METHOD FOR REAL-TIME QUANTIFICATION OF NUCLEIC ACID
20180011967 · 2018-01-11
Inventors
- Jr Winston WONG (New Taipei City, TW)
- Stephen, Chang-Chi KAO (New Taipei City, TW)
- Ying-Ta Lai (New Taipei City, TW)
- Yih-Jyh Shann (New Taipei City, TW)
- Ming-Fa Chen (New Taipei City, TW)
- Chih-Rong Chen (New Taipei City, TW)
Cpc classification
C12Q2537/165
CHEMISTRY; METALLURGY
C12Q2537/165
CHEMISTRY; METALLURGY
G16B25/00
PHYSICS
C12Q2537/16
CHEMISTRY; METALLURGY
G16B25/20
PHYSICS
C12Q2537/16
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention discloses a method of real-time quantification of a target nucleic acid in a sample by constructing a reference table of copy number vs. designated parameter from reference samples which sharing the same nucleic acid sequences with the target nucleic acid. After that, obtain the designated parameter of the target sample and get the copy number by looking up and interpolating to the reference table. The object of the present invention is in particular provide methods for the quantification of the target nucleic acid which the target nucleic acid is quantified independently without comparing it to the standard controls by using a calibration curve. This invention will not only provide a new quantifying method, but will also propose a new standard operational method that eliminates the variations accompanying amplification efficiency, polymerase activity, primer concentrations, and instrument variations.
Claims
1. A method for quantification of a target nucleic acid, comprising the steps of: (a) constructing a reference table of copy number vs. designated parameter from reference samples with the same nucleic acid sequence of the target nucleic acid, wherein the reference table is calibrating and fitting by the steps of: i. preparing and amplifying the reference samples; ii. monitoring and detecting the amplifications of the reference samples in real-time; iii. analyzing the detecting signals to get the designated parameter of each reference samples; and vi. constructing a reference table of copy number v.s designated parameter; (b) amplifying the target nucleic acid; (c) monitoring and detecting the amplification of the target nucleic acid in real-time; (d) analyzing the detected signals to get the designated parameter of the target nucleic acid; and (e) looking up and interpolating to the reference table to get the copy number of the target nucleic acid.
2. The method of claim 1, wherein the amplification reactions of the target nucleic acid and the reference samples are real-time PCR.
3. The method of claim 1, wherein the amplifications of the target nucleic acid and the reference samples are monitored and detected by an optical device or a chemical sensor.
4. The method of claim 3, wherein the chemical sensor is a hydrogen ion or a pyrophosphate.
5. The method of claim 3, wherein the amplifications of the target nucleic acid and the reference samples are monitored and detected by the optical device with the aid of a DNA-binding dye, an intercalating dye, a probe, or a molecular beacon.
6. The method of claim 5, wherein the optical device is a fluorescence signal detection device, and the DNA-binding dye emits a fluorescence signal detected by the fluorescence signal detection device upon interaction with double-stranded nucleic acid after excitation with light.
7. The method of claim 1, wherein the step iii. and step (e) are normalizing the detected signals to fall into the range of 0-1 when the amplifications are saturated.
8. The method of claim 1, wherein the step iii. and step (e) are fitting curves of each reference samples by using the sigmoidal function:
9. The method of claim 8, wherein the normalized signal is a fluorescence signal.
10. The method of claim 1, wherein the step iii. and step (e) are normalizing the cycle number of each serial dilutions by the slop of the curves themselves.
11. A method for quantification of a target nucleic acid, comprising the steps of: (a) constructing a reference table of copy number vs. normalized cycle number from reference samples with the same nucleic acid sequence of the target nucleic acid, wherein the reference table is calibrating and fitting by the steps of: i. preparing the reference samples; ii. amplifying the reference samples; iii. monitoring and detecting the amplifications of the reference samples in real-time; iv. normalizing the detected signals to fall into the range of 0-1 when the amplifications are saturated; v. fitting curves of each serial dilutions by using the sigmoidal function:
12. The method of claim 11, wherein the amplification reactions of the target nucleic acid and the reference samples are real-time PCR.
13. The method of claim 11, wherein the amplifications of the target nucleic acid and the reference samples are monitored and detected by an optical device or a chemical sensor.
14. The method of claim 13, wherein the chemical sensor is a hydrogen ion or a pyrophosphate.
15. The method of claim 13, wherein the amplifications of the target nucleic acid and the reference samples are monitored and detected by the optical device with the aid of a DNA-binding dye, an intercalating dye, a probe, or a molecular beacon.
