Viable viruses with foreign tags
10729756 ยท 2020-08-04
Assignee
Inventors
- Kay S. Faaberg (Ames, IA)
- Allyn Spear (Fishers, IN, US)
- Matthew A. Kappes (Elkridge, MD, US)
- Kelly M. Lager (Colo, IA, US)
Cpc classification
C12N2770/10034
CHEMISTRY; METALLURGY
C12N2770/10021
CHEMISTRY; METALLURGY
International classification
Abstract
Multiple DIVA vaccines effective against porcine reproductive and respiratory syndrome virus (PRRSV) are disclosed. The DIVA vaccines may be negative DIVAs or positive DIVAs. The DIVA vaccines may be produced by modifying the nsp2 region of a modified live virus vaccine. The modification may be one or more deletions only (negative DIVAs) or a deletion with an insertion (positive DIVAs). The insertion may be of an epitope tag, such as a V5, S-Tag, or FLAG tag. Produced DIVA vaccines may be stable through multiple passes and thus may be effective for production and vaccination of animals.
Claims
1. An immunogenic composition, comprising: an isolated polynucleotide sequence representing a modified live vaccine for porcine reproductive and respiratory syndrome virus having an nsp2 region; and a pharmaceutically acceptable adjuvant, wherein the amino acid sequence of the nsp2 region is one of a sequence of SEQ ID NO: 3; a sequence of SEQ ID NO: 13; a sequence of SEQ ID NO: 15; a sequence of SEQ ID NO: 17; a sequence having at least 99% homology to SEQ ID NO: 13; a sequence having at least 99% homology to SEQ ID NO: 15; and a sequence having at least 99% homology to SEQ ID NO: 17, and wherein the immunogenic composition is capable of inducing an immune response in a recipient.
2. The immunogenic composition of claim 1, further comprising a pharmaceutically acceptable carrier.
3. An immunogenic composition, comprising: an isolated polynucleotide sequence representing a modified live vaccine for porcine reproductive and respiratory syndrome virus having an nsp2 region; and a pharmaceutically acceptable adjuvant, wherein the amino acid sequence of the nsp2 is one of a sequence of SEQ ID NO: 5; a sequence of SEQ ID NO: 19; a sequence of SEQ ID NO: 21; a sequence of SEQ ID NO: 23; a sequence having at least 99% homology to SEQ ID NO: 19; a sequence having at least 99% homology to SEQ ID NO: 21; and a sequence having at least 99% homology to SEQ ID NO: 23, and wherein the immunogenic composition is capable of inducing an immune response in a recipient.
4. The immunogenic composition of claim 3, further comprising a pharmaceutically acceptable carrier.
5. A method for reducing the incidence of porcine reproductive and respiratory syndrome virus (PRRSV) in swine, comprising administering to a swine an immunogenic composition in an amount effective to generate an immune response in said swine to said PRRSV, wherein the immunogenic composition comprises an isolated polynucleotide sequence representing a modified live vaccine for porcine reproductive and respiratory syndrome virus having an nsp2 region, wherein the amino acid sequence of the nsp2 region is one of a sequence of SEQ ID NO: 3; a sequence of SEQ ID NO: 13; a sequence of SEQ ID NO: 15; a sequence of SEQ ID NO: 17; a sequence having at least 99% homology to SEQ ID NO: 13; a sequence having at least 99% homology to SEQ ID NO: 15; a sequence having at least 99% homology to SEQ ID NO: 17; a sequence of SEQ ID NO: 5; a sequence of SEQ ID NO: 19; a sequence of SEQ ID NO: 21; a sequence of SEQ ID NO: 23; a sequence having at least 99% homology to SEQ ID NO: 19; a sequence having at least 99% homology to SEQ ID NO: 21; and a sequence having at least 99% homology to SEQ ID NO: 23.
6. The method for reducing the incidence of PRRSV in swine of claim 5, wherein the immune response is protection against porcine reproductive and respiratory syndrome virus.
Description
BRIEF DESCRIPTION OF THE FIGURES
(1) Advantages of embodiments of the present invention will be apparent from the following detailed description of the exemplary embodiments. The following detailed description should be considered in conjunction with the accompanying figures in which:
(2) Exemplary
(3) Exemplary
(4) Exemplary
(5) Exemplary
(6) Exemplary
(7) Exemplary
(8) Exemplary
(9) Exemplary
(10) Exemplary
DETAILED DESCRIPTION
(11) Aspects of the invention are disclosed in the following description and related drawings directed to specific embodiments of the invention. Alternate embodiments may be devised without departing from the spirit or the scope of the invention. Additionally, well-known elements of exemplary embodiments of the invention will not be described in detail or will be omitted so as not to obscure the relevant details of the invention. Further, to facilitate an understanding of the description discussion of several terms used herein follows.
