Asp-X287- Ala-Ser-X288-Ser-Asn-X289-Trp-Ser-Phe-Phe-Pro- X290-X291-X292-X293-Gly
(where X160 represents 0 to 3 amino acid residues; X161 represents 0 to 5 amino acid residues; X162 represents Val or Thr; X163 represents Phe or Leu; X164 represents Asp or Glu; X165 represents Ser or Thr; X166 represents Ala or Val; X167 represents Ser or Val; X168 represents Asp or Glu; X169 represents Asp or Asn; X170 represents His or Asp; X171 represents Ser or Pro; X172 represents Ser or His; X173 represents Ile or His; X174 represents His or Val; X175 represents Lys or Gln; X176 represents Arg or Lys; X177 represents Lys or Ser; X178 represents Trp or Gly; X179 represents Arg or Trp; X180 represents Trp or Leu; X181 represents Leu or Ile; X182 represents Leu or Tyr; X183 represents Lys or Trp; X184 represents Ser or His; X185 represents Ser or Arg; X186 represents Arg or Lys; X187 represents Gln or Asn; X188 represents Lys or Gln; X189 represents Asn or His; X190 represents Ser or Ala; X191 represents Pro or Arg; X192 represents Val or Ile; X193 represents Ser or Pro; X194 represents Met or Ser; X195 represents Ser or Gly; X196 represents Ser or Thr; X197 represents Ser or Asp; X198 represents Ser or Ala; X199 represents 5 to 15 amino acid residues; X200 represents Thr or Ile; X201 represents Thr or Pro; X202 represents Leu or Phe; X203 represents Pro or His; X204 represents Ile or Val; X205 represents Phe or Leu; X206 represents Gln or His; X207 represents Ala or Val; X208 represents Thr or Ala; X209 represents Val or Ser; X210 represents Gly or Ala; X211 represents Phe or Leu; X212 represents Ser or Thr; X213 represents 1 to 10 amino acid residues; X214 represents Tyr or Phe; X215 represents Ser or Thr; X216 represents Ile or Phe; X217 represents 3 to 15 amino acid residues; X218 represents Phe or Leu; X219 represents Asn or Asp; X220 represents Ser or Pro; X221 represents His or Asn; X222 represents Gln or Lys; X223 represents Thr or Asn; X224 represents Gly or Ser; X225 represents Ser or Glu; X226 represents Tyr or Thr; X227 represents Gly or Tyr; X228 represents Tyr or Gln; X229 represents Lys or Arg; X230 represents 3 to 7 amino acid residues; X231 represents Glu or Asp; X232 represents Gln or His; X233 represents Phe or Ser; X234 represents Pro or His; X235 represents Leu or Val; X236 represents 1 to 10 amino acid residues; X237 represents Gly or Ser; X238 represents Pro or Thr; X239 represents Thr or Ser; X240 represents 1 to 10 amino acid residues; X241 represents Phe or Leu; X242 represents Pro or Leu; X243 represents His or Asn; X244 represents Val or Thr; X245 represents Ser or Asp; X246 represents 3 to 10 amino acid residues; X247 represents Pro or His; X248 represents Lys or Gln; X249 represents Thr or Gly; X250 represents Ala or Ser; X251 represents Val or Ser; X252 represents Thr or Leu; X253 represents 1 to 10 amino acid residues; X254 represents Lys or Ala; X255 represents Ile or Ser; X256 represents Val or Phe; X257 represents Pro or Leu; X258 represents His or Ser; X259 represents Lys or His; X260 represents Pro or Trp; X261 represents Phe or Ile; X262 represents Asp or Glu; X263 represents Leu or Val; X264 represents Asp or Ser; X265 represents Asp or Gln; X266 represents His or Glu; X267 represents Ile or Phe; X268 represents Arg or Asn; X269 represents 1 to 15 amino acid residues; X270 represents Arg or Lys; X271 represents Thr or Asp; X272 represents Phe or Ala; X273 represents 0 to 15 amino acid residues; X274 represents Ala or Thr; X275 represents Ser or Pro; X276 represents 1 to 15 amino acid residues; X277 represents Ser or Arg; X278 represents Met or Val; X279 represents Asn or His; X280 represents 5 to 10 amino acid residues; X281 represents Gly or Asp; X282 represents Thr or Asn; X283 represents Asp or Ala; X284 represents 1 to 10 amino acid residues; X285 represents Thr or Val; X286 represents Val or Ala; X287 represents 1 to 10 amino acid residues; X288 represents 1 to 7 amino acid residues; X289 represents Asp or Asn; X290 represents Val or Met; X291 represents Met or Ile; X292 represents Gln or Arg; and X293 represents Ser or Pro.)

[0074] In the aforementioned amino acid sequence, X160 preferably represents 0 to 1 amino acid residue; X161 preferably represents 0 to 3 amino acid residues; X199 preferably represents 7 to 9 amino acid residues; X213 preferably represents 4 to 7 amino acid residues; X217 preferably represents 6 to 10 amino acid residues; X230 preferably represents 4 to 5 amino acid residues; X236 preferably represents 3 to 6 amino acid residues; X240 preferably represents 3 to 9 amino acid residues; X246 preferably represents 5 to 9 amino acid residues; X253 preferably represents 3 to 7 amino acid residues; X269 preferably represents 2 to 12 amino acid residues; X273 preferably represents 0 to 11 amino acid residues; X276 preferably represents 1 to 11 amino acid residues; X280 preferably represents 6 to 10 amino acid residues; X284 preferably represents 2 to 8 amino acid residues; X287 preferably represents 4 to 7 amino acid residues; and X288 preferably represents 3 to 5 amino acid residues.

[0075] The protein of the present invention may also comprise the amino acid sequence of SEQ ID NO:5 as shown below. The aforementioned amino acid sequence of SEQ ID NO:1 or 2 is included by the amino acid sequence of SEQ ID NO:5 (in other words, the amino acid sequence of SEQ ID NO:1 or 2 is contained (present) as part of the amino acid sequence of SEQ ID NO:5). Also, the amino acid sequence of SEQ ID NO:5 is included by an amino acid sequence having at least 25% identity or at least 75% similarity to the amino acid sequence of SEQ ID NO:7 or 11 (in other words, the amino acid sequence of SEQ ID NO:5 is contained (present) as part of an amino acid sequence having at least 25% identity or at least 75% similarity to the amino acid sequence of SEQ ID NO:7 or 11). Examples of a plant having a protein comprising the amino acid sequence of SEQ ID NO:5 as a common motif include, but are not limited to, O. sativa, and Z. mays.

TABLE-US-00007 SEQIDNO:5: Met-Gln-Ser-Gly-X294-X295-Met-Arg-Pro-Val-His-Asn- Ser-Val-Asp-Thr-Val-Asn-Ala-Ala-Ala-Val-Ala-Ile- Val-Thr-Ala-Glu-Ser-Arg-Thr-Gln-Pro-X296-Ala-Glu- X297-Arg-Arg-Lys-Trp-Ala-Asp-X298-Leu-Ser-Val-Tyr- Phe-Cys-Phe-Gly-Ser-Gln-Lys-Asn-Gly-Arg-X299-Arg- X300-X301-His-Ala-X302-Leu-Val-Pro-Glu-Pro-X303- Pro-X304-Arg-Thr-Asp-Ala-Pro-X305-X306-Glu-Ile- Pro-X307-His-Pro-Pro-Pro-Pro-Val-Phe-Pro-Phe-Val- Ala-Pro-Pro-Ser-Ser-Pro-Ala-Ser-Phe-Leu-Gln-Ser- X308-X309-X310-Ser-Ile-Val-Gln-Ser-Pro-X311-Gly- Ala-Pro-X312-Phe-Ser-Pro-Leu-Ser-Pro-Asn-Ser-X313- Ser-Pro-Thr-Gly-Pro-Pro-Ser-Ile-Phe-Ala-Ile-Gly- Pro-Tyr-Ala-His-Glu-Thr-Gln-Leu-Val-Ser-Pro-Pro- Val-Phe-Ser-Ala-Phe-Thr-Thr-Glu-Pro-Ser-Thr-Ala- Pro-Phe-Thr-Pro-Pro-Pro-Glu-Ser-Val-His-Leu-Thr- Thr-Pro-Ser-Ser-Pro-Glu-Val-Pro-Tyr-Ala-Lys-Leu- Leu-Thr-Ser-Ile-Asn-Asn-Ser-Lys-Asn-X314-Glu-X315- Gly-X316-Leu-Gln-Ser-Tyr-X317-X318-Tyr-Pro-X319- Ser-Pro-Ile-Gly-Arg-Leu-Ile-Ser-Pro-Ser-Ser-X320- Cys-Ser-Gly-Thr-X321-Ser-Pro-Phe-Pro-Asp-Pro-Glu- X322-Gln-X323-Ser-Ser-Arg-Ser-X324-X325-X326-X327- Phe-Pro-Val-Arg-Glu-Pro-Pro-Lys-Ile-Leu-Asp-Gly- Glu-Gly-X328-Ala-Thr-Gln-Lys-Leu-Ile-Pro-Arg-His- Met-Arg-Asn-Gly-Gly-Ser-Leu-Leu-Asp-Gly-X329-Ile- Ser-Ala-Ala-Val-Pro-Val-Val-Asp-Phe-Ser-Ala-Arg- Leu-Gln-X330-Asn-X331-His-Ala-Met-Asp-His-Arg- Val-Ser-Phe-Glu-Leu-Thr-Val-Glu-Asp-Val-Ala-Arg- Cys-Leu-Glu-Lys-Lys-Thr-X332-Ile-X333-Gly-X334- Ser-X335-X336-Ala-Ser-Phe-X337-Leu-X338-Pro-Thr- Gly-X339-Gly-Asp-X340-His-X341-Arg-Glu-Ser-Asn- X342-X343-Arg-Ala-Gly-Leu-X344-Val-Asp-Glu-X345- Tyr-His-Asp-Leu-Pro-Glu-Lys-Ala-Arg-Arg-Ser-Leu- Ser-Leu-Arg-X346-Ala-Lys-Glu-Phe-X347-Phe-Asn-Asn- Val-Asp-X348-X349-Ser-Val-Glu-Pro-Ser-Val-Gly-Ser- Asp-Trp-Trp-Ala-Asn-Glu-Lys-Val-Ala-Gly-X350-Thr- X351-Glu-Pro-X352-Lys-X353-Trp-Ser-Phe-X354-Pro- Val-X355-Gln-Pro-Gly-Val-Ser
(where X294 represents Ser or Gly; X295 represents Glu or Asp; X296 represents Gln or Pro; X297 represents Pro or Gln; X298 represents Trp or Arg; X299 represents 0 to 5 amino acid residues; X300 represents Ile or Val; X301 represents Ser or Asn; X302 represents Val or Ala; X303 represents Leu or Ala; X304 represents Pro or Gln; X305 represents Met or Ala; X306 represents Pro or Ala; X307 represents Ile or Asn; X308 represents Gly or Glu; X309 represents Gly or Pro; X310 represents Ala or Thr; X311 represents 0 to 5 amino acid residues; X312 represents Ser or Ala; X313 represents Pro or Gln; X314 represents Ala or Gly; X315 represents Thr or Ala; X316 represents 0 to 5 amino acid residues; X317 represents Gln or Pro; X318 represents Ile or Asn; X319 represents Glu or Asp; X320 represents Ala or Gly; X321 represents Cys or Ser; X322 represents Val or Met; X323 represents Thr or Ala; X324 represents Thr or Ala; X325 represents Phe or Leu; X326 represents Pro or Arg; X327 represents Ser or Leu; X328 represents Ile or Val; X329 represents His or Gln; X330 represents Asn or Pro; X331 represents Asp or Glu; X332 represents Asn or Ala; X333 represents Asn or Ser; X334 represents Glu or Asp; X335 represents Ala or Gly; X336 represents Ala or Thr; X337 represents Arg or His; X338 represents Val or Ala; X339 represents Asn or Ser; X340 represents 0 to 5 amino acid residues; X341 represents Pro or His; X342 represents Asp or Glu; X343 represents Thr or Ala; X344 represents Cys or Tyr; X345 represents Thr or Ser; X346 represents Lys or Leu; X347 represents Lys or Asn; X348 represents Ala or Val; X349 represents Pro or Gly; X350 represents Ile or Met; X351 represents Ser or Thr; X352 represents Arg or Lys; X353 represents Ser or Asn; X354 represents Phe or His; and X355 represents Ala or Val.)

