Personalized healthcare P4 drug monitoring system and method
10732169 ยท 2020-08-04
Inventors
Cpc classification
G01N2800/52
PHYSICS
G01N33/48792
PHYSICS
G01N33/5008
PHYSICS
A61B5/14532
HUMAN NECESSITIES
A61B5/7278
HUMAN NECESSITIES
A61B5/746
HUMAN NECESSITIES
International classification
G01N33/50
PHYSICS
A61B10/00
HUMAN NECESSITIES
Abstract
The claimed invention provides real-time and subsequent analysis personalized user based health, wellness and pharmaceutical and illicit drug detection information. Non-invasive techniques utilize saliva for body levels of wellness indicators and pharmaceutical and illicit drug ingestion which are coordinated over time. Saliva captured on sample strips are real-time indicator reviewed and subsequently analyzed using traditional analytical chemistry techniques including liquid chromatography/mass spectrometry (LC/MS) and coordinated with time of administration with optional genetic sequence analysis to confirm related disease conditions. By using P4 (Participatory, Personalized, Predictive, and Preventive) health management techniques the patient determines if the pharmaceutical is having the correct and desired effect for maximum therapeutic benefit. While illustrative embodiments detecting Metformin and Keppra are provided the system has broad pharmaceutical and illicit drug monitoring applicability.
Claims
1. A personal health monitoring system comprising: A saliva sample collection device, a smartphone personal communication device incorporating one or more central processing units, one or more cameras, internet connection means, health sample subsequent analysis hardware, health sample interpretation software, artificial intelligence element and cloud computing element with real-time interpretation and communication of saliva sample health care results wherein said saliva sample collection device additionally comprises one or more health sample detection aptamers and wherein said saliva sample collection device additionally comprises one or more health sample detection aptamers including aptamers having Seq ID #1.
2. The system of claim 1 wherein said health sample subsequent analysis hardware additionally comprises enzyme-linked immunosorbent assay (ELISA) chemical analysis functionality.
3. A personal health monitoring system comprising: A saliva sample collection device, a smartphone personal communication device incorporating one or more central processing units, one or more cameras, internet connection means, health sample subsequent analysis hardware, health sample interpretation software, artificial intelligence element and cloud computing element with real-time interpretation and communication of saliva sample health care results wherein said saliva sample collection device additionally comprises one or more health sample detection aptamers and wherein said saliva sample collection device additionally comprises one or more health sample detection aptamers including aptamers having Seq ID #2.
4. The system of claim 3 wherein said health sample subsequent analysis hardware additionally comprises chromatography and mass spectrometry functionality.
5. A personal health monitoring system comprising: A saliva sample collection device, a smartphone personal communication device incorporating one or more central processing units, one or more cameras, internet connection means, health sample subsequent analysis hardware, health sample interpretation software, artificial intelligence element and cloud computing element with real-time interpretation and communication of saliva sample health care results wherein said saliva sample collection device additionally comprises one or more health sample detection aptamers and wherein said saliva sample collection device additionally comprises one or more health sample detection aptamers including aptamers having Seq ID #3.
6. The system of claim 5 wherein said health sample analysis subsequent hardware additionally comprises genetic sequencing functionality.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1) The accompanying drawings are included to better illustrate exemplary embodiments of the claimed invention.
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
DESCRIPTION OF EMBODIMENTS
(20) P4 Medicine is Predictive, Preventive, Personalized and Participatory. Its two major objectives are to quantify wellness and demystify disease. In the illustrative examples contained herein, the aims of P4 Medicine are achieved by combining end-user analysis of current health metrics together with follow-on lab analytics of the same saliva sample to determine body levels of administered pharmaceuticals. In a first illustrative example, user health data is gathered by smartphone to capture pharmaceutical administration and related health details such as time food intake.
(21) Optionally, the system may be combined with glucose measuring test strips to report glucose levels to the end-user for personalized and participatory wellness monitoring. The same test strip subsequently analyzed using standard analytical equipment, however, provides the opportunity for predictive and preventative health screening based upon detection of pharmaceuticals and their carriers as well as DNA, RNA and protein indicators of body health as well as the presence or absence of harmful bacteria, viruses and other disease carriers.
EXAMPLES
(22) The optimal management of health using correct pharmaceutical dosing and timing of administration is best managed by the patient. Unfortunately, patients rarely have access to the clinical tools needed for optimal pharmaceutical administration. The first illustrative example depicts the administration of the drug metformin so that using the claimed invention the patient can match drug dosing so that it is optimal for food intake. While metformin is utilized as an illustrative example the claimed invention is not intended to be limited to a particular pharmaceutical or disease state but instead intended for broad health management opportunities.
Examples
Example 1
(23) The claimed P4 drug testing wellness platform is based upon salivary capture and analysis using one or more disposable test strips.
(24) In the first illustrative example, pharmaceutical levels are captured by placing test strip (101) in a user's mouth (not shown) for two minutes to distribute saliva (not shown) to test strip (101).
