Microfluidic device for detecting target gene, method for manufacturing same, and method for detecting using same
10731208 · 2020-08-04
Assignee
- EWHA UNIVERSITY—INDUSTRY COLLABORATION FOUNDATION (Seoul, KR)
- Korea Advanced Institute Of Science And Technology (Daejeon, KR)
Inventors
Cpc classification
B01L2200/12
PERFORMING OPERATIONS; TRANSPORTING
B01L3/502707
PERFORMING OPERATIONS; TRANSPORTING
B01L7/00
PERFORMING OPERATIONS; TRANSPORTING
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
B01L2300/0864
PERFORMING OPERATIONS; TRANSPORTING
B01L3/00
PERFORMING OPERATIONS; TRANSPORTING
B01L3/502715
PERFORMING OPERATIONS; TRANSPORTING
B01L2300/16
PERFORMING OPERATIONS; TRANSPORTING
B01L2300/0816
PERFORMING OPERATIONS; TRANSPORTING
B01L3/502761
PERFORMING OPERATIONS; TRANSPORTING
International classification
B01L7/00
PERFORMING OPERATIONS; TRANSPORTING
B01L3/00
PERFORMING OPERATIONS; TRANSPORTING
Abstract
The present invention provides facile and accurate molecular diagnosis of disease-specific genes capable of the naked eye detection through amplifying the target genes to selectively block the fluid path in a microfluidic device. Specifically, the present invention includes an isothermal amplification of target genes through a rolling circle amplification, a microfluidic device for detecting pathogen genes, and a detection method using the same. Therefore, the present invention can conveniently detect a single target gene, such as a single pathogen, or at the same time, several target genes, such as several pathogens, without complicated mechanical equipment.
Claims
1. A microfluidic device for detecting a target gene comprising: a board; an inlet which is formed on the board and through which a sample solution is introduced from outside the microfluidic device; a first channel connected to the inlet to accommodate the introduced sample solution; a second channel connected to the first channel; an outlet connected to the second channel; a surface coating on the second channel; a primer immobilized on the surface coating of the second channel; and a template complementarily binding to the primer, wherein: (a) the template is SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:10, SEQ ID NO:11 or SEQ ID NO:16, (b) the template comprises target binding regions complementary to a target gene, a primer binding region complementary to the primer, and in-template complementary binding regions, (c) the target binding regions complementary to the target gene are separately located at both ends of the template, (d) the primer binding region complementary to the primer is located between the in-template complementary binding regions, (e) a first one of the in-template complementary binding regions is located between the primer binding region and a first one of the target binding regions, (f) a second one of the in-template complementary binding regions is located between the primer binding region and a second one of the target binding regions, and (g) the in-template complementary binding regions are configured to complementarily bind to each other to form the dumbbell shape.
2. The microfluidic device of claim 1, wherein the second channel comprises 1 to 20 channels.
3. The microfluidic device of claim 1, wherein the second channel comprises 1 to 20 channels, which diverge from an end of the first channel, and the template complementarily binding to the primer immobilized on the surface coating of each second channel binds to the same or a different target gene.
4. The microfluidic device of claim 1, wherein the second channel is surface-coated with at least one member selected from the group consisting of 5-hydroxydopamine HCl, norepinephrine, epinephrine, pyrogallol amine, 3,4-Dihydroxyphenylalanine, catechin, tannins, pyrogallol, pyrocatechol, heparin-catechol, chitosan-catechol, poly(ethylene glycol)-catechol, poly(ethyleneimine)-catechol, poly(methyl methacrylate)-catechol, hyaluronic acid-catechol, polylysine-catechol, and polylysine.
5. The microfluidic device of claim 1, wherein the primer has an end modified with at least one member selected from the group consisting of thiol, amine, hydroxyl, carboxyl, isothiocyanate, NHS ester, aldehyde, epoxide, carbonate, HOBt ester, glutaraldehyde, carbamate, imidazole carbamate, maleimide, aziridine, sulfone, vinylsulfone, hydrazine, phenyl azide, benzophenone, anthraquinone, and diene.
6. The microfluidic device of claim 1, wherein the surface coating comprises 5-hydroxydopamine HCl, and the primer has an end modified with a thiol group or an amine group.
7. The microfluidic device of claim 1, wherein the target gene is derived from at least one member selected from the group consisting of avian influenza, SARS, Escherichia coli O157:H7, Mycobacterium tuberculosis, Bacillus anthracis, Streptococcus pneumonia, Plasmodium, Salmonella, Hepatitis A, B, C, D and E virus, Francisella tularensis, Yersinia pestis, Yersinia enterocolitica, Ebola virus, and MERS-Cov virus.
8. A microfluidic device kit for detecting a target gene comprising: the microfluidic device for detecting the target gene of claim 1; a dNTP; a ligase; and an isothermal nucleic acid polymerase.
9. The microfluidic device kit of claim 8, wherein the ligase is a DNA ligase, and the isothermal nucleic acid polymerase is phi29 polymerase.
10. The microfluidic device kit of claim 8, further comprising a dye reagent, a high salt solution, or a fluorescent reagent.