(12) As used herein, the word exemplary means serving as an example, instance or illustration. The embodiments described herein are not limiting, but rather are exemplary only. It should be understood that the described embodiment are not necessarily to be construed as preferred or advantageous over other embodiments. Moreover, the terms embodiments of the invention, embodiments or invention do not require that all embodiments of the invention include the discussed feature, advantage or mode of operation.
(13) Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. As used herein, the term about refers to a quantity, level, value, or amount that varies by as much as 30%, preferably by as much as 20%, and more preferably by as much as 10% to a reference quantity, level, value, or amount. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now described.
(14) The amounts, percentages, and ranges disclosed herein are not meant to be limiting, and increments between the recited amounts, percentages, and ranges are specifically envisioned as part of the invention.
(15) Optional or optionally means that the subsequently described event or circumstance may or may not occur, and that the description includes instances in which said event or circumstance occurs and instances where it does not. For example, the phrase optionally comprising X means that the composition may or may not contain X, and that this description includes compositions that contain and do not contain X.
(16) Because this invention involves production of genetically altered viruses and involves recombinant DNA techniques, the following definitions are provided to assist in describing this invention. The terms isolated, purified, or biologically pure as used herein, refer to material that is substantially or essentially free from components that normally accompany the material in its native state or when the material is produced. In an exemplary embodiment, purity and homogeneity are determined using analytical chemistry techniques such as polyacrylamide gel electrophoresis or high performance liquid chromatography. A nucleic acid or particular bacteria that are the predominant species present in a preparation is substantially purified. In an exemplary embodiment, the term purified denotes that a nucleic acid or protein that gives rise to essentially one band in an electrophoretic gel. Typically, isolated nucleic acids or proteins have a level of purity expressed as a range. The lower end of the range of purity for the component is about 60%, about 70% or about 80% and the upper end of the range of purity is about 70%, about 80%, about 90% or more than about 90%.
(17) For nucleic acids, sizes are given in either kilobases (kb) or base pairs (bp), or nucleotides (nt). Estimates are typically derived from agarose or acrylamide gel electrophoresis, from sequenced nucleic acids, or from published DNA sequences. For proteins, sizes are given in kiloDaltons (kDa) or amino acid residue numbers. Proteins sizes are estimated from gel electrophoresis, from sequenced proteins, from derived amino acid sequences, or from published protein sequences.
(18) Unless otherwise indicated, a particular nucleic acid sequence for each amino acid substitution (alteration) also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions), the complementary (or complement) sequence, and the reverse complement sequence, as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (see e.g., Batzer et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); and Rossolini et al., Mol. Cell. Probes 8:91-98(1994)). Because of the degeneracy of nucleic acid codons, one can use various different polynucleotides to encode identical polypeptides. Table 2, infra, contains information about which nucleic acid codons encode which amino acids and is useful for determining the possible nucleotide substitutions that are included in this invention.
(19) TABLE-US-00002 TABLE 2 Amino acid Nucleic acid codons Ala/A GCT, GCC, GCA, GCG Arg/R CGT, CGC, CGA, CGG, AGA, AGG Asn/N AAT, AAC Asp/D GAT, GAC Cys/C TGT, TGC Gln/Q CAA, CAG Glu/E GAA, GAG Gly/G GGT, GGC, GGA, GGG His/H CAT, CAC Ile/I ATT, ATC, ATA Stop TAA, TGA, TAG Leu/L TTA, TTG, CTT, CTC, CTA, CTG Lys/K AAA, AAG Met/M ATG Phe/F TTT, TTC Pro/P CCT, CCC, CCA, CCG Ser/S TCT, TCC, TCA, TCG, AGT, AGC Thr/T ACT, ACC, ACA, ACG Trp/W TGG Tyr/Y TAT, TAC Val/V GTT, GTC, GTA, GTG
(20) The term primer refers to an oligonucleotide, which is capable of acting as a point of initiation of synthesis when placed under conditions in which primer extension is initiated. A primer may occur naturally, as in a purified restriction digest, or may be produced synthetically.
(21) A primer is selected to be substantially complementary to a strand of specific sequence of the template. A primer must be sufficiently complementary to hybridize with a template strand for primer elongation to occur. A primer sequence need not reflect the exact sequence of the template. For example, a non-complementary nucleotide fragment may be attached to the 5 end of the primer, with the remainder of the primer sequence being substantially complementary to the strand. Non-complementary bases or longer sequences can be interspersed into the primer, provided that the primer sequence is sufficiently complementary with the sequence of the template to hybridize and thereby form a template primer complex for synthesis of the extension product of the primer.
