Multi-step synthesis of templated molecules

Abstract

Disclosed is a method for the manufacture of a library of complexes. The complexes comprise templated molecules attached to the template which directed the synthesis thereof. The templated molecules are produced in a step-by-step fashion which provides for a high local concentration of reactive groups involved in the formation of connections between the individual components of the template molecule.

Claims

1. A library comprising different complexes, said complexes comprising a first entity and a second entity, wherein the first entity comprises a double stranded oligonucleotide identifier comprising single oligonucleotide strands covalently linked by a first linker, each single strand containing from 12 to 400 nucleic acid monomers, wherein at least one nucleic acid monomer of each single strand is a deoxyribonucleotide, wherein the second entity comprises a small non-peptide molecule and a second linker, the second linker being distinct from the first linker and covalently linking the first entity to the small-non-peptide molecule of the second entity, wherein the small non-peptide molecule of the second entity can be identified by each and both strands of the double stranded oligonucleotide identifier of the first entity, and wherein the small non-peptide molecule is covalently linked to the double stranded identifier oligonucleotide via an anchorage point located at a terminal region of one of the single strands.

2. The library according to claim 1, wherein the small non-peptide molecule of the complexes of the library is selected from the group consisting of monofunctional, difunctional,trifunctional and oligofunctional open-chain hydrocarbons; monofunctional, difunctional,trifunctional and oligofunctional non-aromatic carbocycles; monocyclic, bicyclic, tricyclic and polycyclic hydrocarbons; bridged polycyclic hydrocarbons; monofunctional, difunctional, trifunctional, and oligofunctional non-aromatic heterocycles; monocyclic, bicyclic, tricyclic, and polycyclic heterocycles, bridged polycyclic heterocycles; monofunctional, difunctional,trifunctional and oligofunctional aromatic carbocycles; monocyclic, bicyclic, tricyclic, and polycyclic aromatic carbocycles; and monofunctional, difunctional,trifunctional and oligofunctional aromatic heterocycles.

3. The library of claim 1, wherein the number of complexes is from 2 to 10.sup.18.

4. The library of claim 1, wherein the individual nucleic acid monomers of the covalently linked oligonucleotide identifier comprise a nucleobase moiety and a sugar moiety and an internucleoside linker.

5. The library of claim 4, wherein the nucleobase moiety of the nucleic acid monomers is a natural nucleobase moiety.

6. The library of claim 5, wherein the nucleobase moieties are selected from the group consisting of deoxyadenosine, deoxyguanosine, deoxythymidine, deoxycytidine, adenosine, guanosine, uridine, cytidine and inosine.

7. The library of claim 4, wherein the sugar moiety of the nucleic acid monomers is a pentose.

8. The library of claim 7, wherein the pentose is selected from the group consisting of ribose, 2-deoxyribose, 2-O-methyl-ribose, 2-flouro-ribose, and 2-4-O-methylene-ribose.

9. The library of claim 1, wherein the internucleoside linker linking the individual nucleic acid monomers is a phosphodiester linker.

10. The library according to claim 1, wherein the first and/or second linker is selected from the group consisting of carbohydrides, substituted carbohydrides, vinyl, polyvinyl, substituted polyvinyl, acetylene, polyacetylene, aryl /hetaryl, polyaryl/hetaryl and substituted polyaryl/polyhetaryl, ethers, polyethers, amines, polyamines, substituted polyamines; double stranded, single stranded or partially double stranded natural and unnatural polynucleotides, substituted double stranded, single stranded or partially double stranded natural and unnatural polynucleotides, polyamides, natural and un-natural polypeptides, substituted polyamides, and substituted natural and unnatural polypeptides.

11. The library according to claim 1, wherein said first and/or second linker comprises a polynucleotide linker.

12. The library according to claim 1, wherein said first and/or second linker comprises a polyether linker.

13. The library according to claim 12 wherein said first and/or second linker comprises a polyethyleneglycol linker.

14. The library according to claim 12 wherein said first and/or second linker comprises a substituted polyether linker.

15. The library of claim 4, wherein the nucleobase moiety of the nucleic acid monomers is selected from the group consisting of adenine, guanine, thymine, cytosine, uracil, purine, xanthine, diaminopurine, 8-oxo-N.sup.6-methyladenine, 7-deazaxanthine, 7-deazaguanine, N.sup.4,N.sup.4-ethanocytosin, N.sup.6,N.sup.6-ethano-2,6-diamino-purine, 5-methylcytosine, 5-(C.sub.3-C.sub.6)-alkynylcytosine, 5-fluorouracil, 5- bromouracil, pseudo-isocytosine, 2-hydroxy-5-methyl-4-triazolopyridine, isocytosine, isoguanine, and inosine.

16. The library of claim 1, wherein the first linker of the double stranded identifier oligonucleotide comprises a hair-pin loop of nucleotides covalently linking the two strands of the double stranded identifier oligonucleotide at one end of the strands.

17. The library of claim 1, wherein the small non-peptide molecule is covalently linked to the double stranded identifier oligonucleotide via an anchorage point located at a first terminal region of one of the single strands, and wherein the first linker comprises a hair-pin loop of nucleotides covalently linking the two strands of the double stranded identifier oligonucleotide at a different, second terminal region of the single strands.

18. A method for the enrichment of the library according to claim 1 for small non-peptide molecules having a predetermined activity or functionality, said method comprising the steps of: (i) subjecting said library one or more times to an enrichment condition, and (ii) obtaining an enriched library having a higher relative amount of small non-peptide molecules having said predetermined activity or functionality.

19. The method of claim 18, wherein the oligonucleotide identifiers of the enriched complexes are amplified.

20. The method of claim 18, wherein the small non-peptide molecules of the enriched library are identified by sequencing the oligonucleotide identifier.

21. The method of claim 18, wherein the enrichment condition is an affinity of the small non-peptide molecules of the library of claim 1 for a target molecule or target entity.

22. The library according to claim 11, wherein each of the first and the second linker comprises a polynucleotide linker.

23. The library according to claim 12, wherein each of the first and the second linker comprises a polyether linker.

24. The library according to claim 13, wherein each of the first and the second linker comprises a polyethyleneglycol linker.

25. A library comprising different complexes, wherein each complex comprises i) a first entity comprising a double stranded oligonucleotide identifier comprising single oligonucleotide strands covalently linked by a first linker, ii) a second entity comprising a small non-peptide molecule, and iii) a second linker covalently linking the first entity to the small non-peptide molecule of the second entity, wherein the small non-peptide molecule of the second entity can be identified by each and both of the single strands of the double stranded oligonucleotide identifier of the first entity, wherein the small non-peptide molecule is covalently linked to the double stranded identifier oligonucleotide via an anchorage point located at a terminal region of one of the single strands.

26. The library according to claim 25, wherein the small non-peptide molecule of the complexes of the library is selected from the group consisting of monofunctional, difunctional, trifunctional and oligofunctional open-chain hydrocarbons; monofunctional, difunctional, trifunctional and oligofunctional non-aromatic carbocycles; monocyclic, bicyclic, tricyclic and polycyclic hydrocarbons; bridged polycyclic hydrocarbons; monofunctional, difunctional, trifunctional, and oligofunctional non-aromatic heterocycles; monocyclic, bicyclic, tricyclic, and polycyclic heterocycles, bridged polycyclic heterocycles; monofunctional, difunctional, trifunctional and oligofunctional aromatic carbocycles; monocyclic, bicyclic, tricyclic, and polycyclic aromatic carbocycles; and monofunctional, difunctional, trifunctional and oligofunctional aromatic heterocycles.

27. The library of claim 25, wherein the number of complexes is from 2 to 10.sup.18.

28. The library of claim 25, wherein the individual nucleic acid monomers of the covalently linked oligonucleotide identifier comprise a nucleobase moiety and a sugar moiety and an internucleoside linker.

29. The library according to claim 25, wherein the first and/or second linker is selected from the group consisting of carbohydrides, substituted carbohydrides, vinyl, polyvinyl, substituted polyvinyl, acetylene, polyacetylene, aryl /hetaryl, polyaryl/hetaryl and substituted polyaryl/polyhetaryl, ethers, polyethers, amines, polyamines, substituted polyamines; double stranded, single stranded or partially double stranded natural and unnatural polynucleotides, substituted double stranded, single stranded or partially double stranded natural and unnatural polynucleotides, polyamides, natural and un-natural polypeptides, substituted polyamides, and substituted natural and unnatural polypeptides.

30. The library according to claim 25, wherein said first and/or second linker comprises a polynucleotide linker.

31. The library according to claim 25, wherein said first and/or second linker comprises a polyether linker.

32. The library according to claim 25 wherein said first and/or second linker comprises a polyethyleneglycol linker.

33. The library according to claim 25 wherein said first and/or second linker comprises a substituted polyether linker.

34. The library according to claim 30, wherein each of the first and the second linker comprises a polynucleotide linker.

35. The library according to claim 31, wherein each of the first and the second linker comprises a polyether linker.

36. The library according to claim 32 wherein each of the first and the second linker comprises a polyethyleneglycol linker.

37. The library of claim 25, wherein the first linker of the double stranded identifier oligonucleotide comprises a hair-pin loop of nucleotides covalently linking the two strands of the double stranded identifier oligonucleotide at one end of the strands.

38. The library of claim 25, wherein the small non-peptide molecule is covalently linked to the double stranded identifier oligonucleotide via an anchorage point located at a first terminal region of one of the single strands, and wherein the first linker comprises a hair-pin loop of nucleotides covalently linking the two strands of the double stranded identifier oligonucleotide at a different, second terminal region of the single strands.

39. A method for the enrichment of the library according to claim 25 for small non-peptide molecules having a predetermined activity or functionality, said method comprising the steps of: (i) subjecting said library one or more times to an enrichment condition, and (ii) obtaining an enriched library having a higher relative amount of small non-peptide molecules having said predetermined activity or functionality.

40. The method of claim 39, wherein the oligonucleotide identifiers of the enriched complexes are amplified.

41. The method of claim 39, wherein the small non-peptide molecules of the enriched library are identified by sequencing the oligonucleotide identifier.

42. The method of claim 39, wherein the enrichment condition is an affinity of the small non-peptide molecules of the library of claim 25 for a target molecule or target entity.

43. The library according to claim 1, wherein each nucleic acid monomer present in the oligonucleotide identifier comprises a naturally occurring nucleobase and a backbone moiety.

44. The library according to claim 1, wherein the nucleobases of the nucleic acid monomers of the oligonucleotide identifier are selected from the groupd consisting of naturally occurring nucleobases and non-naturally occurring nucleobases, wherein the nucleobases are connected by backbone moieties comprising a pentose sugar moiety and an internucleoside linker.

45. The library according to claim 44, wherein the nucleobases of the nucleic acid monomers of the identifier are selected from the group consisting of purine and pyrimidine hetero-cycles, including heterocyclic analogues and tautomers thereof.

46. The library according to claim 45, wherein the nucleobases of the nucleic acid monomers are selected from the group consisting of adenine, 8-oxo-N.sup.6-methyladenine; guanine, isoguanine, 7-deazaguanine; cytosine, isocytosine, pseudoisocytosine, N.sup.4,N.sup.4-ethanocytosine, 5-methylcytosine, 5-(C.sup.3-C.sup.6)-alkynylcytosine; thymine; uracil, 5-bromouracil, 5-fluorouracil; inosine; purine, diaminopurine, N.sup.6,N.sup.6-ethano-2,6-diamino-purine; xanthine, 7-deazaxanthine; pyrimidine and 2-hydroxy-5-methyl-4-triazolopyridine; including heterocyclic analogues and tautomers thereof.

47. The library according to claim 44, wherein each backbone moiety is independently selected from the group consisting of ##STR00001## ##STR00002## wherein B denotes a nucleobase.

48. The library according to claim 1, wherein each nucleic acid monomer present in the oligonucleotide identifier is composed of a nucleobase and a backbone moiety, wherein each nucleobase is selected from the group consisting of naturally occurring nucleobases and non-naturally occurring nucleobases, and wherein each backbone moiety comprises a pentose sugar moiety and an internucleoside linker.

49. The library according to claim 48, wherein the pentose sugar moiety is selected from the group consisting of ribose, 2-deoxyribose, 2-O-methyl-ribose, 2-flouro-ribose, and 2-4-O-methylene-ribose (LNA), and wherein each nucleobase is attached to the 1 position of each pentose sugar moiety.

50. The library according to claim 48, wherein each internucleoside linker is connecting the 3 end of a preceding pentose monomer to a 5 end of a succeeding pentose monomer in the identifier oligonucleotide.

51. The library according to claim 50, wherein each internucleoside linker is independently selected from the group of consisting of a phosphodiester linker, a phosphorothioate linker, a methylphosphonate linker, a phosphoramidate linker, a phosphotriester linker, a phosphodithioate linker, and a non-phosphorous-containing linker.

52. The library according to claim 1, wherein the olgionucleotide identifier comprises nucleic acid monomers selected from the group consisting of nucleosides consisting of deoxyadenosine, deoxyguanosine, deoxythymidine, and deoxycytidine, wherein said nucleosides are connected through phosphodiester linkages.

53. The library according to claim 1, wherein the oligonucleotide identifier comprises nucleic acid monomers selected from the group consisting of nucleosides consisting of adenosine, guanosine, uridine, cytidine, and inosine, wherein said nucleosides are connected through phosphodiester linkages.