11. A method for manufacturing the microfluidic device for detecting a target gene according to claim 1 comprising: (S1) providing a microfluidic device comprising a board, an inlet which is formed on the board and through which a sample solution is introduced from outside the microfluidic device, a first channel connected to the inlet to accommodate the introduced sample solution, a second channel connected to the first channel, and an outlet connected to the second channel; (S2) coating the second channel of the microfluidic device to provide a coated second channel; (S3) immobilizing a primer to bind to a template on the coated second channel; and (S4) binding, to the primer, a template comprising the target binding regions complementary to a target gene, the primer binding region complementary to the primer, and the in-template complementary binding regions, wherein: (a) the target binding regions complementary to the target gene are separately formed at both ends of the template, (b) the primer binding region complementary to the primer is formed between the in-template complementary binding regions, (c) the first one of the in-template complementary binding regions is located between the primer binding region and the first, one of the target binding regions, (d) the second one of the in-template complementary binding regions is located between the primer binding region and the second one of the target binding regions, and (e) the in-template complementary binding regions are configured to complementarily bind to each other to form the dumbbell shape.
12. A method for detecting a target gene using the microfluidic device for detecting the target gene of claim 1 comprising: (S1) providing the microfluidic device for detecting the target gene of claim 1; (S2) introducing a sample solution into the first channel; and (S3) adding a dNTP, a ligase, and an isothermal nucleic acid polymerase to the second channel of the microfluidic device for detecting the target gene.
13. The method of claim 12, comprising (S4) allowing amplified gene products to flocculate to form hydrogel with a diameter of 50 m to 5 mm on the second channel and an outlet.
14. The method of claim 13, further comprising (S5) adding a dye reagent, a high salt solution, or a fluorescent reagent.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1) The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
BEST MODE FOR CARRYING OUT THE INVENTION
(16) Hereinafter, embodiments are described in detail with reference to the drawings in order to aid the understanding of the present invention. The following embodiments, however, are provided only to illustrate the present invention, and the scope of the present invention should not be limited to the following embodiments and may include different embodiments. In the drawings, the widths, lengths, and thicknesses of elements may be exaggerated for clarity. Like reference numerals refer to like elements throughout the specification. Further, it will be understood that when an element is referred to as being on another element, the element may be directly on another element or an intervening element.
<Preparative Embodiment 1> Manufacture of Template
(17) (1) Manufacture of Template_BA
(18) A Bacillus anthracis-specific template (Template_BA), which is a template specifically binding to Bacillus anthracis (Template_BA, SEQ ID NO:10), was manufactured based on the pathogen gene sequence of Bacillus anthracis (Integrated DNA Technology, San Jose, Calif., USA). Template_BA includes: binding regions complementary to a target gene (pathogen gene of Bacillus anthracis), which are pathogen complementary sites (20 mer, bold letters in a white background); in-template complementary binding regions to form a dumbbell shape, which are in-template complementary regions (21 mer2, 42 mer in total, italic); and a binding region complementary to a primer, which is a primer immobilization region (37 mer), wherein the binding region complementary to the primer is indicated in underlined italic type.
(19) TABLE-US-00004 5/5Phos/TTTGAAATGGAGAAAATCGAAGTACTCAGC GTAAGTTTAGAGGTAGCATGCTAGTATCGACGTACG TACCAACTTACGCTGAGTACTTCGATTTGAGCG-3
(20) (2) Manufacture of Template_E
(21) A Ebola virus s-specific template (Template_E), which is a template specifically binding to Ebola virus (Template_E, SEQ ID NO:11), was manufactured based on the pathogen gene sequence of Ebola virus. Template_E includes: binding regions complementary to a target gene (pathogen gene of Ebola virus), which are pathogen complementary sites (25 mer, bold letters in a white background); in-template complementary binding regions to form a dumbbell shape, which are in-template complementary regions (21 mer2, 42 mer in total, italic); and a binding region complementary to a primer, which is a primer immobilization region (37 mer), wherein the binding region complementary to the primer is indicated in underlined italic type.
(22) TABLE-US-00005 5/5Phos/GACGCACGCGAATCGAAGTACTCAGCGTA AGTTTAGAGGTAGCATGCTAGTATCGACGTACGTAC CAACTTACGCTGAGTACTTCGATTAACGAGAAATCG CAC-3
<Embodiment 1> Microfluidic Device for Detecting Target Gene
(23) An illustrative configuration of a microfluidic device for detecting a target gene according to the present invention is described with reference to
(24) Referring to
(25) To ease immobilization of the primer on the second channel, the second channel may be coated to have a functional group to combine with the primer. Also, the primer may be modified to have a functional group to combine with the functional group on the second channel.