(22) Oligonucleotides and polynucleotides that are not commercially available can be chemically synthesized e.g., according to the solid phase phosphoramidite triester method first described by Beaucage and Caruthers, Tetrahedron Letts. 22:1859-1862 (1981), or using an automated synthesizer, as described in Van Devanter et al., Nucleic Acids Res. 12:6159-6168 (1984). Other methods for synthesizing oligonucleotides and polynucleotides are known in the art. Purification of oligonucleotides is by either native acrylamide gel electrophoresis or by anion-exchange HPLC as described in Pearson & Reanier, J. Chrom. 255:137-149 (1983).
(23) The terms identical or percent identity, in the context of two or more polynucleotides or polypeptide sequences, refer to two or more sequences or sub-sequences that are the same or have a specified percentage of nucleotides or amino acids (respectively) that are the same (e.g., 80%, 85% identity, 90% identity, 99%, or 100% identity), when compared and aligned for maximum correspondence over a designated region as measured using a sequence comparison algorithm or by manual alignment and visual inspection.
(24) The phrase high percent identical or high percent identity, in the context of two polynucleotides or polypeptides, refers to two or more sequences or sub-sequences that have at least about 80%, identity, at least about 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide or amino acid identity, when compared and aligned for maximum correspondence, as measured using a sequence comparison algorithm or by visual inspection. In an exemplary embodiment, a high percent identity exists over a region of the sequences that is at least about 16 nucleotides or amino acids in length. In another exemplary embodiment, a high percent identity exists over a region of the sequences that is at least about 50 nucleotides or amino acids in length. In still another exemplary embodiment, a high percent identity exists over a region of the sequences that is at least about 100 nucleotides or amino acids or more in length. In one exemplary embodiment, the sequences are high percent identical over the entire length of the polynucleotide or polypeptide sequences.
(25) For sequence comparison, typically one sequence acts as a reference sequence, to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters. Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Natl. Acad. Sci. USA 85:2444 (1988), by computerized implementations of various algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by manual alignment and visual inspection (see, e.g., Ausubel et al. (eds.), Current Protocols in Molecular Biology, 1995 supplement).
(26) The complement of a particular polynucleotide sequence is that nucleotide sequence which would be capable of forming a double-stranded DNA or RNA molecule with the represented nucleotide sequence, and which can be derived from the represented nucleotide sequence by replacing the nucleotides by their complementary nucleotide according to Chargaff's rules (A< >T; G< >C) and reading in the 5 to 3 direction, i.e., in opposite direction of the represented nucleotide sequence (reverse complement).
(27) As used herein, the term promoter refers to a polynucleotide that, in its native state, is located upstream or 5 to a translational start codon of an open reading frame (or protein-coding region) and that is involved in recognition and binding of RNA polymerase and other proteins (trans-acting transcription factors) to initiate transcription. The promoters that are predominately functional in a specific tissue or set of tissues are considered tissue-specific promoters. A promoter can be used as a 5 regulatory element for modulating expression of a particular desired polynucleotide (heterologous polynucleotide) operably linked thereto. When operably linked to a transcribable polynucleotide, a promoter typically causes the transcribable polynucleotide to be transcribed in a manner that is similar to that of which the promoter is normally associated.
(28) The term vector refers to DNA, RNA, a protein, or polypeptide that are to be introduced into a host cell or organism. The polynucleotides, protein, and polypeptide which are to be introduced into a host can be therapeutic or prophylactic in nature; can encode or be an antigen; can be regulatory in nature; etc. There are various types of vectors including viruses, viroids, plasmids, bacteriophages, cosmids, and bacteria.
(29) An expression vector is nucleic acid capable of replicating in a selected host cell or organism. An expression vector can replicate as an autonomous structure, or alternatively can integrate, in whole or in part, into the host cell chromosomes or the nucleic acids of an organelle, or it is used as a shuttle for delivering foreign DNA to cells, and thus replicate along with the host cell genome. Thus, an expression vector are polynucleotides capable of replicating in a selected host cell, organelle, or organism, e.g., a plasmid, virus, artificial chromosome, nucleic acid fragment, and for which certain genes on the expression vector (including genes of interest) are transcribed and translated into a polypeptide or protein within the cell, organelle or organism; or any suitable construct known in the art, which comprises an expression cassette. In contrast, as described in the examples herein, a cassette is a polynucleotide containing a section of an expression vector. The use of the cassettes assists in the assembly of the expression vectors. An expression vector is a replicon, such as plasmid, phage, virus, chimeric virus, or cosmid, and which contains the desired polynucleotide sequence operably linked to the expression control sequence(s).