54. The library according to claim 1, wherein the oligonucleotide identifier comprises nucleic acid monomers selected from a first group consisting of nucleosides consisting of deoxyadenosine, deoxyguanosine, deoxythymidine, and deoxycytidine, as well as nucleosides selected from a second group consisting of nucleosides consisting of adenosine, guanosine, uridine, cytidine, and inosine, wherein said nucleosides are connected through phosphodiester linkages.

55. The library according to claim 1, wherein the second linker is a polyethylene glycol (PEG) linker.

56. The library according to claim 55, wherein the small non-peptide small non-peptide molecules of the library are selected from the group consisting of monofunctional, difunctional, trifunctional and oligofunctional, open-chain hydrocarbons, monocyclic, bicyclic, tricyclic and polycyclic hydrocarbons, bridged polycyclic hydrocarbons; monofunctional, difunctional trifunctional and oligofunctional, non-aromatic carbocycles, monofunctional, difunctional, trifunctional and oligofunctional, aromatic carbocycles, monocyclic, bicyclic, tricyclic and polycyclic, aromatic carbocycles; monofunctional, difunctional, trifunctional and oligofunctional, non-aromatic heterocycles, monofunctional, difunctional, trifunctional and oligofunctional, aromatic heterocycles monocyclic, bicyclic, tricyclic and polycyclic heterocycles, and bridged polycyclic heterocycles.

57. The library according to claim 25, wherein each nucleic acid monomer present in the oligonucleotide identifier comprises a naturally occurring nucleobase and a backbone moiety.

58. The library according to claim 25, wherein the nucleobases of the nucleic acid monomers of the oligonucleotide identifier are selected from the group consisting of naturally occurring nucleobases and non-naturally occurring nucleobases, wherein the nucleobases are connected by backbone moieties comprising a pentose sugar moiety and an internucleoside linker.

59. The library according to claim 58, wherein the nucleobases of the nucleic acid monomers of the oligonucleotide identifier are selected from the group consisting of purine and pyrimidine hetero-cycles, including heterocyclic analogues and tautomers thereof.

60. The library according to claim 59, wherein the nucleobases of the nucleic acid monomers are selected from the group consisting of adenine, 8-oxo-N.sup.6-methyladenine; guanine, isoguanine, 7-deazaguanine; cytosine, isocytosine, pseudoisocytosine, N.sup.4,N.sup.4-ethanocytosine, 5-methylcytosine, 5-(C.sup.3-C.sup.6)-alkynylcytosine; thymine; uracil, 5-bromouracil, 5-fluorouracil; inosine; purine, diaminopurine, N.sup.6,N.sup.6-ethano-2,6-diamino-purine; xanthine, 7-deazaxanthine; pyrimidine and 2-hydroxy-5-methyl-4-triazolopyridine; including heterocyclic analogues and tautomers thereof.

61. The library according to claim 58, wherein each backbone moiety is independently selected from the group consisting of ##STR00003## ##STR00004## wherein B denotes a nucleobase.

62. The library according to claim 25, wherein each nucleic acid monomer present in the oligonucleotide identifier is composed of a nucleobase and a backbone moiety, wherein each nucleobase is selected from the group consisting of naturally occurring nucleobases and non-naturally occurring nucleobases, and wherein each backbone moiety comprises a pentose sugar moiety and an internucleoside linker.

63. The library according to claim 62, wherein the pentose sugar moiety is selected from the group consisting of ribose, 2-deoxyribose, 2-O-methyl-ribose, 2-flouro-ribose, and 2-4-O-methylene-ribose (LNA), and wherein each nucleobase is attached to the 1 position of each pentose sugar moiety.

64. The library according to claim 62, wherein each internucleoside linker is connecting the 3 end of a preceding pentose monomer to a 5 end of a succeeding pentose monomer in the identifier oligonucleotide.

65. The library according to claim 64, wherein each internucleoside linker is independently selected from the group of consisting of a phosphodiester linker, a phosphorothioate linker, a methylphosphonate linker, a phosphoramidate linker, a phosphotriester linker, a phosphodithioate linker, and a non-phosphorous-containing linker.

66. The library according to claim 25, wherein the oligonucleotide identifier comprises nucleic acid monomers selected from the group consisting of nucleosides consisting of deoxyadenosine, deoxyguanosine, deoxythymidine, and deoxycytidine, wherein said nucleosides are connected through phosphodiester linkages.

67. The library according to claim 25, wherein the oligonucleotide identifier comprises nucleic acid monomers selected from the group consisting of nucleosides consisting of adenosine, guanosine, uridine, cytidine, and inosine, wherein said nucleosides are connected through phosphodiester linkages.

68. The library according to claim 25, wherein the oligonucleotide identifier comprises nucleic acid monomers selected from a first group consisting of nucleosides consisting of deoxyadenosine, deoxyguanosine, deoxythymidine, and deoxycytidine, as well as nucleosides selected from a second group of nucleosides consisting of adenosine, guanosine, uridine, cytidine, and inosine, wherein said nucleosides are connected through phosphodiester linkages.

69. The library according to claim 25, wherein the second linker is a polyethylene glycol (PEG) linker.

70. The library according to claim 69, wherein the small non-peptide molecules of the library are selected from the group consisting of monofunctional, difunctional, trifunctional and oligofunctional, open-chain hydrocarbons, monocyclic, bicyclic, tricyclic and polycyclic hydrocarbons, bridged polycyclic hydrocarbons; monofunctional, difunctional trifunctional and oligofunctional, non-aromatic carbocycles, monofunctional, difunctional, trifunctional and oligofunctional, aromatic carbocycles, monocyclic, bicyclic, tricyclic and polycyclic, aromatic carbocycles; monofunctional, difunctional, trifunctional and oligofunctional, non-aromatic heterocycles, monofunctional, difunctional, trifunctional and oligofunctional, aromatic heterocycles monocyclic, bicyclic, tricyclic and polycyclic heterocycles, and bridged polycyclic heterocycles.

71. A library comprising different complexes, wherein each complex comprises i) a first entity comprising a double stranded oligonucleotide identifier comprising single oligonucleotide strands covalently linked by a first linker, wherein the first linker links oligonucleotide strand 3 and 5 ends, ii) a second entity comprising a small non-peptide molecule, and iii) a second linker covalently linking the first entity to the second entity, wherein the small non-peptide molecule of the second entity can be identified by each and both of the single strands of the double stranded oligonucleotide identifier, wherein the first entity is covalently linked to the second entity at or near the 3 or 5 end of a single strand of the double stranded oligonucleotide identifier.

72. The library of claim 71, wherein the number of complexes is from 2 to 10.sup.18.

73. The library according to claim 72, wherein the small non-peptide molecule of the complexes of the library is selected from the group consisting of monofunctional, difunctional,trifunctional and oligofunctional open-chain hydrocarbons; monofunctional, difunctional,trifunctional and oligofunctional non-aromatic carbocycles; monocyclic, bicyclic, tricyclic and polycyclic hydrocarbons; bridged polycyclic hydrocarbons; monofunctional, difunctional, trifunctional, and oligofunctional non-aromatic heterocycles; monocyclic, bicyclic, tricyclic, and polycyclic heterocycles, bridged polycyclic heterocycles; monofunctional, difunctional,trifunctional and oligofunctional aromatic carbocycles; monocyclic, bicyclic, tricyclic, and polycyclic aromatic carbocycles; and monofunctional, difunctional,trifunctional and oligofunctional aromatic heterocycles.

74. The library according to claim 73, wherein the first and/or second linker is selected from the group consisting of carbohydrides, substituted carbohydrides, vinyl, polyvinyl, substituted polyvinyl, acetylene, polyacetylene, aryl /hetaryl, polyaryl/hetaryl and substituted polyaryl/polyhetaryl, ethers, polyethers, amines, polyamines, substituted polyamines; double stranded, single stranded or partially double stranded natural and unnatural polynucleotides, substituted double stranded, single stranded or partially double stranded natural and unnatural polynucleotides, polyamides, natural and un-natural polypeptides, substituted polyamides, and substituted natural and unnatural polypeptides.

75. The library according to claim 74, wherein said first and/or second linker comprises a polynucleotide linker.

76. The library according to claim 74, wherein said first and/or second linker comprises an optionally substituted polyether linker.

77. The library according to claim 74, wherein said first and/or second linker comprises a polyethyleneglycol linker.

78. The library of claim 75, wherein the first linker comprises a hair-pin loop of nucleotides.

79. The library of claim 78, wherein the second entity is covalently linked to the first entity at or near the 5 or 3 end of a single strand of double stranded identifier oligonucleotide, and wherein the first linker comprises a hair-pin loop comprising nucleotides covalently linking the two strands of the double stranded identifier oligonucleotide at the opposite end of the single strand.

80. The library according to claim 76, wherein the second linker comprises an optionally substituted polyether linker.

81. The library according to claim 77, wherein the second linker comprises a polyethylene glycol.

82. The library according to claim 80, wherein the polyether linker is not substituted.

83. The library according to claim 71, wherein each nucleic acid monomer present in the oligonucleotide identifier is composed of a nucleobase and a backbone moiety, wherein each nucleobase is selected from the group consisting of naturally occurring nucleobases and non-naturally occurring nucleobases, and wherein each backbone moiety comprises a pentose sugar moiety and an internucleoside linker.

84. The library according to claim 83, wherein the pentose sugar moiety is selected from the group consisting of ribose, 2-deoxyribose, 2-O-methyl-ribose, 2-flouro-ribose, and 2-4-O-methylene-ribose (LNA).

85. The library according to claim 83, wherein each internucleoside linker connects the 3 end of a preceding pentose monomer to a 5 end of a succeeding pentose monomer, and wherein each internucleoside linker is independently selected from the group consisting of a phosphodiester linker, a phosphorothioate linker, a methylphosphonate linker, a phosphoramidate linker, a phosphotriester linker, a phosphodithioate linker and a non-phosphorous-containing linker.

86. The library according to claim 85, wherein at least one internucleoside linker is a non-phosphorous-containing linker.

87. A library comprising different complexes, wherein each complex comprises i) a first entity comprising a double stranded oligonucleotide identifier comprising single oligonucleotide strands covalently linked by a terminally located hair-pin loop comprising nucleotides, wherein the hairpin loop covalently links oligonucleotide strand 3 and 5 ends. ii) a second entity comprising a molecule selected from the group consisting of monofunctional, difunctional, trifunctional and oligofunctional open-chain hydrocarbons; monofunctional, difunctional, trifunctional and oligofunctional non-aromatic carbocycles; monocyclic, bicyclic, tricyclic and polycyclic hydrocarbons; bridged polycyclic hydrocarbons; monofunctional, difunctional, trifunctional, and oligofunctional non-aromatic heterocycles; monocyclic, bicyclic, tricyclic, and polycyclic heterocycles, bridged polycyclic heterocycles; monofunctional, difunctional, trifunctional and oligofunctional aromatic carbocycles; monocyclic, bicyclic, tricyclic, and polycyclic aromatic carbocycles; and monofunctional, difunctional, trifunctional and oligofunctional aromatic heterocycles, iii) a linker covalently linking the first entity and the second entity, wherein the molecule of the second entity can be identified by each and both of the single strands of the double stranded oligonucleotide identifier, wherein the first entity is covalently linked to the second entity at a terminal location of the first entity.

88. The library according to claim 87, wherein the linker covalently linking the first entity and the second entity is selected from the group consisting of carbohydrides, substituted carbohydrides, vinyl, polyvinyl, substituted polyvinyl, acetylene, polyacetylene, aryl/hetaryl, polyaryl/hetaryl and substituted polyaryl/polyhetaryl, ethers, polyethers, amines, polyamines, substituted polyamines; double stranded, single stranded or partially double stranded natural and unnatural polynucleotides, substituted double stranded, single stranded or partially double stranded natural and unnatural polynucleotides, polyamides, natural and un-natural polypeptides, substituted polyamides, and substituted natural and unnatural polypeptides.

89. The library according to claim 87, wherein the linker covalently linking the first entity and the second entity comprises an optionally substituted polyether linker.

90. The library according to claim 87, wherein the linker covalently linking the first entity and the second entity comprises a polyethylene glycol.

91. The library according to claim 89, wherein the polyether is not substituted.

92. The library according to claim 87, wherein each nucleic acid monomer present in the oligonucleotide identifier is composed of a nucleobase and a backbone moiety, wherein each nucleobase is selected from the group consisting of naturally occurring nucleobases and non-naturally occurring nucleobases, and wherein each backbone moiety comprises a pentose sugar moiety and an internucleoside linker.

93. The library according to claim 92, wherein the pentose sugar moiety is selected from the group consisting of ribose, 2-deoxyribose, 2-O-methyl-ribose, 2-flouro-ribose, and 2-4-O-methylene-ribose (LNA).

94. The library according to claim 92, wherein each internucleoside linker connects the 3 end of a preceding pentose monomer to a 5 end of a succeeding pentose monomer, and wherein each internucleoside linker is independently selected from the group consisting of a phosphodiester linker, a phosphorothioate linker, a methylphosphonate linker, a phosphoramidate linker, a phosphotriester linker, a phosphodithioate linker, and a non-phosphorous-containing linker.

95. The library according to claim 94, wherein at least one internucleoside linker is a non-phosphorous-containing linker.

96. The library according to claim 95, wherein further internucleoside linkers of the identifier oligonucleotide are independently selected from the group of consisting of a phosphodiester linker, a phosphorothioate linker, a methylphosphonate linker, a phosphoramidate linker, a phosphotriester linker and a phosphodithioate linker.

