COMPOSITION AND KIT FOR DIFFERENTIATING CANCER ASSOCIATED FIBROBLASTS INTO MACROPHAGES, AND METHOD OF USING THE SAME

Abstract

Provided are a composition and a kit for reprogramming cancer associated fibroblasts (CAFs) into macrophages, and a method of using the same. According to a method of reprogramming CAFs according to an aspect, macrophages may be prepared with a high yield in a short period of time, and the tumor microenvironment may be suppressed and macrophages produced by reprogramming CAF may elimininate cancer cells. Therefore, the macrophages may be usefully applied as an anticancer agent or an anticancer adjuvant.

Claims

1. A method of differentiating CAFs (cancer-associated fibroblasts) into macrophages, the method comprising: enhancing expression of Oct4 and Sox2 in CAFs and culturing the CAFs in a medium to differentiate the CAFs into iPCs (induced pluripotent stem cells); culturing the iPCs in a medium to differentiate the iPCs into hematopoietic stem cells; and culturing the hematopoietic stem cells in a medium to differentiate the hematopoietic stem cells into macrophages.

2. The method of claim 1, wherein, in the differentiation into iPCs, expression of miR125b is further enhanced in the CAFs.

3. The method of claim 1, wherein, in the differentiation into iPCs, the CAFs are cultured in a medium comprising a serum replacement, -mercaptoethanol, basic fibroblast growth factor (bFGF), or a combination thereof.

4. The method of claim 1, wherein, in the differentiation into iPCs, the culturing is adherent-culturing.

5. The method of claim 1, wherein, in the differentiation into iPCs, the culturing is performed for 10 days to 20 days.

6. The method of claim 1, wherein, in the differentiation into hematopoietic stem cells, the iPCs are cultured in a medium comprising -mercaptoethanol, fetal calf serum (FCS), or a combination thereof.

7. The method of claim 1, wherein, in the differentiation into hematopoietic stem cells, the culturing is suspension culturing.

8. The method of claim 1, wherein, in the differentiation into hematopoietic stem cells, the culturing is performed for 10 days to 20 days.

9. The method of claim 1, wherein, in the differentiation into macrophages, the hematopoietic stem cells are cultured in a medium comprising IL-4, M-CFS, or a combination thereof.

10. The method of claim 1, wherein, in the differentiation into macrophages, the culturing is adherent-culturing.

11. The method of claim 1, wherein, in the differentiation into macrophages, the culturing is performed for 5 days to 10 days.

12. The method of claim 3, wherein a concentration of the serum replacement is 1% by weight to 20% by weight, a concentration of the 3-mercaptoethanol is 0.05 mM to 1.5 mM, and a concentration of the bFGF is 1 ng/ml to 20 ng/ml in the total medium.

13. The method of claim 6, wherein a concentration of the 3-mercaptoethanol is 0.05 mM to 1.5 mM, and a concentration of the FCS is 10% by weight to 30% by weight of the total medium.

14. The method of claim 9, wherein a concentration of the IL-4 is 1 g/ml to 20 g/ml, and a concentration of the M-CFS is 1 g/ml to 20 g/ml.

15. Macrophages prepared by the method of claim 1.

16. A pharmaceutical composition for preventing or treating cancer, the pharmaceutical composition comprising macrophages prepared by the method of claim 1.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0054] The above and other aspects, features, and advantages of certain embodiments of the disclosure will be more apparent from the following description taken in conjunction with the accompanying drawings, in which:

[0055] FIG. 1 shows a graph of expression levels of -SMA, FSP-1, VEGF, and MMP2, which are CAF markers, in cancer-associated fibroblasts, confirmed by qRT-PCR;

[0056] FIG. 2A shows results of observing iPCs under a fluorescence microscope, the iPCs obtained by transducing Oct4, Sox2, Oct4/Sox2, miR125b, or Sox2/miR125b into CAFs;

[0057] FIG. 2B shows results of observing iPCs under a fluorescence microscope, the iPCs obtained by transducing Oct4, Sox2, Oct4/Sox2, miR125b, or Sox2/miR125b into normal fibroblasts;