(30) A heterologous polynucleotide sequence is operably linked to one or more transcription regulatory elements (e.g., promoter, terminator and, optionally, enhancer) such that the transcription regulatory elements control and regulate the transcription and/or translation of that heterologous polynucleotide sequence. A cassette can have the heterologous polynucleotide operably linked to one or more transcription regulatory elements. As used herein, the term operably linked refers to a first polynucleotide, such as a promoter, connected with a second transcribable polynucleotide, such as a gene of interest, where the polynucleotides are arranged such that the first polynucleotide affects the transcription of the second polynucleotide. In some embodiments, the two polynucleotide molecules are part of a single contiguous polynucleotide. In other embodiments, the two polynucleotides are adjacent. For example, a promoter is operably linked to a gene of interest if the promoter regulates or mediates transcription of the gene of interest in a cell. Similarly, a terminator is operably linked to the polynucleotide of interest if the terminator regulates or mediates transcription of the polynucleotide of interest, and in particular, the termination of transcription. Constructs of the present invention would typically contain a promoter operably linked to a transcribable polynucleotide operably linked to a terminator.
(31) The term recombinant when used with reference, e.g., to a cell, or nucleic acid, protein, or vector, indicates that the cell, organism, nucleic acid, protein or vector, has been modified by the introduction of a heterologous nucleic acid or protein or the alteration of a native nucleic acid or protein, or that the cell is derived from a cell so modified. Thus, for example, recombinant viruses may express genes/polynucleotides that are not found within the native (non-recombinant or wild-type) form of the viruses or express native genes in an otherwise abnormal amountover-expressed, under-expressed or not expressed at allcompared to the non-recombinant or wild-type sequence, polynucleotide, or organism.
(32) A vaccine is defined herein as a biological agent which is capable of providing a protective response in an animal to which the vaccine has been delivered and is incapable of causing severe disease. Administration of the vaccine results in increased immunity from a disease; the vaccine stimulates antibody production or cellular immunity against the pathogen causing the disease. Immunity is defined herein as the induction of a significantly higher level of protection in a population of recipients, such as porcine, against mortality and clinical symptoms after vaccination compared to an unvaccinated group. In particular, the vaccine(s) according to the invention can: (a) protect a large proportion of vaccinated animals against the occurrence of clinical symptoms of the disease and mortality, or; (b) result in a significant decrease in clinical symptoms of the disease and mortality.
(33) The term effective amount of a compound or property as provided herein is meant such amount as is capable of performing the function of the compound or property for which an effective amount is expressed. As will be pointed out below, the exact amount required will vary from process to process, depending on recognized variables such as the compounds employed and the processing conditions observed. Thus, it is not possible to specify an exact effective amount. However, an appropriate effective amount may be determined by one of ordinary skill in the art using only routine experimentation.
(34) The term DIVA or DIVA vaccine refers to a vaccine which may be used to differentiate infected from vaccinated animals. Differentiation may be made according to any known method in the art which can substantially identify a DIVA-vaccinated organism from an infected organism. A DIVA vaccine may be, for example, a negative DIVA or a positive DIVA. A negative DIVA vaccine is a vaccine which has been modified by a deletion in one or more regions of its sequence relative to the corresponding region(s) of the virus. A positive DIVA vaccine is a vaccine which has been modified by an insertion in one or more regions of its sequence relative to the corresponding region(s) of the virus. The insertion may be a tag, such as an epitope tag, which may be used to positively identify the vaccine.
(35) The deletions and/or insertions in a DIVA vaccine may vary in length. Deletions according to the present invention may be as small as 10 amino acids in length or as large as 120 amino acids in length (and the corresponding size in the encoding cDNA sequence(s)). Insertions may be as small as 8 amino acids in length or as large as 30 amino acids in length.
(36) In some instances, vaccines of the present invention may also be administered with one or more adjuvants, which includes any material included in the vaccine formulation that enhances an immune response in the recipient that is induced by the vaccine.
(37) An immunogenic composition may refer to a vaccine, optionally including one or more adjuvants, carriers, or other pharmaceutically acceptable materials. Immunogenic compositions may also be referred to as vaccine compositions.