97. The method of claim 87, wherein the terminal location of the first entity is a terminal region of either of the covalently linked single strands of the double stranded oligonucleotide identifier.

98. The library according to claim 87, wherein the second entity is covalently linked to the first entity at a terminal region of a single strand of the double stranded identifier oligonucleotide, and wherein the hair-pin loop covalently links the two strands of the double stranded identifier oligonucleotide at the opposite end of the single strand.

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) FIG. 1 shows the general principle for one embodiment of the present invention for the multi-step synthesis of templated molecules.

(2) FIG. 2 shows the general structure of templates useful in the generation of a library.

(3) FIG. 3 shows an example as designs of templates for the generation of a library. In panel A, coding regions 1-6 are SEQ ID NOs:29-34, respectively. In panel B, codon 1 is SEQ ID NO:35, anti-codon 1 is SEQ ID NO:36, codon 6 is SEQ ID NO:37, and anti-codon 6 is SEQ ID NO:38.

(4) FIG. 4 shows examples of building blocks for use in the preparation of a library of templated molecules.

(5) FIG. 5 shows further examples of building blocks.

(6) FIGS. 6A, 6B, 6C, 6D and 6E show examples of the preparation of building blocks.

(7) FIG. 7 shows examples of the preparation of building blocks starting from a 5-NH.sub.2 derivatized oligonucleotide.

(8) FIG. 8 shows a general procedure of performing one embodiment for the formation of the templated molecule.

(9) FIG. 9 shows an example of the embodiment shown in FIG. 8 involving light induced reaction between symmetrical building blocks.

(10) FIG. 10 shows a general procedure of performing one embodiment for the formation of the templated molecule.

(11) FIG. 11 shows a general procedure of performing one embodiment of the invention for the formation of a mixed polymer templated molecule.

(12) FIG. 12 shows examples of simultaneous reaction and cleavage of neighbouring of functional entities for the formation of and alpha-peptide (FIG. 12A) and a polyamine (FIG. 12C).

(13) FIG. 13 shows examples of simultaneous reaction and cleavage of neighbouring functional entities for the formation of a peptoid, or an - or -peptide (FIG. 13A), and a hydrazino peptide (FIG. 13B).

(14) FIG. 14 depicts a templated synthesis of a polymer, using non-simultaneous reaction and cleavage.

(15) FIG. 15 depicts formation of a templated molecule due to activation of reactive groups and partly release of the templated molecule for the template by ring-opening.

(16) FIG. 16 shows the connection of two functional entities by the fill-in of connecting moiety.

(17) FIG. 17, example 1, discloses an exemplification of FIG. 16, in which an imine is formed by a fill-in reaction.

(18) FIG. 18, example 2, shows an exemplification of FIG. 16, in which an amide is formed.

(19) FIG. 19, example 3, shows an exemplification of FIG. 16, in which an urea bonding is formed.

(20) FIG. 20, example 3.1, shows an exemplification of FIG. 16 in which functional entities 13.3.1.A and 13.3.1.B are synthesised.

(21) Synthesis of the functional entity 13.3.1A:

(22) 5-Fluoroindole (1eq) is dissolved in ethanol and treated with pent-4-enoic acid [2-(4-oxo-piperidin-1-yl)-ethyl]-amide (1.2 eq) and 2N KOH. The mixture is stirred o/n at reflux. The crude is evaporated and purified by silica gel filtration. The purified materiel is treated with methyl 3-bromobutanoate (1.2 eq) and NaH (1.5 eq) in DMF at rt. After 5 hours LiOH (10 eq) and water is added and the reaction mixture is stirred at rt o/n. The final product is purified by LC-MS and loaded on a DNA oligo containing an amino function.

(23) Synthesis of the functional entity 13.3.1B:

(24) 3-Pent-4-enoylamino-butyric acid (1 eq) is treated with 3-hydroxymethyl-benzoic acid tert-butyl ester (1.2 eq), DIC (1.2 eq) and DMAP (0.2 eq) in DCM. The reaction mixture is stirred o/n at rt. The crude is evaporated and purified by silica gel filtration. The purified material is dissolved in diethyl ether and treated with HCI in diethyl ether. After stirring for 3 hours the mixture is evaporated and the crude material loaded on a DNA oligo containing an amino function.

(25) Fill in experiment using functional entity 13.3.1A and 13.3.1B:

(26) The two loaded oligos are mixed with a template oligo in in hepes buffer (pH=7.5) and 100 mM NaCI. 1,1-Carbonylbisbenzotriazole (0.1M in MeOH) is added and the mixture is left at rt for 4 hours. pH is then adjusted to 9 and the mixture is left at rt o/n.

(27) FIG. 21, shows the formation of chiral and achiral templated molecules.

(28) FIG. 22, shows the formation of a phosphodiester bond by symmetric fill-in.

(29) FIG. 23, shows the formation of a phosphodiester bond by a fill-in reaction, wherein the building block comprises a single reactive group.

(30) FIG. 24, shows a pericyclic fill-in reaction.

(31) FIG. 25, shows an exemplification of FIG. 16, in which functional entities 13.7.1A and 13.7.1.B are synthesised.

(32) Synthesis of the functional entity 13.7.1A:

(33) 3-Methylamino-propionic acid methyl ester (1eq) is dissolved in DCM and triethylamine (2eq). The mixture is cooled to 0 and treated with acryloyl chloride (1.5 eq). After 2 hours the reaction mixture is evaporated, redissolved in THF and treated with LiOH (10 eq) and water. The mixture is left at rt for 3 hours. The crude is extracted with EtOAc (2x). The combined organic phases are dried over MgSO4 and evaporated. The product is purified by LC-MS and loaded on a DNA oligo containing an amino function.

(34) Synthesis of the functional entity 13.7.1B:

(35) Amino-furan-2-yl-acetic acid (1 eq) is treated with acetic anhydride (3 eq) at rt for 1 hour. The crude is evaporated and the product purified by LC-MS and then treated with 3-hydroxymethyl-benzoic acid tert-butyl ester (1.2 eq), DIC (1.2 eq) and DMAP (0.2 eq) in DCM. The reaction mixture is stirred o/n at rt. The crude is evaporated and purified by silica gel filtration. The purified material is dissolved in diethyl ether and treated with HCI in diethyl ether. After stirring for 3 hours the mixture is evaporated and the crude material loaded on a DNA oligo containing an amino function.

(36) Pericyclic reaction experiment using functional entity 13.7.1A and 13.7.1B:

(37) The two loaded ( )idos are mixed with a template oligo in in hepes buffer (pH=7.5) and 100 mM. The mixture is left at rt for 4 hours. pH is then adjusted to 9 and the mixture is left at rt o/n.

(38) FIG. 26 shows a schematic representation of a fill-in reaction using asymmetric monomers.

(39) FIG. 27 shows an asymmetric fill-in reaction using modified Staudinger ligation and ketone-hydrazide reaction.

(40) FIG. 28 shows a schematic representation of a templated synthesis of a non-linear molecule.

(41) FIG. 29 shows a representation of the templated synthesis of a non-linear molecule employing reactive groups of different classes and non-simultaneous reaction and cleavage.

(42) FIG. 30 depicts a templated synthesis of a non-linear molecule, by exploiting the increased proximity effect that arises from a migrating scaffold.

(43) FIGS. 31 and 32 show examples of the templated synthesis of non-linear molecules.

(44) FIG. 33 shows a schematic representation of a templated synthesis, wherein the reaction step may be performed under conditions where specific annealing of building blocks to the template is inefficient.

(45) FIGS. 34 to 41 show examples of various reactions types allowing simultaneous reaction and cleavage.

(46) FIGS. 42 to 44 show examples of pairs of reactive groups (X) and (Y), and the resulting bond (XY).

(47) FIG. 45 shows a schematic representation (panel A) of the zipper box principle and an example (panel B) of two building blocks.

(48) FIG. 46 shows a schematic representation of various methods for increasing the proximity of functional entities of different building blocks.

(49) FIG. 47 shows examples of the chemical constitution of a linker to be able to be cleaved.

(50) FIG. 48 schematically shows the templated synthesis by generating a new reactive group.

(51) FIG. 49 shows a method in which reactive groups generated in a first round subsequently are reacted with introduced reactive groups.

(52) FIGS. 50 to 52 show examples of post-templating modifications of the templated molecule.

(53) FIG. 53 illustrates one preferred method for selection of template-displaying molecules.

(54) FIGS. 54 to 58 show the proposed complexes that may form when a reaction step is performed using set-ups that allow for stacking of DNA duplexes.

(55) FIG. 59 shows an autoradiography of a polyacrylamide gel analysis of the reaction between building blocks.

(56) FIG. 60 shows the Feuston 3 functional entity as well as the Feuston 5 ligand.62

(57) FIG. 61 shows the structure of pentenoyl protected aspartate.

(58) FIG. 62 shows the use of allylglycine building blocks.

(59) FIG. 63 shows the autoradiography of a polyacrylamide gel.

(60) FIG. 64 shows an Elisa analysis of a product of a two-step encoding process.

DETAILED DESCRIPTION OF THE INVENTION

(61) The following symbols are used in the figures to indicate general characteristics of the system: FIG. 9; FIG. 12; FIG. 13, FIGS. 15 to 19; FIGS. 20 to 27; FIGS. 31 to 32, FIGS. 34 to 41, FIGS. 45 to 46, FIGS. 48 and 49, and FIGS. 54 to 58 a long horizontal line symbolizes a template. Coding region 1 symbolizes sequences that anneal to type 1 building blocks. Building blocks are symbolized as shown in FIGS. 4-7. X/Y, S/T and P/Q represent pairs of reactive groups (where the reactive groups of one pair (e.g. X and Y) are partly or fully orthogonal to the reactive groups of other pairs (e.g. S/T, P/Q)). R.sub.1, R.sub.2, . . . , R.sub.x symbolize functional groups. L.sub.1 and L.sub.1, L.sub.2, L.sub.3, . . . represent cleavable linkers, where linkers of one group (e.g., L.sub.1-linkers) are cleavable under conditions where linkers of other groups (L.sub.2, L.sub.3 . . . ) are not cleaved, or are cleaved less efficiently. The proximity effect that results from incorporating two building blocks on the same template, or alternatively, as a result of incorporating a building block on a template to which is attached a reactive group, may be enhanced by any of the methods described above or below that increases this effect. For example, in order to increase the efficiency and specificity of templated synthesis, the proximity effect may be increased by the introduction of zipper boxes in most of the general concepts described here.

(62) In all the examples, the templated molecule may be coupled to the template through the non-covalent interaction of a monomer building block with the template, or alternatively, through covalent or non-covalent coupling to the template, and may be located at either of the ends of the template, or anywhere on the template. The coupling reaction to the template may be performed before, during or after the synthesis of the templated molecule.

(63) For clarity, in some of the figures only the reaction step, not the cleavage step, has been included.

(64) The figures included have been drawn so as to highlight specific set-ups.

(65) Obviously, any combination of the methods may be employed, in order to make linear, as well as non-linear molecules, to use reactive groups that lead to simultaneous cleavage, as well as reactive groups that do not lead to simultaneous cleavage, to use cleavable and non-cleavable linkers etc.

(66) The protocol for an embodiment of a multi-step templated synthesis is shown in FIG. 1 and involves a number of steps that each result in the addition of one or more molecular moieties to a growing molecule that eventually becomes the templated molecule. Each of these steps can be divided into substeps. Initially, a number of templates (also called a library of templates) are provided. Each of the templates comprises a plurality of unique codons and a reactive group. Also, a plurality of different building blocks are provided, each of the building blocks comprises a functional entity separated from an anti-codon with a suitable linker. The anti-codon of a specific building block complements a unique codon of a template and is, therefore, capable under proper hybridisation conditions to anneal to the unique codon. The incorporation of building blocks is initiated by contacting the plurality of different templates with a subset of the entire amount of building blocks. The subset carries anti-codons which hybridise to unique codons of a distinct coding region. A connection between the reactive group of the template and the functional entity of the building blocks is obtained. In FIG. 1 the reactive group of the template is part of a building block (building block 1) and the said building block is hybridised to the template. In a preferred embodiment the building block 1 comprising the reactive group of the template and the second building block are contacted with the template simultaneously to allow for an efficient connection between the functional entities. The line between FE.sub.1 and FE.sub.2 symbolise a direct connection between the functional entities or an indirect connection via a bridging molecule entity. The molecule part formed by a connection of FE.sub.1 to FE.sub.2 is a nascent templated molecule, which may be added further functional entities resulting in a growing nascent templated molecule.

(67) The propagation part of the method starts with the incorporation of a further building block (building block 3). The incorporation involves the hybridisation of a subset of the building blocks to the plurality of templates bearing the nascent templated molecule. The subset of building blocks is selected to have anti-codons which complement unique codons of the templates, said unique codons being in the vicinity of, preferably neighbouring to, unique codons hybridised to the building block(s) bearing the templated molecule. The functional entity of the further building block is able to form a chemical connection to the nascent templated molecule through the reaction of a reactive group attached to the functional entity. The linkage between one or more of the functional entities and the corresponding anti-codons may be cleaved if desired and the incorporation of a new building block may be performed. In the example illustrated in FIG. 1 only three functional entities are connected in the templated molecule. However the propagation step may be conducted as many times as appropriate to obtain the desired templated compound.