[0058] FIG. 3A shows qRT-PCR results of analyzing the expression of Oct4, Sox2, and Nanog, which are pluripotency markers, in iPCs, the iPCs being obtained by transducing Oct4, Sox2, Oct4/Sox2, miR125b, or Sox2/miR125b into CAFs;

[0059] FIG. 3B shows qRT-PCR results of analyzing the expression of Oct4, Sox2, and Nanog, which are pluripotency markers, in iPCs, the iPCs being obtained by transducing Oct4, Sox2, Oct4/Sox2, miR125b, or Sox2/miR125b into normal fibroblasts;

[0060] FIG. 4 shows results of analyzing whether iPCs obtained from CAFs by a method according to an aspect have EB-forming ability;

[0061] FIG. 5A shows flow cytometry results of analyzing the expression of CD34 which is a membrane protein of hematopoietic stem cells differentiated from iPCs which were obtained by transducing Oct4, Sox2, Oct4/Sox2, miR125b, or Sox2/miR125b into CAFs;

[0062] FIG. 5B shows flow cytometry results of analyzing the expression of CD34 which is a membrane protein of hematopoietic stem cells differentiated from iPCs which were obtained by transducing Oct4, Sox2, Oct4/Sox2, miR125b, or Sox2/miR125b into normal fibroblasts;

[0063] FIG. 6A shows qRT-PCR results of analyzing the expression of GATA2 and Brachy in hematopoietic stem cells differentiated from the iPCs which were obtained by transducing Oct4, Sox2, Oct4/Sox2, miR125b, or Sox2/miR125b into CAFs;

[0064] FIG. 6B shows qRT-PCR results of analyzing the expression of GATA2 and Brachy in hematopoietic stem cells differentiated from the induced pluripotent stem cells which were obtained by transducing Oct4, Sox2, Oct4/Sox2, miR125b, or Sox2/miR125b into normal fibroblasts;

[0065] FIG. 7A shows flow cytometry results of analyzing the expression of CD45 which is a cell membrane marker for blood cells/monocytes in hematopoietic stem cells which were obtained by transducing Oct4, Sox2, Oct4/Sox2, miR125b, or Sox2/miR125b into CAFs;

[0066] FIG. 7B shows flow cytometry results of analyzing the expression of CD45 which is a cell membrane marker for blood cells/monocytes in hematopoietic stem cells which were obtained by transducing Oct4, Sox2, Oct4/Sox2, miR125b, or Sox2/miR125b into normal fibroblasts;

[0067] FIG. 8A shows qRT-PCR results of analyzing the expression of C/EBP, PU.1, MXIL1, and GATA1 in macrophages which were obtained by transducing Oct4, Sox2, Oct4/Sox2, miR125b, or Sox2/miR125b into CAFs.

[0068] FIG. 8B shows qRT-PCR results of analyzing the expression of C/EBP, PU.1, MXIL1, and GATA1 in macrophages which were obtained by transducing Oct4, Sox2, Oct4/Sox2, miR125b, or Sox2/miR125b into normal fibroblasts;

[0069] FIG. 9A shows results of evaluating phagocytic function of macrophages which were obtained by transducing Oct4, Sox2, Oct4/Sox2, miR125b, or Sox2/miR125b into CAFs;

[0070] FIG. 9B shows results of evaluating phagocytic function of macrophages which were obtained by transducing Oct4, Sox2, Oct4/Sox2, miR125b, or Sox2/miR125b into normal fibroblasts; and

[0071] FIG. 10 is an illustration showing the preparation of macrophages from cancer-associated fibroblasts.

DETAILED DESCRIPTION

[0072] Reference will now be made in detail to embodiments, examples of which are illustrated in the accompanying drawings, wherein like reference numerals refer to like elements throughout. In this regard, the present embodiments may have different forms and should not be construed as being limited to the descriptions set forth herein. Accordingly, the embodiments are merely described below, by referring to the figures, to explain aspects of the present description. As used herein, the term and/or includes any and all combinations of one or more of the associated listed items. Expressions such as at least one of, when preceding a list of elements, modify the entire list of elements and do not modify the individual elements of the list.