[0076] In the aforementioned amino acid sequence, X299 preferably represents 0 to 2 amino acid residues; X311 preferably represents 1 to 2 amino acid residues; X316 preferably represents 1 to 2 amino acid residues; and X340 preferably represents 0 to 2 amino acid residues.

[0077] In the present invention, a nucleic acid encoding the aforementioned protein is used. As referred to herein, the term nucleic acid refers to a polymer in which nucleotides are linked together via phosphoester bonds, and is interchangeably used with the terms polynucleotide and oligonucleotide. The structure of the nucleic acid is not particularly limited, and can be single-strand or double-strand. The nucleic acid includes deoxyribonucleic acid (DNA), ribonucleic acid (RNA), and hybrids thereof (e.g., DNA-RNA hybrid double strand; chimeric nucleic acid in which DNA and RNA are linked into a single strand). The building blocks of the nucleic acid mainly include purine bases such as adenine (A) and guanine (G), and pyrimidine bases such as thymine (T), cytosine (C) and uracil (U), and also include modified forms of said bases as long as they are capable of translating into a protein of interest. The nucleic acid used in this invention is preferably mRNA or cDNA encoding a protein of interest.

[0078] The nucleic acid and protein of the present invention are not particularly limited as long as they are capable of increasing plant biomass, but the inventive nucleic acid and protein are preferably derived from a dicotyledonous plant or a monocotyledonous plant. Or they may be derived from Physcomitrella patens. Examples of the dicotyledonous plant include, but are not limited to, Arabidopsis thaliana, Glycine max, Raphanus sativus, Populus trichocarpa, Vitis vinifera, Gossypium arboretum (cotton), Brassica napus (rape), Beta vulgaris (beet), Nicotiana tabacum (tobacco), and Solanum lycopersicum (tomato). Among them, A. thaliana, G. max, and R. sativus are preferred, with A. thaliana and G. max being more preferred, and A. thaliana being most preferred. Examples of the monocotyledonous plant include, but are not limited to, Oryza sativa, Zea mays, Triticum aestivum (wheat), Hordeum vulgare (barley), Sorghum bicolor (sorghum), Saccharum officinarum (sugarcane), and Allium cepa (onion). Among them, O. sativa, Z. mays, and T. aestivum are preferred, with O. sativa and Z. mays being more preferred.

[0079] As the protein of the present invention, BIL7 proteins derived from different species of plants can be used; for example, BIL7 proteins derived from A. thaliana, G. max, O. sativa, Z. mays, R. sativus, P. trichocarpa, V vinifera, or P. patens (i.e., proteins comprising the amino acid sequence of any of SEQ ID NOs:7, 9, 11, 13, 15, 17, 19 and 21) can be used. Also, as the inventive protein, homologs of BIL7 proteins derived from different species of plants can be used; for example, homolog proteins of A. thaliana BIL7 (i.e., proteins comprising the amino acid sequence of any of SEQ ID NOs:23, 25 and 27) can be used.

[0080] In one embodiment, the present invention also covers proteins that comprise an amino acid sequence derived from any of the amino acid sequences of BIL7 proteins derived from different species of plants and their homologs (e.g., the amino acid sequence of any of SEQ ID NOs:7, 9, 11, 13, 15, 17, 19, 21, 23, 25 and 27) by deletion, insertion, substitution, or addition of one or some amino acids, and which have an activity to increase plant biomass. As referred to above, some amino acids refers to, for example, 2 to 40 amino acids, 2 to 30 amino acids, 2 to 20 amino acids, 2 to 10 amino acids, 2 to 7 amino acids, 2 to 5 amino acids, 5 amino acids, 4 amino acids, 3 amino acids, or 2 amino acids. The deletion, insertion, substitution or addition of one or some amino acids can be done by using a method known in the art (e.g., by altering a nucleic acid). It is preferred that such an altered amino acid sequence comprise the amino acid sequence of SEQ ID NO:1.

[0081] Introduction of a mutation into a nucleic acid can be done by the Kunkel method, the gapped duplex method, or any other methods pursuant thereto. For example, a mutation introduction kit based on site-directed mutanogenesis (e.g., Transformer Site-Directed Mutagenesis Kit (Clontech Laboratories, Inc.) or QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies)) can be used. For introduction of a mutation into a nucleic acid, a chemical mutagenic agent such as EMS (ethyl methanesulfonate), 5-bromouracil, 2-aminopurine, hydroxylamine, N-methyl-N-nitro-N-nitrosoguanidine or any other carcinogenic compound, or a radiant or ultraviolet ray such as X-ray, -ray, -ray, -ray or ion beam can be used.

[0082] In one embodiment, the present invention covers proteins that comprise an amino acid sequence having an identity of at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity, or a similarity of at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, with respect to any of the amino acid sequences of BIL7 proteins derived from different species of plants and their homologs (e.g., the amino acid sequence of any of SEQ ID NOs:7, 9, 11, 13, 15, 17, 19, 21, 23, 25 and 27), and which have an activity to increase plant biomass. The identity and similarity in amino acid sequence have been described hereinabove. It is preferred that such a similar amino acid sequence comprise the amino acid sequence of SEQ ID NO:1.

[0083] When BIL7 protein derived from A. thaliana, G. max, O. sativa, Z. mays, R. sativus, P. trichocarpa, V. vinifera, or P. patens is used as the protein of the present invention, a nucleic acid comprising the nucleotide sequence of any of SEQ ID NOs:6, 8, 10, 12, 14, 16, 18 and 20 is mainly used as a nucleic acid encoding said BIL7 protein. When any of three homolog proteins of A. thaliana BIL7 is used, a nucleic acid comprising the nucleotide sequence of any of SEQ ID NOs:22, 24 and 26 is mainly used as a nucleic acid encoding such a homolog protein.

[0084] In one embodiment of the present invention, the nucleic acid comprising the nucleotide sequence of any of SEQ ID NOs:6, 8, 10, 12, 14, 16, 18, 20, 22, 24 and 26 also includes nucleic acids that hybridize under stringent conditions to a nucleic acid consisting of a nucleotide sequence complementary to said nucleotide sequence, and which encode a protein having an activity to increase plant biomass.

[0085] As referred to above, the under stringent conditions means that hybridization takes place under moderately or highly stringent conditions. To be specific, the moderately stringent conditions can be easily determined by those having ordinary skill in the art on the basis of, for example, the length of nucleic acid. Basic conditions are described in Sambrook, et al., Molecular Cloning: A Laboratory Manual, 3rd ed., ch. 6, Cold Spring Harbor Laboratory Press, 2001. Typically, the moderately stringent conditions comprise: prewashing in 5SSC, 0.5% SDS, 1.0 mM EDTA (pH8.0); hybridization in ca. 50% formamide, 2-6SSC, preferably 5-6SSC, 0.5% SDS at about 42 C. (or any other similar hybridization solution like a Stark's solution in ca. 50% formamide at about 42 C.); and washing in 0.1-6SSC, 0.1% SDS at about 50-68 C. The moderately stringent conditions preferably comprise hybridization (and washing) in 6SSC, 0.5% SDS at about 50 C.