(68) As a terminal phase the linkers connecting functional entities/templated molecule and anti-codons may be cleaved. The complex comprising the templated molecules (specific compositions or sequences of molecular moieties, the identity of which is determined by the template) attached to the templates that templated their synthesis, can now be taken through a screening process. This process leads to an enrichment of templated molecules complexes with appropriate characteristics. The isolated complexes may now be enriched by amplification of the templates, and a new round of templated synthesis and screening can be performed. Eventually, the templated molecules may be identified by characterization of the corresponding templates.

(69) The stages of the process involving incorporation of building blocks may be mediated by chemicals, or enzymes such as polymerase or ligase. For example, the anti-codon part of the building blocks may be nucleotide-derivatives that are incorporated by a polymerase. Incorporation may also be solely by hybridization of building blocks to the template. If the template is a DNA molecule, the template may comprise primer binding sites at one or both ends (allowing the amplification of the template by e.g. PCR). The remaining portion of the templates may be of random or partly random sequence.

(70) The reaction stage of the method involves reactions between the incorporated building blocks, thereby forming chemical connections between the functional entities. The chemical connection can be a direct chemical bond or the connection can be established through a suitable bridging molecule.

(71) The optional cleavage step involves cleaving some, all but one, or all of the linkers that connect the functional entities and anti-codons. In FIG. 1 the templated molecule is displayed by cleaving the linkers of the second and third functional entities, while maintaining the linker from the first building block.

(72) Subsequent to the production of library according to the invention a selection is performed. The selection or screening involves enriching the population of template-templated molecule pairs for a desired property. For example, passing a library of templated molecule-template complexes over a solid phase to which a protein target has been immobilized, and washing unbound complexes off, will enrich for complexes that are able to bind to the protein.

(73) The selection may be performed more than once, for example with increasing stringency. Between each selection it is in general preferable to perform an amplification. The amplification involves producing more of the template-templated molecule complexes, by amplification of the template or complementing template, and producing more of the template-templated molecule pairs, for further rounds of selection/screening, or for sequencing or other characterization. For example, if the template is a DNA strand, the template may be amplified by PCR, where after the templated synthesis can be performed using the amplified DNA, as described above.

(74) Cloning and sequencing may also be useful techniques and involve the cloning of the isolated templates or complementing templates, followed by characterization. In some cases, it may be desirable to sequence the population of isolated templates or complementing templates, wherefore cloning of individual sequences is not required.

(75) In FIG. 2, in the upper part of the figure, the general structure of a template is shown. The templates comprise x coding regions. Each coding region has a unique sub-structure which differentiates it from some or all of the other coding regions. Shown below the general structure of a template are specific templates. A given specific template carries a specific set of x unique codons. A unique codon specifies (by way of interaction with a specific anti-codon of a building block) a specific functional entity. The unique codons 1.1, 1.2, 1.3, . . . , 1.m are all examples of coding region 1 sequences. The general design of the templates therefore enables the templated incorporation of building blocks, in the sense that a sub-set of building blocks can be added that will only be incorporated at the same position on the template (i.e., coding region 1 if the building blocks have anti-codons that are complementary to the unique codons of codon region 1).

(76) FIG. 3 shows an example of a design of templates and anti-codons for oligonucleotide-based building blocks. Section A discloses the general structure of a set of templates carrying 6 coding regions, each containing a partly random sequence (X specifies either C or G), and a constant sequence that is identical for all sequences in the group (e.g., all coding region 1 sequences carries a central ATATTT sequence). By using C and G only (or, alternatively, A and T only), the building blocks that are complementary to coding regions 1 have very similar annealing temperatures wherefore misannealing is insignificant. The attachment point of the linker that connects the anti-codon and the functional entity is not specified in the figure. Ideally, the linker is attached to the constant region of the anti-codon, in order to avoid bias in the annealing process.

(77) Section B of FIG. 3 shows examples of codon and anti-codon sequences. Example codon 1 and codon 6 sequences are shown. The example codon 1 sequence represents one specific sequence out of 1024 different sequences that anneal specifically to the complementary anti-codon 1 sequences; the example codon 6 sequence represents one specific sequence out of 128 different sequences that anneal to the complementary anti-codon 6 sequences.

(78) FIG. 4 illustrates different general designs of building blocks. A building block comprises or essentially consists of a functional entity, connected through a (cleavable) linker to an anti-codon. Panel A shows a building block with one reactive group (X), connecting the, functional group (R.sub.x) with the anti-codon. This type of building block may be used for the simultaneous reaction and cleavage protocol (e.g. FIGS. 10 and 28). The functional entity in this example comprises one reactive group, and a functional group R.sub.x, also called a functionality. The reactive groups typically become part of the templated molecule. Panel B shows a building block with two reactive groups (X and Y), connecting the anti-codon and the functional group (R.sub.x). The functional entity in this example comprises two reactive groups that are both part of the moiety that links the anti-codon and functional group, R.sub.x. Panel C shows a building block with a reactive group (X) connecting R.sub.x and the anti-codon, and a reactive group (Y) attached to the R.sub.x group. This type of building block may be used in the simultaneous reaction and cleavage protocol (e.g., FIG. 10 and 11). The functional entity comprises two reactive groups X and Y, where X is part of the linker, and Y is attached to the functional group R.sub.x. Panel D shows a building block with one reactive group (X). The reactive group (X) does not link the functional group (Rx) and the complementing element. A cleavable linker (L) is provided in order to release the functional entity from the anti-codon. This type of building block may be used in protocols that require cleavage of the linker after the reactive groups of the functional entities have reacted (e.g., FIG. 15). Panel E disclose a building block with four reactive groups and a functional group Rx. The four reactive groups and the functional group Rx may serve as a scaffold, onto which substituents (encoded by building blocks bound to codons on the same template) are coupled through reaction of reactive groups (X) of other building blocks with the reactive groups (Y) (e.g., FIG. 28). In this example, no cleavable linker is indicated. Therefore, after the templating reactions the templated molecule is attached to the template through the linker of this building block.

(79) In FIG. 5 three different building blocks are depicted. Building block A comprises an anti-codon (horizontal line), which may be an oligonucleotide, to which a linker carrying the functional entity is attached to the central part. The portion of the linker marked a may represent a oligonucleotide sequence to which a single stranded nucleotide may be annealed in order to make the linker more rigid, or alternatively, a may represent a zipper box sequence of nucleotides or other type of zipper box moiety. The vertical line may represent a PEG (polyethylene glycol) linker, oligonucleotide linker, or any other linker that provides the functional entity with the appropriate freedom interact productively with a functional entity of a building block annealed to the same template during the templating process. In building block, the linker is attached to the terminus of the anti-codon. The anti-codon and the linker may be one continuous strand of an oligonucleotide. The horizontal part here represents the anti-codon, and the vertical part represents the linker. The linker may contain a moiety a that functions as a zipper box (see FIG. 45), a rigid linker, or an annealing site for another entity that rigidifies the linker upon annealing. In building block C of FIG. 5 the linker and anti-codon may be a continuous strand of an oligonucleotide. Attached to the linker is a nucleophile Nu which may react with a functional entity. This may be used as an anchorage point for the templated molecule. Building block C may preferably be used as the starting or the terminal building block. When used in the initial stage of the production of the complex comprising the templated molecule, building block C may provide the template with a reactive group to which the functional entities may be attached in the growing templated molecule. In a further embodiment of the invention Nu of building block C represents any reactive group able to participate in a reaction resulting in the formation of a connection to a functional entity of a building block.

(80) FIGS. 6A, 6B, 6C, 6D and 6E show five different general methods for the preparation of building blocks. The general methods involves the coupling of the functional entities to oligonucleotide-based building blocks. Reactions and reagents are shown that may be used for the coupling of functional entities to modified oligonucleotides (modified With thiol, carboxylic acid, halide, or amine), without significant reaction with the unmodified part of the oligonucleotide. As an alternative approach, the functional entity may be synthesized as phosphoramidite precursor, which can then be used for oligonucleotide synthesis by standard methods, resulting in an oligonucleotide-derivative carrying a functional entity.

(81) FIG. 7 shows the design and synthesis of exemplary building blocks. Panel A shows a general synthesis scheme for building blocks using DNA oligonucleotide as codon, and coupling amines and carboxylic esters. The oligonucleotide is purchased with an amine coupled to e.g. the base at a terminal position of the oligo. By addition of EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride) and NHS (N-hydroxysuccinimide), the oligonucleotide is coupled to the building block through an amide bond. Panel B shows specific synthesis schemes for the generation of specific classes of building blocks.

(82) FIG. 8 illustrates an embodiment for the templated synthesis of a polymer. X and Y are reactive groups of the functional entity. X and Y may be different kinds of reactive groups (e.g., amine and carboxylic acid), of the same kind but different (e.g., different primary amines or a primary amine and a secondary amine), or identical. Reaction of X with Y to form XY either happens spontaneously when the building block has been incorporated, or is induced by a change of conditions (e.g. pH), or by the addition of an inducing factor (chemical or UV exposure, for example)

(83) FIG. 9 show light-induced reaction between symmetric coumarin-derivatives. Light-induced reaction of the coumarin units, followed by cleavage of the linker, result in a ring structure. Examples of functional groups (phosphate and carboxylic acid) are shown. The building blocks are said to be symmetric because the two reactive groups, two coumarin units, are of the same reactivity (in fact, in this example are identical).

(84) FIG. 10 shows an embodiment-for templated synthesis of a polymer. A population of templates, each carrying four codons are incubated with two sets of building blocks (carrying anti-codons 1 and 2, respectively), at a temperature that ensures efficient and specific annealing of anti-codons type 1 to coding regions 1, and efficient and specific annealing of anti-codons type 2 to coding regions 2. After annealing, the excess building blocks may optionally be removed. If desired, reactive groups may be deprotected (and thus activated for reaction) at this step. Then building block-template complexes are incubated under conditions that allow the reactive groups of the building blocks (i.e., reactive groups X and Y) to react. This leads to a transfer of the functional group R1 from building block 1 to building block 2, and thus results in the formation of a dimeric polymer carrying two functional groups, R1 and R2. The process is then repeated, i.e. a third monomer (with anti-codon type 3) is added, and after annealing to coding region 3, excess building block is removed, and the reaction between X and Y now leads to the formation of a trimeric polymer, coupled to the building block annealed to coding region 3. Once more, the process is repeated with building blocks of type 4, resulting in the formation of a tetrameric polymer.

(85) The reactive groups X and Y used in this scheme thus have two functions: i) reaction between X and Y leads to coupling of the corresponding functionalities (e.g., R1 and R2), and simultaneously, ii) the linker between R1 and the anti-codon is cleaved. Examples of reactive groups X and Y with such characteristics (i.e., the ability to simultaneously react and cleave) are shown in FIGS. 34 to 41. By appropriate choice of X and Y, the nascent polymer is migrated down the template, from building block to building block, as it is being synthesized. For example, by choosing X=ester (COOR), and Y=amine (NH.sub.2), the nucleophilic attack of the amine on the ester leads to transfer of the upstream functionality (e.g., R.sub.1) to the downstream building block (e.g., carrying anti-codon type 2). This ensures the highest possible effect of proximity with this set-up (i.e., in each step, the reacting X and Y are carried on neighbouring monomers).

(86) If desired, the templated polymer may be coupled to the template through the non-covalent interaction of a building block with the template (in the example given, through the interaction of building block 4 with the template), or alternatively, through covalent coupling to a reactive group on the template, located at either of the ends of the template, or anywhere on the template sequence. In the latter case, the coupling reaction to the template may be performed before, during or after the synthesis of the polymer.

(87) FIG. 11 shows the templated synthesis of a mixed polymer. The most noticeable difference, when compared to the embodiment shown in FIG. 10 is that the reactive groups on the individual building blocks are different. The pairs of reactive groups (X/Y, S/T, and P/Q) are chosen so that the reaction of X and Y, S and T, P and Q, respectively, results in transfer of a functional group from one building block to another (i.e., the reaction both mediates the coupling of the two functional groups and the cleavage of the linker that initially connects one of the functional groups to the anti-codon). Example pairs of reactive groups that mediate this simultaneous reaction and cleavage are shown in FIGS. 34 to 41.

(88) FIG. 12 shows two methods of obtaining different classes of compounds using simultaneous reaction and cleavage. In FIG. 12A, the formation of an alpha-peptide is disclosed and in FIG. 12C the synthesis of a polyamine is shown.

(89) In FIG. 12A, two building blocks are incorporated by hybridization to the template. One of the building blocks is an oligonucleotide to which has been appended a thioester. The other building block is an oligonucleotide to which has been appended an amino acid thioester. The amine of the latter building block attacks the carbonyl of the other building block. This results in formation of an amide bond, which extends the peptide one unit. When the next amino acid thioester building block is incorporated, this may attack the thioester carbonyl, resulting in cleavage of the dipeptide from the anti-codon, to form a tripeptide. This process is repeated until the desired peptide has been generated. Importantly, as the reaction in each step is between the incoming subunit-precursor and the subunit of the nascent polymer that is closest to the linker that connects it to the anti-codon, the geometry of the nucleophilic attack remains unchanged. The reactivity of the amine with the ester may be tuned in several ways. Parameters that will affect the reactivity include: (i) pH and temperature, (ii) nature of ester (thio-, phosphor or hydroxy-ester); (iii) the nature of the substituent on the sulfur (see FIG. 12B below).

(90) The general scheme presented here can be applied to most nucleophilic reactions, including formation of various types of peptides, amides, and amide-like polymers (e.g., mono-,di-, tri-, and tetra-substituted -, , -, and -peptides, polyesters, polycarbonate, polycarbarmate, polyurea), using similar functional entities.