EXAMPLE 1

[0073] Preparation of Macrophages from Cancer-Associated Fibroblasts

[0074] To prepare macrophages from CAFs, differentiation factors were first transduced into CAFs to prepare induced pluripotent stem cells, which were then differentiated into hematopoietic stem cells, and from the hematopoietic stem cells, macrophages were differentiated. An illustration showing the preparation of macrophages from CAFs is as shown in FIG. 10.

[0075] 1.1. Preparation of Cell Line and Vector

[0076] CAFs (CAF, Catalog # CAF05) derived from human colon cancer were purchased from Neuromics (USA). As a control group, MRC5 which is a normal lung fibroblast was purchased from ATCC (USA) and used.

[0077] The differentiation factors to be transduced into the fibroblasts were Oct4, Sox2, and/or miR125b, and lentiviral vectors (pLM-mCitrin-Sox2, pLM-vexGFP-Oct4, and pMG-MIR-125b-1) for their expression were purchased from Addgene, and LPP-mCherry-HmiR125b was prepared in Macrogen (Korea).

[0078] To characterize the used fibroblasts, expression patterns of -SMA, FSP-1, VEGF, and MMP2P which are reported as CAF markers were examined by qRT-PCR. RNAs in the cells were isolated using Trizol, and cDNA was synthesized using 1 g of RNA, and primers of Table 1 were used to perform qRT-PCR. The relative expression level of the CAF marker in the CAFs was shown by taking the amount of the CAF marker in the normal fibroblasts as 1.

TABLE-US-00001 TABLE1 Name of gene 5->3 sequence Note a-SMA Forward CACTGCCGCATCCTCATC SEQIDNO:1 Reverse TGCTGTTGTAGGTGGTTTCAT SEQIDNO:2 FSP1 Forward TGTCCTGCATCGCCATGATGT SEQIDNO:3 GTA Reverse TGAACTTGCTCAGCATCAAGCACG SEQIDNO:4 VEGF Forward AGGAGGAGGGCAGAATCATCA SEQIDNO:5 Reverse CTCGATTGGATGGCAGTAGCT SEQIDNO:6 MMP2 Forward GCGGCGGTCACAGCTACTT SEQIDNO:7 Reverse CACGCTCTTCAGACTTTGGTTCT SEQIDNO:8 OCT4 Forward CTGAAGCAGAAGAGGATCAC SEQIDNO:9 Reverse GACCACATCCTTCTCGAGCC SEQIDNO:10 SOX2 Forward AACGTTTGCCTTAAACAAGACCAC SEQIDNO:11 Reverse CGAGATAAACATGGCAATCAAATG SEQIDNO:12 NANOG Forward CGAAGAATAGCAATGGTGTGACG SEQIDNO:13 Reverse TTCCAAAGCAGCCTCCAAGTC SEQIDNO:14 GATA2 Forward GGGCTAGGGAACAGATCGACG SEQIDNO:15 Reverse GCAGCAGTCAGGTGCGGAGG SEQIDNO:16 Brachy Forward ATGAGCCTCGAATCCACATAGT SEQIDNO:17 Reverse TCCTCGTTCTGATAAGCAGTCA SEQIDNO:18 C/EBPa Forward CTAGAGATCTGGCTGTGGGG SEQIDNO:19 Reverse TCATAACTCCGGTCCCTCTG SEQIDNO:20 PU.1 Forward ACGGATCTATACCAACGCCA SEQIDNO:21 Reverse GGGGTGGAAGTCCCAGTAAT SEQIDNO:22 MIXL1 Forward AGTTGGACTGCCTTGGTCACTT SEQIDNO:23 Reverse ACAAACCTCCGCCTTTCCTCTA SEQIDNO:24 CA GATA1 Forward GGGATCACACTGAGCTTGC SEQIDNO:25 Reverse ACCCCTGATTCTGGTGTGG SEQIDNO:26 GAPDH Forward GAAAYCCCATCACCAATCTTCC SEQIDNO:27 AGG Reverse GCAATTGAGCCCCAGCCTTCTC SEQIDNO:28

[0079] FIG. 1 shows a graph of expression levels of -SMA, FSP-1, VEGF, and MMP2, which are CAF markers, in CAFs, confirmed by qRT-PCR.