[0086] The highly stringent conditions can also be easily determined by those skilled in the art on the basis of, for example, the length of nucleic acid. The highly stringent conditions are generally defined as involving hybridization and/or washing at a higher temperature and/or a lower salt concentration than the moderately stringent conditions (e.g., hybridization in ca. 0.5% SDS, and 6-0.2SSC, preferably 6SSC, more preferably 2SSC, still more preferably 0.2SSC, or 0.1SSC, at about 65 C.), for example, as involving hybridization under the aforementioned conditions and washing in 0.2-0.1SSC, 0.1% SDS at about 65-68 C. As a buffer for use in hybridization and washing, SSPE (1SSPE: 0.15 M NaCl, 10 mM NaH.sub.2PO.sub.4, and 1.25 mM EDTA, pH7.4) can be used in place of SSC (1SSC: 0.15M NaCl and 15 mM sodium citrate). Washing is done for about 15 minutes to 1 hour after the completion of hybridization.

[0087] There can also be used a commercial hybridization kit in which no radioactive material is used as a probe. Specific examples include hybridization using the ECL direct labeling & detection system (produced by Amersham). Stringent hybridization is performed, for example, under the following conditions: after 5% (w/v) of a blocking reagent and 0.5 M of NaCl are added to a hybridization buffer in a kit, hybridization is performed at 42 C. for 4 hours, and washing is done twice in 0.4% SDS and 0.5SSC at 55 C. for 20 minutes, and then once in 2SSC at room temperature for 5 minutes.

[0088] In one embodiment, the present invention also covers nucleic acids that have an identity of at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% with respect to the nucleotide sequence of any of SEQ ID NOs:6, 8, 10, 12, 14, 16, 18, 20, 22, 24 and 26, and which encode a protein having an activity to increase plant biomass.

[0089] The identity between two nucleotide sequences can be determined by visual inspection and mathematical calculation, or is more preferably determined by comparing sequence information using a computer program. A typical and preferred computer program is the Wisconsin Package version 10.0 program, GAP, developed by Genetics Computer Group (GCG; Madison, Wis.) (Devereux, et al., 1984, Nucl. Acids Res., 12: 387). By using this GAP program, comparison can be made not only between two nucleotide sequences, but also between two amino acid sequences, and between a nucleotide sequence and an amino acid sequence. Preferred default parameters for the GAP program include: (1) the GCG implementation of a unitary comparison matrix (containing a value of 1 for identities and 0 for non-identities) for nucleotides, and the weighted amino acid comparison matrix of Gribskov and Burgess, Nucl. Acids Res., 14: 6745, 1986, as described by Schwartz and Dayhoff, eds., Atlas of Polypeptide Sequence and Structure, National Biomedical Research Foundation, pp. 353-358, 1979; or other comparable comparison matrices; (2) a penalty of 30 for each gap and an additional penalty of 1 for each symbol in each gap for amino acid sequences; or penalty of 50 for each gap and an additional penalty of 3 for each symbol in each gap for nucleotide sequences; (3) no penalty for end gaps; and (4) no maximum penalty for long gaps. Other sequence comparison programs available to those skilled in the art include, for example, the BLASTN program, version 2.2.7, available on the website of the National Library of medicine (http://www.ncbi.nlm.nih.gov/blast/bl2seq/bls.html), or the UW-BLAST2.0 algorithm. Standard default parameter settings for UW-BLAST2.0 are described on the following website: http://blast.wustl.edu. In addition, the BLAST algorithm uses the BLOSUM62 amino acid scoring matrix, and optional selection parameters that can be used are as follows: (A) inclusion of a filter to mask segments of the query sequence that have low compositional complexity (as determined by the SEG program of Wootton and Federhen (Computers and Chemistry, 1993); also refer to Wootton and Federhen, 1996, Analysis of compositionally biased regions in sequence databases, Methods Enzymol. 266: 554-71) or segments consisting of short-periodicity internal repeats (as determined by the XNU program of Clayerie and States (Computers and Chemistry, 1993)); and (B) a statistical significance threshold for reporting matches against database sequences, or E-score (the expected probability of matches being found merely by chance, according to the stochastic model of Karlin and Altschul (1990); if the statistical significance ascribed to a match is greater than this E-score threshold, the match will not be reported); a preferred E-score threshold value is 0.5, or is, in ascending order of preferability, 0.25, 0.1, 0.05, 0.01, 0.001, 0.0001, 1e-5, 1e-10, 1e-15, 1e-20, 1e-25, 1e-30, 1e-40, 1e-50, 1e-75, or 1e-100.

[0090] (2) Construct

[0091] The present invention provides a construct comprising the above-described nucleic acid and a promoter. As referred to herein, the construct refers to a conjugate in which a plurality of nucleic acids are linked together, and the construct of this invention comprises the above-described nucleic acid and a promoter as its constitutional units. In this invention, the nucleic acid and the promoter need not necessarily be directly linked together, and may also be indirectly linked together via a different type of nucleic acid. It is preferred that the promoter be operably linked to the nucleic acid of this invention. The phrase operably linked means that the promoter is linked to a nucleic acid of interest such that the promoter can exhibit its functioni.e., transcribe the nucleic acid of interest.

[0092] The promoter is not particularly limited as long as it is capable of transcribing a nucleic acid of interest in a plant cell. Examples of the promoter include, but are not limited to, cauliflower mosaic virus 35S promoter (CaMV35S), various ubiquitin promoters, various actin promoters, tobacco PR1a gene promoter, nopaline synthase gene promoter, napin gene promoter, and oleosin gene promoter.

[0093] In the present invention, a promoter having a function of expressing a nucleic acid in a plant in a site-specific manner can also be used. Examples of such a promoter include, but are not limited to, promoters expressing a nucleic acid in a leaf-specific manner (e.g., O. sativa psb0 gene promoter (Japanese Patent Application Publication No. JP 2010-166924)), promoters expressing a nucleic acid in a stem-specific manner (e.g., A. thaliana FA6 promoter (Gupta, et al., 2012 Plant Cell Rep. 31: 839-850)), promoters expressing a nucleic acid in a root-specific manner (e.g., RCc3 promoter (Xu, et al., 1995 Plant Mol Biol 27: 237-248)), and promoters expressing a nucleic acid mainly in vegetative organs such as roots, stems and leaves (e.g., A. thaliana AS promoter; Non-Patent Literature 1).

[0094] Further, an inducible promoter can be used in the present invention. Such a promoter can be exemplified by promoters that are known to be expressed by external causes such as infection or invasion of fungi, bacteria or viruses, high or low temperature, drought, ultraviolet irradiation, or distribution of particular compounds such as hormones like auxins or brassinosteroids. Specific examples of such promoters include, but are not limited to: an O. sativa chitinase gene promoter (Xu, et al., 1996 Plant Mol. Biol. 30:387) and a tobacco PR protein gene promoter (Ohshima, et al., 1990 Plant Cell 2:95), which are expressed by infection or invasion of fungi, bacteria or viruses; an O. sativa lip19 gene promoter induced by low temperature (Aguan, et al., 1993 Mol. Gen. Genet. 240:1); O. sativa hsp80 and hsp72 gene promoters induced by high temperature (Van Breusegem, et al., 1994 Planta 193:57); an A. thaliana rab16 gene promoter induced by drought (Nundy, et al., 1990 Proc. Natl. Acad. Sci. USA 87:1406); a Petroselinum crispum (parsley) chalcone synthase gene promoter induced by ultraviolet irradiation (Schulze-Lefert, et al., 1989 EMBO J. 8:651); a Z. mays alcohol dehydrogenase gene promoter induced under anaerobic conditions (Walker, et al., 1987, Proc. Natl. Acad. Sci. USA 84:6624); and a promoter induced by salt stress (Shinozaki, K. and Yamaguchi-Shinozaki, K., Curr. Opin. Plant Biol. 3, 217-223 (2000)).

[0095] (3) Vector

[0096] The present invention provides a vector comprising the above-described construct. In other words, this invention provides a vector comprising an operably linked promoter and the inventive nucleic acid.

[0097] The vector can be prepared simply by liking a recombination vector available in the art to a desired nucleic acid according to a common procedure. A plant transformation vector is particularly useful to increase plant biomass using the nucleic acid of the present invention. The vector used in this invention is not particularly limited as long as it can be used to achieve the intended effects of this invention in plant cells, and for example, pBI vectors, pBluescript vectors, and pUC vectors can be used. Examples of pBI vectors include, but are not limited to, pBI121, pBI101, pBI101.2, pBI101.3, and pBI221. Binary vectors such as pBI vectors are preferable in that they can introduce an intended nucleic acid to a plant via Agrobacterium. Examples of pBluescript vectors include, but are not limited to, pBluescript SK(+), pBluescript SK(), pBluescript II KS(+), pBluescript II KS(), pBluescript II SK(+), and pBluescript II SK(). Examples of pUC vectors include, but are not limited to, pUC19 and pUC119. pBluescript and pUC vectors are preferable in that they can directly introduce a nucleic acid to a plant. Further, binary vectors such as pGreen series (www.pgreen.ac.uk) and pCAMBIA series (www.cambia.org), and superbinary vectors such as pSB11 (Komari, et al., 1996, Plant J, 10: 165-174) and pSB200 (Komori, et al., 2004, Plant J, 37: 315-325) can be preferably used.

[0098] It is preferred that the above-described vector comprise a transcription terminator sequence containing a polyadenylation site required for stabilization of a transcript. Those skilled in the art can select an appropriate transcription terminator sequence.

[0099] The transcription terminator sequence is not particularly limited as long as it functions as a transcription termination site, and the transcription terminator sequence can be a known one. The transcription terminator sequence can be selected depending on the promoter to be used, and for example, cauliflower mosaic virus 35S transcription termination region (CaMV35S terminator) and nopaline synthase gene transcription termination region (Nos terminator) can be used. By locating the transcription terminator sequence at an appropriate position in the above-described recombinant expression vector, the occurrence of a phenomenon in which an unnecessarily long transcript is synthesized after the vector is introduced in a plant cell can be prevented.