(91) FIG. 12B shows four different thioesters with different substituents on the sulphur and therefore different reactivity towards nucleophiles.

(92) FIG. 12C relates to the formation of a polyamine. Using the same principle as in FIG. 12A, a polyamine is formed.

(93) FIG. 13 shows simultaneous reaction and cleavage for two reactions. In reaction A a peptoid or an - or -peptide is formed (FIG. 13A), and in reaction B, a hydrazino peptide is formed (FIG. 13B).

(94) In reaction A, two building blocks are initially incorporated, one of which carries both a nucleophile (an amino group) and an electrophile (e.g. an ester); the other building block only carries an electrophile (e.g. a thioester). As a result, the nucleophilic amine will attack the electrophile of the building block attached to the same template. As a result, a dimeric structure is formed, linked to building block that initially carried the amine. Upon sequential addition of building blocks, the linear structure grows, and eventually the desired templated molecule (a peptoid or an - or -peptide) has been formed.

(95) The reaction B follows the same line as in A, except that hydrazine-peptide precursor building blocks are used, leading to the formation of hydrazino peptides.

(96) FIG. 14 shows a general reaction scheme for templated synthesis of a polymer, using non-simultaneous reaction and cleavage. In this scheme, the reaction of the reactive groups (e.g., X and Y) does not in itself lead to cleavage, wherefore the functional entity is coupled to the anti-codon via a cleavable linker. Therefore, each addition of a subunit to the growing polymer involves two steps. First, the reactive groups X and Y react to form a bond XY. Then, in a separate step, a cleavable linker L is cleaved, which releases one of the functional entities from the anti-codon. By alternating between two types of cleavable linkers (cleavable under different conditions) one may achieve migration of the nascent polymer down the template, like described in FIG. 10 and 11. This ensures the highest possible effect of proximity with this set-up (i.e., in each step, the reacting X and Y are carried on neighbouring monomers). In the example, some or all of the reactive pairs may be of the same kind (e.g., X/Y=S/T=P/Q).

(97) Example reactions that do not mediate simultaneous reaction and cleavage are shown in FIGS. 42 to 44. Any combination of cleavable and non-cleavable linkers may be used, dependent on the nature of the reactive groups in the functional entities (e.g., dependent on whether the reaction involves a release from the anti-codon).

(98) FIG. 15 relates to activation of reactive groups and release from anti-codon by ring-opening.

(99) Reaction of the initiator with X in the ring structure opens the ring, resulting in activation of Y. Y can now react with X in a neighboring functional entity. As a result of ring-opening, the functional entities are released from the anti-codons. If the zipper-box principle is applied to this set-up (where each additional building block added reacts with the nascent templated molecule attached to the initiator), the initiator linker must carry half of the zipper (e.g., the sense strand), and all the building blocks must carry the other half of the zipper-box (the anti-sense strand).

(100) Ring-opening of N-thiocarboxyanhydrides, to form -peptides.

(101) After incorporation of two building blocks, where one of the building blocks carry an initiator reactive group (or incorporation of one building block next to a covalently attached initiator molecule), the initiator is activated, for example by deprotection or by an increase in pH. The primary amine then attacks the carbonyl of the N-thiocarboxyanhydride (NTA) unit. As a result, CSO is released, and a primary amine is generated. When the next building block is incorporated, this amine will react with the NTA, and eventually when all the building blocks have been incorporated and the NTA units have reacted, a -peptide will have formed. Finally, the linkers that connect the -peptide to the anti-codons are cleaved, resulting in a -peptide attached to its template through one linker.

(102) A number of changes to this set-up can be envisaged. For example, instead of thiocarboxyanhydrides, one might use carboboxyanhydrides. The initiator might be protected with a base- or photolabile group. If a base-labile protection group is chosen, the stability of the carboxyanhydride must be considered. At higher pH it may be advantageous to use carboxyanhydrides rather than thiocarboxyanhydrides. Other types of peptides and peptide-like polymers (e.g., mono-,di-, tri-, and tetra-substituted -, -, -, and -peptides, polyesters, polycarbonate, polycarbarmate, polyurea) can be made, using a similar scheme. For example, a-peptides can be made by polymerization of 5-membered carboxyanhydride rings.

(103) FIG. 16 shows the principle of symmetric fill-in (symmetric XX building blocks). The fill-in reaction occurs between the reactive groups (X in the figure) and bridging molecules Y-Y in figure).

(104) For clarity, only the reaction (not the cleavage) is shown in the figure. X represents the reactive groups of the functional entity. In this case the two reactive groups are of the same kind. (Y-Y) is added to the mixture before, during or after incorporation of the building blocks.

(105) FIG. 17 shows imine formation by fill-in reaction.

(106) Dialdehyde is added in excess to incorporated diamines. As a result, an imine is formed. In the example, the templated molecule carries the following functional groups: cyclopentadienyl and hydroxyl.

(107) FIG. 18 shows an example of amide formation using symmetric fill-in. After incorporation of two building blocks each carrying a di-amine, non-incorporated building blocks may be removed. Then EDC (1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide), and dicarboxylic acid is added in excess to the primary amines of the building blocks. Alternatively, a di-(N-hydroxy-succinimide ester) may be added in excess. At a pH of 7-10, this will lead to the formation of two amide bonds linking the functional entities. After reaction, excess reagents may be removed by dialysis, precipitation of the building blocks and template, gel filtration or by other means that separate the reagents from the building blocks. When the process of incorporation-and-reaction has been repeated a number of times, and the desired molecule has been templated, the linkers (L) may be cleaved, and, if functional groups have been masked by protection groups (PG), these functional groups can be deprotected to expose the functional groups. Appropriate protecting groups would be for example Boc-, Fmoc, benzyloxycarbonyl (Z, cbz), trifluoracetyl, phthaloyl, or other amino protecting groups described e.g. in (T. W. Green and Peter G. M. Wuts (1991), Protective Groups in Organic Synthesis).

(108) An alternative route to amide-bonded functional entities would be to incorporate building blocks carrying di-carboxylic acids, and then add diamines, NHS and EDC. Alternatively, the building blocks could carry N-hydroxy-succinimidyl (NHS) esters, which would react with the added amines without the need to add EDC and NHS.

(109) FIG. 19 shows an example of urea-bond formation.

(110) The functional entities of the incorporated building blocks react with phosgen or a phosgen-equivalent such as CDI to form a polyurea. Formaldehyde may also be used. The linkers are cleaved and the protected hydroxyl is deprotected. Appropriate leaving groups (Lv) are chloride, imidazole, nitrotriazole, or other good leaving groups.

(111) FIG. 21 shows the formation of chiral and achiral templated molecules. In this example, the functional group Rx is used as a cleavable linker, that generates the desired functional group upon activation. In both reaction A and reaction B, a urea-bond is formed.

(112) In reaction scheme A in FIG. 21, the functional group is attached to the backbone via a chiral carbon. The hydrogen on this carbon is drawn to emphasize this. Before bond formation, there is free rotation about the bond connecting the chiral carbon and the functional group. When the reactive groups (the amines) react with the phosgen equivalent (e.g., a carbonyldiimidazole) to form the templated molecule, the building blocks may be inserted in either of two orientations (as indicated by the position of the hydrogen, left or right). As a result, each encoded residue of the templated molecule will have two possible chiral forms. If the templated molecule was e.g. a pentameric polyurea (formed from five functional entities), this molecule would have 2.sup.5=32 stereoisomers. In certain cases it may be advantageous to incorporate such additional structural diversity in the library (for example when a low building block diversity is employed). In other cases such additional diversity is not desirable, as the screening efficiency may become compromised, or it may become too difficult to determine the identity of a templated molecule that has been isolated in a screening process.

(113) In reaction scheme B in FIG. 21, the chiral carbon of reaction A has been replaced by a nitrogen. As a result, the resulting templated molecule is achiral, i.e. the template encodes one specific structure.

(114) FIG. 22 shows the formation of a phosphodiester bond by the principle of symmetric fill-in. The incorporated building blocks react with the activated fill-in molecule to form a phosphodiester bond. Then the linkers are cleaved, releasing the templated molecule from its template. An example of an appropriate leaving group (Lv) is imidazole.

(115) FIG. 23 shows phosphodiester formation with one reactive group in each building block.

(116) Upon addition of a dihydroxylated compound such as 1,3-dihydroxypyridine, a phosphodiester bond is formed. Finally, the functional group Rx is liberated from the anti-codon by cleavage of the protection groups/cleavable linker that connected it to the anti-codon.

(117) FIG. 24 shows an example of a pericyclic fill-in reaction.

(118) First, two building blocks are incorporated. Then 1,4-benzoquinone is added in excess, resulting in the formation of a polycyclic compound. A third building block is added, reacted with the 1,4-benzoquinone, and this process is repeated a number of times until the desired templated molecule has been generated. Finally, all but one of the linkers that connect the templated molecule to the anti-codon, are cleaved.

(119) FIG. 26 relates to asymmetric fill-in using XS building blocks.

(120) A fill-in reaction between reactive groups (X and S) and bridging molecules (T-Y) is shown. For clarity, only the reaction (not linker cleavage) is shown. X and S represent the reactive groups of the functional entity. In this case the two reactive groups are not of the same kind. (T-Y) is added to the mixture before, during or after incorporation of the building blocks. Likewise, significant reaction between X and Y, and between S and T may take place during or after incorporation of the building blocks.

(121) FIG. 27 shows an example of asymmetric fill-in by modified Staudinger ligation and ketone-hydrazide reaction. The reactive groups X and S of the building blocks are azide and hydrazide. The added molecule that fills the gaps between the building blocks carry a ketone and a phosphine moiety. The reactions between a ketone and a hydrazide, and between an azide and a phosphine, are very chemoselective. Therefore, most functional groups Rx can be employed without the need for protection during the reactions. Examples for the molecular moieties R, R1, X and Y may be found in (Mahal et al. (1997), Science 276, pp. 1125-1128; Saxon et al. (2000), Organic Letters 2, pp. 2141-2143).

(122) FIG. 28 shows a general reaction scheme for templated synthesis of a non-linear molecule. A template carrying four codons is mixed with two building blocks. The functional entity of one building block comprises a reactive group X and a functional group R.sub.1. The other building block comprises three reactive groups Y and a functional group R.sub.2. The building block bound to codon 2 is here called the scaffold, as the functional groups are transferred to this building block during the templating process.

(123) After incubation at a temperature that ensures efficient and specific annealing of the two building blocks to their respective codon, and optionally, excess building block has been removed, X is brought to react with one of the reactive groups Y, for example by changing the conditions, by deprotecting X or Y, or by simply exploiting the pronounced proximity of X and Y groups when the building blocks are bound to the template.

(124) In this scheme, X and Y have been chosen so as to allow simultaneous reaction and cleavage. Thus, as a result of the reaction between X and Y, the substituent group (functional group) R.sub.1 is transferred to the scaffold. Example reactive groups X and Y that mediate simultaneous reaction and cleavage are given in FIGS. 34 to 41. Any pair of reactive groups X and Y that mediates simultaneous reaction and cleavage can be used in this scheme, i.e., different X/Y pairs may be used at each substituent position.

(125) Annealing and reacting of two more building blocks lead to the formation of a scaffolded molecule carrying three substituents (R.sub.1, R.sub.3 and R.sub.4). The identity of the substituents is determined by the codons of the template to which the scaffolded molecule is attached.

(126) FIG. 29 shows templated synthesis of a non-linear molecule, employing reactive groups of different kinds, and non-simultaneous reaction and cleavage. The reactive groups X, S, P and Y, T, Q may be of different kinds, and the bonds formed (XY, ST, and PQ) therefore may be of different kinds.

(127) After reaction and then cleavage of the linker L (that attaches the functional entity of the first building block to the anti-codon), the substituent (functional group) R1 is transferred to the second building block (the scaffold). Thus, relative to the synthesis scheme of FIG. 28, here an additional step of linker cleavage is required. After repeating the processes of annealing, reacting and cleavage a number of times, a scaffolded molecule has been formed carrying encoded substituents. The identity of the substituents is determined by the codons of the template to which the scaffolded molecule is attached. The position of the substituents are determined by the identity of the reactive groups Y, T and Q of the scaffold, and therefore indirectly determined by the identity of the codon to which the scaffold building block anneals. Therefore, in this set-up, the identity and position of the substituents, as well as the identity of the scaffold, is determined by the sequence of the template. The reactive pairs may also be of the same kind (e.g., X/Y=S/T=P/Q).

(128) FIG. 30 discloses the principle of templated synthesis of a non-linear molecule, by exploiting the increased proximity effect that arises from a migrating scaffold. In this set-up, the templated molecule migrates down the template as it is being synthesized. This is made possible by the use two different linkers L.sub.x and L.sub.y, cleavable under different conditions. As a result, a high proximity is maintained throughout the templating process, as the building blocks that react in each reaction step are bound to adjacent coding regions on the template.

