1. Patent Search
  2. Details

HUMAN LAMBDA LIGHT CHAIN MICE

20200239837 ยท 2020-07-30

    Inventors

    Cpc classification

    International classification

    Abstract

    Genetically modified mice are provided that express human variable (hV) sequences, including mice that express hV sequences from an endogenous mouse light chain locus, mice that express hV sequences from an endogenous mouse light chain locus, and mice that express hV sequences from a transgene or an episome wherein the hV sequence is linked to a mouse constant sequence. Mice are provided that are a source of somatically mutated human variable sequences useful for making antigen-binding proteins. Compositions and methods for making antigen-binding proteins that comprise human variable sequences, including human antibodies, are provided.

    Claims

    1-20. (canceled)

    21. A method of generating a human light chain variable region, the method comprising: (a) immunizing a genetically modified mouse with an antigen, wherein the germline genome of the genetically modified mouse comprises: one or more human V gene segments and one or more human J gene segments, wherein the one or more human V gene segments and the one or more human J gene segments replace endogenous mouse V gene segments and endogenous J gene segments; and wherein the one or more human V gene segments and one or more human J gene segments are operably linked to an endogenous mouse light chain constant (C) region gene; and (b) determining a human light chain variable region that encodes a human light chain variable domain of an antibody that specifically binds the antigen and was generated by the genetically modified mouse, wherein the human light chain variable region is derived from a human V gene segment of the one or more human V gene segments and a human J gene segment of the one or more human J gene segments.

    22. The method of claim 21, comprising isolating a B cell of the genetically modified mouse and amplifying the light chain variable region from the B cell of the genetically modified mouse.

    23. The method of claim 21, wherein the one or more human V gene segments and the one or more human J gene segments are unrearranged gene segments.

    24. The method of claim 21, wherein the one or more human V gene segments comprises at least 12 human V gene segments.

    25. The method of claim 21, wherein the one or more human V gene segments comprises at least 28 human V gene segments.

    26. The method of claim 21, wherein the one or more human V gene segments comprises at least 40 human V gene segments.

    27. The method of claim 21, wherein the one or more human J gene segments comprises a human J1, J2, J3, J7, or a combination thereof.

    28. The method of claim 21, wherein an endogenous mouse immunoglobulin light chain locus is deleted in whole or in part.

    29. The method of claim 21, wherein 10% to 45% of the B cells of the genetically modified mouse express an antibody that comprises an immunoglobulin light chain comprising a human light chain variable domain and a mouse C domain.

    30. The method of claim 29, wherein the human light chain variable domain is derived from a rearranged hV/hJ that is a V3-1/J1, V3-1/J7, V4-3/J1, V4-3/J7, V2-8/J1, V3-9/J1, V3-10/J1, V3-10/J3, V3-10/J7, V2-14/J1, V3-19/J1, V2-23/J1, V3-25/J1, V1-40/J1, V1-40/J2, V1-40/J3, V1-40/J7, V7-43/J1, V7-43/J3, V1-44/J1, V1-44/J7, V5-45/J1, V5-45/J2, V5-45/J7, V7-48/J1, V7-46/J2, V7-48/J7, V9-49/J1, V9-49/J2, V9-49/J7 or V1/J1.

    31. The method of claim 21, wherein the germline genome of the genetically modified mouse further comprises a human V-J intergenic region from a human immunoglobulin light chain locus, wherein the human V-J intergenic region is contiguous with a human V gene segment and a human J gene segment.

    32. The method of claim 31, wherein the human V-J intergenic region is placed between a human V gene segment and a human J gene segment.

    33. A method for generating a human light chain variable domain comprising: (a) immunizing a genetically modified mouse with an antigen, wherein the germline genome of the genetically modified mouse comprises: one or more human V gene segments and one or more human J gene segments, wherein the one or more human V gene segments and the one or more human J gene segments replace endogenous mouse V gene segments and endogenous J gene segments; and wherein the one or more human V gene segments and one or more human J gene segments are operably linked to an endogenous mouse C gene; and (b) determining a human light chain variable domain of an antibody that specifically binds the antigen and was generated by the genetically modified mouse.

    34. The method of claim 33, wherein determining a human light chain variable domain comprises determining a nucleotide sequence that encodes the human light chain variable domain.

    35. The method of claim 33, wherein the one or more human V gene segments and one or more human J gene segments are unrearranged gene segments.