<Embodiment 2> Manufacture of Microfluidic Device for Detecting Target Gene (Device for Detecting Pathogen Gene)
Embodiment 2-1: Method for Manufacturing Microfluidic Device for Detecting Single Target Gene (Method for Manufacturing Microfluidic Device for Detecting Single Pathogen (Bacillus anthracis) Gene
(26) Operation 1: Operation of Providing Microfluidic Device
(27) According to one embodiment of the present invention, a microfluidic device (1 III.sup.3in1 uncoated Microscopy Chamber (ibidi)) was prepared to manufacture a microfluidic device for detecting a target gene (microfluidic device for detecting a pathogen gene). The microfluidic device of the present invention includes a board 100; an inlet 101 which is formed on the board and through which a sample solution is introduced from the outside; a first channel 102 connected to the inlet to accommodate the introduced sample solution; a second channel 103 connected to the first channel; and an outlet 104 connected to the second channel (see
(28) Operation 2: Operation of Coating Second Channel of Microfluidic Device
(29) 1 mg/ml of 5-hydroxydopamine HCl (Sigma Aldrich) was dissolved in a 10 mM Tris buffer (1M UltraPure 1M Tris-HCl, pH 8.0, Invitrogen). Next, the pH of the resulting product was adjusted to 8, thereby preparing a coating composition. The second channel of the device (1 III.sup.3in1 uncoated Microscopy Chamber (ibidi)) was filled with the coating composition. After two hours, the second channel was washed using DDW (Water Purification System, LABOGENE).
(30) Operation 3: Operation of Immobilizing (Combining) Primer Binding to Template on Coated Second Channel
(31) Primer-5SS-polyA9 (BIONEER, SEQ ID NO:9) was used as a primer.
(32) After preparing 100 pmol of the primer and 5M DTT (DL-Dithiothreitol, Sigma Aldrich), 100 pmol of the primer and 5 l of 5 M DTT were mixed, and DDW (Water Purification System, LABOGENE) was added thereto to 50 l in total. The mixture was subjected to DDT processing for four hours to break a disulfide bond of the primer, after which remaining DTT was eliminated using a 3K Amicon tube (Amicon Ultra Centrifugal Filters 3K, MILLIPORE) (Eppendorf Centrifuge 5415R) (centrifugation was performed twice in total in order to thoroughly eliminate DTT, including first centrifugation for 25 minutes at 132,000 rpm and 4 C. and second centrifugation for 25 minutes at 132,000 rpm and 4 C. with addition of 40 l of DDW). 5 l of the solution obtained by eliminating DTT was put into each of the three branches of the second channel 103 (channel 1: the left branch of the second channel of
(33) Operation 4: Operation of Combining Template Including Binding Region Complementary to Target Gene, Binding Region Complementary to Primer, and In-Template Complementary Binding Region to Form Dumbbell Shape with Primer (Primer-template Combining Operation)
(34) Referring to
Embodiment 2-2: Method for Manufacturing Microfluidic Device for Detecting Two or More Target Genes (Method for Manufacturing Microfluidic Device for Detecting Two or More Pathogen (Bacillus anthracis and Ebola Virus) Genes
(35) Operation 1: Operation of Providing Microfluidic Device
(36) According to one embodiment of the present invention, a microfluidic device (1 III.sup.3in1 uncoated Microscopy Chamber (ibidi)) was prepared to manufacture a microfluidic device for detecting a target gene (microfluidic device for detecting a pathogen gene). The microfluidic device of the present invention includes a board 100; an inlet 101 which is formed on the board and through which a sample solution is introduced from the outside; a first channel 102 connected to the inlet to accommodate the introduced sample solution; a second channel 103 connected to the first channel; and an outlet 104 connected to the second channel (see
(37) Operation 2: Operation of Coating Second Channel of Microfluidic Device
(38) 1 mg/ml of 5-hydroxydopamine HCl (Sigma Aldrich) was dissolved in a 10 mM Tris buffer (1M UltraPure 1M Tris-HCl, pH 8.0, Invitrogen). Next, the pH of the resulting product was adjusted to 8, thereby preparing a coating composition. The second channel of the device (1 III.sup.3in1 uncoated Microscopy Chamber (ibidi)) was filled with the coating composition. After two hours, the second channel was washed using DDW (Water Purification System, LABOGENE).
(39) Operation 3: Operation of Immobilizing (combining) Primer Binding to Template on Coated Second Channel
(40) Primer-5SS-polyA9 (BIONEER, SEQ ID NO:9) was used as a primer.