16. The method of claim 13, wherein the optical device is a fluorescence signal detection device, and the DNA-binding dye emits a fluorescence signal detected by the fluorescence signal detection device upon interaction with double-stranded nucleic acid after excitation with light.
17. The method of claim 11, wherein the detected signal is a fluorescence signal.
18. A method for constructing a reference table of copy number vs. normalized cycle number from reference samples with the same nucleic acid sequence of a target nucleic acid, comprising the steps of: (a) preparing the reference samples; (b) amplifying the reference samples; (c) monitoring and detecting the amplifications of the reference samples in real-time; (d) normalizing the detected signals to fall into the range of 0-1 when the amplifications are saturated; (e) fitting curves of each s reference samples by using the sigmoidal function:
19. The method of claim 18, wherein the amplification reaction of the reference samples is real-time PCR.
20. The method of claim 18, wherein the amplifications of the reference samples are monitored and detected by an optical device or a chemical sensor.
21. The method of claim 20, wherein the chemical sensor is a hydrogen ion or a pyrophosphate.
22. The method of claim 18, wherein the amplifications of the reference samples are monitored and detected by the optical device with the aid of a DNA-binding dye, an intercalating dye, a probe, or a molecular beacon.
23. The method of claim 20, wherein the optical device is a fluorescence signal detection device, and the DNA-binding dye emits a fluorescence signal detected by the fluorescence signal detection device upon interaction with double-stranded nucleic acid after excitation with light.
24. The method of claim 18, wherein the signal is a fluorescent signal.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0018] A more complete understanding of the present disclosure may be realized by reference to the accompanying drawing in which:
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
DETAILED DESCRIPTION
[0028] The following merely illustrates the principles of the present disclosure. It will thus be appreciated that those skilled in the art will be able to devise various arrangements which, although not explicitly described or shown herein, embody the principles of the disclosure and are included within its spirit and scope.
[0029] Furthermore, all examples and conditional languages recited herein are principally intended expressly to be only for pedagogical purposes to aid the reader in understanding the principles of the disclosure and the concepts contributed by the inventor(s) to furthering the art, and are to be construed as being without limitation to such specifically recited examples and conditions.
[0030] Moreover, all statements herein reciting principles, aspects, and embodiments of the disclosure, as well as specific examples thereof, are intended to encompass both structural and functional equivalents thereof. Additionally, it is intended that such equivalents including both currently known equivalents as well as equivalents developed in the future, i.e., any elements later developed that perform the same function, regardless of structure.
[0031] Unless otherwise explicitly specified herein, the drawings are not drawn to scale.
[0032] As shown in
[0033] The method 100 commences by preparing the reference samples 110 and measuring the amplification in real-time 111. The amplification of both reference samples and target sample(s) may be monitored in real-time by monitoring the optical signals (fluorescent signals, phosphorescent signal, and etc.) which generated during the amplification, or the chemical sensors (hydrogen ion, pyrophosphate, and etc.) which are by-products of the amplification or other specific materials, as long as they are proportional to the amplifications.
[0034] Once the amplification completes, analyze the detected signals from the reference samples 112, and the reference table is then constructed using the copy number vs. designated parameter information 113. The target sample(s) is/are then amplified under the same condition 114, while measuring its amplification in real-time 115. After analyzing the detected signals 116, the copy number of the target sample(s) is/are known by comparing the value of the designated parameters to the reference table 117. Using this new quantifying approach proposed by this disclosed invention, the variations accompanying amplification efficiency, polymerase activity, primer concentration, and the instrument variations can be eliminated.
[0035] In another embodiment of the present invention, the amplification of reference samples and target sample(s) are monitored by adding EvaGreen® dye which are emitted the fluorescent signal during amplification. The EvaGreen® dye could be replaced by other materials (SYBR® 1 Dye, molecular beacon, probe, and etc.) which generated the optical signals (fluorescent signals, phosphorescent signal, and etc.) during the amplification, or the chemical sensors (hydrogen ion, pyrophosphate and etc.) which are by-products of the amplification or other specific materials, as long as they are proportional to the amplifications.
[0036] The detected signals of reference samples and target sample(s) are analyzed by sigmoidal curve fitting function as shown in
where NS is normalized fluorescent signal, t is cycle number, t.sub.1/2 is the fractional cycle at which reaction fluorescence reaches half of the maximal reaction fluorescence, τ is the slope of the curve. The two variants are t.sub.1/2 and τ.