[0080] As shown in FIG. 1 CAF markers were overexpressed in the used CAFs, as compared with normal fibroblasts.

[0081] 1.2. Preparation of iPCs from CAFs

[0082] Lentiviral vectors for expression of Oct4, Sox2, and miR125b genes were transduced into CAFs to prepare iPCs, respectively. Specifically, packaging DNA (TAKARA) used for formation of viral particles, and each viral vector of pLM-mCitrin-Sox2, pLM-vexGFP-Oct4, and LPP-mCherry-HmiR125b were combined at a ratio of 3:1, and then transduced into a host cell HEK293T, respectively. 48 hours after transduction, each medium of the host cell including the virus was filtered using a filter with a size of 0.45 pm to remove cell debris, thereby obtaining viruses.

[0083] CAFs and normal fibroblasts were cultured in a 6-well plate, respectively. When their growth reached 90% or more, polybrene was used to induce infection of CAFs and normal fibroblasts with the lentiviruses obtained above, respectively. Each cell was infected with the lentivirus twice, and adherent-cultured for about 14 days while replacing media every about 48 hours. The CAFs and fibroblasts were induced into iPCs by acquiring pluripotency. At this time, adherent-culture was performed using a plate coated with a protein geltrex.

[0084] The gene combinations transduced into the CAFs and fibroblasts via the lentivirus are as follows. [0085] Oct4 [0086] Sox2 [0087] Oct4/Sox2 [0088] miR125b [0089] Sox2/miR125b

[0090] A composition of the used medium is as follows:

[0091] DMEM/F12+10% knockout serum replacement(KSR) +1% NEAA +1 mM L-glutamine +1% penicillin streptomycin (P/S) +0.1 mM -mercaptoethanol +10 ng/ml basic fibroblast growth factor (bFGF) +30 ng/ml insulin-like growth factor 2 (IGFII)

[0092] 1.3. Differentiation of Hematopoietic Stem Cells from iPCs

[0093] To prepare hematopoietic stem cells from the obtained iPCs, when colonies were observed by the culturing, the adherent cell culturing was changed to suspension cell culturing in a poly-hema-coated plate. When the culturing method is changed to the suspension cell culturing, cells may grow while forming a spheroid. The cells were continuously cultured for about 14 days while replacing the medium every about 48 hours. In detail, differentiation of hematopoietic stem cells was induced by adding the medium for the first about 7 days and changing the medium every other day for the remaining period. A composition of the used medium is as follows:

[0094] KnockOut DMEM (KO-DMEM) +20% fetal calf serum (FCS) +1% penicillin streptomycin (P/S) +1% NEAA +1 mM L-glutamine +0.1 mM -mercaptoethanol

[0095] 1.4. Differentiation of Macrophages from Hematopoietic Stem Cells

[0096] To induce differentiation of macrophages from the differentiated hematopoietic stem cells, spherical hematopoietic stem cells obtained by the culturing were separated into single cells using accutase, followed by adherent-cell culture. To induce differentiation into macrophages, the cells were cultured for about 1 week while replacing the medium every other day. A composition of the used medium is as follows:

[0097] RPM11640 +10% FBS +1% (P/S) +10 g/ml IL-4 +10 g/ml M-CSF

EXPERIMENTAL EXAMPLE 1

[0098] Identification of iPCs Prepared from CAFs

[0099] To examine cell morphology and protein changes by gene transduction in the iPCs obtained in Example 1.2, fluorescence microscopy was utilized. In detail, the expression level of Sox2, Oct4, and miR125b were detected using mCitrin fluorescent protein, GFP fluorescent protein, and mCherry fluorescent protein, which are attached to Sox2, Oct4 and miR125b, respectively. To observe cell morphology, cells were imaged using a Nikon Eclipse Ts2P fluorescence microscope. GFP fluorescence was detected using a 39002 filter set (Chroma) after excitation at a wavelength of 470 nm, and mCitrin and mCherry were detected using a 39004 filter set (Chroma) after excitation at a wavelength of 525 nm.