    36. The method of claim 33, wherein the one or more human V gene segments comprises at least 12 human V gene segments.

    37. The method of claim 33, wherein the one or more human V gene segments comprises at least 28 human V gene segments.

    38. The method of claim 33, wherein the one or more human V gene segments comprises at least 40 human V gene segments.

    39. The method of claim 33, wherein the one or more human J gene segments comprises a human J1, J2, J3, J7, or a combination thereof.

    40. The method of claim 33, wherein an endogenous mouse immunoglobulin light chain locus is deleted in whole or in part.

    41. The method of claim 33, wherein 10% to 45% of the B cells of the genetically modified mouse express an antibody that comprises an immunoglobulin light chain comprising a human light chain variable domain and a mouse C domain.

    42. The method of claim 41, wherein the human light chain variable domain is derived from a rearranged hV/hJ that is a V3-1/J1, V3-1/J7, V4-3/J1, V4-3/J7, V2-8/J1, V3-9/J1, V3-10/J1, V3-10/J3, V3-10/J7, V2-14/J1, V3-19/J1, V2-23/J1, V3-25/J1, V1-40/J1, V1-40/J2, V1-40/J3, V1-40/J7, V7-43/J1, V7-43/J3, V1-44/J1, V1-44/J7, V5-45/J1, V5-45/J2, V5-45/J7, V7-48/J1, V7-46/J2, V7-48/J7, V9-49/J1, V9-49/J2, V9-49/J7 or V1-51/J1.

    43. The method of claim 33, wherein the germline genome of the genetically modified mouse further comprises a human V-J intergenic region from a human immunoglobulin light chain locus, wherein the human V-J intergenic region is contiguous with a human V gene segment and a human J gene segment.

    44. The method of claim 43, wherein the human V-J intergenic region is placed between a human V gene segment and a human J gene segment.

    Description

    BRIEF DESCRIPTION OF THE FIGURES

    [0148] FIG. 1 shows a detailed illustration, not to scale, of the human light chain locus including the clusters of V gene segments (A, B and C) and the J and C region pairs (J-C pairs)

    [0149] FIG. 2 shows a general illustration, not to scale, of a targeting strategy used to inactivate the endogenous mouse light chain locus.

    [0150] FIG. 3 shows a general illustration, not to scale, of a targeting strategy used to inactivate the endogenous mouse light chain locus.

    [0151] FIG. 4A shows a general illustration, not to scale of an initial targeting vector for targeting the endogenous mouse light chain locus with human light chain sequences including 12 hV gene segments and hJ1 gene segment (12/1- Targeting Vector).

    [0152] FIG. 4B shows a general illustration, not to scale, of four initial targeting vectors for targeting the endogenous mouse light chain locus with human light chain sequences including 12 hV gene segments and hJ1 gene segment (12/1- Targeting Vector), 12 hV gene segments and hJ1, 2, 3 and 7 gene segments (12/4- Targeting Vector), 12 hV gene segments, a human V-J genomic sequence and hJ1 gene segment (12()1- Targeting Vector) and 12 hV gene segments, a human V-J genomic sequence and hJ1, 2, 3 and 7 gene segments (12()4- Targeting Vector).

    [0153] FIG. 5A shows a general illustration, not to scale, of a targeting strategy for progressive insertion of 40 hV gene segments and a single hJ gene segment into the mouse light chain locus.

    [0154] FIG. 5B shows a general illustration, not to scale, of a targeting strategy for progressive insertion of 40 hV gene segments and a single hJ gene segment into the mouse locus.

    [0155] FIG. 6 show a general illustration, not to scale, of the targeting and molecular engineering steps employed to make unique human - hybrid targeting vectors for construction of a hybrid light chain locus containing a human intergenic sequence, multiple hJ gene segments or both.

    [0156] FIG. 7A shows a general illustration, not to scale, of the locus structure for a modified mouse light chain locus containing 40 hV gene segments and a single hJ gene segment operably linked to the endogenous C2 gene.

    [0157] FIG. 7B shows a general illustration, not to scale, of the locus structure for four independent, modified mouse light chain loci containing 40 hV gene segments and either one or four hJ gene segments with or without a contiguous human V-J genomic sequence operably linked to the endogenous C gene.