[0037] In this embodiment, the designated parameter is t.sub.1/2. There are two operating parts of the embodiment.
[0038] The key procedures of detected signals analyzing of reference samples 212a-212d and target sample(s) 312a-312d and their operating theories are listed as below:
[0039] a) After detecting the signals of the reference samples, subtracts the background value of each reference samples and then normalizes the variants of the fluorescent signal into the range of 0-1 212a. After this step, the fluorescent signal would become normalized. The purpose of this step is to reduce the inconsistent baseline signal which caused by reaction variations. (Such as the slight differences of light source or detector magnification, etc.)
[0040] Secondly, the normalized fluorescent signal and cycle number are fitted by two-parametric sigmoid function 212b. The t.sub.1/2 and τ of each reference samples are obtained after this step. These two parameters, t.sub.1/2 and τ, represent the trend lines of all reference samples of this amplification. These two parameters provide the information of copy number and amplification efficiency of the reference samples.
[0041] c) Dividing the cycle number by τ, the x-axis that records the cycle number is then normalized 212c. Since the amplification efficiencies vary under both situations, (1) for different qPCR operations, and (2) for each samples in amplified in one qPCR operation, it is hard to estimate the copy number. Therefore, this step is intended to relate the copy number solely to the normalized cycle number.
[0042] d) Re-fitting the curves of each reference samples by sigmoid function 212d, the t.sub.1/2 of each reference samples are obtained. t.sub.1/2 are only related to the copy number. That is, t.sub.1/2 will be different only when the copy number of each reference samples are different. The t.sub.1/2 of each reference samples remain constants for different amplification efficiency.
[0043] e) Reference table 213 is organized by each t.sub.1/2 which is corresponding to each of the different concentration of reference samples. After the reference table is constructed, if there is a need to quantify target sample(s) which share the same nucleic acid sequence as the reference samples, the copy number of the target sample(s) can be obtained by comparing and interpolating to the reference table 317, which is got from the following steps for completing the amplification 314 of the target sample(s) to obtain the fluorescent signals 315, and processing the values to get the t½ of the target sample(s) with the same data processing steps 316a-316d.
[0044] The present invention is further elucidated by the following examples:
Example 1 Calibration of Different Primer Concentration
[0045] Step A. Amplification of UCP1 gDNAs 210 (Reference Samples)
[0046] The gDNA was isolated from whole blood using a QIAamp® DNA BLOOD Mini Kit (QIAGEN N.V.). The gDNA concentration was adjusted to 10 ng/μl (hereinafter, reference samples).
[0047] Primers having SEQ ID NO:1 and SEQ ID NO:2 were used to amplified a UCP1 sequence. The primer sequences are shown in Table 1. Two serial single dilutions were prepared from 0.4 μM with primer concentrations of 0.2 μM and 0.1 μM. As shown on Table 2, for each amount of the primer, the experiment was performed duplicate.
TABLE-US-00001 TABLE 1 Primer Sequence Primers used in the examples Sequence ID Function Sequence 5′-3′ SEQ ID Forward primer of CAGTTAAGAGCCTTTGCCAG No: 1 UCP1 SEQ ID Reverse primer of TCCTTGGAATCCAGAACTAC No: 2 UCP1
[0048] The amplification reaction was carried out which was measured and monitored in real-time in the Evagreen® dye on a BioRad CFX Connect Real-time System (BioRad Laboratories, Inc.). Each reaction mixture volume was 25 μl, and was amplified under the following conditions:
TABLE-US-00002 TABLE 2 Conditions of the Amplification of the reference samples Condition 1 Condition 2 Condition 3 No. 1 & 2 No. 3 & 4 No. 5 & 6 DNA gDNA 10 ng template Primer UCP1-F1, UCP1-B1 Primer 0.4 μM 0.2 μM 0.1 μM dNTP 0.2 mM EvaGreen ® 0.25X Polymerase 1.25 unit MgCl.sub.2 3.5 mM Total 25 μl Volume
[0049] The reaction mixtures were firstly incubated for 2 minutes at 94° C. The actual amplification reaction was carried out for 45 cycles according to the following scheme: [0050] 94° C. 10 sec..fwdarw.60° C. 10 sec..fwdarw.72° C. 15 sec.