(25) Adequate saliva capture is confirmed by illumination of pH region (109). In the first illustrative example, the user waits an additional three minutes upon which a measurable color change takes place at enzymatic region (107). Salivary indicator levels may be estimated by user color comparison visually or by computer analysis by a smartphone type device (not shown). The detection of salivary glucose is based on a coupling reaction between glucose oxidase and peroxidase. Glucose oxidase oxidizes the salivary glucose into gluconolactone and hydrogen peroxide (H2O2). In the presence of peroxidase, 10-acetyl-3,7-dihydroxyphenoxazine reacts with H2O2 in a 1:1 stoichiometry in order to produce a white to pink color. In a preferred embodiment, the chemical sensor at enzymatic region (107) is a compound having the following structural formula:
(26) ##STR00001##
(27) In the first illustrative embodiment, the salivary test strip may be single purpose as illustrated by salivary test strip (101) depicted by
(28) Both pharmaceutical and illicit drug levels are derived from the user's saliva. Saliva is unlike blood in that it is stable at room temperature for long periods of time, safe to collect and transport and not considered medical waste.
Example 2
(29) Metformin (Metformin hydrochloride) is a type of medicine known as a biguanide. The drug works to lower the amount of sugar in the blood of people with diabetes. It does this by lowering the amount of sugar produced in the liver, and also increasing the sensitivity of muscle cells to insulin.
(30)
(31) In preferred embodiment Example 2 detailed below a user captures glucose data in near real time utilizing a plurality of multi-function salivary test strips which are subsequently remotely analyzed for metformin. It is a direct and intended consequence of the claimed invention that measuring pharmaceutical levels and glucose from saliva provides more immediate and relevant composite wellness picture owing to the delay between meal ingestion and corresponding blood levels. In the second illustrative example the user is able to locally capture glucose information shortly after sample exposure.
(32) To obtain pharmaceutical levels of metformin in the second illustrative example sample test strip (201) is mailed to a remote location for further analysis using traditional laboratory equipment such as LC/MS. Local analysis of glucose is by illustration only and not by limitation as any target capable of local enzymatic, aptamer and/or antibody analysis may be captured. By using a smartphone to input time of saliva sample data capture as well as most recent mealtime, glucose results are immediately captured and metformin results are subsequently returned to generate results allowing the user to determine general wellness indicators including ideal time for metformin pharmaceutical administration. A primary goal of this embodiment of the claimed invention is to allow the patient to best align the maximum therapeutic effect of metformin for processing of blood glucose after a meal is eaten by the patient.
(33)
(34)
(35) The remainder of Example 2 illustrated by
(36) In a more specific illustrative embodiment, sample preparation step (601) begins with a user taking Metformin placing a saliva sample collection means in the mouth to collect saliva and takes a digital photo of the lateral flow sample strip with a smartphone. The strip may optionally contain glucose sensing means. After exposure to saliva the user takes a photo of the strip which captures the time of strip exposure and provides time and body glucose data to the system. The saliva capture means is associated to the system by way of 2D bar code, machine readable numbers or other identifiable characteristics. Pharmaceutical data capture step (603) takes place with the user inputting pharmaceutical details of metformin dosage and latest time of administration. Input may be through smartphone, smart watch, stand alone computer or other dedicated computing device. After saliva exposure and smartphone photo capture the sample is placed into a prepaid envelope provided during purchase in the consumer packaging and is sent by mail or otherwise transported to a central analysis facility and analyzed by liquid chromatography and mass spectrometry (LC/MS) during sample chemical analysis step (605). Unlike blood or other biological material collection, the sample is safe at room temperature and does not create hazardous waste handling concerns.
(37)
(38) Use of the claimed system is an iterative process, the more times the user provides results the more powerful the data becomes for user lifestyle wellness management. Optional data alert/feedback gathering step (613) is available to alert the user, designated family members and medical providers if critical overdose or dose omission is detected during sample analysis. Feedback can also be obtained as a result of change in behavior and can be as simple as the system asking the user Now that you are taking your pill at 8:00 AM, do you feel better? Data mining step (615) provides a deeper analysis into metformin drug administration as a function of time and behavior as greater data is collected by the system. While artificial intelligence cloud computing provides a computationally powerful tool, the smartphone/smart watch user interface report of data aggregation is intended to be simple by design. Aggregate results in this illustrative example are provided monthly in a simple format. The user receives a monthly snapshot of You took your pill on time twenty-eight days out of thirty this month, great job! Your feedback says your pill works best when you take it at 9:27 AM, glad to see it is working better. You also switched to a generic version on day 15 and reported no adverse effects, based on your cost data this month you saved $317 because of the switch!