(129) FIG. 31 shows the templated synthesis of various non-linear molecules. FIG. 31, panel A: Three building blocks are added and reacted one at a time. Each building block comprises an activated ester (reactive group, (X)) where the ester moiety carries a functional group Rx. Upon reaction between the esters and the amines on the scaffold (scaffold is covalently attached to the template), amide bonds are formed, and the Rx groups are now coupled to the scaffold via amide bonds. This is thus an example of simultaneous reaction (amide formation) and cleavage (release of the Rx moiety from the anti-codon), see e.g. FIG. 28. FIG. 31, panel B: Analogously to FIG. 31, panel A, three amines react with three esters to form three amide bonds, thereby coupling the functional groups Rx to the scaffold moiety. However, as opposed to FIG. 31, panel A, the scaffold is here encoded by the template, and therefore the scaffold is here part of the functional entity of a building block. FIG. 31, panel C: Three building blocks are used. The nucleophilic amine (covalently attached to the template) attacks the ester carbonyl of the building block bound to coding region 3; the amine of the third monomer attacks the thioester of the next incorporated building block, and after incorporation of the third building block, the Horner-Wittig Emmans reagent of the building block reacts with the aldehyde of the third monomer under alkaline conditions. This forms the templated molecule. The double bond may be post-templating modified by hydrogenation to form a saturated bond, or alternatively, submitted to a Michael addition. FIG. 31, panel D: The thiol of the scaffold reacts with the pyridine-disulfide of the incorporated building block. The amine of the scaffold reacts with the ester of the second incorporated building block. The double nitrile-activated alpha-position is acylated by the thioester of the next building block in the presence of base. Finally, the aryliodide undergoes Suzuki coupling with the arylboronate of monomer 4 to yield the biaryl moiety. FIG. 31, panel E: The incorporated building block acylates one of the primary amines.

(130) The aryliodide undergoes a Suzuki coupling by reaction with the next building block, and the benzylic amine is acylated by last incorporated building block. FIG. 32, panel F: Acylation of the hydrazine followed by cyclization leads to formation of a hydroxypyrazole. After incorporation of the second building block, the arylbromide undergoes Suzuki coupling with the aryl boronate. Finally, the aldehyde reacts with the Horner-Wittig-Emmons reagent of the building block that is next incorporated, to yield an alpha, beta-unsaturated amide, which may be further modified or functionalized by either reduction with H.sub.2/PdC or Michael addition with nucleophiles. Alternatively, a fourth building block might be used to template the coupling of a nucleophilic substituent at the double bond position.

(131) FIG. 33 shows a general procedure of templated synthesis, wherein the reaction step may be performed under conditions where specific annealing of building blocks to the template is inefficient.

(132) It may be desirable to perform the reaction step (or one of the other steps) under conditions where annealing of building blocks is in-efficient. To solve this potential problem, one may covalently link the incorporated building blocks, either chemically or by using a ligase (when the anti-codon comprises an oligonucleotide) or a polymerase (when the anti-codon is e.g. a nucleotide). In this set-up, the template is designed to fold back on itself.

(133) In step 1, the two incorporated building blocks are incorporated and may be ligated together, and be linked to the template, during or after their incorporation. If desired, the conditions may now be changed to increase the efficiency of the reaction step that follows. Then, in step 2, the reactive groups X and Y are brought to react. Because the building blocks are covalently attached to each other (and to the template), the reaction can be performed under conditions where annealing of the building blocks to the template is inefficient. Reaction conditions that may not be compatible with efficient annealing and double helix structure include organic solvents, low salt and high temperature, all of which may be used with the set-up described in this figure.

(134) After step 2 (reaction), the conditions are changed again, in order to allow efficient incorporation and covalent linkage of the next building block (step 3). This cycling between conditions that allow incorporation and ligation, and that allow reaction, is continued until the desired number of building blocks have been incorporated and reacted. Finally, some of the linkers are cleaved to give the templated molecule. As described above, the covalent coupling of the building blocks to each other allows the reaction between their reactive groups to be performed under more diverse conditions than would otherwise be possible. In addition, covalent coupling between building blocks makes it possible to use anti-codons comprising shorter recognition sequences. When the anti-codon comprises an oligonucleotide, it is generally preffered to use an oligonucleotide of at least fifteen nucleotides during incorporation, in order to obtain high efficiency of incorporation. However, if a ligase or chemical is used to covalently couple the building blocks, a shorter oligonucleotide (4-8 nucleotides) may be used. This will bring the reactive groups X and Y into closer proximity, and increase the local concentration of rective groups dramatically: If the distance between the reactive groups is decreased from 16 nucleotides to 4 nucleotides, this will increase the local concentration 4.sup.3=64. Everything else being equal, this will increase the rate of the reaction by 64-fold.

(135) In order to change between conditions that allow incorporation and covalent coupling between building blocks, and conditions that allow the reaction to occur efficiently, the templates may be attached to a solid phase material (e.g., streptavidin beads if the templates are biotinylated), or the templates (with the building blocks associated to them) may be precipitated and resuspended in appropriate buffer during the steps of incorporation and reaction.

(136) FIGS. 34 to 41 show various reaction types allowing simultaneous reaction and activation. Different classes of reactions are shown which mediate translocation of a functional group from one monomer building block to another, or to an anchorage point. The reactions have been grouped into three different classes: Nucleophilic substitutions, addition-elimination reactions, and transition metal catalyzed reactions. These reactions are compatible with simultaneous reaction and activation. FIG. 34, panel A: Reaction of nucleophiles with carbonyls. As a result of the nucleophilic substitution, the functional group R is translocated to the monomer building block initially carrying the nucleophile. FIG. 34, panel B: Nucleophilic attack by the amine on the thioester leads to formation of an amide bond, in effect translocating the functional group R of the thioester to the other monomer building block. FIG. 34, panel C: Reaction between hydrazine and -ketoester leads to formation of pyrazolone, in effect translocating the R and R functional groups to the other monomer building block. FIG. 34, panel D: Reaction of hydroxylamine with -ketoester leads to formation of the isoxazolone, thereby translocating the R and R groups to the other monomer building block. FIG. 35, panel E: Reaction of thiourea with -ketoester leads to formation of the pyrimidine, thereby translocating the R and R groups to the other monomer building block. FIG. 35, panel F: Reaction of urea with malonate leads to formation of pyrimidine, thereby translocating the R group to the other monomer building block. FIG. 35, panel G: Depending on whether ZO or ZNH, a Heck reaction followed by a nucleophilic substitution leads to formation of coumarin or quinolinon, thereby translocating the R and R groups to the other monomer building block. FIG. 35, panel H: Reaction of hydrazine and phthalimides leads to formation of phthalhydrazide, thereby translocating the R and R groups to the other monomer building block. FIG. 36, panel I: Reaction of amino acid esters leads to formation of diketopiperazine, thereby translocating the R group to the other monomer building block. FIG. 36, panel J: Reaction of urea with -substituted esters leads to formation of hydantoin, and translocation of the R and R groups to the other monomer building block. FIG. 36, panel K: Alkylation may be achieved by reaction of various nucleophiles with sulfonates. This translocates the functional groups R and R to the other monomer building block. FIG. 36, panel L: Reaction of a di-activated alkene containing an electron withdrawing and a leaving group, whereby the alkene is translocated to the nucleophile. FIG. 37, panel M: Reaction of disulfide with mercaptane leads to formation of a disulfide, thereby translocating the R group to the other monomer building block. FIG. 37, panel N: Reaction of amino acid esters and amino ketones leads to formation of benzodiazepinone, thereby translocating the R group to the other monomer building block. FIG. 37, panel O: Reaction of phosphonates with aldehydes or ketones leads to formation of substituted alkenes, thereby translocating the R group to the other monomer building block. FIG. 38, panel P: Reaction of boronates with aryls or heteroaryls results in transfer of an aryl group to the other monomer building block (to form a biaryl). FIG. 38, panel Q: Reaction of arylsulfonates with boronates leads to transfer of the aryl group. FIG. 38, panel R: Reaction of boronates with vinyls (or alkynes) results in transfer of an aryl group to the other monomer building block to form a vinylarene (or alkynylarene). FIG. 39, panel S: Reaction between aliphatic boronates and arylhalides, whereby the alkyl group is translocated to yield an alkylarene. FIG. 39, panel T: Transition metal catalysed alpha-alkylation through reaction between an enolether and an arylhallide, thereby translocating the aliphatic part. FIG. 39, panel U: Condensations between e.g. enamines or enolethers with aldehydes leading to formation of alpha-hydroxy carbonyls or alpha,beta-unsaturated carbonyls. The reaction translocates the nucleophilic part. FIG. 40, panel V: Alkylation of alkylhalides by e.g. enamines or enolethers. The reaction translocates the nucleophilic part. FIG. 40, panel W: [2+4] cycloadditions, translocating the diene-part. FIG. 40, panel X: [2+4] cycloadditions, translocating the ene-part. FIG. 40, panel Y: [3+2] cycloadditions between azides and alkenes, leading to triazoles by translocation of the ene-part. FIG. 41, panel Z: [3+2] cycloadditions between nitriloxides and alkenes, leading to isoxazoles by translocation of the ene-part.

(137) FIGS. 42 to 44 show pairs of reactive groups (X) and (Y), and the resulting bond (XY).

(138) A collection of reactive groups that may be used for templated synthesis as described herein are shown, along with the bonds formed upon their reaction.

(139) After reaction, cleavage may be required (e.g., see FIG. 8).

(140) FIG. 45 shows a method of increasing the proximity effect of the template: The Zipper-box.

(141) Panel A discloses linkers carrying oligonucleotide zipper boxes (a) and (b) that are complementary. By operating at a temperature that allows transient interaction of (a) and (b), the reactive groups X and Y are brought into close proximity during multiple annealing and strand-melting events, which has the effect of keeping X and Y in close proximity in a larger fraction of the time than otherwise achievable. Alternatively, one may cycle the temperature between a low temperature (where the zipper boxes pairwise interact stably), and a higher temperature (where the zipper boxes are apart, but where the anti-codon remains stably attached to the codon of the template). By cycling between the high and low temperature several times, a given reactive group X is exposed to several reactive groups Y, and eventually will react to form an XY bond. As a final alternative, the temperature may be kept appropriately low that the two strands of the zipper-box (a and b) are stably associated. Independent on which of these protocols is followed, the building blocks must be added to the reaction mix at an appropriately high temperature where the interaction between the codon and anti-codon is specific. Once the building blocks have been specifically associated with the template, the temperature can be lowered, and the alternative protocols described above followed, in order to achieve a high reaction efficiency.

(142) When the anti-codon is an oligonucleotide (e.g., DNA, RNA) or oligonucleotide analog (e.g., PNA, LNA), it may be practical to use a continuous nucleotide strand, comprising both the anti-codon, linker and zipper-box (see (B) below).

(143) Panel B shows sequences of two DNA oligo-based building blocks. The anti-codon (annealing region), linker and zipper-box are indicated. Thus, in this example, one linear DNA molecule constitutes the anti-codon, the linker that connects the functional entity and the anti-codon, and the zipper-box. The reactive groups X (a carboxylic acid) and Z (an amine) are coupled to the 3-end of DNA oligo 1 and the 5-end of DNA oligo 2, respectively. A template sequence to which oligo 1 and oligo 2 would anneal might contain the following sequence: 5-CCGATGCAATCCAGAGGTCGGCTGGATGCTCGACAGGTC.

(144) FIG. 46 shows three methods of how the proximity effect can be increased:

(145) FIG. 46, panel A: Helix stacking, FIG. 46, panel B Ligation and FIG. 46, panel C Rigid linkers.

(146) FIG. 46, panel A: Helix stacking. Two building blocks with oligonucleotide-based anti-codons anneal to their respective codons (in the figure, the left building block is a scaffold that carries four reactive groups, and the right building block carries a functional entity with e.g. one reactive group, i.e., the latter building block may carry the substituent that will become attached to the scaffold. Double helices tend to stack, especially if the sequence of the opposing ends of the helices has been designed so as to optimize this interaction (for example by the presence of the sequence GGG at the ends of the duplex structures). This stacking tendency will bring the two building blocks into closer proximity, in turn increasing reaction efficiency between the functional entities. If the substituent-building blocks have anti-codons with lower melting temperatures than that of the scaffold-building block, the substituent building block may be removed after its reaction with the scaffold building block, before the next building block is incorporated. In this way, the template region between two reacting building blocks may be kept single stranded, allowing this region to loop out and let the two duplex structures stack during the reaction between the two building blocks.

(147) FIG. 46, panel B: Ligation of building blocks. The anti-codons of two building blocks may be chemically or enzymatically ligated together. Coupling of two anti-codons will increase the annealing efficiency. Therefore, smaller anti-codons can be used if ligated together with the previously incorporated building block. As an example, first add a building block (or just an 20-nucleotide DNA oligo) with a melting temperature of e.g. 60 C. Then add another building block (e.g., with a 8-nucleotide DNA anti-codon) with a low melting temperature and therefore only capable of transiently interacting with the template at the ambient temperature. If a DNA ligase is employed, or if the anti-codon can be ligated to the anti-codon of the first building block chemically, then the second building block will become firmly attached to the template, despite its short length of just 8 nucleotides. Thus, ligation allows the use of shorter anti-codons, which in turn brings the reactive groups into closer proximity.

(148) FIG. 46, panel C: Rigid linkers. By using linkers comprising one or more flexible regions (hinges) and one or more rigid regions, the probability of two functional entities getting into reactive contact may be increased.

(149) a. Symbol used for building block with a rigid part and two flexible hinges.

(150) b. A building block with the characteristics described in (a). The building block contains a continuous oligonucleotide-strand, constituting both the anti-codon (horizontal line), and linker (vertical line) connecting the functional entity (FE) with the anti-codon. Annealing of a complementary sequence to the central part of the linker leads to formation of a rigid double helix; at either end of the linker a single-stranded region remains, which constitutes the two flexible hinges.