[0100] FIG. 2A shows results of observing iPCs under a fluorescence microscope, the iPCs obtained by transducing Oct4, Sox2, Oct4/Sox2, miR125b, or Sox2/miR125b into CAFs.

[0101] FIG. 2B shows results of observing iPCs under a fluorescence microscope, the iPCs obtained by transducing Oct4, Sox2, Oct4/Sox2, miR125b, or Sox2/miR125b into normal fibroblasts.

[0102] As shown in FIGS. 2A and 2B, the iPCs prepared by overexpression of Oct4, Sox2 and/or miR125b transduced into CAFs and normal fibroblasts were able to form stem cell colonies having the same morphology as embryonic stem cells. Further, the expression of fluorescent proteins according to the each transduced gene was observed.

[0103] Therefore, we could confirm that Oct4, Sox2 and/or miR125b transduced into CAFs and normal fibroblasts were overexpressed, and as a result, the prepared cells could form stem cell colonies, indicating successful differentiation into iPCs.

[0104] Further, to examine whether expression of Oct4, Sox2, and Nanog which are pluripotency markers was increased by single or combined introduction of Oct4, Sox2, and/or miR125b, qRT-PCR was performed.

[0105] FIG. 3A shows qRT-PCR results of analyzing the expression of Oct4, Sox2, and Nanog, which are pluripotency markers, in iPCs, the iPCs being obtained by transducing Oct4, Sox2, Oct4/Sox2, miR125b, or Sox2/miR125b into CAFs.

[0106] FIG. 3B shows qRT-PCR results of analyzing the expression of Oct4, Sox2, and Nanog, which are pluripotency markers, in iPCs, the iPCs being obtained by transducing Oct4, Sox2, Oct4/Sox2, miR125b, or Sox2/miR125b into normal fibroblasts.

[0107] As shown in FIGS. 3A and 3B, when Oct4 or both Oct4 and Sox2 was/were overexpressed in CAFs, Oct4, Sox2, and Nanog showed similar expression levels with each other. In contrast, even though only Oct4 was overexpressed in normal fibroblasts, the degree of Sox2 expression level was high enough to the case when Sox2 was overexpressed. These results support the previous experimental results reporting that only Oct 4 expression is sufficient to differentiate normal fibroblasts into hematopoietic stem cells. Meanwhile, when Sox2, miR125b, or Sox2/miR125b was overexpressed in CAFs, Oct4, Sox2, and Nanog showed similar expression levels with each other. In normal fibroblasts, all the three genes also showed similar results. Further, when miR125b was overexpressed in CAFs, Nanog showed a relatively high expression.

[0108] Therefore, it was confirmed that both CAF and normal fibroblast could be successfully differentiated into the iPCs by the method stated above, and when the iPCs were differentiated from CAFs and normal fibroblasts even by the same differentiation method, they showed different cell characteristics from each other.

EXPERIMENTAL EXAMPLE 2

[0109] Identification of Hematopoietic Stem Cells

[0110] To examine whether the hematopoietic stem cells obtained in Example 1.3 had differentiation ability, embryonic body (EB) formation which is a characteristic of stem cells was examined. In detail, colonies formed by gene transduction were separated into single cells, and then cultured in a poly-hema-coated plate, followed by observation under a microscope daily.

[0111] Cells acquiring stem cell characteristics show three-dimensional spherical cell growth in a non-adherent state, whereas cells having no stem cell characteristics do not show three-dimensional spherical cell growth.

[0112] FIG. 4 shows results of analyzing whether iPCs obtained by transduction of Oct4, Sox2, Oct4/Sox2, miR125b, or Sox2/miR125b into CAFs have EB-forming ability.

[0113] As shown in FIG. 4, when Oct4, Sox2, Oct4/Sox2, miR125b, or Sox2/miR125b was transduced, all the iPCs obtained thereby showed three-dimensional spherical cell growth in a non-adherent state, indicating that they had EB-forming ability. Further, differentiation of hematopoietic stem cells from EB of the iPCs prepared by the method was induced.