(39)
Example 3
(40) In a third illustrative example, expanded personalized wellness information is obtained by substitution of an indicator aptamer in place of or augmenting glucose sensing. In addition, LC/MS pharmaceutical detection is supplemented with DNA and RNA sequencing of the saliva sample as well as optional ELISA analysis. In the third illustrative example the presence or absence of the drug Keppra is determined. In
(41) Data analysis step (807) takes place in a cloud computing environment to analyze body levels of pharmaceutical Keppra against time of administration and aptamer and/or genetic sequence indicated and genetic sequencing indicated conditions to determine the best time when the drug should be taken for optimal beneficial effect. In a foreseeable and intended embodiment the presence or absence of pharmaceutical carriers as well as multi-drug detection is carried out by the LC/MS system to determine if the pharmaceutical product is counterfeit and if the user is at risk from multi-drug cross reactions. In an intended alternate embodiment the presence or absence of illicit substances is also detected. Furthermore, the genetic sequencing and data analysis of the saliva sample allows for detection of bacterial and viral infections by screening for miRNA and DNA targets of interest.
(42) The results are wirelessly transmitted over the internet during data transmission step (809) and the user's smartphone or smartwatch user interface displays a high level metadata analysis during data reporting step (811). Unlike traditional Physician's Desk Reference (PDR) or pharmaceutical packet insert materials, the data is presented in plain language and can be as simple as You've been taking your medication regularly but it looks like you may have a bacterial infection as well. Have you noticed a health change or consulted your physician?
(43) Use of the claimed system is an iterative process, the more times the user provides results the more powerful the data becomes for user lifestyle wellness management. Optional data alert/feedback gathering step (813) is available to alert the user, designated family members and medical providers if critical overdose, dose omission or counterfeit pharmaceutical product is detected during sample analysis by screening for both pharmaceutical product as well as commonly used pharmaceutical carriers. Feedback can also be obtained as a result of change in behavior and can be as simple as the system asking the user It looks like you inadvertently took a double dose of your product last week. Now that you are taking your pill at its recommended levels again, do you feel better? Data mining step (815) provides a deeper analysis into drug administration as a function of time and behavior as greater data is collected by the system. While artificial intelligence cloud computing provides a computationally powerful tool, the smartphone/smart watch user interface report of data aggregation is intended to be simple by design. Aggregate results in this illustrative example are provided in a simple format for improved user personalized health. While illustrative genetic sequence indicators are provided as sequence ID number 1 for H3N2 flu, sequence ID number 2 for H1N1 flu and sequence ID number 3 for e. Coli, the sequences are by way of illustration and not intended to limit the scope or reach of the use of the claimed invention incorporating genetic sequence information.
(44)
(45)
(46)
(47)
(48)
(49)
(50)
(51) The system of the third example is illustrated in
(52)
(53)
(54) In the description, numerous specific details are set forth in order to provide a thorough understanding of the present embodiments. It will be apparent, however, to one having ordinary skill in the art that the specific detail need not be employed to practice the present embodiments. In other instances, well-known materials or methods have not been described in detail in order to avoid obscuring the present embodiments.
(55) Reference throughout this specification to one embodiment, an embodiment, one example or an example means that a particular feature, structure or characteristic described in connection with the embodiment or example is included in at least one embodiment of the present embodiments. Thus, appearances of the phrases in one embodiment, in an embodiment, one example or an example in various places throughout this specification are not necessarily all referring to the same embodiment or example. Furthermore, the particular features, structures or characteristics may be combined in any suitable combinations and/or sub-combinations in one or more embodiments or examples. In addition, it is appreciated that the figures provided herewith are for explanation purposes to persons ordinarily skilled in the art and that the drawings are not necessarily drawn to scale.
(56) As used herein, the terms comprises, comprising, includes, including, has, having, or any other variation thereof, are intended to cover a non-exclusive inclusion. For example, a process, article, or apparatus that comprises a list of elements is not necessarily limited to only those elements but may include other elements not expressly listed or inherent to such process, article, or apparatus. Additionally, any examples or illustrations given herein are not to be regarded in any way as restrictions on, limits to, or express definitions of any term or terms with which they are utilized. Instead, these examples or illustrations are to be regarded as being described with respect to one particular embodiment and as being illustrative only. Those of ordinary skill in the art will appreciate that any term or terms with which these examples or illustrations are utilized will encompass other embodiments which may or may not be given therewith or elsewhere in the specification and all such embodiments are intended to be included within the scope of that term or terms. Language designating such nonlimiting examples and illustrations includes, but is not limited to: for example, for instance, e.g., and in one embodiment.
INDUSTRIAL APPLICABILITY
(57) The claimed invention has industrial applicability in the biomedical arts. In particular, the claimed invention is directly relevant to the therapeutic administration of pharmaceuticals for mitigation of and therapeutic effects against diseases.
(58) TABLE-US-00001 SequenceListing NameSequence Seq.ID.No.1 H3N2 CTCATCTTACCCTTTTTCTCCTCTG Seq.ID.No.2 H1N1 TTTACCTCCTCTTTTCGTACTCTCC Seq.ID.No.3 E.coli GGTGGTGGCGGGGGGTGGGGGGGTT