[0100] The above-described recombinant expression vector may also contain other nucleic acid segments. Such other nucleic acid segments are not particularly limited and can be exemplified by transformant selection markers, enhancers, and nucleotide sequences for enhancing translation efficiency. The aforementioned recombinant expression vector may further have a T-DNA region. The T-DNA region is capable of enhancing gene introduction efficiency particularly when the aforementioned recombinant expression vector is introduced into a plant using Agrobacterium.

[0101] As the transformant selection markers, drug resistance genes, for example, can be used. Specific examples of such drug resistance genes include, but are not limited to, drug resistance genes against hygromycin, bleomycin, kanamycin, gentamicin, or chloramphenicol (e.g., neomycin phosphotransferase gene which is resistant to the antibiotic kanamycin or gentamicin; hygromycin phosphotransferase gene which is resistant to hygromycin). Also, phosphinothricin acetyltransferase gene which is resistant to the herbicide phosphinothricin can be used. Thus, by selecting a plant that grows in a medium containing any of the aforementioned antibiotics or herbicide, a transformed plant can be easily picked up.

[0102] The nucleotide sequences for enhancing translation efficiency can be exemplified by the omega sequence derived from tobacco mosaic virus. By locating the omega sequence in an untranslated region (5UTR) of a promoter, translation efficiency of the aforementioned fusion genes can be enhanced.

[0103] The enhancers can be exemplified by enhancer regions comprising an upstream sequence of the CaMV35S promoter. As described above, various nucleic acid segments can be included in the aforementioned recombinant expression vector depending on the purpose.

[0104] Also, a method for constructing the recombinant expression vector is not particularly limited, and it is only sufficient to introduce the nucleic acid, promoter, and terminator sequence of the present invention, and optionally other DNA segments, in a prescribed order in a vector appropriately selected as a matrix. Insertion of a nucleic acid into a vector as a matrix is performed by using, for example, a method in which a purified nucleic acid is cleaved with an appropriate restriction enzyme and the cleaved nucleic acid is inserted into a restriction enzyme site or multicloning site in an appropriate vector according to a common procedure (e.g., Molecular Cloning, 5.61-5.63).

[0105] Those skilled in the art can appropriately prepare a vector harboring a desired gene according to a common genetic engineering technique. Such a vector can generally be prepared easily by using various types of commercially available vectors.

[0106] (4) Host Cell

[0107] The present invention provides a host cell comprising the above-described vector (or in other words, a host cell having introduced therein the nucleic acid of this invention).

[0108] The host cell of the present invention is not particularly limited but is preferably a plant cell. Examples of the host cell include various forms of plant cells, such as suspension-cultured cells, protoplasts, and cells in plants.

[0109] The plant cell is not particularly limited, and cells derived from a dicotyledonous plant or a monocotyledonous plant can be used. Examples of the dicotyledonous plant include, but are not limited to, Arabidopsis thaliana, Glycine max, Gossypium arboretum, Brassica napus, Beta vulgaris, Nicotiana tabacum, Solanum lycopersicum, Raphanus sativus, Vitis vinifera, and Populus trichocarpa. Among them, A. thaliana, G. max, G. arboretum, B. napus, N. tabacum, and S. lycopersicum are preferred, with A. thaliana, G. max, G. arboretum, and B. napus being more preferred. Examples of the monocotyledonous plant include, but are not limited to, Oryza sativa, Zea mays, Triticum aestivum, Hordeum vulgare, Sorghum bicolor, Saccharum officinarum, and Allium cepa. Among them, O. sativa, Z. mays, T. aestivum, and Sorghum bicolor are preferred, with O. sativa and Z. mays being more preferred.

[0110] Likewise, as for the nucleic acid of the present invention, nucleic acids derived from various plant species can be used. In this invention, the plant species from which the nucleic acid is derived may be the same or different from that from which the host cell (plant cell) is derived. In other words, this invention can provide both of a host cell (plant cell) having introduced therein either a nucleic acid derived from the same plant species as that from which said host cell is derived or a vector comprising said nucleic acid, and a host cell (plant cell) having introduced therein either a nucleic acid derived from a different plant species from that from which said host cell is derived or a vector comprising said nucleic acid. Also, in this invention, when the plant from which the nucleic acid is derived is a dicotyledonous plant, a host cell from a dicotyledonous plant may be selected, or when the plant from which the nucleic acid is derived is a monocotyledonous plant, a host cell from a monocotyledonous plant may be selected.

[0111] A method for expressing a nucleic acid of interest in the host cell can be exemplified by methods in which the nucleic acid is incorporated in an appropriate vector and the vector is introduced into a living organism by a method known to those skilled in the art, such as polyethylene glycol method, Agrobacterium method, liposome method, cationic liposome method, calcium phosphate precipitation method, electric pulse perforation method (electroporation) (Current Protocols in Molecular Biology, edit. Ausubel, et al., (1987), Publish. John Wiley & Sons., Sections 9.1 to 9.9), lipofection method (GIBCO-BRL), microinjection method, or particle gun method. In the present invention, the Agrobacterium method can be preferably used. When a nucleic acid is introduced into a plant cell, the nucleic acid may be directly introduced using the microinjection method, the electroporation method, the polyethylene glycol method, or the like, or may be indirectly introduced into the plant cell through a virus or bacterium having an ability to infect plants, by incorporating the nucleic acid in a plasmid for gene introduction in plants and using the plasmid as a vector. Typical examples of such a virus include, but are not limited to, cauliflower mosaic virus, tobacco mosaic virus, and geminivirus, and examples of such a bacterium include, but are not limited to, Agrobacterium. When gene introduction into a plant is performed by the Agrobacterium method, a commercially available plasmid can be used.

[0112] (5) Transformed Plant

[0113] The present invention provides a plant having the above-described vector introduced therein (or in other words, a plant having the nucleic acid of this invention introduced therein). When the host cell of this invention is a plant cell, the plant cell is included by the plant (transformed plant) of this invention. The plant of this invention includes not only such a plant cell, but also the whole of a plant, plant organs (e.g., root, stem, leaf, petal, seed, fruit, mature embryo, immature embryo, ovule, ovary, shoot apex, anther, pollen), plant tissues (e.g., epidermis, pholoem, parenchyma, xylem, vascular bundle), segments thereof, callus, shoot primordia, seedling, multiple shoot, hairy root, cultured root, and the like.

[0114] The plant of the present invention is a dicotyledonous plant or a monocotyledonous plant. Examples of the dicotyledonous plant include, but are not limited to, Arabidopsis thaliana, Glycine max, Gossypium arboretum, Brassica napus, Beta vulgaris, Nicotiana tabacum, Solanum lycopersicum, Raphanus sativus, Vitis vinifera, and Populus trichocarpa. Among them, A. thaliana, G. max, G. arboretum, B. napus, N. tabacum, and S. lycopersicum are preferred, with A. thaliana, G. max, G. arboretum, and B. napus being more preferred. Examples of the monocotyledonous plant include, but are not limited to, Oryza sativa, Zea mays, Triticum aestivum, Hordeum vulgare, Sorghum bicolor, Saccharum officinarum, and Allium cepa. Among them, O. sativa, Z. mays, T. aestivum, and S. bicolor are preferred, with O. sativa and Z. mays being more preferred.

[0115] As in the case of the host cell described above, the species of the plant of the present invention may be the same as or different from the plant species from which an introduced nucleic acid is derived. In other words, this invention can provide both of a plant having introduced therein either a nucleic acid derived from the same species of plant or a vector comprising said nucleic acid (i.e., a plant having introduced therein a nucleic acid or a vector comprising said nucleic acid, wherein the species of said plant is the same as the plant species from which said nucleic acid is derived), and a plant having introduced therein either a nucleic acid derived from a different species of plant or a vector comprising said nucleic acid (i.e., a plant having introduced therein a nucleic acid or a vector comprising said nucleic acid, wherein the species of said plant is different from the plant species from which said nucleic acid is derived). Also, in this invention, when the plant from which the nucleic acid is derived is a dicotyledonous plant, the plant into which the nucleic acid is introduced can be a dicotyledonous plant, or when the plant from which the nucleic acid is derived is a monocotyledonous plant, the plant into which the nucleic acid is introduced can be a monocotyledonous plant.

[0116] The present invention can provide the following plants:

(i) a monocotyledonous plant having introduced therein a nucleic acid derived from a monocotyledonous plant or a vector comprising said nucleic acid;
(ii) a monocotyledonous plant having introduced therein a nucleic acid derived from a dicotyledonous plant or a vector comprising said nucleic acid;
(iii) a dicotyledonous plant having introduced therein a nucleic acid derived from a dicotyledonous plant or a vector comprising said nucleic acid;
(iv) a dicotyledonous plant having introduced therein a nucleic acid derived from a monocotyledonous plant or a vector comprising said nucleic acid.
Among them, preferred are:
(i) a monocotyledonous plant having introduced therein a nucleic acid derived from a monocotyledonous plant or a vector comprising said nucleic acid;
(ii) a monocotyledonous plant having introduced therein a nucleic acid derived from a dicotyledonous plant or a vector comprising said nucleic acid; and
(iii) a dicotyledonous plant having introduced therein a nucleic acid derived from a dicotyledonous plant or a vector comprising said nucleic acid.
More preferred are:
(i) a monocotyledonous plant having introduced therein a nucleic acid derived from a monocotyledonous plant or a vector comprising said nucleic acid; and
(ii) a monocotyledonous plant having introduced therein a nucleic acid derived from a dicotyledonous plant or a vector comprising said nucleic acid.

[0117] The plant of the present invention includes a plant obtained by growing a plant cell having introduced therein the nucleic acid of this invention or a vector comprising said nucleic acid, and a plant which is the progeny, offspring or clone of said plant, and their reproductive materials (e.g., seed, fruit, cut panicle, tuber, root tuber, stock, callus, protoplast). Reproduction of a plant from a transformed plant cell can be done by a method known to those skilled in the art depending on the type of the plant cell. The techniques of reproduction have been established and widely used in the technical field of this invention. These techniques can be suitably used in this invention.