    [0158] FIG. 8A shows contour plots of Ig.sup.+ and Ig.sup.+ splenocytes gated on CD19.sup.+ from a wild type mouse (WT), a mouse homozygous for 12 hV and four hJ gene segments including a human V-J genomic sequence (12hV-VJ-4hJ) and a mouse homozygous for 40 hV and one hJ gene segment (40hV-1hJ).

    [0159] FIG. 8B shows the total number of CD19.sup.+ B cells in harvested spleens from wild type (WT), mice homozygous for 12 hV and four hJ gene segments including a human V-J genomic sequence (12hV-VJ-4hJ) and mice homozygous for 40 hV and one hJ gene segment (40hV-1hJ).

    [0160] FIG. 9A, in the top panel, shows contour plots of splenocytes gated on singlets and stained for B and T cells (CD19.sup.+ and CD3.sup.+, respectively) from a wild type mouse (WT) and a mouse homozygous for 40 hV, and four J gene segments including a human V-J genomic sequence (40hV-VJ-4hJ). The bottom panel shows contour plots of splenocytes gated on CD19.sup.+ and stained for Ig.sup.+ and Ig.sup.+ expression from a wild type mouse (WT) and a mouse homozygous for 40 hV and four J gene segments including a human V-J genomic sequence (40hV-VJ-4hJ).

    [0161] FIG. 9B shows the total number of CD19.sup.+, CD19.sup.+Ig.sup.+ and CD19.sup.+Ig.sup.+ B cells in harvested spleens from wild type mice (WT) and mice homozygous for 40 hV and four J gene segments including a human V-J genomic sequence (40hV-VJ-4hJ).

    [0162] FIG. 9C shows contour plots of splenocytes gated on CD19.sup.+ and stained for immunoglobulin D (IgD) and immunoglobulin M (IgM) from a wild type mouse (WT) and a mouse homozygous for 40 hV and four J gene segments including a human V-J genomic sequence (40hV-VJ-4hJ). Mature (72 for WT, 51 for 40hV-VJ-4hJ) and transitional (13 for WT, 22 for 40hV-VJ-4hJ) B cells are noted on each of the contour plots.

    [0163] FIG. 9D shows the total number of CD19.sup.+ B cells, transitional B cells (CD19.sup.+IgM.sup.hiIgD.sup.lo) and mature B cells (CD19.sup.+IgM.sup.loIgD.sup.hi) in harvested spleens from wild type mice (WT) and mice homozygous for 40 hV and four J gene segments including a human V-J genomic sequence (40hV-VJ-4hJ).

    [0164] FIG. 10A, in the top panel, shows contour plots of bone marrow stained for B and T cells (CD19.sup.+ and CD3.sup.+, respectively) from a wild type mouse (WT) and a mouse homozygous for 40 hV and four J gene segments including a human V-J genomic sequence (40hV-VJ-4hJ). The bottom panel shows contour plots of bone marrow gated on CD19.sup.+ and stained for ckit.sup.+ and CD43.sup.+ from a wild type mouse (WT) and a mouse homozygous for 40 hV and four J gene segments including a human V-J genomic sequence (40hV-VJ-4hJ). Pro and Pre B cells are noted on the contour plots of the bottom panel.

    [0165] FIG. 10B shows the number of Pro (CD19.sup.+CD43.sup.+ckit.sup.+) and Pre (CD19.sup.+CD43.sup.ckit.sup.) B cells in bone marrow harvested from the femurs of wild type mice (WT) and mice homozygous for 40 hV and four J gene segments including a human V-J genomic sequence (40hV-VJ-4hJ).

    [0166] FIG. 10C shows contour plots of bone marrow gated on singlets stained for immunoglobulin M (IgM) and B220 from a wild type mouse (WT) and a mouse homozygous for 40 hV and four J gene segments including a human V-J genomic sequence (40hV-VJ-4hJ). Immature, mature and pro/pre B cells are noted on each of the contour plots.

    [0167] FIG. 10D shows the total number of immature (B220.sup.intIgM.sup.+) and mature (B220.sup.hiIgM.sup.+) B cells in bone marrow isolated from the femurs of wild type mice (WT) and mice homozygous for 40 hV and four J gene segments including a human V-J genomic sequence (40hV-VJ-4hJ).

    [0168] FIG. 10E shows contour plots of bone marrow gated on immature (B220.sup.intIgM.sup.+) and mature (B220.sup.hiIgM.sup.+) B cells stained for Ig and Ig expression isolated from the femurs of a wild type mouse (WT) and a mouse homozygous for 40 hV and four J gene segments including a human V-J genomic sequence (40hV-VJ-4hJ).