(41) After preparing 100 pmol of the primer and 5M DTT (DL-Dithiothreitol, Sigma Aldrich), 100 pmol of the primer and 5 l of 5 M DTT were mixed, and DDW (Water Purification System, LABOGENE) was added thereto to 50 l in total. The mixture was subjected to DDT processing for four hours to break a disulfide bond of the primer, after which remaining DTT was eliminated using a 3K Amicon tube (Amicon Ultra Centrifugal Filters 3K, MILLIPORE) (Eppendorf Centrifuge 5415R) (centrifugation was performed twice in total in order to thoroughly eliminate DTT, including first centrifugation for 25 minutes at 132,000 rpm and 4 C. and second centrifugation for 25 minutes at 132,000 rpm and 4 C. with addition of 40 l of DDW). 5 l of the solution obtained by eliminating DTT was put into each of the three branches of the second channel 103 (channel 1: the left branch of the second channel of
(42) Accordingly, the primer may be immobilized on the second channel of the microfluidic device (see A of
(43) Operation 4: Operation of Combining Template Including Binding Region Complementary to Target Gene, Binding Region Complementary to Primer, and In-Template Complementary Binding Region to Form Dumbbell Shape with Primer (Primer-Template Combining Operation)
(44) Referring to
(45) Accordingly, the primer immobilized on the second channel may be combined with the templates (see B of
<Embodiment 3> Method for Detecting Target Gene Using Microfluidic Device for Detecting Target Gene
(46) Principle of Detecting Target Gene
(47) A method for detecting a target gene using a microfluidic device for detecting a target gene is based on a principle in which a closed-form dumbbell-shaped template with a nick disappearing is ligated only in the presence of a target gene (for example, a pathogen gene) and is subsequently amplified by rolling circle amplification (RCA) to for a self-assembled precise structure of particles (see
(48)
(49) An isothermal nucleic acid polymerase performs RCA of infinitely repetitively replicating nucleic acid using the closed-form template for detecting the target gene as a template until a dNTP is exhausted (see
Embodiment 3-1: Method for Detecting Target Gene Using Microfluidic Device for Detecting Single Target Gene (Method for Detecting Single Target Pathogen (Bacillus anthracis) Gene Using Microfluidic Device for Detecting Single Target Gene)
(50) Operation 1: Operation of Providing Microfluidic Device for Detecting Single Target Gene (Microfluidic Device for Detecting Single Pathogen (Bacillus anthracis) Gene) According to Embodiment 2-1
(51) A microfluidic device for detecting a single target gene was provided (prepared). Specifically, a microfluidic device for detecting a single target gene (microfluidic device for detecting a single pathogen (Bacillus anthracis) gene) was provided according to Embodiment 2-1.
(52) Operation 2: Operation of Introducing Sample Solution into First Channel
(53) (1) Preparation of Sample Solution
(54) A sample (Pathogen_BA, SEQ ID NO:12) was prepared based on the pathogen gene sequence of Bacillus anthracis by order from Bioneer (HPLC Purification). A sample solution was prepared using Pathogen_B_A 100 in 1PBS.
(55) Table 4 below illustrates the template and pathogen sequence of Bacillus anthracis used in Embodiment 3.
(56) TABLE-US-00006 TABLE4 Pathogen SEQID Templatesequence SEQID Pathogen kind NO: (5.fwdarw.3) NO: sequence Bacillus 10 5-phosphateTTTGAAATGGAG 12 5-TTCTCCATT anthracis AAAATCGAAGTACTCAGCGTA TCAAACGCT AGTTTAGAGGTAGCATGCTAG CA-phosphate-3 TATCGACGTACGTACCAACTT ACGCTGAGTACTTCGATTTGA GCG-3
(57) (2) Operation of Introducing Sample Solution Prepared in (1) to First Channel
(58) 60 l of the sample solution prepared in (1) was introduced into a first channel through an inlet of the microfluidic device for detecting the single target gene. The sample solution, introduced into the first channel of the microfluidic device for detecting the single target gene, transferred by capillarity to the second channel via the first channel. After being left for two hours, the device was washed with DDW (Water Purification System, LABOGENE).
(59) Operation 3: Ligation of Single Target Gene (Single Pathogen (Bacillus anthracis) Gene) Included on Sample Solution and Template
(60) The sample solution introduced into the first channel flowed into the second channel by capillarity.
(61) Next, the second channel of the microfluidic device for detecting the single target gene was filled with 30 l of 2 T7 ligase, 5 l of T7 ligase 5, 0.2 l of 100 mM DTT, and 24.8 l of DDW (Water Purification System/LABOGENE). To prevent the evaporation of moisture in the device, the mixtures were allowed to react with the sample solution in a plastic container sealed with a parafilm. The plastic container was filled with tissue dampened with water and 25 C. water. Next, the reactants were subjected to reaction with no shaking at 25 C. for three hours in a shaking incubator (VS-8480 (VISION SCIENNTIFIC CO)).
(62) Operation 4: Amplification (Rolling Circle Amplification) of Ligated Gene Product
(63) Next, the second channel of the microfluidic device for detecting the single target gene was filled with 2 l of 25 mM dNTP, 6 l of 10 T7 ligase reaction buffer (Biolabs), 50 l of phi 29 polymerase (10 unit/l), 1 l of pyrophosphatase, and 1 l of 100 mM DTT. Reaction was carried out in a plastic container sealed with a parafilm in order to prevent the evaporation of moisture in the second channel of the microfluidic device for detecting the single target gene. The plastic container was filled with tissue dampened with water and 30 C. water. Next, the reactants were subjected to reaction with no shaking at 30 C. for three hours in a shaking incubator (VS-8480 (VISION SCIENNTIFIC CO)).
(64) Operation 5: Detection of Amplified Target Gene Product (Identification of Detected Target Gene)
(65) 50 l of a 1:1000 GelRed (GelRed, Biotium) dilution (diluted with DDW (Water Purification System, LABOGENE)) was added as a detection composition through the inlet. A 1:200 GelRed (GelRed, Biotium) dilution was allowed to flow to the second channel via the first channel. Although GelRed (GelRed, Biotium) diluted at 1:10000 is generally used, the dilution rate of GelRed is adjusted to see the color with the naked eye and is not limited thereto.