[0118] A method for regenerating a transformed plant cell to reproduce a plant varies with the type of the plant cell. For example, the method of Fujimura, et al. (Plant Tissue Culture Lett. 2:74 (1995)) is used for Oryza sativa, and the methods of Shillito, et al. (Bio/Technology 7:581 (1989)) and Gorden-Kamm, et al. (Plant Cell 2:603 (1990)) are used for Zea mays. The presence of a foreign nucleic acid introduced into a transformed plant which is reproduced by such a method as mentioned above and is planted can be determined by the known PCR method or Southern hybridization method, or by analysis of a DNA nucleotide sequence in the plant. In such a case, DNA extraction from the transformed plant can be done by following the known method of J. Sambrook, et al. (Molecular Cloning, 2nd ed., Cold Spring Harbor Laboratory Press, 1989).

[0119] For example, when a foreign nucleic acid present in a reproduced plant is analyzed by PCR, an amplification reaction is performed using as a temperate a DNA extracted from the reproduced plant in such a manner as above. Alternatively, it is also possible that synthesized oligonucleotides having nucleotide sequences appropriately selected according to the nucleotide sequence of the nucleic acid of the present invention or an altered nucleic acid are used as primers, and an amplification reaction is done in a reaction liquid having a mixture of said primers. In an amplification reaction, an amplified product of a DNA fragment comprising the nucleotide sequence of a nucleic acid of interest can be obtained by repeating a cycle of DNA denaturation, annealing, and extension a few dozen times. When a reaction liquid containing an amplified product is subjected to, for example, agarose electrophoresis, amplified DNA fragments are separated, so that it can be confirmed that the DNA fragments correspond to the genes of this invention.

[0120] Once a transformed plant having a nucleic acid of interest introduced in the genome is obtained, an offspring can be produced from the plant by sexual or asexual reproduction. Also, a reproductive material is obtained from the plant or the offspring or clone thereof, and the plant can be mass produced based on said reproductive material. The present invention covers a plant cell having introduced therein either the nucleic acid of this invention or a recombinant expression vector comprising said nucleic acid, a plant comprising said cell, an offspring and clone of said plant, and a reproductive material from said plant and its offspring and clone. In other words, this invention covers T0 generation plants which are initial regenerated transgenic plants, and their progeny plants such as T1 generation plants which are seeds from TO generation plants, as well as hybrid plants created by crossing those different generation plants, each of which is used as one parent, and progeny plants from said hybrid plants.

[0121] The plant (transformed plant) of the present invention also includes so-called site-specific transformants in which the native promoter controlling the bil7 gene of wild-type plants (including plants having no nucleic acid of this invention (e.g., bil7 gene) introduced from the outside) is replaced by any of the aforementioned promoters. Such plants are characterized in that the biomass is increased by enhanced expression of the bil7 gene inherent in the plants caused by the replaced promoter. This invention also covers, in one embodiment, plants in which the specified nucleic acid (e.g., bil7 gene) is eventually strongly expressed (overexpressed); thus, such site-specific transformants can also be included within the scope of this invention. As a method for preparing such plants, various known genome editing techniques such as CRISPR method, ZFN method, and TAL effector nuclease (TALEN) method can be used.

[0122] The thus-prepared transformed plants are expected to have an advantageous characteristic in that the biomass is increased relative to ordinary plants. The plant used as a target for transformation in the present invention is not particularly limited, and various species of transformed plants with increased biomass can be prepared by the method of this invention.

[0123] (6) Method for Increasing Plant Biomass

[0124] The present invention provides a method for increasing plant biomass comprising the step of introducing the above-described nucleic acid into a plant. More specifically, the method of this invention is a method for increasing plant biomass, comprising the steps of: preparing a vector comprising the nucleic acid of this invention and a promoter operably linked to said nucleic acid; introducing said vector into a host cell (plant cell); and reproducing a plant from the plant cell having said nucleic acid introduced therein. The method of this invention can be obtained by utilizing a plant biomass increasing activity of the protein encoded by the nucleic acid of this invention.

[0125] In the method of the present invention, the above-described nucleic acid, or instead a vector comprising said nucleic acid can be introduced into a plant. Introduction of the inventive nucleic acid or a vector comprising said nucleic acid into a plant is done by a method as described above; the nucleic acid can be introduced into a plant through introduction of the nucleic acid into a host cell (plant cell). Also, the type of the plant used as a target in the method of this invention, the relationship of said plant with the plant species from which the introduced nucleic acid is derived, and other conditions are as described above. In addition, the terms, materials, techniques and other matters that should be considered in relation to the inventive method are understood in accordance with the descriptions and definitions given hereinabove.

[0126] (7) Method for Preparing a Plant with Increased Biomass

[0127] The present invention provides a method for preparing a plant with increased biomass, comprising the step of introducing the above-described nucleic acid into a plant. More specifically, the method of this invention is a method for preparing a plant with increased biomass, comprising the steps of: preparing a vector comprising the nucleic acid of this invention and a promoter operably linked to said nucleic acid; introducing said vector into a host cell (plant cell); and reproducing a plant from the plant cell having said nucleic acid introduced therein. The method of this invention can be obtained by utilizing a plant biomass increasing activity of the protein encoded by the nucleic acid of this invention.

[0128] In the method of the present invention, the above-described nucleic acid, or instead a vector comprising said nucleic acid can be introduced into a plant. Introduction of the nucleic acid or a vector comprising said nucleic acid into a plant is done by a method as described above; the nucleic acid can be introduced into a plant through introduction of the nucleic acid into a host cell (plant cell). Also, the type of the plant used as a target in the method of this invention, the relationship of said plant with the plant species from which the introduced nucleic acid is derived, and other conditions are as described above. In addition, the terms, materials, techniques and other matters that should be considered in relation to the inventive method are understood in accordance with the descriptions and definitions given hereinabove.

[0129] (8) Method for Screening for a Plant with Increased Biomass

[0130] The present invention provides a method for screening for a plant with increased biomass using the above-described protein or nucleic acid. This method comprises the following steps:

(1) measuring the expressions levels of the protein of this invention or a nucleic acid encoding said protein in test and wild-type plants;
(2) comparing the expressions levels obtained at step (1); and
(3) selecting the test plant whose expression level is higher than that in the wild-type plant.

[0131] As described above, the morphology of the plant used as a target in the screening method of the present invention includes not only a plant cell, but also the whole of a plant, plant organs (e.g., root, stem, leaf, petal, seed, fruit, mature embryo, immature embryo, ovule, ovary, shoot apex, anther, pollen), plant tissues (e.g., epidermis, pholoem, parenchyma, xylem, vascular bundle), segments thereof, callus, shoot primordia, seedling, multiple shoot, hairy root, cultured root, and the like. From the viewpoint of screening, it is particularly preferred that the plant be in a state before growing into maturity or in a juvenile state. Thus, seed (mature seed, immature seed), mature embryo, immature embryo, callus, shoot, seedling, and the like are particularly preferred morphology of the plant in the inventive screening method.

[0132] As referred to herein, the wild-type plant is a phenotype of line or plant most frequently found among target plants, and mainly refers to a plant species that is not genetically modified at all. The morphology of the wild-type plant can be any of the morphology mentioned above, but is preferably the same as the morphology of a test plant.

[0133] Measurement of protein or nucleic acid expression level can be conducted by using a well-known method in the art. For example, the expression level of a protein can be measured by extracting a protein from a plant, preparing or obtaining an antibody against the protein of the present invention (e.g., BIL7 protein from different species of plants), and performing western blotting, immunoassay (e.g., ELISA) or any other methods pursuant thereto using said antibody. The antibody used can be either a monoclonal antibody or a polyclonal antibody. Also, the antibody can be an antibody molecule per se or a fragment thereof, such as Fab, Fab, or F(ab).sub.2. As a label for the antibody, a radioisotope, an enzyme, a fluorescent substance, a luminescent substance, or the like, which are per se known, is used. The expression level of a nucleic acid can be measured by, for example, extracting RNA from a plant, preparing or obtaining primers capable of specifically amplifying the nucleic acid of the present invention, or probes capable of specifically detecting said nucleic acid, based on the nucleotide sequence of said inventive nucleic acid (e.g., BIL7 gene from different species of plants), and performing RT-PCR, Northern blotting, or any other methods pursuant thereto using said primers or probes.

[0134] The expression level of a protein or a nucleic acid can be qualitative or quantitative, but is preferably quantified as a numerical value (measured value). The expression levels obtained from test and wild-type plants are mutually compared, and when the expression level in the test plant is higher than that in the wild-type plant, it can be determined that plant biomass is increased. By selecting such a test plant, screening for a plant with increased plant biomass can be done.

[0135] (9) Method for Verifying a Plant with Increased Biomass

[0136] The present invention provides a method for verifying a plant with increased biomass using the above-described protein or nucleic acid. This method comprises the following steps:

(1) measuring the expressions levels of the protein of this invention or a nucleic acid encoding said protein in test and wild-type plants;
(2) comparing the expressions levels obtained at step (1); and
(3) confirming that the expression level in the test plant is higher than that in the wild-type plant.

[0137] The verification method of the present invention is synonymous with the use of the protein or nucleic acid of this invention as a marker (protein marker or nucleic acid marker). In other words, when the protein or nucleic acid of this invention is detected in a plant of interest and also the expression level of the inventive protein or nucleic acid in said plant is higher than that in a wild-type one, said plant of interest is expected to have increased biomass.

[0138] The morphology of the plant used as a target in the verification method of the present invention has been described above in relation to the screening method, and all plant parts and the like as listed above are likewise included by the morphology of the plant used in the verification method, but it is particularly preferred that the plant be in a state before growing into maturity or in a juvenile state. Thus, seed (mature seed, immature seed), mature embryo, immature embryo, callus, shoot, seedling, and the like are particularly preferred morphologys of the plant in the inventive verification method.