(38) Immunogenic compositions of the present invention can also comprise pharmaceutically or veterinarily acceptable carriers in addition to the recombinant protein component of the vaccine. Carriers utilized in practicing the vaccines provided herein can be any known in the art and can be liquid, solid, semi-solid, or gel. The type of formulation can be modified depending on the route of administration of the antigen. For example, if the vaccines of the present invention are applied parenterally (intramuscularly, intravascularly, or subcutaneously), a liquid formulationsuch as an emulsion, suspension, or solutionmay be preferred. For oral administration, the vaccines of the present invention can be applied to carriers such as pellets, tablets, kibbles, chewables, powders and beads, as well as specific materials such as microcrystalline cellulose (MCC), plant-based products and soil-based products (e.g., clays). Preferably, carriers are non-toxic to the recipient. In some instances the vaccines of the present invention, with or without carriers, can be presented to a recipient for ingestion via suspension in drinking water. One of skill in the art is readily able to choose such carriers for application to recipient animals such as porcine.
(39) Vaccines in the present invention may be modified-live vaccines (MLV), which are also referred to as attenuated vaccines. An MLV is a vaccine is a vaccine based on a virus modified such that it no longer causes the same clinical symptoms when administered to a recipient. For example, swine administered with a MLV for PRRSV would not exhibit the same clinical symptoms they would if they had been directly infected by PRRSV.
(40) Vaccines in the present invention involve the editing of nucleotide and/or amino acid sequences. Though examples of only specific modifications, i.e. deletions or additions, of certain sequence lengths and in certain locations within the sequences are given below, one of ordinary skill in the art would understand that minor modifications may also be useful in the present invention. For example, a deletion may start up to 6 nucleotide residues prior to or after the disclosed starting location, and a deletion may end up to 6 nucleotide residues prior to or after the disclosed ending location. Further, an insertion, such as a tag, may be exactly the same length as one of the disclosed tags or 4 amino acids in length.
(41) Porcine and swine are used interchangeably herein and refer to any animal that is a member of the family Suidae such as, for example, a pig.
(42) Although the following Example uses a single parental strain, it is envisioned that the nsp2 region used in the present invention may be used as an insert and/or replacement in any other suitable viral strain.
EXAMPLES
(43) To produce vaccine viruses capable of differentiating infected from vaccinated animals (DIVA) and to be useful as tags to follow virus infection of cultured cells or in animals, two deletion constructs of the parental pMLV strain (as produced from the PRRSV strain VR-2332, as described in Wang, et al, 2008; Attenuation of porcine reproductive and respiratory syndrome virus strain MN184 using chimeric construction with vaccine sequence, Virology 371, 418-429) that had proven replication competent in MARC-145 cells [pV7-nsp223 (deletion of nsp2 N-terminal amino acids (aa) 12-34) and pV7-nsp287 (deletion of nsp2 hypervariable region aa 726-812)] were selected for further study. pV7-nsp287 has also been shown to be replication competent in swine, producing adequate titers (Faaberg et al., 2010. In vivo growth of porcine reproductive and respiratory syndrome virus engineered nsp2 deletion mutants. Virus Res. 154, 77-85; Guo et al., 2011. Large scale parallel pyrosequencing technology: PRRSV strain VR-2332 nsp2 deletion mutant stability in swine. Virus Res. 161, 162-169).
(44) The cDNA sequence of the nsp2 region of the pMLV strain is given in SEQ ID NO: 1 and the cDNA sequences of nsp2 region of the two deletion constructs of nsp223 and nsp287 are given in SEQ ID NO: 2 and SEQ ID NO: 4, respectively. The amino acid sequences of the two deletion constructs of nsp223 and nsp287 are given in SEQ ID NO: 3 and SEQ ID NO: 5, respectively. Three small immunogenic tags were chosen for insertion into the deletion mutants: a small epitope found on the P and V proteins of simian virus 5 (V5), the commonly used synthetic FLAG tag, and an oligopeptide derived from pancreatic ribonuclease A (S-tag) (
(45) To generate a simplified cloning vector that lacked critical restriction enzyme recognition sites, an existing cloning vector (pCR-XL-TOPO; ThermoFisher Scientific, Waltham, Mass., USA) was deconstructed and modified. To do so, pCR-XL-TOPO was digested with HinfI and the two fragments (339 bp, 1043 bp) containing the origin of replication and the Zeocin resistance gene were gel purified and ligated. Subsequently, a multiple cloning site (MCS) was inserted by ligation of four annealed synthetic oligonucleotides to encode the sequence 5-CATGTACTAGTAGGCCTAGATCTGCATGCGAATTCCGCGGATCCGGCCGGCCGGCCG GCCCGGGCTCTAGACTCGAGAAGCTTTTAATTAAACCATG (SEQ ID NO: 24) into the existing PciI site. This vector was designated pCHAZ.