[0114] As a result, it was confirmed that iPCs prepared by the method had pluripotent stem cell characteristics.

[0115] Further, to examine differentiation ability of the iPCs into hematopoietic stem cells and blood cells, flow cytometry was performed to examine expression of CD34 protein which is a hematopoietic stem cell membrane marker. First, cells were separated into single cells by treatment with Accutase (gibco), and then washed and blocked with a 1% FBS/PBS solution. Then, APC-conjugated antibody was incubated for CD34 detection. To examine expression of CD34 protein, APC Mouse Anti-Human CD34 available from BD was used, and as a control group, APC Mouse IgG1-Isotype was used to perform flow cytometry. Data were analyzed using a Flowjo program.

[0116] FIG. 5A shows flow cytometry results of analyzing the expression of CD34 which is a membrane protein of hematopoietic stem cells differentiated from iPCs which were obtained by transducing Oct4, Sox2, Oct4/Sox2, miR125b, or Sox2/miR125b into CAFs.

[0117] FIG. 5B shows flow cytometry results of analyzing the expression of CD34 which is a membrane protein of hematopoietic stem cells differentiated from iPCs which were obtained by transducing Oct4, Sox2, Oct4/Sox2, miR125b, or Sox2/miR125b into normal fibroblasts.

[0118] As shown in FIGS. 5A and 5B, when hematopoietic stem cells derived from CAFs were treated with Oct4 and Sox2 at the same time (Oct4/Sox2), the highest CD34 expression was observed. When normal fibroblasts were treated with Sox2 or miR125b alone, or both Oct4 and Sox2, all showed the similar results.

[0119] Further, to examine whether the cells had ability to differentiate into a mesoderm, expression of GATA2 and Brachy which are mesodermal lineage markers was examined by qRT-PCR.

[0120] FIG. 6A shows qRT-PCR results of analyzing the expression of GATA2 and Brachy in hematopoietic stem cells differentiated from the iPCs which were obtained by transducing Oct4, Sox2, Oct4/Sox2, miR125b, or Sox2/miR125b into CAFs.

[0121] FIG. 6B shows qRT-PCR results of analyzing the expression of GATA2 and Brachy in hematopoietic stem cells differentiated from the iPCs which were obtained by transducing Oct4, Sox2, Oct4/Sox2, miR125b, or Sox2/miR125b into normal fibroblasts.

[0122] As shown in FIGS. 6A and 6B, the hematopoietic stem cells differentiated from CAFs showed a significant increase of Brachy (T) in the presence of miR125b, whereas the hematopoietic stem cells differentiated from normal fibroblasts showed no significant change.

EXPERIMENTAL EXAMPLE 3

[0123] Identification of Macrophages

[0124] Further, to examine whether the obtained hematopoietic stem cells had ability to differentiate into macrophages by Example 1.4, the formed EB was separated into single cells, which were then cultured. After culturing with a macrophage colony-stimulating factor (M-CSF) and cytokines for 7 days, expression of CD45 which is a cell membrane marker for blood cells/monocytes was analyzed by flow cytometry using an antigen-antibody reaction.

[0125] FIG. 7A shows flow cytometry results of analyzing the expression of CD45 which is a membrane protein in blood cells/monocytes which were obtained by transducing Oct4, Sox2, Oct4/Sox2, miR125b, or Sox2/miR125b into CAFs.

[0126] FIG. 7B shows flow cytometry results of analyzing the expression of CD45 which is a membrane protein in blood cells/monocytes which were obtained by transducing Oct4, Sox2, Oct4/Sox2, miR125b, or Sox2/miR125b into normal fibroblasts.

[0127] As shown in FIGS. 7A and 7B, when the blood cells/monocytes cells derived from CAFs were treated with Oct4 and Sox2 at the same time, the highest CD45 expression was observed.