(66) Referring to a of
Embodiment 3-2: Method for Detecting Target Gene Using Microfluidic Device for Detecting Two or More Target Genes (Method for Detecting Single Target Pathogen (Bacillus Anthracis and Ebola Virus) Gene Using Microfluidic Device for Detecting Two or More Target Genes)
(67) Operation 1: Operation of Providing Microfluidic Device for Detecting Two or More Target Genes (Microfluidic Device for Detecting Two or More Pathogen (Bacillus Anthracis and Ebola Virus) Genes) According to Embodiment 2-2
(68) A microfluidic device for detecting two or more target genes was provided (prepared). Specifically, a microfluidic device for detecting two or more target genes (microfluidic device for detecting two or more pathogen (Bacillus anthracis and Ebola virus) genes) was provided according to Embodiment 2-2.
(69) Operation 2: Operation of Introducing Sample Solution into First Channel
(70) (1) Preparation of Sample Solution
(71) A sample (Pathogen_BA, SEQ ID NO:12) was prepared based on the pathogen gene sequence of Bacillus anthracis by order from Bioneer (HPLC Purification). A sample solution was prepared using Pathogen_B_A 100 in 1PBS.
(72) (2) Preparation of Sample
(73) Samples (Pathogen_BA, SEQ ID NO:12 and Pathogen_E, SEQ ID NO:13) were prepared based on the pathogen gene sequences of Bacillus anthracis and Ebola virus by order from Bioneer (HPLC Purification). A sample solution was prepared using Pathogen_B_A 100 in 1PBS. Further, a sample solution was prepared using Pathogen_E 100 in 1PBS.
(74) Table 5 below illustrates the templates and pathogen sequences of Bacillus anthracis and Ebola virus used in Embodiment 2.
(75) TABLE-US-00007 Pathogen SEQID Templatesequence SEQID Pathogen kind NO: (5.fwdarw.3) NO: sequence Bacillus 10 5-phosphate-TTTGAAATGGAG 12 5-TTCTCCATT anthracis AAAATCGAAGTACTCAGCGTA TCAAACGCT AGTTTAGAGGTAGCATGCTAG CA-phosphate-3 TATCGACGTACGTACCAACTT ACGCTGAGTACTTCGATTTGA GCG-3 Ebola 11 5-phosphate-GACGCACGCGAATC 13 5-CGCGTG virus GAAGTACTCAGCGTAAGTTTA CGTCGTGCG GAGGTAGCATGCTAGTATCGA ATTTCTCGT CGTACGTACCAACTTACGCTG T-phosphate-3 AGTACTTCGATTAACGAGAAA TCGCAC-3
(76) (2) Operation of Introducing Sample Solution Prepared in (1) to First Channel
(77) 60 l of the sample solution prepared in (1) was introduced into a first channel through an inlet of the microfluidic device for detecting the single target gene. The sample solution, introduced into the first channel of the microfluidic device for detecting the single target gene, transferred to the second channel via the first channel. 5 l of total 20 l Template_E and 5 l of total 20 l Template_B_A were put into channel 2 and channel 3 of the second channel. After being left for two hours, the device was washed with DDW (Water Purification System, LABOGENE).
(78) Operation 3: Ligation of Two or More Target Genes (Two or More Pathogen (Bacillus Anthracis and Ebola Virus) Genes)) Included in Sample Solution and Template
(79) The second channel of the microfluidic device for detecting the single target gene was filled with 30 l of 2 T7 ligase, 5 l of T7 ligase 5, 0.2 l of 100 mM DTT, and 24.8 l of DDW (Water Purification System/LABOGENE). To prevent the evaporation of moisture in the device, reaction was carried out in a plastic container sealed with a parafilm. The plastic container was filled with tissue dampened with water and 25 C. water. Next, the reactants were subjected to reaction with no shaking at 25 C. for three hours in a shaking incubator (VS-8480 (VISION SCIENNTIFIC CO)).
(80) Accordingly, the target gene (pathogen gene) present in the sample complementarily bound to the specific template to form a ring-shaped template (see C of
(81) Operation 4: Amplification (Rolling Circle Amplification) of Ligated Gene Product
(82) <Method 1>
(83) Next, the second channel of the microfluidic device for detecting the two or more target genes was filled with 2 l of 25 mM dNTP, 6 l of 10 T7 ligase reaction buffer (Biolabs), 50 l of phi 29 polymerase (10 unit/l), 1 l of pyrophosphatase, and 1 l of 100 mM DTT. Reaction was carried out in a plastic container sealed with a parafilm in order to prevent the evaporation of moisture in the second channel of the microfluidic device for detecting the two or more target genes. The plastic container was filled with tissue dampened with water and 30 C. water. Next, the reactants were subjected to reaction with no shaking at 30 C. for three hours in a shaking incubator (VS-8480 (VISION SCIENNTIFIC CO)).
(84) <Method 2>
(85) Next, the second channel of the microfluidic device for detecting the two or more target genes was filled with 2 l of 25 mM dNTP, 1 l of 0.4 mM Biotin-14-dCTP, 2 l of 10 T7 ligase reaction buffer (Biolabs), 5 l of phi 29 polymerase (500 unit/l), 1 l of pyrophosphatase, 0.8 l of 100 mM DTT, and 6.2 l of DDW. Reaction was carried out in a plastic container sealed with a parafilm in order to prevent the evaporation of moisture in the second channel of the microfluidic device for detecting the two or more target genes. The plastic container was filled with tissue dampened with water and 30 C. water. Next, the reactants were subjected to reaction at 30 C. for three hours in a shaking incubator (VS-8480 (VISION SCIENNTIFIC CO)).