    [0169] FIG. 11 shows a nucleotide sequence alignment of the V-J-C junction of eighteen independent RT-PCR clones amplified from splenocyte RNA of mice bearing human light chain gene sequences at an endogenous mouse light chain locus. A6=SEQ ID NO:57; B6=SEQ ID NO:58; F6=SEQ ID NO:59; B7=SEQ ID NO:60; E7=SEQ ID NO:61; F7=SEQ ID NO:62; C8=SEQ ID NO:63; E12=SEQ ID NO:64; 1-4=SEQ ID NO:65; 1-20=SEQ ID NO:66; 3B43=SEQ ID NO:67; 5-8=SEQ ID NO:68; 5-19=SEQ ID NO:69; 1010=SEQ ID NO:70; 11A1=SEQ ID NO:71; 7A8=SEQ ID NO:72; 3A3=SEQ ID NO:73; 2-7=SEQ ID NO:74. Lower case bases indicate non-germline bases resulting from either mutation and/or N addition during recombination. Consensus amino acids within the Framework 4 region (FWR4) encoded by the nucleotide sequence of hJ1 and mouse C are noted at the bottom of the sequence alignment.

    [0170] FIG. 12 shows a nucleotide sequence alignment of the V-J-C junction of twelve independent RT-PCR clones amplified from splenocyte RNA of mice bearing human light chain gene sequences including a contiguous human V-J genomic sequence at an endogenous mouse light chain locus. 5-2=SEQ ID NO:87; 2-5=SEQ ID NO:88; 1-3=SEQ ID NO:89; 4B-1=SEQ ID NO:90; 3B-5=SEQ ID NO:91; 7A-1=SEQ ID NO:92; 5-1=SEQ ID NO:93; 4A-1=SEQ ID NO:94; 11A-1=SEQ ID NO:95; 5-7=SEQ ID NO:96; 5-4=SEQ ID NO:97; 2-3=SEQ ID NO:98. Lower case bases indicate non-germline bases resulting from either mutation and/or N addition during recombination. Consensus amino acids within the Framework 4 region (FWR4) encoded by the nucleotide sequence of each human J and mouse C are noted at the bottom of the sequence alignment.

    [0171] FIG. 13 shows a nucleotide sequence alignment of the V-J-C junction of three independent RT-PCR clones amplified from splenocyte RNA of mice bearing human light chain gene sequences at an endogenous mouse light chain locus. 2D1=SEQ ID NO:101; 2D9=SEQ ID NO:102; 3E15=SEQ ID NO:103. Lower case bases indicate non-germline bases resulting from either mutation and/or N addition during recombination. Consensus amino acids within the Framework 4 region (FWR4) encoded by the nucleotide sequence of hJ1 and mouse C2 are noted at the bottom of the sequence alignment.

    DETAILED DESCRIPTION

    [0172] Although specific features of various embodiments are discussed in detail, the descriptions of the specific aspects, embodiments, and examples do not limit the subject matter of the claims; it is the claims that describe the scope of the invention. All terms and phrases used in this disclosure include the meanings normally ascribed to them in the art.

    [0173] The term contiguous includes reference to occurrence on the same nucleic acid molecule, e.g., two nucleic acid sequences are contiguous if they occur on the same nucleic molecule but are interrupted by another nucleic acid sequence. For example, a rearranged V(D)J sequence is contiguous with a constant region gene sequence, although the final codon of the V(D)J sequence is not followed immediately by the first codon of the constant region sequence. In another example, two V gene segment sequences are contiguous if they occur on the same genomic fragment, although they may be separated by sequence that does not encode a codon of the V region, e.g., they may be separated by a regulatory sequence, e.g., a promoter or other noncoding sequence. In one embodiment, a contiguous sequence includes a genomic fragment that contains genomic sequences arranged as found in a wild-type genome.

    [0174] The phrase derived from when used concerning a variable region derived from a cited gene or gene segment includes the ability to trace the sequence back to a particular unrearranged gene segment or gene segments that were rearranged to form a gene that expresses the variable domain (accounting for, where applicable, splice differences and somatic mutations).

    [0175] The phrase functional when used concerning a variable region gene segment or joining gene segment refers to usage in an expressed antibody repertoire; e.g., in humans V gene segments 3-1, 4-3, 2-8, etc. are functional, whereas V gene segments 3-2, 3-4, 2-5, etc. are nonfunctional.