(46) To generate subclones of the targeted regions of nsp2, 2-step mutagenic PCR was carried out using Phusion polymerase (New England Biolabs, Ipswich, Mass., USA) and the pMLV infectious clone as a template. This mutagenic PCR introduced a pair of inverted EarI sites just internal to the region targeted for deletion, such that the sites excised themselves upon digestion and subsequent fill-in of the overhangs and self-ligation would generate the desired deletion. PCR products were A-tailed using GoTaq polymerase (Promega, Madison, Wis., USA) and subcloned into pGEMTeasy (Promega). All PCR subclones were verified by sequencing. These PCR subclones were subsequently transferred into pCHAZ through ligation of the SphI/SpeI fragment from pGEMTeasy into the corresponding sites of the pCHAZ MCS. The 23/EarI and 87/EarI pCHAZ subclones were then digested with EarI and filled-in using Klenow DNA polymerase (New England Biolabs). To generate the untagged deletions, cut plasmids were self-ligated. To insert an epitope tag, complimentary 5-phosphorylated synthetic oligonucleotides encoding the desired epitope tag were annealed and ligated in place of the deleted sequence. The oligonucleotide sequences encoding the tags for V5, S-Tag, and FLAG are given in SEQ ID NO: 6, 8, and 10, respectively. The amino acid sequences of each tag V5, S-Tag, and FLAG are given in SEQ ID NO: 7, 9, and 11, respectively. Each oligonucleotide tag sequence was engineered to contain an identifying restriction enzyme recognition site (V5: XbaI; S-tag: NotI; 3xFLAG: PsiI), through translationally silent nucleotide changes. Once sequence verified, pCHAZ subclones were transferred to an intermediate clone containing nucleotides 1-4546 of the MLV genome, terminating in an FseI site, termed MLV-Fragment I. This transfer was completed through ligation of the EcoRI/BamHI (23) or HindIII/FseI (87) fragments from the respective deleted or tagged-deleted pCHAZ clones into the MLV-Fragment I intermediate clone. All intermediate clones were then transferred to the full-length pMLV infectious clone, by swapping the parental SphI/FseI fragment with the corresponding respective deleted or tagged-deleted sequence. Traditional Sanger sequencing using existing PRRSV primers (available on request) was used to determine the full-length sequence of all prepared pMLV mutant cDNA clones.
(47) Two of the resulting viruses were negative DIVAs (rMLV-nsp223 and rMLV-nsp287) and six viruses were positive DIVAs (rMLV-nsp223-V5, rMLV-nsp223-S, rMLV-nsp223-FLAG, rMLV-nsp287-V5, rMLV-nsp287-S, rMLV-nsp287-FLAG). These virus names have been abbreviated herein to 23, 87, 23-V5, 23-S, 23-FLAG, 87-V5, 87-S, 87-FLAG, respectively.
(48) The full-length cDNA clones (10 g) were linearized at the 3-end by cleavage with PacI, extracted with phenol:chloroform and resuspended in 10 l RNase-free TE (10 mM Tris-HCl, 1 mM EDTA) or water. Capped RNA transcripts were produced from 1 g linearized DNA using the mMESSAGE MACHINE T7 Ultra kit (ThermoFisher Scientific). Transcribed RNA was then purified by phenol:chloroform extraction and resuspended in RNase-free water (40 l). RNA was evaluated for quality on 1% native agarose gel and quantified by spectrophotometry. Transcripts (10 ng or 100 ng) derived from pMLV23, pMLV87, pMLV23-V5, pMLV23-FLAG and pMLV87-V5 were initially transfected in MARC-145 cells using DMRIE-C(Han, et al., 2007. Identification of nonessential regions of the nsp2 replicase protein of porcine reproductive and respiratory syndrome virus strain VR-2332 for replication in cell culture. J. Virol. 81, 9878-9890).
(49) MARC-145 cultured cells in Minimum Essential Medium Eagle (EMEM) medium (Sigma-Aldrich 56416c; St. Louis, Mo., USA) supplemented with 10% fetal bovine serum (bovine viral diarrhea free; Omega Scientific Inc., Tarzana, Calif., USA) and 50 g/ml gentamicin sulfate was used to rescue and propagate recombinant viruses.
(50) Subsequently, all RNA transcripts (1.5 and 3 g) were electroporated in duplicate into MARC-145 cells using an established method (Ansari, et al., 2006. Influence of N-linked glycosylation of porcine reproductive and respiratory syndrome virus GP5 on virus infectivity, antigenicity, and ability to induce neutralizing antibodies. J. Virol. 80, 3994-4004). Electroporated MARC-145 cells were plated onto 60 cm.sup.2 plates (passage 0) and passaged up to 2 times on 6-well plates until cytopathic effect (CPE) was seen. Recombinant virus was blindly passaged for 10 passages by inoculating 100 l infected cell clarified supernatant diluted in 900 l basal medium onto a monolayer of MARC-145 cells at 80% confluency in a T75 flask, rotating the infected cells 1 h at room temperature, then incubating the cells at 37 C., 5% CO.sub.2 for 4-5 days. Each passage was harvested, centrifuged at 4000 rpm for 10 min, aliquoted into 2-4 ml tubes and frozen at 80 C.