(86) The target gene (nucleic acid) may be amplified by RCA according to Method 1 or Method 2 (see D of
(87) Operation 5: Detection of Amplified Target Gene Product (Identification of Detected Target Gene)
(88) A tangled single-strand rolling-circle-amplified gene product (see E of
(89) <Detection Method Related to Method 1 of Operation 4>
(90) 50 l of a 1:1000 GelRed (GelRed, Biotium) dilution (diluted with DDW
(91) (Water Purification System, LABOGENE)) was added as a detection composition through the inlet. A 1:80 GelRed (GelRed, Biotium) dilution was allowed to flow to the second channel via the first channel.
(92) Referring to b of
(93) <Detection Method Related to Method 2 of Operation 4>
(94) Streptavidin beads were used as a detection composition. Specifically, 50 l of a 1:20 Streptavidin Fluoresbrite YG Microspheres 2.0 Micro dilution (diluted with DDW (Water Purification System, LABOGENE)) was added through the inlet.
(95) Referring to
<Experimental Embodiment 1> Identification of Electrophoresis Result of Each Operation
(96) An experiment was conducted to identify binding and ligation of Template_BA manufactured in Preparative Embodiment 1 and the pathogen using an electrophoresis result. In Experimental Embodiment 1, the experiment was simply performed in a tube to identify reaction of the template of Preparative Embodiment 1 and the pathogen. Further, a thermo cycler was used for tests in different reaction conditions. In addition, an experiment was conducted to identify binding and ligation of Template_E manufactured in Preparative Embodiment 1 and the pathogen using an electrophoresis result. In the tube experiment, since the template was not immobilized to the primer, phosphate was not attached to the 3 end of each pathogen, that is, the 3 end of the pathogen gene.
(97) (1) Identification of Annealing Operation
(98) A template for 100 Bacillus anthracis (Template_BA, SEQ ID NO:10) was diluted with DEPC (Sigma-Aldrich) as a solvent into 1Template_BA. 3.2 l of DDW (Water Purification System, LABOGENE), 1 l of 10PBS with pH 7.4 (Gibco by Life Technologies), and 5 l of 40 mM MgCl.sub.2 (Sigma-Aldrich) were sequentially put into a tube, to which 0.8 l (that is, 0.8 pmole) of 1Template_BA was added. Subsequently, temperature was decreased for one hour from 95 C. to 4 C. using a thermo cycler (Bio-Rad T100).
(99) Next, 2 l of a loading dye (Gel Loading Dye Blue 6, Biolabs) was added, followed by electrophoresis in a 15% PAGE in 1 Tris-borate-EDTA (TBE) buffer (150 V, 45 minutes) and dying with GelRed (GelRed, Biotium), thereby identifying an electrophoresis result using Gel Doc EZ (Bio-Rad).
(100) An experiment for identifying an annealing operation was conducted in the same manner except for using Template_E (SEQ ID NO:11) instead of Template_BA.
(101) (2) Identification of Hybridization Operation
(102) An experiment was conducted as follows to identify hybridization of Bacillus anthracis (Pathogen_BA Not Phosp, SEQ ID NO:14) in the sample and the template. First, 2 l of DDW (Water Purification System, LABOGENE), 1 l of 10PBS with pH 7.4 (Gibco by Life Technologies), and 5 l of 40 mM MgCl.sub.2 (Sigma-Aldrich) were sequentially put into a tube, to which 1 l of 10Pathogen_BA_Not Phosp and 1 l of 10Template_B_A were added. Subsequently, temperature was decreased for one hour from 95 C. to 4 C. using a thermo cycler (Bio-Rad T100).
(103) Next, 1 l (that is 0.8 pmol) of the template was diluted with 9 l of 1PBS to have a total volume of 10 l, after which 2 l of a loading dye (Gel Loading Dye Blue 6, Biolabs) was added, followed by electrophoresis in a 15% PAGE in 1 Tris-borate-EDTA (TBE) buffer (150 V, 45 minutes) and dying with GelRed (GelRed, Biotium), thereby identifying an electrophoresis result using Gel Doc EZ (Bio-Rad).
(104) A hybridization operation was identified in the same manner except for using Template_E (SEQ ID NO:11), instead of Template_BA (SEQ ID NO:1), and using Template_E_Not Phosp (SEQ ID NO:15), instead of Pathogen_BA_Not Phosp (SEQ ID NO:14).