[0128] Further, to examine whether the obtained blood cells/monocytes cells had ability to differentiate into macrophages, changes in C/EBP, PU.1, MXIL1 and GATA1 expression in the blood cells/monocytes cells were examined by qRT-PCR. It is known that C/EBP is a critical factor for differentiation/development of blood cells, and PU.1 is an inducer of differentiation/development of monocyte/macrophage. Further, MXIL1 and GATA1 are factors that contribute to differentiation of mesodermal lineages and blood cells/monocytes. These genes are reported to play a role in differentiating cells from hematopoietic stem cells/stem-cells to determine characteristics of blood cells and to develop their function.

[0129] FIG. 8A shows qRT-PCR results of analyzing the expression of C/EBP, PU.1, MXIL1, and GATA1 in macrophageswhich were obtained by transducing Oct4, Sox2, Oct4/Sox2, miR125b, or Sox2/miR125b into CAFs.

[0130] FIG. 8B shows qRT-PCR results of analyzing the expression of C/EBP, PU.1, MXIL1, and GATA1 in macrophageswhich were obtained by transducing Oct4, Sox2, Oct4/Sox2, miR125b, or Sox2/miR125b into normal fibroblasts.

[0131] As shown in FIGS. 8A and 8B, expression of C/EBP which is a critical factor for differentiation/development of macrophages was greatly increased, and expression of PU.1 which is an inducer of differentiation/development of monocytes was also increased, after differentiation of macrophages. Further, expression of MXIL1 and GATA1 which contribute to differentiation of mesodermal lineages and monocytes was increased, when simultaneous expression of Oct4 and Sox2 was induced, as compared with single introduction of Oct4 or Sox2. The macrophages derived from normal fibroblasts showed increased CD45 expression, when Sox2 or miR125b was treated alone or co-treated with Oct4, rather than Oct4 alone. C/EBP expression was increased by Sox2 introduction, and the highest expression thereof was observed when induced together with Oct4. Further, expression of PU.1 and MXIL1 which contribute to differentiation/development of monocytes was increased in the macrophages derived from normal fibroblasts by Sox2 introduction.

EXPERIMENTAL EXAMPLE 4

[0132] Evaluation of Functionality of Macrophage

[0133] To examine whether the macrophages obtained in Example 1.4 had functionality, their phagocytic function was evaluated. In detail, 1 m-sized latex beads were used. Differentiation of macrophages from hematopoietic stem cells was induced for 1 week, and then 1 m-sized latex beads (sigma) stabilized in a cell culture medium were added to cells, and allowed to react for 90 minutes. The cells were washed with cold phosphate-buffered saline (PBS), and then fixed in a 4% paraformaldehyde solution. Cell morphology and phagocytosis were observed under a microscope.

[0134] FIG. 9A shows results of evaluating phagocytic function of macrophages which were obtained by transducing Oct4, Sox2, Oct4/Sox2, miR125b, or Sox2/miR125b into CAFs.

[0135] FIG. 9B shows results of evaluating phagocytic function of macrophages which were obtained by transducing Oct4, Sox2, Oct4/Sox2, miR125b, or Sox2/miR125b into normal fibroblasts.

[0136] As shown in FIGS. 9A and 9B, when the macrophages derived from CAFs or normal fibroblasts were co-cultured with latex beads, intracellular uptake of the latex beads was observed. Further, the cell morphology changed similarly to that of macrophage.

[0137] Therefore, it was confirmed that the macrophages derived from CAFs or normal fibroblasts by the method according to an aspect were functional macrophages having the phagocytic function.

[0138] According to a method of reprogramming CAFs according to an aspect, macrophages may be prepared with a high yield in a short period of time, and the tumor microenvironment may be suppressed and macrophages reprogrammed from CAFs may be capable of eliminating cancer cells. Therefore, the macrophages may be usefully applied as an anticancer agent or an anticancer adjuvant.

[0139] It should be understood that embodiments described herein should be considered in a descriptive sense only and not for purposes of limitation. Descriptions of features or aspects within each embodiment should typically be considered as available for other similar features or aspects in other embodiments. While one or more embodiments have been described with reference to the figures, it will be understood by those of ordinary skill in the art that various changes in form and details may be made therein without departing from the spirit and scope of the disclosure as defined by the following claims.