(51) Confirmation of Viral Mutants.
(52) In order to provide evidence that the modified viruses were as expected, RNA was purified from each virus at passage 3 and passage 10 and fully analyzed by RT-PCR (
(53) After passage 3, primer pairs were utilized to confirm the expected size of each product (
(54) At passage 10, in order to assess whether the mutant viruses still displayed the proper mutation with the correct inserted restriction enzyme site, restriction enzyme analysis was performed on all mutants using the products of primer sets A and C (
(55) Viral Mutant Stability.
(56) To assess the influence of viral passage on sequence stability as well as to reconfirm the passages were not contaminated with other mutants, viruses at passages 3 and 10 were also processed for next generation whole viral genome sequencing using the Illumina MiSeq desktop genome sequencer (
(57) Overall, the modified viral genomes were stable and the mutations were few in number, except for 87-FLAG. All mutations but one led to amino acid changes, and all but one were single nucleotide polymorphisms (SNP). No changes were seen in the nucleotides that were modified by deletion or deletion-tagged insertion. Sixteen of the 35 mutations detected in the combined nucleotide alignment maintained the original nucleotide at a particular site, but also revealed a co-existing viral population with another nucleotide at that same site (Table 3). Only one nucleotide (ORF4 nt 13581) was shown to change consistently in most modified viruses, resulting in either a G.fwdarw.A, G.fwdarw.A/G (R) or evidence of two successive mutations A.fwdarw.A/T (W). Most amino acid mutations that arose over 3 to 10 passages of the modified viruses in MARC-145 cells reflected non-conservative changes. The mutation noted in ORF5 and ORF5a, seen in both 23 and 87, removed a predicted N-glycosylation motif near the N-terminal end of GP5.
(58) TABLE-US-00003 TABLE 3 Mutations arising at 3 and 10 passages in each DIVA vaccine 23 23-V5 23-FLAG 23-S Region Nucleotide MLV 0 3 10 0 3 10 0 3 10 0 3 10 Nsp1 953 C Nsp1 1254 T W Nsp2 1342 G A A Nsp2 1883 A Nsp2 2837 A Nsp2 3291 G Nsp2 3783 C Y Nsp4 5751 C Nsp4 6146 A G G Nsp7 7200 C S Nsp7 7201 C Y ORF2 12494 A G ORF2 12639 A G ORF3 12976 A R R ORF4 13581 G A A A A A A A A ORF4 13739 T ORF5; 13885 A R 5a Amino 87 87-V5 87-FLAG 87-S acid Region 0 3 10 0 3 10 0 3 10 0 3 10 mutation Nsp1 Y R.fwdarw.R/C Nsp1 L.fwdarw.L/H Nsp2 G.fwdarw.R Nsp2 R I.fwdarw.I/V Nsp2 R S.fwdarw.S/G Nsp2 T G.fwdarw.V Nsp2 T.fwdarw.T/I Nsp4 T S.fwdarw.L Nsp4 K.fwdarw.E Nsp7 P.fwdarw.P/R Nsp7 ORF2 S S.fwdarw.S/G ORF2 Q.fwdarw.R ORF3 I.fwdarw.I/V ORF4 W W W R A R V.fwdarw.V//F ORF4 Y T.fwdarw.T ORF5; R N.fwdarw.N/D; 5a Q.fwdarw.Q/R
(59) Northern Blot Analyses.