(105) (3) Identification of Ligation Operation
(106) 2.4 l of DDW (Water Purification System, LABOGENE), 10 l of 2 T7 ligase reaction buffer (Biolabs), 1.6 l of 100Pathogen_BA_Not Phosp (SEQ ID NO:14), and 0.8 l of 100Template_BA (SEQ ID NO:10) were sequentially put into a tube, and temperature was decreased for five minutes from 95 C. to 4 C. using a thermo cycler (Bio-Rad T100). Next, 0.2 l of 100 mM DTT (Epicenter RepliPHI Phi29 reagent set (0.1 g/l)) and 5 l of T7 ligase (Biolabs) were added. Then, temperature was maintained at 25 C. for 13 hours, at 65 C. for 20 minutes, and at 10 C. using the thermo cycler (Bio-Rad T100). As a result, 20 l of 4 ligation product was obtained. 2 l of a loading dye (Gel Loading Dye Blue 6, Biolabs) was added to 0.8 pmole of the ligation product, followed by electrophoresis in a 15% PAGE in 1 Tris-borate-EDTA (TBE) buffer (150 V, 45 minutes) and dying with GelRed (GelRed, Biotium), thereby identifying an electrophoresis result using Gel Doc EZ (Bio-Rad).
(107) A ligation operation was identified in the same manner except for using Template_E (SEQ ID NO:11), instead of Template_BA (SEQ ID NO:1), and using Template_E_Not Phosp (SEQ ID NO:15), instead of Pathogen_BA_Not Phosp (SEQ ID NO:14).
(108) (4) Rolling Circle Amplification
(109) 7.2 l of DDW (Water Purification System, LABOGENE), 2 l of 10 T7 ligase reaction buffer (Biolabs), and Epicenter RepliPHI Phi29 reagent set (0.1 g/l) were sequentially put into a tube, to which 2 l (8 pmole) of 4 ligation product obtained in the ligation operation was added. Subsequently, 2 l of 25 mM dNTP (Epicenter RepliPHI Phi29 reagent set (0.1 g/l)), 0.8 l of 100 mM DTT (Epicenter RepliPHI Phi29 reagent set (0.1 g/l)), 1 l of Pyrophosphatase (100 U/ml, Biolabs), and 5 l of Phi 29 polymerase (Epicenter RepliPHI Phi29 reagent set (0.1 g/l)) were sequentially added. Then, temperature was maintained at 30 C. for 15 hours, at 65 C. for 10 minutes, and at 4 C. using the thermo cycler (Bio-Rad T100).
(110) (5) Identification of Electrophoresis Result
(111) Based on a DNA Ladder (Quick-Load LMW Ladder, Biolabs), the template (Template_BA, SEQ ID NO:10), the pathogen (Pathogen_BA_Not Phosp, SEQ ID NO:14), and 0.8 pmole of each of the products obtained in Operations (1) to (3) were loaded and were subjected to electrophoresis, results of which are illustrated in
(112) Referring to
<Experimental Embodiment 2> Identification of SEM Image of RCA Product
(113) (1) Identification of Bacillus anthracis
(114) 20 l of the RCA product, obtained using Template_B_A manufactured in Preparative Embodiment 1 according to method (4) of Experimental Embodiment 1, was mixed with 2 l of 2M MgCl.sub.2 and was slowly cooled (from 95 C. to 4 C. for one hour), so that a white DNA ball of about 1 mm was formed.
(115) The DNA ball was dried for 24 hours on glassware (MARIENFELD), was bound to mica (Pelco Mica sheets, Ted Pella Corp.), and was photographed with an SEM (Tm3030 tabletop microscope, Hitachi High-Tech). As shown in
(116) (2) Identification of Ebola Virus
(117) 20 l of the RCA product, obtained using Template_E manufactured in Preparative Embodiment 1 according to method (3) of Experimental Embodiment 1, was mixed with 5M NH.sub.4OAc 40 (SIGMA-Aldrich), and 100% EtOH 500 was added to the mixture, followed by freezing for 20 minutes. The resulting product was subjected to centrifugation (10,000 rpm, 20 minutes, 4 C.), and 40 l of the supernatant was sonicated (BRANSON 5510) for 30 minutes. The product was dried for 24 hours on glass, was bound to mica (Pelco Mica sheets, Ted Pella Corp.), and was photographed with an SEM (Tm3030 tabletop microscope, Hitachi High-Tech). As shown in
<Experimental Embodiment 3> Identification of Hydrogel Formation of RCA Gene Product
(118) An experiment was conducted to identify whether the amplified gene product obtained by RCA in Experimental Embodiment 1 formed hydrogel. Bacillus anthracis (Pathogen_BA Not Phosp, SEQ ID NO:14) and Ebola virus (Pathogen_E Not Phosp, Sequence No. 15) were used as pathogens.
(119) In Experimental Embodiment 3, the experiment was simply performed in a tube to identify reaction of the template of Preparative Embodiment 1 and the pathogens. Further, a thermo cycler was used for tests in different reaction conditions.
(120) For viscosity measurement due to hydrogel formation, viscosity and rotational viscosity measurement was performed using a tube and a pipette tip.
(121) (1) Viscosity Measurement using Tube and Pipette Tip
(122) The flowability of a reactant liquid (solution containing the RCA product obtained in (4) of Experimental Embodiment 1) was measured while tilting the tube 90 degrees based on the major axis of the tube. No flowability identified for 60 seconds indicated that a target gene, for example, a pathogen gene (Template_BA or Template_E), was detected.