    [0176] A heavy chain locus includes a location on a chromosome, e.g., a mouse chromosome, wherein in a wild-type mouse heavy chain variable (V.sub.H), heavy chain diversity (D.sub.H), heavy chain joining (J.sub.H), and heavy chain constant (C.sub.H) region DNA sequences are found.

    [0177] A locus includes a location on a chromosome, e.g., a mouse chromosome, wherein in a wild-type mouse variable (V), joining (J), and constant (C) region DNA sequences are found.

    [0178] A locus includes a location on a chromosome, e.g., a mouse chromosome, wherein in a wild-type mouse variable (V), joining (J), and constant (C) region DNA sequences are found.

    [0179] The term unrearranged includes the state of an immunoglobulin locus wherein V gene segments and J gene segments (for heavy chains, D gene segments as well) are maintained separately but are capable of being joined to form a rearranged V(D)J gene that comprises a single V,(D),J of the V(D)J repertoire.

    Mice Expressing Human Variable Domains

    [0180] Mice that express antibodies that are fully human, or partly human and partly mouse, have previously been reported. VELOCIMMUNE genetically engineered mice comprise a replacement of unrearranged V(D)J gene segments at endogenous mouse loci with human V(D)J gene segments. VELOCIMMUNE mice express chimeric antibodies having human variable domains and mouse constant domains (see, e.g., U.S. Pat. No. 7,605,237). Most other reports concern mice that express fully human antibodies from fully human transgenes in mice that have disabled endogenous immunoglobulin loci.

    [0181] Antibody light chains are encoded by one of two separate loci: kappa () and lambda (). Mouse antibody light chains are primarily of the type. Mice that make mouse antibodies, and modified mice that make fully human or chimeric human-mouse antibodies, display a bias in light chain usage. Humans also exhibit light chain bias, but not so pronounced as in mice; the ratio of light chains to light chains in mice is about 95:5, whereas in humans the ratio is about 60:40. The more pronounced bias in mice is not thought to severely affect antibody diversity, because in mice the variable locus is not so diverse in the first instance. This is not so in humans. The human light chain locus is richly diverse.

    [0182] The human light chain locus extends over 1,000 kb and contains over 80 genes that encode variable (V) or joining (J) segments (FIG. 1). Within the human light chain locus, over half of all observed V domains are encoded by the gene segments 1-40, 1-44, 2-8, 2-14, and 3-21. Overall, about 30 or so of the human V gene segments are believed to be functional. There are seven J gene segments, only four of which are regarded as generally functional J gene segments-J1, J2, J3, and J7.

    [0183] The light chain locus in humans is similar in structure to the locus of both mice and humans in that the human light chain locus has several variable region gene segments that are capable of recombining to form a functional light chain protein. The human light chain locus contains approximately 70 V gene segments and 7 J-C gene segment pairs. Only four of these J-C gene segment pairs appear to be functional. In some alleles, a fifth J-C gene segment pair is reportedly a pseudo gene (C6). The 70 V gene segments appear to contain 38 functional gene segments. The 70 V sequences are arranged in three clusters, all of which contain different members of distinct V gene family groups (clusters A, B and C; FIG. 1). This is a potentially rich source of relatively untapped diversity for generating antibodies with human V regions in non-human animals.

    [0184] In stark contrast, the mouse light chain locus contains only two or three (depending on the strain) mouse V region gene segments (FIG. 2). At least for this reason, the severe bias in mice is not thought to be particularly detrimental to total antibody diversity.

    [0185] According published maps of the mouse light chain locus, the locus consists essentially of two clusters of gene segments within a span of approximately 200 kb (FIG. 2). The two clusters contain two sets of V, J, and C genes that are capable of independent rearrangement: V2-J2-C2-J4-C4 and V1-J3-C3-J1-C1. Although V2 has been found to recombine with all J gene segments. V1 appears to exclusively recombine with C1. C4 is believed to be a pseudo gene with defective splice sites.

    [0186] The mouse light chain locus is strikingly different. The structure and number of gene segments that participate in the recombination events leading to a functional light chain protein from the mouse locus is much more complex (FIG. 3). Thus, mouse light chains do not greatly contribute to the diversity of an antibody population in a typical mouse.