[0139] Measurement of protein or nucleic acid expression level in the inventive verification method can be conducted by using a well-known method in the art. A specific example of such a well-known method has been described above in relation to the screening method. In this invention, the expression level of a protein or a nucleic acid can be qualitative or quantitative, but is preferably quantified as a numerical value (measured value). The expression levels obtained from test and wild-type plants are mutually compared, and when the expression level in the test plant is confirmed to be higher than that in the wild-type plant, it can be determined that plant biomass is increased.

EXAMPLES

[0140] Hereunder, the present invention will be specifically described by way of working examples, but these examples are not intended to limit the technical scope of this invention. Those skilled in the art can easily make any alterations or modifications to this invention based on the descriptions in the present specification, and such alterations and modifications are also included in the technical scope of this invention.

Example 1 Selection of a Bil7 Mutant

[0141] The FOX hunting system (Full-length cDNA Over-expression Gene Hunting System) is a method for identifying the functions of DNA based on changes in characters caused by introduction and strong expression of a full-length cDNA in a plant (WO 03/018808). In this example, from among about 8,800 Arabidopsis (Arabidopsis thaliana) FOX lines (Ichikawa, et al., 2006), selection was made of plant lines exhibiting a bil (Brz-insensitive-long-hypocotyl) morphology in which hypocotyl elongates relative to wild-type Arabidopsis (A. thaliana) in the presence of the brassinosteroid (BR) biosynthesis inhibitor brassinazole (Brz) in the dark. Plants exhibiting a bil morphology in the presence of Brz in the dark are believed to have Brz resistance. The selection consisted of primary and secondary selections. The selected lines were back-crossed to the wild-type, and the thus-created hybrid Fl generation plants were confirmed to exhibit a bil morphology in the presence of Brz in the dark, thereby it was confirmed that bil mutation is a dominant character. Since FOX lines are gain-of-function mutants, the dominant mutation was considered to indicate that the cause of the mutation originates from FOX.

[0142] First, seeds of 20 to 40 FOX lines were mixed and grown under the conditions of germination in the presence of 3 M Brz in the dark, and hypocotyl elongation lines were primarily selected. Then, after the primarily selected plants were grown, the obtained seeds were grown again under the conditions of germination in the presence of 3 M Brz in the dark and hypocotyl elongation lines were secondarily selected. Additionally, in the secondary selection, the lines divided into one-fourth with a strong bil morphology, two-fourths with a moderate bil morphology, and the other one-fourth with a comparable bil morphology to the wild-type; thus, it was confirmed that bil mutation is a dominant character. As a result of this secondary selection, several lines of candidate mutants apparently exhibiting more significant hypocotyl elongation than wild-type Columbia-0 (Col-0) were obtained. Among them, line No. 72 which exhibited the longest hypocotyl elongation morphology was named as bil7-1D (Brz-insensitive-long-hypocothl 7-1D) and used as a target for analysis. The hypocotyl elongation of bil7-1D in the presence of 3 M Brz in the dark was about 2.5 times longer than that of the wild-type, and was considered as a strong Brz-resistant mutant character comparable to bil1-1D/bzr1-1D (positive control with Brz resistance) which is a gain-of-function mutant of BIL1/BZR1, a master transcription factor for BR signaling (FIG. 1).

[0143] For the purpose of analyzing the morphological features of bil7-1D, morphological observation for maturity was conducted. A mature bil7-1D mutant plant on day 60 which seemed to stop growing was morphologically analyzed, and the results found that the inflorescence of bil7-1D elongated about 1.5 times longer than the wild-type (FIGS. 2A, C). It was also found that the number of primary inflorescences for bil7-1D was similar to that for the wild-type but that the number of secondary inflorescences for bil7-1D increased about twice (FIGS. 2D, E). The rosette leaves of bil7-1D were more rounded than those of the wild-type and similar to those of bil1-1D/bzr1-1D (FIG. 2B).

[0144] Further, analysis of reproductive organs was conducted. In not all but about 45% of the flowers of bil7-1D, it was observed that flower petals did not open normally (FIG. 3A) and so no normal siliques were produced even after flowers were formed (FIG. 3B). Thus, in bil7-1D, relative to the wild-type, the number of flowers increased but the number of normal siliques decreased (FIGS. 3D, E). Also, the number of seeds per silique in bil7-1D decreased, thereby resulting in a decrease in the total number of seeds (FIG. 3F). The seeds of bil7-1D grew larger than the wild-type ones (FIG. 3C), and the weight of seeds of bil7-1D increased about twice as compared to that of the wild-type (FIG. 3G).

[0145] As a result of analysis of the growth process of bil7-1D, it was considered that although bil7-1D tends to be slightly delayed in flowering (FIG. 4A) and growth (FIG. 4B), there is no significant difference between bil7-1D and the wild-type in view of the values for bil1-1D/bzrl-1D which is reported as a delayed-flowering mutant (Zhang, et al., 2013). According to temporal observation, bil7-1D and the wild-type are similar in the rate of inflorescence elongation, but in the wild-type, the flowering period ended and inflorescence elongation ceased on about day 45 after seeding, whereas the flowering period and inflorescence elongation in bil7-1D continued until about day 60 (FIG. 4C). These results revealed that bil7-1D exhibits significant growth-promoting morphological characters related to inflorescence elongation.

Example 2 Isolation and Identification of Bil7-1D Mutant Causative Gene

[0146] Based on the morphological analysis of the bil7-1D plant, it was presumed that the mutant causative gene BILI is capable of inducing growth-promoting morphological characters such as inflorescence elongation and activating BR signaling. Thus, the bil7-1D mutant causative gene BIL7 was isolated and subjected to homologous protein analysis and functional domain search. Then, it was confirmed that the morphology of bil7-1D was reproduced by preparing a high BIL7-expressing transformant (BIL7-OX) and highly expressing the BIL7 candidate gene; thus, the BIL7 gene was established.

[0147] 2-1 Isolation of Bil7-1D Mutant Causative Gene

[0148] As for the cDNA introduced in the bil7-1D mutant, the genome of the mutant was used as a template, and PCR and sequencing were performed with primers specific for 35S CaMV promoter and NOS terminator to obtain gene fragments.

[0149] Rosette leaves were collected from the bil7-1D mutant, and genomic DNA was extracted from the collected leaves using the Nucleon DNA Extraction Kit (Amersham). Then, PCR was performed on the extracted DNA. The PCR solution, reaction conditions, and primers are as mentioned below.

TABLE-US-00008 TABLE 3 (PCR cycle) (Components of PCR solution) 1 95 C. 3 min DNA template 1 L 2 94 C. 30 sec 10 EX Taq buffer 3 L 3 63.1 C. 30 sec dNTP mix 3 L 4 72 C. 4 min primerF 0.2 L <#2-4 40> primerR 1 L 5 72 C. 5 min EX Taq 1 L 6 end dH.sub.2O 21.6 L Total 30 L

TABLE-US-00009 TABLE4 Primerset: Forwardprimer(5-3) Reverseprimer(5-3) FOX-F1 GGAAGTTCATTTATTCGGAGAG FOX-F2 GGCAACAGGATTCAATCTTAAG (SEQIDNO:28) (SEQIDNO:29)

[0150] The nucleotide sequence of the thus-obtained PCR product was sequenced, and as a result, a gene encoding a novel protein with unknown function was presented as BIL7 candidate gene.

[0151] The expression of the BIL7 candidate gene was analyzed by realtime RT-PCR. Total RNA was extracted from the plant using the RNeasy Plant Mini Kit (QIAGEN). Then, a reaction solution was prepared using the Takara PrimeScript RT Reagent Kit (Perfect Realtime), and cDNA was synthesized in a cDNA reaction (started at 37 C. for 15 min, followed by at 85 C. for 5 sec, and ended at 4 C.). Using the thus-synthesized cDNA as a template, realtime PCR was done under the following conditions.

TABLE-US-00010 TABLE 5 PCR conditions Components of PCR solution 1 95 C. 30 sec SYBR Premix Ex Taq II 12.5 L 2 95 C. 5 sec 100 l primer F 0.1 L 3 60 C. 30 sec 100 l primer R 0.1 L <#2-3 50> dH.sub.2O 7.3 L cDNA 5.0 L total 30 L

TABLE-US-00011 TABLE6 RT-PCRprimersets Forwardprimer Reverseprimer gene (5-3) (5-3) ACT2 CGCCATCCAAGCTGTTCTC TCACGTCCAGCAAGGTCAAG (SEQIDNO:30) (SEQIDNO:31) BIL7 CATTCGTCTCTCGGGTCCA TCTTCGGCGAAGCTGATCTA (SEQIDNO:32) (SEQIDNO:33) BIL7(for CGAGAAAATTCTCAGACTCA AAGCAGCTGCGTTTATAGTA RNAi) (SEQIDNO:34) (SEQIDNO:35) BIL7- GGTGGTTTCTGAGTAGTAGT AGTCTCAACGCTGTTATTA homolog1 (SEQIDNO:36) (SEQIDNO:37) BIL7- GTTATTTGATTGTCGTCGTT TTCTAGACTCAGCGGAGAC homolog2 (SEQIDNO:38) (SEQIDNO:39) BIL7- CTGTTGAAGAAACCCTACTC ACCTTTTCCTCTGATCCT homolog3 (SEQIDNO:40) (SEQIDNO:41)

[0152] As a result, the expression level of the BIL7 candidate gene in bil7-1D increased at least about 40 times as compared to that of the wild-type (FIG. 5). This result, combined with the fact that bil7-1D is a dominant mutant, suggested that overexpression of the BIL7 candidate gene is the cause of bil7-1D phenotype.

[0153] 2-2 Analysis of the Amino Acid Sequence of the BIL7 Gene

[0154] Since the BIL7 candidate gene encodes a protein with unknown function, a motif search against the PROSITE (http://prosite.expasy.org/) and PSORT (http://psort.hgc.jp/form.html) databases and hydrophobicity analysis using GENETYX-MAC were conducted based on the amino acid sequence of BIL7 to estimate the function of the translated product.