(123) Further, when a reactant liquid (solution containing the RCA product obtained in (4) of Experimental Embodiment 1) was drawn (sucked) using a pipette tip, the reactant liquid (solution containing the RCA product obtained in (4) of Experimental Embodiment 1) was sucked up along the surface of the pipette tip due to a viscosity change. When the liquid has a similar level of viscosity to that of water, no liquid was sucked up along the tip. However, when the liquid increased in viscosity, the material was more sucked up along the tip and returned (see a of
(124) In RCA using Template_BA or Template_E, manufactured in Preparative Embodiment 1, the product had viscosity to hardly exhibit flowability for 60 seconds, making it possible to detect a target gene, for example, a pathogen gene (Template_BA or Template_E). Further, it was identified that hydrogel with higher viscosity was formed using Template_E having a larger length complementary to a pathogen than using Template_BA.
(125) (2) Measurement with Rotational Viscometer
(126) The viscosity change of an amplified gene product obtained by RCA disclosed in Experimental Embodiment 1 using Template_E, manufactured in Preparative Embodiment 1, was measured using a rotational viscometer. An increase in the viscosity change of a reactant liquid (solution containing the RCA product obtained in (4) of Experimental Embodiment 1) and a ratio between storage modulus (G) and loss modulus (G) were measured, results of which are illustrated in b of
<Experimental Embodiment 4> Identification of Effect of Coating of Second Channel of Microfluidic Device for Detecting Target Gene
(127) After performing a method for detecting a target gene using the microfluidic device for detecting the target gene according to the method of Embodiment 3-1, the second channel was observed with an atom-probe microscope (AFM, NX-10, Park System). After performing the method for detecting the target gene (method of Embodiment 3-1) using a microfluidic device for detecting a single target gene manufactured by the method for manufacturing the microfluidic device for detecting the single target gene of Embodiment 2-1 except for not performing the process of Operation 2 (without the process of coating the second channel with 5-hydroxydopamine HCl), the second channel was observed with an atom-probe microscope (AFM, NX-10, Park System).
(128) As a result, when a primer was immobilized without the process of coating using 5-hydroxydopamine HCl (pretreatment process using 5-hydroxydopamine HCl) (a of
(129) Thus, when coating the second channel of the microfluidic device for detecting the target gene with 5-hydroxydopamine HCl, 5-hydroxydopamine HCl reacted with the primer containing a thiol group, so that the primer was effectively immobilized on the second channel of the microfluidic device for detecting the target gene, thus increasing the amplification of nucleic acid by a subsequent process.
<Experimental Embodiment 5> Detection of MERS Virus Using Microfluidic Device for Detecting Target Gene
(130) (1) Manufacture of Microfluidic Device for Detecting Target MERS Gene
(131) As described above in Operation 1 and Operation 2 of Embodiment 2, a device including an inlet, a first channel, three second channels, and outlets formed at the end of the second channels, which are formed on a board, was prepared as in
(132) Next, as in Operation 3 of Embodiment 2, a mixture solution of Primer-5SS-polyA9 (BIONEER, SEQ ID NO:9) as a primer and DTT was introduced through the inlet. A thiol group present in the primer was exposed by DTT, and the exposed thiol group bound to a vinyl coating (or 5-hydroxydopamine HCl coating) on the second channel. Next, washing with DDW was performed.
(133) Solutions of 0.2 l (=20 pmole) of different template 100 diluted with 1PBS (Gibco by Life Technologies) were added to the primer immobilized on the three second channels, so that each template bound to the primer.
(134) Specifically, Template_BA (template for Bacillus anthracis, SEQ ID NO:10) obtained in (1) of Preparative Embodiment 1 was bound to the left second channel from a top view. This second channel is a negative control (NC). Even though the MERS virus is present in a sample introduced into the microfluidic device, the MERS virus does not react with the template, thus not causing RCA.
(135) A template for the MERS virus (MERS-CoV) was bound to the middle second channel. The middle second channel is a sample. Only when the MERS gene is present in a sample introduced into the microfluidic device, RCA occurs. The template for the MERS virus has the following sequence.
(136) TABLE-US-00008 TemplateMERS 5/5Phos/AGGGCACATCTCCGAATCGAAGTACTCAGC GTAAGTTTAGAGGTAGCATGCTAGTATCGACGTACG TACCAACTTACGCTGAGTACTTCGATTATACCC-3
(137) In the template MERS sequence, a region complementary to target MERS-CoV genes are indicated in bold type in a white background, in-template complementary regions are indicated in underlined italic type, and a binding region complementary to the primer is indicated in underlined italic type.
(138) The template for the MERS virus was bound to the primer immobilized on the second channel in the right second channel from the top view, and a target MERS gene to bind to the template was added to always cause RCA. The right second channel is a positive control (PC).
(139) (2) Detection of Target MERS Gene
(140) Next, a sample including a MERS virus gene to bind to the template for the MERS virus was introduced through the inlet of the microfluidic device manufactured in (1). Subsequently, ligation was allowed to occur at 25 C. overnight, and RCA was allowed to occur at 25 C. for four hours. Ligation time and RCA time may be adjusted depending on conditions. For example, when a result is identified using fluorescence, ligation time and RCA time may be adjusted to be even shorter. For example, observation may be performed after two-hour ligation and two-hour RCA.
(141)
(142) The result is illustrated in
DESCRIPTION OF REFERENCE NUMERALS
(143) 100: board 101: inlet 102: first channel 103: second channel 104: outlet