(60) In PRRSV infected cells, many subgenomic RNA (sgRNA) species are detected that are produced by a discontinuous transcription strategy that proceeds through a fusion of the viral genome 5 untranslated region (UTR) to one of several sites downstream during negative strand synthesis (Kappes and Faaberg, 2015. PRRSV structure, replication and recombination: Origin of phenotype and genotype diversity. Virology 479-480, 475-486; Snijder et al., Arterivirus molecular biology and pathogenesis. J. Gen. Virol. 94, 2141-2163). These mRNAs include the standard sgRNAs (RNAs 2-7;
(61) Northern blot analysis was performed according to the NorthernMax Kit instructions (AM1940; ThermoFisher Scientific). MARC-145 cells were inoculated with the third passage of each virus at an MOI of 0.01. Two days after infection, intracellular RNA was extracted, denatured for 1 hour at 50 C. with glyoxal loading dye and then electrophoresed (5 g/sample) on a glyoxal denaturing gel and transferred onto a 0.45 m Whatman Nytran SuPerCharge nylon membrane (Sigma-Aldrich) by gravity overnight at room temperature. The membrane was hybridized with a digoxin-labeled oligonucleotide probe (7-p14890: 5-CCTTCTTTCTCTTCTGCTGCTTGCCGTTGTTATTTGGCAT (SEQ ID NO: 33); V5: 5-GGTGGAATCTAGACCCAGCAGTGGGTTGGGGATGGGCTTGCC (SEQ ID NO: 34); FLAG: 5-CTTGTCATCGTCATCCTTGTAGTCGATATCGTGATCCTTGTAATCGCCGTCATGATCC TTATAATC (SEQ ID NO: 35); S: 5-AATCCATATGCTGGCGTTCGAACTTAGCGGCC (SEQ ID NO: 36)) complementary to ORF7, V5, FLAG, and S-tag respectively in ULTRAhyb Ultrasensitive Hybridization Buffer (AM8670; ThermoFisher Scientific) at 68 C. for 16-20 h, washed two times in low stringency 2 Saline-Sodium Citrate (0.3 M sodium chloride and 30 mM trisodium citrate; SSC) with 0.1% SDS at room temperature for 10 min. The membrane was then processed for immunological detection using the DIG DNA Labeling and Detection Kit following the manufacturer's instructions (11093657910 ROCHE; Sigma-Aldrich).
(62) With some PRRSV strains, as is the case with MLV, other atypical RNAs are detected (Wang et al., 2008; Yuan et al., 2000; Yuan et al., 2004). These unusual RNAs, termed heteroclites, have been shown to be products of aberrant fusions of viral genome 5 sequence with downstream sequence at 2-7 nucleotide stretches that are not conserved and vary between the individual nonconforming subgenomic RNAs (
(63) Multi-Step Growth Curve.
(64) Using passage 3 stocks, the deletion and deletion-tagged viruses were analyzed for viral replication rate. Growth curves were performed simultaneously (0.1 MOI input) with sampling at 0, 6, 12, 24, 36, 48 and 72 h, using known techniques (Han et al., 2007. Identification of nonessential regions of the nsp2 replicase protein of porcine reproductive and respiratory syndrome virus strain VR-2332 for replication in cell culture. J. Virol. 81, 9878-9890; Wang et al., 2008). Virus titers of recombinant MLV, 23, 87, 23-V5, 87-V5, 23-S, 87-S, 23-FLAG and 87-FLAG at each time point were determined by plaque assay on MARC-145 cells. Titers (plaque forming units (PFU)/ml) were determined on MARC-145 cells to assess in vitro growth properties.
(65) A range of replication rates was observed. 23, 23-V5, 23-S, 23-FLAG and 87-V5 viruses replicated to titers that were 0.8-1.5 logs higher than MLV on MARC-145 cells, while 87, 87-S, 87-FLAG viruses replicated at rates similar to the vaccine strain MLV (
(66) Immunofluorescence.
(67) Each tagged mutant was assessed by immunofluorescence with either an antibody to PRRSV nucleocapsid (SDOW17) or by an antibody to one of the three different tags. Uninfected or infected MARC-145 cells grown on chamber slides were fixed with paraformaldehyde, permeabilized with 0.2% Triton X-100 in phosphate buffered saline (PBS), and treated with 0.1% sodium borohydride PBS. Primary antibodies used were mAb SDOW-17 (1:50; RTI, Brookings, S. Dak., USA) specific for the PRRSV nucleocapsid protein, mAb to the V5-tag (1:500; Abcam, Cambridge, Mass., USA), mAb to the FLAG tag (1:500; Sigma-Aldrich, St. Louis, Mo.) and mAb to the S tag (1:100; Abcam). The secondary antibody used was fluorescein isothiocyanate (FITC)-conjugated affinity isolated goat anti-mouse IgG (Fc specific; Sigma-Aldrich). DAPI (4,6-diamidino-2-phenylindole) was used to stain nuclei (Thermo-Scientific). Stained slides were visualized using 40 and 60 oil immersion objectives on a Nikon A1R+ laser scanning confocal microscope.
(68) All viral mutants showed reactivity to the nucleocapsid antibody, as shown with untagged deletion mutant 23 (
(69) The foregoing description and accompanying figures illustrate the principles, preferred embodiments and modes of operation of the invention. However, the invention should not be construed as being limited to the particular embodiments discussed above. Additional variations of the embodiments discussed above will be appreciated by those skilled in the art.
(70) Therefore, the above-described embodiments should be regarded as illustrative rather than restrictive. Accordingly, it should be appreciated that variations to those embodiments can be made by those skilled in the art without departing from the scope of the invention as defined by the following claims.