[0155] The results found that the sequence of BIL7 contains a N-myristoylation predictive site and a N-glycosylation predictive site. No other domain predictive of function was observed. Since no transmembrane domain was found but a nuclear localization signal (NLS) was present, nuclear localization was presumed to occur.

[0156] Three different BIL7 homologous proteins were found in Arabidopsis thaliana (thale cress). It was also found that highly homologous proteins are present in other wide variety of plant species, such as Raphanus sativus (radish), Glycine max (soybean), Populus trichocarpa (poplar), Vitis vinifera (grape), Oryza sativa (rice), and Physcomitrella patens. All of these proteins were unreported and novel proteins with unknown function. Further, a particularly highly conservative region was found in these groups of homologous proteins. Based on this region, search for amino acids showing higher homology was conducted, but no protein predictive of function was found. Since the sequence region of the myristoylation predictive site was found to be relatively conservative in other genes, the possibility was suggested that the function of BIL7 may be related to functions shared in common by these proteins.

[0157] 2-3 Preparation and Morphological Observation of a High BIL7-Expressing Transformant (BIL7-OX)

[0158] A construct in which the BIL7 gene was linked downstream of 35S CaMV promoter was transformed into wild-type Arabidopsis (Arabidopsis thaliana) to prepare a high BIL7-expressing transformant (BIL7-OX), which was subjected to morphological observation.

[0159] RNA was extracted from rosette leaves of wild-type Arabidopsis (Arabidopsis thaliana) using the RNeasy Plant Mini Kit (QIAGEN). Then, cDNA was synthesized using the SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen) by following the kit protocol. Using this cDNA as a template, PCR was performed with the primers shown below to amplify BIL7.

TABLE-US-00012 TABLE7 Primersforcloningintoentryvector(pENTR) Sequence Forwardprimer Reverseprimer BIL7full CCCATGAGAAGCGGTGCTA TTAGCTTAGTGTACCTGAC length ATGG TG (SEQIDNO:42) (SEQIDNO:43)

[0160] Amplified BIL7 was cloned into an entry vector (pENTR) using the pENTER/D TOPO Cloning Kit (Invitrogen). The prepared pENTR vector was introduced into each of pGWB2 containing a 35S promoter and pGWB80 containing an RNAi construct by Gateway technology using the Gateway LR Clonase II Enzyme Mix (Invitrogen), to obtain BIL7-inserted transformation vectors, pGWB2-BIL7 and pGWB80-BIL7-RNAi.

[0161] Then, the prepared vectors were introduced into Agrobacterium, which was used to transform wild-type Arabidopsis (Arabidopsis thaliana) by the flower dipping method.

[0162] Two microliters of the prepared vectors were added to 50 L of Agrobacterium-competent cells, and the contents were mixed and left to stand on ice for 30 minutes. After being left in liquid nitrogen for one minute, the mixture was thawed at 37 C. for one minute. 250 L of a liquid YEP medium was added, and the mixture was cultured at 28 C. for one hour and then spread onto a YEP medium plate supplemented with 50 g/mL of kanamycin and hygromycin and 100 g/mL of rifampycin. Colony PCR was performed to determine whether or not the vectors were introduced in Agrobacterium.

[0163] The Agrobacterium colony having the vectors introduced therein was cultured overnight in a liquid YEP medium, and then the culture was scaled up to 500 mL and cultured overnight. The culture was centrifuged at 5000 rpm for 10 minutes to remove the supernatant, and then the remainder was suspended in a MS medium supplemented with 5% (w/v) sucrose. The wild-type with siliques removed was transformed with the suspension by the flower dipping method. The resulting T1 seeds were selected on a MS medium supplemented with 25 g/mL of kanamycin to obtain a high BIL7-expressing transformant (BIL7-OX) and a BIL7 expression-inhibited transformant (BIL7-RNAi) (FIG. 6).

[0164] BIL7-OX lines were examined for the morphological characteristics of bil7-1D as described in Example 1 (FIGS. 7, 8). As a result, the rosette leaf morphology found in bil7-1D was observed not in BIL7-OX1 with low BIL7 expression level but only in BIL7-OX2 with high BIL7 expression level (FIG. 7A). There was a tendency that the length of inflorescence and the number of secondary inflorescences was enhanced in a transformant line with higher BIL7 expression level (FIGS. 7A, B, FIG. 8D). The number of primary inflorescences, which was similar between bil7-1D and the wild-type, tended to slightly decrease with an increase in BIL7 expression (FIG. 8C). With regard to seeds, as the level of BIL7 expression was higher, the number of normal siliques decreased, but the weight of seeds increased as in the case of bil7-1D (FIGS. 8B, E, F).

[0165] Hence, all of the mature morphologies observed in bil7-1D were likewise found in the BIL7-OX lines. In view of this, combined with the results of observation of hypocotyl in a Brz-resistant phenotype, it was considered that the morphologies of bil7-1D were reproduced by high expression of the BIL7 candidate gene. From these results, it was established that this gene is a causative gene of bil7-1D.

Example 3 Oryza sativa Transformation with OsBIL7, a BIL7 Homologous Gene from O. sativa

[0166] There was constructed a vector in which the BIL7 homologous gene from Oryza sativa, OsBIL7, was ligated downstream of a ubiquitin promoter which is a constitutive expression promoter in O. sativa. This vector was used to perform O. sativa transformation.

[0167] First, the BIL7 homologous gene from O. sativa, OsBIL7, was cloned. Total RNA of O. sativa Nipponbare wild-type was extracted using Qiagen's RNeasy Plant Kit. Then, from the total RNA, cDNA was synthesized using Invitrogen's SuperScript II Kit. Using this cDNA as a template, PCR was performed with the primers shown below to amplify OsBIL7.

TABLE-US-00013 OsY72-GW-F1: (SEQIDNO:44) CACCATGCAGAGTGGGAGCGAGAT OsY72-GW-R1: (SEQIDNO:45) TTAGCTGACCCCTGGCTGT

[0168] Amplified OsBIL7 was cloned using the pENTER/D TOPO Cloning Kit (Invitrogen).

[0169] Then, O. sativa transformation was performed using the prepared vector. The O. sativa variety used was Nipponbare. The above-constructed vector was transformed into O. sativa by the high-speed transformation method (Toki, et al., Plant J. 47: 969-76, 2006) via the Agrobacterium strain EHA105. The resulting transformed T1 generation and homologous T2 generation were examined for yield characters. As a result, it was found that the number of tillers and seed yield increased in both of T1 generation and homologous T2 generation (FIGS. 9A, B).

[0170] Hence, it was confirmed that BILI is capable of increasing yield also in O. sativa.

Example 4 Biomass Evaluation in Transformants of the Oryza sativa Variety Yukihikari in which the OsBIL7 Gene was Overexpressed

[0171] The vector constructed in Example 3 was transformed into Oryza sativa (variety Yukihikari) via the Agrobacterium strain LBA4404. At the same time, pSB4 (Komari, et al., 1996, Plant J. 10: 165-174) was used as a control and transformed into the plant. The transformation was carried out in accordance with the method of Hiei, et al. (2008, Plant J. 6:271-282). The concentration of hygromycin in a selection medium, a regeneration medium, and a rooting medium was 30 g/mL. An evaluation of the resulting transformants of initial generation (T0 generation) was carried out in a closed greenhouse for genetically modified plants, located in the Plant Innovation Center of Japan Tobacco Inc. The day length was 14.5 hours, and the greenhouse temperature was maintained at 28 C. during the daytime and at 21 C. during the nighttime. After 18 days of transplantation from plant boxes to pots, 36 well-grown seedlings were selected for each transformant, and each one of the 36 seedlings was transplanted to a polypot (12 cm diameter, 830 cc volume). To determine the presence or absence of the introduced genes, PCR assay was made of the OsBIL7 gene and the hygromycin resistance gene. As a result, 4 seedlings were observed to be deficient in the OsBIL7 gene. In contrast, none of the 36 control vector-transformants was deficient in the hygromycin resistance gene. Therefore, data were gathered of the 32 OsBIL7-transformants and the 36 control vector-transformants. The characters measured were culm length, number of tillers, number of panicles, panicle length, number of rough rice per panicle, number of fertile rough rice per panicle, weight of one panicle, panicle weight per plant, upper-ground dry matter weight, and panicle weight per plant. As for culm length, the length of the longest culm was measured. To measure panicle length, number of rough rice per panicle, number of fertile rough rice per panicle, and weight of one panicle, the panicle of the (longest) culm whose length was measured was taken as a sample of measurement. The number of panicles was counted with the exclusion of late-emerging panicles. The harvest was carried out in the order starting with a plant ripened earlier. After completion of the character examination, data were gathered and statistically analyzed. The average values for the different characters are shown in Table 9. FIG. 10 shows seedlings of transformants immediately before being transplanted to polypots. FIG. 11 shows the status of transformants during the maturity period.

TABLE-US-00014 TABLE 9 Number of Number of Culm Panicle rough rough length Number of Number of length rice per rice per (cm) tillers panicles (cm) panicle panicle OsBIL7 65 8.9 6.9 18.4 73 56 Control vector 51 9.8 8.2 13.8 50 36 Weight of Percentage of Weight of fertile fertile one Panicle Upper-ground rough rice rough rice panicle weight per dry matter per plant (%) (g) plant (g) weight (g) (g) OsBIL7 76 1.60 7.73 17.8 6.95 Control vector 73 0.94 5.73 12.8 5.15

[0172] It was found that the OsBIL7 transformants have the following characteristics relative to the control vector- transformed plants. The OsBIL7-transformed plants were higher in culm length by 14 cm, longer in panicle length by 4.6 cm, and larger in number of rough rice per panicle by 23 grains. Since both types of transformants were similar in seed fertility, the number of fertile rough rice per panicle in the OsBIL7-transformants was larger by 20 grains. Also, the OsBIL7-transformants increased in weight of one panicle by 0.66 g (170%) and in panicle weight per plant by 2.00 g (135%). Eventually, said OsBIL7-transformants increased in weight of fertile rough rice per plant, which corresponds to the yield of seeds, by 1.80 g (135%). Further, said OsBIL7-transformants increased in upper-ground dry matter weight by 5.00 g (140%).