(151) FIG. 47 discloses various cleavable linkers. A number of cleavable linkers are shown, as well as the agents that cleave them and the products of the cleavage-reaction. In addition, catalysts including enzymes and ribozymes, may also be used to cleave the linker. Exemplary enzymes are proteases (e.g. chymotrypsin), nucleases, esterases and other hydrolases.

(152) FIG. 48 shows two different ways of templated synthesis by generating a new reactive group. In cases where the reaction of X and Y leads to formation of a new reactive group Z, this may be exploited to increase the diversity of the templated molecule, by incorporating building blocks carrying reactive groups Q that react with Z. Using this approach, the templated molecules may be very compact structures, and thus, this approach describes a method to make highly substituted (functionalized and diverse) libraries of molecules of relatively low molecular weight.

(153) FIG. 48, panel A: First, a building block carrying a reactive group X and a building block carrying a reactive group Y is incorporated, whereafter X and Y react, leading to the formation of the Z bond. Then a building block carrying a reactive group Q is added, whereafter Z reacts with Q, to form the ZQ bond. In this example, both the reaction of X with Y, and of Z with Q, are reactions that involve simultaneous reaction and cleavage.

(154) FIG. 46, panel B: First, a building block carrying a reactive group X and a building block carrying a reactive group Y is incorporated, whereafter X and Y react, leading to the formation of the Z bond. Then a building block carrying a reactive group Q is added, whereafter Z reacts with Q, to form the ZQ bond. In this example, the reaction of Z with Q does not involve simultaneous cleavage, wherefore an additional step of linker cleavage is introduced.

(155) FIG. 49, example 1, shows a templated synthesis by generating a new reactive group. The reaction of the functional entities of the first three building blocks leads to formation of two double bonds, which may react with two hydroxylamines carried in by the building blocks added in the latter steps, and leads to formation of an ester, which may react with the hydroxylamine, encoded by a building block. Finally, the linkers are cleaved, generating the templated molecule.

(156) FIGS. 50 to 52 show different methods of performing post-templating modifications on templated molecule. After the templating process has been performed, the templated molecules may be modified to introduce new characteristics. This list describes some of these post-templating modificiations.

(157) FIG. 53 illustrates one preferred method for selection of template-displaying molecules.

(158) FIGS. 54 to 58 show the proposed complexes that may form when a reaction step is performed using set-ups that allow for stacking of DNA duplexes.

(159) FIG. 59 shows a autoradiography of a polyacrylamide gel analysis of the reaction between building blocks.

(160) FIG. 60 shows the Feuston 3 functional entity as well as the Feuston 5 ligand. Structure 1 shows the Feuston 3 functional entity, which is needed together with Gly and Asp to create Feuston 5 (structure 2). Feuston 5 (structure 2) is a ligand that binds to the v.sub.3 integrin receptor (as described in press; Feuston BP et al. J Med Chem. 2002 Dec. 19;45(26):5640-8)

(161) FIG. 61 shows the structure of the pentenoyl protected aspartate entity used to load an amino modified scaffold oligo, to create the Feuston 5 ligand.

(162) FIG. 62 shows the use of allylglycine building blocks.

(163) FIG. 63 shows the autoradiography of a polyacrylamide gel. The autoradiography shows the three transfers of -Ala to an amino modified scaffold oligo, this scaffold oligo being radioactively labeled. Lanes 1, 3 and 5 shows cross-linked product between scaffold amine and functional entity -Ala AG carboxylic acid fortransfers 1, 2 and 3. Lanes 2, 4 and 6 shows cleaved product, i.e. scaffold carming the transferred functional entity.

(164) FIG. 64 shows an Elisa analysis of the product of the two-step encoding process. The result is from an ELISA done on the feuston 5 ligand generated by seguential transfers to a scaffold oligo (first column). The controls are the RGD peptide, which is an Integrin II and (second column;) loaded on a 20 mer oligo and uncoated wells (no Integrin immobilized; third and fourth columns).

EXAMPLES

(165) In the following examples, building blocks are used which contain a zipper box adjacent to the functional entity. The zipper box sequences are underlined below. The following buffers and protocols are used in the same three examples.

(166) Buffers.

(167) Buffer A (100 mM Hepes pH=7.5; 1 M NaCl)

(168) Buffer B (20 mM Hepes pH=7.5; 200 mM NaCl)

(169) 5-Labeling with .sup.32P.

(170) Mix 5 pmol oligonucleotide, 2 l 10 phosphorylation buffer (Promega cat#4103), 1 l T4 Polynucleotide Kinase (Promega cat#4103), 1 l -.sup.32P ATP, add H.sub.2O to 20 l. Incubate at 37 C. 10-30 minutes.

(171) PAGE (polyacrylamide gel electrophoresis).

(172) The samples are mixed with formamide dye 1:1 (98% formamide, 10 mM EDTA, pH 8, 0.025 % Xylene Cyanol, 0.025% Bromphenol Blue), incubated at 80 C. for 2 minutes, and run on a denaturing 10% polyacrylamide gel. Develop gel using autoradiography (Kodak, BioMax film).

Example 1

(173) The Effect of Alternating Temperature on Reaction Efficiency in the Zipper Box System.

(174) DNA-oligos:

(175) X=Carboxy-dT (Glen Research, cat.no. 10-1035)

(176) 6=Amino-Modifier 5 (cat. Nr. 10-1905)

(177) TABLE-US-00002 AH316: (SEQIDNO:1) 5-6GTAACAGACCTGTCGAGCATCCTGCT AH331: (SEQIDNO:2) 5-CGACCTCTGGATTGCATCGGTGTTACX AH140: (SEQIDNO:3) 5-AGCTGGATGCTCGACAGGTCAGGTCGATCCGCGTTACCAGTCTTGCC TGAACGTAGTCGTCCGATGCAATCCAGAGGTCG

(178) Experimental.

(179) Mix 10 l Buffer A, 1 pmol AH 331 (.sup.32P-labelled), 10 pmol AH 316, 5 pmol AH 140, and add H.sub.20 to 50 l.

(180) Anneal from 80 C. to 30 C. (1 C./30 sek). Then dilute 100 times in buffer B +50 mM DMT-MM. (Prepared according to Kunishima et al. Tetrahedron (2001), 57, 1551) dissolved in ddH.sub.2O.

(181) Incubate at one of 8 different temperature profiles o/n (6 different constant temperatures ( 15 C.; 17.8 C.; 22.7 C.; 28.3 C.; 31.0 C.; or 35.0 C.; or alternating between 10 C. for 5 sec. and 35 C. for 1 sec.); or alternating between 20 C. for 5 sec. and 45 C. for 1 sec). Analyze by 10% urea polyacrylamide gel electrophoresis.

(182) Results.

(183) The polyacrylamide gel analysis showed that a more efficient reaction results from alternating the temperature between 10 C. and 35 C., rather than performing the reaction at a constant temperature of 15 C., 17.8 C., 22.7 C., 28.3 C., 31.0 C., or 35.0 C.

Example 2

(184) The Effect of Stacking on Reaction Efficiency.

(185) DNA-oligos:

(186) X=Carboxy-dT (cat.no. 10-1035)

(187) Z=Amino-Modifier C6 dT (cat.no. 10-1039)

(188) 6=Amino-Modifier 5 (cat.no. 10-1905)

(189) TABLE-US-00003 AH36: (SEQIDNO:4) 5-CGACCTCTGGATTGCATCGGTCATGGCTGACTGTCCGTCGAATGTGT CCAGTTACX AH38: (SEQIDNO:5) 5-AGCTGGATGCTCGACAGGTCCCGATGCAATCCAGAGGTCG AH51: (SEQIDNO:6) 5-ZGTAACACCTGTGTAAGCTGCCTGTCAGTCGGTACTGACCTGTCGA GCATCAGCT AH137: (SEQIDNO:7) 5-ACGACTACGTTCAGGCAAGA AH138: (SEQIDNO:8) 5-TCTTGCCTGAACGTAGTCGTAGGTCGATCCGCGTTACCAGAGCTGGA TGCTCGACAGGTCCCGATGCAATCCAGAGGTCG AH139: (SEQIDNO:9) 5-CGACCTCTGGATTGCATCGG AH143: (SEQIDNO:10) 5-CTGGTAACGCGGATCGACCTTCATTTTTTTTTTTTTTTTTTTTTGGC TGACTGTCCGTCGAATGTGTCCAGTTACX AH202: (SEQIDNO:11) 5-TCTGGATTGCATCGGGTTACX AH270: (SEQIDNO:12) 5-6GTAACGACCTGTCGAGCATCCAGCT AH286: (SEQIDNO:13) 5-AGCTGGATGCTCGACAGGTCAAGTAACAGGTCGATCCGCGTTATATC GTTTACGGCATTACCCGTATAGCCGCTAGATGCCCAACCATGACGGCCCA TAGCTTGCGGCTTGC AH320: (SEQIDNO:14) 5-AGCTGGATGCTCGACAGGTCAGGTCGATCCGCGTTACCAGGCCCATA GCTTGCGGCTTGCTGCAGTCGATGGACCATGCCTCTTGCCTGAACGTAGT CGTCCGATGCAATCCAGAGGTCG AH321: (SEQIDNO:15) 5-CAAGAGGCAT AH322: (SEQIDNO:16) 5-TCAGGCAAGAGGCATGGTCC AH342: (SEQIDNO:17) 5-TACTTGACCTGTCGAGCATCGTTACX AH343: (SEQIDNO:18) 5-6GTAACCAGCTGCAAGCCGCAAGCTATGGGC

(190) Experimental.

(191) Mix buffer A and relevant oligos (see table below).

(192) TABLE-US-00004 Oligo 1 Oligo 3 Experiment (.sup.32P-labelled) Oligo 2 Template Oligo 4 Oligo 5 Buffer A H.sub.2O to 1 5 pmol 10 pmol 10 pmol 2 l 10 l AH 36 AH 51 AH 38 2 5 pmol 10 pmol 10 pmol 10 pmol 10 pmol 2 l 10 l AH 143 AH 51 AH 138 AH 139 AH 137 3 1 pmol 10 pmol 5 pmol 10 l 50 l AH 202 AH 270 AH 320 4 1 pmol 10 pmol 5 pmol 10 l 50 l AH 36 AH 51 AH 320 5 1 pmol 10 pmol 5 pmol 50 pmol 10 l 50 l AH 202 AH 270 AH 320 AH 321 6 1 pmol 10 pmol 5 pmol 50 pmol 10 l 50 l AH 36 AH 51 AH 320 AH 321 7 1 pmol 10 pmol 5 pmol 50 pmol 10 l 50 l AH 202 AH 270 AH 320 AH 322 8 1 pmol 10 pmol 5 pmol 50 pmol 10 l 50 l AH 36 AH 51 AH 320 AH 322 9 0.2 pmol 2 pmol 1 pmol 2 l 10 l AH 342 AH 343 AH 286 10 0.2 pmol 2 pmol 1 pmol 4 pmol 2 l 10 l AH 342 AH 343 AH 286 AH 356 11 0.2 pmol 2 pmol 1 pmol 4 pmol 4 pmol 2 l 10 l AH 342 AH 343 AH 286 AH 357 AH 358

(193) Anneal from 80 C. to 30 C. (1 C./min). Add 0.5 M DMT-MM. (Prepared according to Kunishima et al. Tetrahedron (2001), 57, 1551) dissolved in H.sub.2O. to a final concentration of 50 mM. Incubate at 10 C. for 5 sec. and then 25 C. for 1 sec. Repeat o/n.

(194) Analyze by 10% urea polyacrylamide gel electrophoresis.

(195) Results.

(196) In order to test the effect of stacking of DNA duplexes on reaction efficiency, we designed a number of different set-ups of templates and building blocks (see FIGS. 54 to 58). The following conclusions were reached:

(197) FIG. 54, panel 1 and FIG. 59, lane 1: Reference reaction between two building blocks annealed to adjacent sites on the template. As expected an efficient reaction is observed. In this set-up, the two building blocks anneal to the template and thereby form DNA duplexes that can stack onto each other.

(198) FIG. 54, panel 2 and FIG. 59, lane 2: In this set-up, the two building blocks anneal to adjacent sites on the template. However, the two DNA-duplexes stack onto each other, basically forming one long DNA duplex. This rigid duplex does not allow the two building blocks to bend around the flexible hinge that might otherwise be present at the connection point between the two duplexes (i.e. the position of the nick in the DNA). Consequently, no significant reaction between the two building blocks is observed.

(199) FIG. 54, panel 3 and FIG. 59, lane 3; and FIG. 54, panel 4 and FIG. 59, lane 4: Despite the fact that the two building blocks anneal to sites separated by 80 nucleotides, the reaction is still very efficient. We speculate that this is because of stacking, i.e. the intervening 80 nucleotides are looped out as a consequence of this, and therefore, the two functional entities are brought into close proximity.

(200) In the experiment of FIG. 59, lane 3 the linker that connects the functional entity to the complementing element is short (5 nucleotides); in FIG. 59, lane 4 it is long (35 nucleotides). However, both linker lengths result in an efficient reaction.