    [0187] Exploiting the rich diversity of the human light chain locus in mice would likely result in, among other things, a source for a more complete human repertoire of light chain V domains. Previous attempts to tap this diversity used human transgenes containing chunks of the human light chain locus randomly incorporated into the mouse genome (see, e.g., U.S. Pat. Nos. 6,998,514 and 7,435,871). Mice containing these randomly integrated transgenes reportedly express fully human light chains, however, in some cases, one or both endogenous light chain loci remain intact. This situation is not desirable as the human light chain sequences contend with the mouse light chain ( or ) in the expressed antibody repertoire of the mouse.

    [0188] In contrast, the inventors describe genetically modified mice that are capable of expressing one or more light chain nucleic acid sequences directly from a mouse light chain locus, including by replacement at an endogenous mouse light chain locus. Genetically modified mice capable of expressing human light chain sequences from an endogenous locus may be further bred to mice that comprise a human heavy chain locus and thus be used to express antibodies comprising V regions (heavy and light) that are fully human. In various embodiments. The V regions express with mouse constant regions. In various embodiments, no endogenous mouse immunoglobulin gene segments are present and the V regions express with human constant regions. These antibodies would prove useful in numerous applications, both diagnostic as well as therapeutic.

    [0189] Many advantages can be realized for various embodiments of expressing binding proteins derived from human V and J gene segments in mice. Advantages can be realized by placing human sequences at an endogenous light chain locus, for example, the mouse or locus. Antibodies made from such mice can have light chains that comprise human V domains fused to a mouse C.sub.L region, specifically a mouse C or C region. The mice will also express human V domains that are suitable for identification and cloning for use with human C.sub.L regions, specifically C and/or C regions. Because B cell development in such mice is otherwise normal, it is possible to generate compatible V domains (including somatically mutated V domains) in the context of either C or C regions.

    [0190] Genetically modified mice are described that comprise an unrearranged V gene segment at an immunoglobulin or light chain locus. Mice that express antibodies that comprise a light chain having a human V domain fused to a C and/or C region are described.

    Sterile Transcripts of the Immunoglobulin Light Chain Locus

    [0191] Variations on the theme of expressing human immunoglobulin sequences in mice are reflected in various embodiments of genetically modified mice capable of such expression. Thus, in some embodiments, the genetically modified mice comprise certain non-coding sequence(s) from a human locus. In one embodiment, the genetically modified mouse comprises human V and J gene segments at an endogenous light chain locus, and further comprises a human light chain genomic fragment. In a specific embodiment, the human light chain genomic fragment is a non-coding sequence naturally found between a human V gene segment and a human J gene segment.

    [0192] The human and mouse light chain loci contain sequences that encode sterile transcripts that lack either a start codon or an open reading frame, and that are regarded as elements that regulate transcription of the light chain loci. These sterile transcripts arise from an intergenic sequence located downstream or 3 of the most proximal V gene segment and upstream or 5 of the light chain intronic enhancer (Ei) that is upstream of the light chain constant region gene (C). The sterile transcripts arise from rearrangement of the intergenic sequence to form a VJ1 segment fused to a C.

    [0193] A replacement of the light chain locus upstream of the C gene would remove the intergenic region encoding the sterile transcripts. Therefore, in various embodiments, a replacement of mouse light chain sequence upstream of the mouse C gene with human light chain gene segments would result in a humanized mouse light chain locus that contains human V and J gene segments but not the light chain intergenic region that encodes the sterile transcripts.

    [0194] As described herein, humanization of the endogenous mouse light chain locus with human light chain gene segments, wherein the humanization removes the intergenic region, results in a striking drop in usage of the light chain locus, coupled with a marked increase in light chain usage. Therefore, although a humanized mouse that lacks the intergenic region is useful in that it can make antibodies with human light chain variable domains (e.g., human or domains), usage from the locus decreases.

    [0195] Also described is humanization of the endogenous mouse light chain locus with human V and J gene segments coupled with an insertion of a human intergenic region to create a V locus that contains, with respect to transcription, between the final human V gene segment and the first human J gene segment, a intergenic region; which exhibits a B cell population with a higher expression than a locus that lacks the intergenic region. This observation is consistent with a hypothesis that the intergenic region-directly through a sterile transcript, or indirectly-suppresses usage from the endogenous light chain locus. Under such a hypothesis, including the intergenic region would result in a decrease in usage of the endogenous light chain locus, leaving the mouse a restricted choice but to employ the modified ( into ) locus to generate antibodies.