[0173] To sum up the above, it was found that overexpression of the OsBIL7 gene driven by a ubiquitin promoter in the O. sativa variety Yukihikari results in an increase in O. sativa upper-ground biomass as well as in the yield of seeds.

Example 5 Biomass Evaluation in Oryza sativa Transformants in which Arabidopsis thaliana BIL7 Gene was Overexpressed

[0174] It was examined whether overexpression of A. thaliana BIL7 gene in the monocotyledonous plant O. sativa leads to an increase in O. sativa yield.

[0175] The BIL7 gene-cording region of the BIL7 gene cDNA clone (pENTR entry vector) constructed in Example 2 was amplified by PCR and ligated downstream of a ubiquitin promoter in the O. sativa transformation binary vector used in Example 3. The primers used in PCR are as shown below.

TABLE-US-00015 TABLE10 AtBIL7GWB1-F1 forward aggatttatcacaagtttgtacaaaaaagcaggctccgc (SEQIDNO:46) AtBIL7GWB1-F2 forward gtttggtgttactcctgcaggatttatcacaagtttgtac (SEQIDNO:47) AtBIL7GWB1-R1 Reverse caccactttgtacaagaaagctgggtcggcgcgcccaccct (SEQIDNO:48) tttagcttagtgtacctgactg AtBIL7GWB1-R2 Reverse ggccgatttggcccctgcaggatttatcaccactttgtaca (SEQIDNO:49) agaaagctgggtc

[0176] The resulting construct Ubi-AtBIL7 was transformed into O. sativa (variety Yukihikari) via the Agrobacterium strain LBA4404. At the same time, the modified pIG121Hm vector, p121Hm (containing the cassette CaMV35S promoter-hygromycin resistance gene-NOS terminator in the T-DNA region) was used as a control and transformed into the plant. The transformation was carried out in accordance with the method of Hiei, et al. (2008, Plant J. 6:271-282). The concentration of hygromycin in a selection medium, a regeneration medium, and a rooting medium was 30 g/mL. An evaluation of the resulting transformants of initial generation (T0 generation) was carried out in a closed greenhouse for genetically modified plants, located in the Plant Innovation Center of Japan Tobacco Inc. The day length was 14.5 hours, and the greenhouse temperature was maintained at 28 C. during the daytime and at 21 C. during the nighttime. After 20 days of transplantation from plant boxes to pots, 36 well-grown seedlings were selected for each transformant, and each one of the 36 seedlings was transplanted to a polypot (12 cm diameter, 830 cc volume). To determine the presence or absence of the introduced genes, all of the 72 transformed plants, including control ones, were subjected to PCR assay of the BIL7 gene and the hygromycin resistance gene. The characters measured were plant length after 5 weeks of transplantation to pots, flag leaf length in the longest culm, culm length, number of panicles, panicle length, number of rough rice per panicle, number of fertile rough rice per panicle, weight of fertile rough rice per panicle, weight of one panicle, panicle weight per plant, upper-ground dry matter weight, and panicle weight per plant. As for culm length, the length of the longest culm was measured. To measure panicle length, number of rough rice per panicle, number of fertile rough rice per panicle, weight of fertile rough rice per panicle, and weight of one panicle, the panicle of the (longest) culm whose length was measured was taken as a sample of measurement. The number of panicles was counted with the exclusion of late-emerging panicles. 1000 fertile rough rice weight was calculated by dividing weight of fertile rough rice per panicle by number of fertile rough rice per panicle and multiplying the resulting quotient by 1000.

[0177] The 36 BIL7 transformants were assayed for the presence or absence of the BIL7 gene. As a result, no BIL7 transformant was deficient in the BIL7 gene. Likewise, none of the 36 control vector-transformant was deficient in the hygromycin resistance gene. Therefore, data were gathered of the 36 BIL7 transformants and the 36 control vector transformants. The average values for the different characters are shown in Table 11. FIG. 12 shows the growth status of seedlings immediately before being transplanted to polypots. FIG. 13 shows the status of seedlings during the maturity period.

TABLE-US-00016 TABLE 11 Number of Number of Plant Flag leaf Culm Panicle rough fertile height length length Number of length rice per rough rice (cm) (cm) (cm) panicles (cm) panicle per panicle BIL7 75 35 62 7.4 18.6 65 52 Control vector 60 26 49 8.0 14.4 51 39 Weight of Percentage of 1000-fertile Upper-ground fertile fertile rough rice Weight of Panicle dry matter rough rice rough rice weight one panicle weight weight per plant (%) (g) (g) per plant (g) (g) BIL7 77 26.1 1.52 7.97 17.2 7.17 Control vector 75 23.5 1.04 6.83 13.5 5.99

[0178] It was found that the BIL7 transformants have the following characteristics relative to the control vector transformants. After 5 weeks of seeding, the BIL7 transformants were taller in plant length by 15 cm. The BIL7 transformants were longer in flag leaf length by 9 cm, and higher in culm length by 13 cm. Also, said plants were longer in panicle length by 4.2 cm and larger in number of rough rice per panicle by 14 grains. Since both types of plants were similar in seed fertility, the number of fertile rough rice per panicle in the BIL7 transformants was larger by 13 grains. The 1000 fertile rough rice weight of said plants was heavier by 2.6 g. Said plants increased in weight of one panicle by 0.48 g (146%), and in panicle weight per plant by 1.34 g (120%). Eventually, said plants increased in weight of fertile rough rice per plant, which corresponds to the yield of seeds, by 1.18 g (120%). Further, said plants increased in upper-ground dry matter weight by 3.77 g (128%).

[0179] To sum up the above, it was found that overexpression of the BIL7 gene driven by a ubiquitin promoter in the O. sativa variety Yukihikari results in an increase in O. sativa upper-ground biomass as well as in the yield of seeds.

Example 6 Biomass Evaluation in Zea mays Transformants in which the OsBIL7 Gene was Overexpressed

[0180] The vector constructed in Example 3 was transformed into Zea mays (inbred line A188) in accordance with the method of Ishida, et al. (2007) via the Agrobacterium strain LBA4404. The obtained transformants were planted in a closed greenhouse for genetically modified plants, located in the Plant Innovation Center of Japan Tobacco Inc. The day length was 14.5 hours, and the greenhouse temperature was maintained at 28 C. during the daytime and at 20 C. during the nighttime. The extracted tassels were cut before flowering. Corn silks sufficiently extracted from ears were crossed with pollens collected from non-transgenic Z. mays (inbred line A188) to obtain T1 seeds. These seeds were used to conduct evaluation test for biomass-related characters. The evaluation test was conducted on 6 out of the 25 collected plants, in consideration of the results of PCR assay of the OsBIL7 gene and the hygromycin resistance gene in T0 generation plants, as well as plant shape, number of seeds, and seed weight. The evaluation test was conducted in two rounds (on a total of 6 lines consisting of 3 lines in first round and 3 lines in second round). Each one of the grains for each line was seeded into a polypot with a volume of 570 cc (a total of 25 grains per line were seeded in a total of 25 pots). After 17 to 18 days of seeding, portions of leaves were cut away, immersed in hygromycin solution, and examined for hygromycin resistance and sensitivity. Some plants inferior in early growth stage were eliminated, and 16 plants for each line were transplanted to polypots with a volume of 5100 cc and continued to be planted. The characters measured were days to silking, number of leaves, lengths of 9th to 13th leaves, and plant height. As for days to silking, the number of days from seeding to silking was counted, and as for plant height, the final plant height after 84 days of seeding was measured. For each line, comparison was made between hygromycin-resistant plants (i.e., plants regarded as harboring the OsBIL7 gene) and hygromycin-sensitive plants (i.e., plants regarded as deficient in the OsBIL7 gene). The results are shown in Table 12. As a result, no difference in days to silking and total number of leaves was observed between the resistant plants and the sensitive plants. However, the plant height and lengths of 9th to 13th leaves in the resistant plants increased relative to those in the sensitive plants (Table 12).

[0181] To sum up the above, it was found that overexpression of the OsBIL7 gene in the Z. mays inbred line A188 results in an increase in Z. mays upper-ground biomass.

TABLE-US-00017 TABLE 12 Total days to number of Leaf length (cm) Plant Number of silking leaves 9th 10th 11th 12th 13th height Line name Hygromycin plants (days) (leaves) leaf leaf leaf leaf leaf (cm) OsBIL7-01 Resistant 12 58.5 14.9 87.1 87.3 83.3 78.7 70.1 150.7 Sensitive 4 59.3 14.5 85.3 83.5 78.3 73.8 64.0 146.8 OsBIL7-02 Resistant 10 59.4 15.0 87.5 86.1 81.4 76.5 67.0 147.3 Sensitive 4 59.5 15.0 86.3 85.0 79.8 75.5 67.0 146.5 OsBIL7-03 Resistant 8 58.6 14.9 87.5 86.5 82.4 77.1 68.3 149.1 Sensitive 8 60.0 14.5 85.5 82.8 78.0 71.3 60.4 140.8 OsBIL7-04 Resistant 8 56.6 14.9 90.8 89.8 62.5 78.0 66.4 163.6 Sensitive 8 58.8 14.8 86.0 84.1 78.5 72.8 63.4 161.9 OsBIL7-05 Resistant 8 59.8 15.0 91.8 88.5 81.5 75.1 65.8 165.6 Sensitive 8 59.3 15.0 86.3 83.4 77.9 72.4 63.3 162.5 OsBIL7-06 Resistant 8 58.6 14.8 89.0 85.5 80.4 74.5 63.0 161.6 Sensitive 8 57.6 14.8 82.5 78.8 74.3 68.3 58.4 157.5

INDUSTRIAL APPLICABILITY

[0182] The present invention is useful in industrial fields which can utilize biomass, such as food, energy and environment fields. By using this invention, plant biomass can be effectively increased.