Step B. Data Analyzing
[0051]
[0052] As shown in
TABLE-US-00003 TABLE 3 t.sub.1/2 and τ of each sample after sigmoidal curve fitting 212b t.sub.1/2 τ No. 1 0.4 μM 27.87 1.5239 No. 2 0.4 μM 27.9 1.4428 No. 3 0.2 μM 29.773 1.6063 No. 4 0.2 μM 29.826 1.614 No. 5 0.1 μM 37.16 1.9203 No. 6 0.1 μM 37.038 1.9301
[0053] As shown in
TABLE-US-00004 TABLE 4 t.sub.1/2 of each reference samples after normalization 212c. t.sub.1/2 No. 1 0.4 μM 18.289 No. 2 0.4 μM 19.338 No. 3 0.2 μM 18.535 No. 4 0.2 μM 18.48 No. 5 0.1 μM 19.351 No. 6 0.1 μM 19.19
Example 2 Calibration of Different dNTP Concentration
[0054] Step A. Amplification of UCP1 gDNAs 210 (Reference Samples)
[0055] The conditions and the processes of gDNA extraction and amplification are identical with Example 1 as listed in Table 5 except: a. two serial single dilutions were prepared from 0.4 mM with dNTP concentrations of 0.2 mM and 0.1 mM, b. the primer concentration is 0.4 μM.
TABLE-US-00005 TABLE 5 Conditions of the Amplification of the reference samples Condition 4 Condition 5 Condition 6 No. 7 & 8 No. 9 & 10 No. 11 & 12 DNA gDNA 10 ng template Primer UCP1-F1, UCP1-B1 primer 0.4 μM dNTP 0.4 mM 0.2 mM 0.1 mM EvaGreen ® 0.25X Polymerase 1.25 unit MgCl.sub.2 3.5 mM Total 25 μl Volume
Step B. Data Analysis
[0056] As shown in
Example 3 Reference Table Construction
[0057] Three different concentration templates are used in EXAMPLE 3 to construct a reference table of copy number vs. t.sub.1/2.
Step A. Amplification of UCP1 gDNAs 210 (Reference Samples)
[0058] The gDNA was isolated from whole blood using a QIAamp® DNA BLOOD Mini Kit (QIAGEN N.V.). The gDNA concentration was adjusted to 10 ng/μl. Two serial single dilutions were prepared from this with gDNA concentration of 2.5 ng/μ1, and 0.625 ng/μ1.
[0059] Primers having SEQ ID NO: 1 and SEQ ID NO: 2 were used to amplified a UCP1 sequence. The primer sequences are already listed in Table 1. As shown in Table 6, for each amount of the gDNA, the experiment was performed duplicate. The amplification reaction was carried out which was measured and monitored in real-time in the Evagreen® dye on a BioRad CFX Connect Real-time System (BioRad Laboratories, Inc.). Each reaction mixture volume was 25 μl, and was amplified under the following conditions:
TABLE-US-00006 TABLE 6 Conditions of the Amplification of the reference samples Condition 7 Condition 8 Condition 9 No. 13 & 14 No. 15 & 16 No. 17 & 18 DNA 10 ng 2.5 ng 0.625 ng template Primer UCP1-F1, UCP1-B1 primer 0.4 μM dNTP 0.2 mM EvaGreen ® 0.25X Polymerase 1.25 unit MgCl.sub.2 3.5 mM Total 25 μl Volume
Step B. Data Analysis
[0060] As shown in
[0061] The t.sub.1/2 of each copy number are as shown in Table 7. They will only be different when the copy number differed.
TABLE-US-00007 TABLE 7 The copy number of UCP-1 t.sub.1/2 0.625 ng 18.280 2.5 ng 19.217 10 ng 20.580
Example 4 Target Sample Quantification
[0062] Taking a 5 ng gDNA as DNA template of the target sample, the amplification conditions and processes are identical with the reference samples in Example 3. After amplifying the target sample 314, monitoring and detecting the fluorescent signal in real-time 315. The t.sub.1/2 of the target sample is obtained after analyzing the detected signals with the same processing step as Example 3 316a-316d.
[0063] The value of the t.sub.1/2 of the target sample is 18.497. The copy number of the target sample is 4.03 ng after comparing and interpolating the obtained t1/2 to the reference table 317. The relative error is less than 20% to theoretic value.
[0064] Those skilled in the art will readily observe that numerous modifications and alterations of the device and method may be made while retaining the teachings of the invention. Accordingly, the above disclosure should be construed as limited only by the metes and bounds of the appended claims.