(201) FIG. 54, panel 5 and FIG. 59, lane 5; and FIG. 54, panel 6 and FIG. 59, lane 6: The annealing sites and separation between them are identical to those of the experiment described above (FIG. 54, panels 3 and 4; FIG. 54, lanes 3 and 4). In addition, a short oligo (10 nucleotides) has been annealed to the central region of the template. This result in a drastic decrease in reaction efficiency for the building blocks with the short linkers (lane 5); the reaction efficiency of the building blocks with the long linkers is only slightly affected if at all by the annealing of the short oligo. As indicated by the suggested structure of the complexes (FIG. 54, panels 5 and 6), we believe this is because of stacking of the 3 DNA duplexes to generate an extended duplex: The short linkers cannot reach across the extended duplex; the long linkers can reach across the extended duplex structure and the reaction efficiency is not significantly affected.

(202) FIG. 54, panel 7 and FIG. 59, lane 7; and FIG. 54, panel 8 and FIG. 59, lane 8: As immediately above, except that a 20 nucleotide long oligo is annealed to the central region of the template. In this case none of the linkers (short or long) can reach across the extended duplexes, and as a result no or little reaction is observed.

(203) FIG. 54, panel 9 and FIG. 59, lane 9; FIG. 54, panel 10 and FIG. 59, lane 10; and FIG. 54, panel 11 and FIG. 59, lane 11: In these experiments the building blocks are oriented the other way, i.e. the linker connecting the complementing element and the functional entity is near the ends of the template. Additionally, the complementing element of the left building block contains a 5-nucleotide sequence that is complementary to other right end of the template. As a result, the building block should be capable of circularizing the template, as depicted in FIGS. 56 to 58, panels 9-11. These circular structures should also be stabilized by an extended duplex structure across the ends of the template. In the experiments of lanes 10 and 11, a short oligo (10 nucleotides) or two longer oligos (each 20 nucleotides) are annealed to the central region. This has no effect on the reaction efficiency, in correlation with the proposal that the building blocks stack onto each other through a circularization of the template, thereby bringing the functional entities into close proximity.

Example 3

(204) Single Step Transfers of Functional Entities.

(205) DNA-Oligos:

(206) 7=Thiol-Modifier C6 S-S (Glen Research, cat.no.10-1936)

(207) Z=Amino-Modifier C6 dT (10-1039)

(208) P=PC Spacer (10-4913)

(209) TABLE-US-00005 AH136: (SEQIDNO:19) 5-AGCTGGATGCTCGACAGGTCTCTTGCCTGAACGTAGTCGTCCGATGC AATCCAGAGGTCG AH174: (SEQIDNO:20) 5-TACGTTCAGGCAAGAGT6CCAGTTAC7 AH190: 5-ZGTAACACCTGPTGACCTGTCGAGCATC (SEQIDNO:21uptothePandSEQIDNO:39after theP)

(210) Experimental:

(211) Loading of NHM on the DNA-oligo:

(212) Dry 10 nmol DNA oligo (AH174) and then resuspended in 50 l 100 mM DTT (1,4-Dithio-L-Threitol D-9760 Sigma) in 50 mM Phosphate buffer pH=8. Incubate at 37 C. for 1 hour.

(213) Purification on Microspin G-25 (Amersham Biosciences, 27-5325-01).

(214) Add 50 l 200 mM NHM ( N-Hydroxymaleimide Fluka 55510) and incubate at 25 C. for 2 hours.

(215) Purification on Microspin G-25 equilibrated in H.sub.2O.

(216) Loading of building blocks (4-pentenoic-acid, -ala-Boc or CH.sub.3COOH) on the NHM-DNA-oligo:

(217) Mix 50 l 100 mM EDC and 50 p 100 mM building block. Incubate at 25 C. for 30 minutes.

(218) Then mix 500 pmol NHM-DNA-oligo (AH174-NHM) and 10 l of the EDC/building block mix from above. Add 100 mM MES pH=6 to 20 l. Incubate at 25 C. for 5 minutes.

(219) Purification on Micro Bio-Spin Chromatography Columns P6 (Bio-Rad 732-6221) equilibrated in 100 mM MES pH=6.

(220) Transfers:

(221) Mix 350 pmol AH136, 300 pmol AH190 and 500 pmol building block loaded AH 174. Add Buffer A to 50 l.

(222) Anneal from 60 C. to 25 C. (1 C./30 sec.)

(223) Incubate at 10 C. for 5 sec. and then 25 C. for 1 sec. Repeat o/n.

(224) Purification on Micro Bio-Spin Chromatography Columns P6 equilibrated in H.sub.2O.

(225) Results:

(226) The transfers were analyzed by MS, see table below. Transfer efficiencies of 20-34% were observed.

(227) TABLE-US-00006 Transfer efficiency 4-pentenoic-acid -ala-Boc CH.sub.3COOH 3334% 2023% 2933%

Example 4

(228) Multistep Transfer of Functional Entities to a Scaffold Oligonucleotide

(229) In this example three functional entities are transferred to an amino modified scaffold oligo by a three step reaction, and analyzed by a denaturing acrylamide gel using radio labelling.

(230) Loading of Functional Entities on Modified Oligonucleotides to Create Building Blocks.

(231) 5 nmoles of three carboxylic acid modified building block oligos [AH 155; 5CTG GTA ACG CGG ATC GAC CTG TTA CT-COOH 3, SEQ ID NO:22; AH 272 5ACG ACT ACG TTC AGG CAA GAG TTA CT-COOH 3, SEQ ID NO:23; and AH 202 5-TCT GGA TTG CAT CGG CTG TTA CT-COOH 3, SEQ ID NO:24] (all oligonucleotides described ordered from DNA technology, Aarhus, Denmark) one from each of the three positions corresponding to the template were loaded with -Alanine methyl ester coupled to allylglycine n-Boc followed by Boc deprotection (-AlaOMe AG). The loading was done by incubating each of the oligos with 10 mM -AlaOMe AG, 75 mM DMT-MM in 150 mM Hepes-OH buffer, pH 7.5 to a final volume of 50 l at 25 C. shaking overnight. Then adding 5 l 1 M NH.sub.4-acetate, incubated at 25 C. for 10 min, then spin column purified with ddH.sub.2O equilibrated columns (Micro Bic-Spin chromatography columns P-6, Bio-Rad). The deprotection of the methyl group protected acid was done by adding 0.5 l 2M NaOH to the oligos and incubating for 10 min at 80 C. Lastly the oligos were spin column purified and loadings confirmed by mass spectrophotometry.

(232) Transfers of Functional Entities to Scaffold Oligo.

(233) In order to be able to analyze the functional entity transfers using acrylamide gel analysis, the scaffold oligo [MDL251 5amino-C6 dT-ACC TGT CGA GCA TCC AGC T 3, SEQ ID NO:25] was radioactively labelled in the 3 end. 50 pmol of the oligo was labelled with 10 l ddATP P32 (Amersham Biosciences) by adding 4 l 10NEbuffer 4, 4l 10CoCl2 and 35 units of terminal deoxynucleotide transferase (New England Biolabs) and water to a final volume of 40 l. Mixture incubated at 37 C. for 1 hour. Labeled oligo purified using ddH2O equilibrated spin column.

(234) 12.5 pmol of the labeled scaffold oligo, 125 pmol loaded building block oligo AH 202, corresponding to position three on the template and 62.5 pmol template [AH 154 5 AGC TGG ATG CTC GAC AGG TCA AGT AAC AGG TCG ATC CGC GTT ACC AGT CTT GCC TGA ACG TAG TCG TCC GAT GCA ATC CAG AGG TCG 3 as follows, SEQ ID NO:26] was incubated in a final volume of 45 l containing 20 mM Hepes-OH pH 7.5, 200 mM NaCl buffer. The oligos were annealed by heating to 80 C. and slowely going down to 20 C. (1/min) using a thermocycler (Eppendorf, Mastergradient) Following the annealing 5 l 0.5M DMT-MM was added. Sample crosslinked, see FIG. 32 overnight cycling at 10 C. 10 sec/35 C. 1 sec.

(235) The sample was spin column purified and the crosslinked product cleaved to give first transfer of -Ala to scaffold oligo amine by adding 10 l 25 mM 12 dissolved in 1:1 tetrahydrofuran:H2O and incubated at 37 C. for 1.5 hours. Followed by addition of 1.5 l M -mercapotethanol and then purified with two equilibrated spin columns. The sample was completely dried down and oligos redissolved in 30 l ddH20. Transfer 2, oligo AH 272 and transfer 3, AH 202 were done in the exact same way as just described including the annealing, crosslinking and cleavage. For each remaining round adding same amount of building block oligo, 125 pmol.

(236) Samples for analysis were taking out along the way, before and after crosslinking for the three transfers, which were analyzed on a 10% acrylamide denaturing gel, see FIG. 63. As can be seen, crosslinking efficiency (step 1) was approximately 50% (FIG. 63, lane 1). This was followed by an almost 100% efficient cleavage (lane 2), which results in the transfer of the -Ala moiety onto the scaffold. This is followed by the crosslinking/cleavage of step 2 and 3 (lanes 3+4, 5+6) to generate the final product on the scaffold oligo. The product thus contains the three transferred -Ala moieties.

Example 5

(237) Two-step Transfer and Functional Analysis by ELISA.

(238) In this example two entities are transferred to a scaffold oligo by a two-step reaction to produce a ligand, Feuston 5 (see FIG. 60) that binds to the V3 integrin receptor. The product of the two-step process was analyzed by Elisa.

(239) Loading of Functional Entities on Modified Oligonucleotides to Create Building Blocks.

(240) Two building block oligos were used, AH 155 (see above) loaded with Feuston 3 allylglycine. Feuston 3 is a derivative of the Feuston 5 ligand see FIG. 60 (F3OMeAG) and AH 272 (see above) loaded with glycine allylglycine (GlyO-MeAG) according to the above protocol (example Xa) for loadings of allylglycine functional entities to carboxylic acid modified oligos. 10 nmoles of each was loaded in two reactions each.

(241) To create the Feuston 5 ligand aspartate is also needed. Therefore aspartate which was loaded as a pentenoyl (amine) and methyl (carboxylic acid) protected functional entity see FIG. 61, to an amino modified scaffold oligo [AH 270 ;5 amino-GTA ACG ACC TGT CGA GCA TCC AGC T 3, SEQ ID NO:27]. The loading was done by mixing 25 l 150 mM EDC (N-(3-Dimethylaminopropyl)-N-ethylcarbodiimide hydrochloride, Fluka), 25 l NHS (N-hydroxysuccinimide, Sigma) and 5 l 100 mM of the pentenoyl protected. aspartate functional entity, all reagents were dissolved in N,N-dimethylformamide, DMF. Incubated at 25 C. for 40 min. To this mixture 5 nmol of the scaffold oligo, AH 270 resuspended in 30 l 150 mM Hepes-OH pH 7.5 was added and this incubated shaking over night at 25 C. The amine pentenoyl protection group was deprotected by adding 20 l 25 mM I2 dissolved in 1:1 tetrahydrofuran:water and incubated at 37 C. for 2 hours. Followed by spin column purification, and loading confirmed by mass spectrum analysis.

(242) Transfers of Functional Entities to Scaffold Oligo.

(243) The transfers were done in the same manner as described above, but using larger amounts of oligo to ensure there being enough ligand created to give a sufficient signal in the ELISA. For the first round the following amounts were used: 850 pmol loaded scaffold oligo; AH 270, 7500 pmol loaded building block oligo; AH 272 and 3250 pmol template oligo AH 140 [5 AGC TGG ATG CTC GAC AGG TCA GGT CGA TCC GCG TTA CCA GTC TTG CCT GAA CGT AGT CGT CCG ATG CAA TCC AGA GGT CG 3, SEQ ID NO:28]. The second round, adding 7500 pmol loaded building block oligo AH 155 for a transfer.

(244) The created Feuston 5 ligand on the scaffold oligo still had a methyl group protected acid on the aspartate, which was deprotected just as described before. By adding 0.5 l 2 M NaOH to the oligos and incubating at 80 C. for 10 min. The sample this time though was pH calibrated with 0.5 l 2 M HCl and was now ready for the ELISA analysis.

(245) ELISA assay

(246) Maxisorb plates (Nunc Immunomodule U8 Maxisorp. Biotecline) were coated with V3 integrin receptor 0.1 g/well in PBS over night at 4 C. The wells were blocked with 300 l blocking buffer containing PBS, 0.05% Tween 20 (Sigma), 1% BSA (Sigma), 0.1 mg/mL herring sperm DNA (Sigma), for 3 hours at room temperature. Wells were washed 5*300 l using wash buffer containing PBS, 0.05% Tween 20, 1% BSA. The sample prepared above containing the displayed Feuston 5 ligand on a scaffold oligo was added to a well, control for the experiment being a 20 mer oligo loaded with the RGD peptide, a well known and well described ligand for this integrin receptor (loaded according to above described method for the pentenoyl and methyl protected aspartate functional entity). The incubation with these ligands was done in ligand binding buffer containing PBS, 1 mM MnCl2, 1 mg/mL BSA at room temperature for one hour. Washed in washing buffer 5*300 l. Incubated with 100 l horseradish peroxidase-streptavidine (Endogen) diluted 1:10000 times in wash buffer, incubated for one hour at room temperature. Washed again in 5*300 l wash buffer. 100 l 3,3,5,5-tetrametylbenzidine hydrogenperoxidase (TMB substrate, Kem-en-tec) added and incubated at room temperature until color development. 100 l 0.2 M sulphuric acid added, color measured at 450 nm, see FIG. 64. As can be seen the Feuston 5 ligand generated by the two-step encoding procedure is active and binds the integrin receptor with relatively high efficiency.