    [0196] In various embodiments, a replacement of mouse light chain sequence upstream of the mouse C gene with human light chain sequence further comprises a human light chain intergenic region disposed, with respect to transcription, between the 3 untranslated region of the 3 most V gene segment and 5 to the first human J gene segment. Alternatively, such an intergenic region may be omitted from a replaced endogenous light chain locus (upstream of the mouse C gene) by making a deletion in the endogenous light chain locus. Likewise, under this embodiment, the mouse generates antibodies from an endogenous light chain locus containing human light chain sequences.

    Approaches to Engineering Mice to Express Human V Domains

    [0197] Various approaches to making genetically modified mice that make antibodies that contain a light chain that has a human V domain fused to an endogenous C.sub.L (e.g. C or C) region are described. Genetic modifications are described that, in various embodiments, comprise a deletion of one or both endogenous light chain loci. For example, to eliminate mouse light chains from the endogenous antibody repertoire a deletion of a first V-J-C gene cluster and replacement, in whole or in part, of the V-J gene segments of a second gene cluster with human V-J gene segments can be made. Genetically modified mouse embryos, cells, and targeting constructs for making the mice, mouse embryos, and cells are also provided.

    [0198] The deletion of one endogenous V-J-C gene cluster and replacement of the V-J gene segments of another endogenous V-J-C gene cluster employs a relatively minimal disruption in natural antibody constant region association and function in the animal, in various embodiments, because endogenous C genes are left intact and therefore retain normal functionality and capability to associate with the constant region of an endogenous heavy chain. Thus, in such embodiments the modification does not affect other endogenous heavy chain constant regions dependent upon functional light chain constant regions for assembly of a functional antibody molecule containing two heavy chains and two light chains. Further, in various embodiments the modification does not affect the assembly of a functional membrane-bound antibody molecule involving an endogenous heavy chain and a light chain, e.g., a hV domain linked to a mouse C region. Because at least one functional C gene is retained at the endogenous locus, animals containing a replacement of the V-J gene segments of an endogenous V-J-C gene cluster with human V-J gene segments should be able to make normal light chains that are capable of binding antigen during an immune response through the human V-J gene segments present in the expressed antibody repertoire of the animal.

    [0199] A schematic illustration (not to scale) of a deleted endogenous mouse V-J-C gene cluster is provided in FIG. 2. As illustrated, the mouse light chain locus is organized into two gene clusters, both of which contain function gene segments capable of recombining to form a function mouse light chain. The endogenous mouse V1-J3-C3-J1-C1 gene cluster is deleted by a targeting construct (Targeting Vector 1) with a neomycin cassette flanked by recombination sites. The other endogenous gene cluster (V2-V3-J2-C2-J4-C4) is deleted in part by a targeting construct (Targeting Vector 2) with a hygromycin-thymidine kinase cassette flanked by recombination sites. In this second targeting event, the C2-J4-C4 endogenous gene segments are retained. The second targeting construct (Targeting Vector 2) is constructed using recombination sites that are different than those in the first targeting construct (Targeting Vector 1) thereby allowing for the selective deletion of the selection cassette after a successful targeting has been achieved. The resulting double-targeted locus is functionally silenced in that no endogenous light chain can be produced. This modified locus can be used for the insertion of human V and J gene segments to create an endogenous mouse locus comprising human V and J gene segments, whereby, upon recombination at the modified locus, the animal produces light chains comprising rearranged human V and J gene segments linked to an endogenous mouse C gene segment.

    [0200] Genetically modifying a mouse to render endogenous gene segments nonfunctional, in various embodiments, results in a mouse that exhibits exclusively light chains in its antibody repertoire, making the mouse useful for evaluating the role of light chains in the immune response, and useful for making an antibody repertoire comprising V domains but not V domains.

    [0201] A genetically modified mouse that expresses a hV linked to a mouse C gene having been recombined at the endogenous mouse light chain locus can be made by any method known in the art. A schematic illustration (not to scale) of the replacement of the endogenous mouse V2-V3-J2 gene segments with human V and J gene segments is provided in FIG. 4A. As illustrated, an endogenous mouse light chain locus that had been rendered nonfunctional is replaced by a targeting construct (12/1- Targeting Vector) that includes a neomycin cassette flanked by recombination sites. The V2-V3-J2 gene segments are replaced with a genomic fragment containing human sequence that includes 12 hV gene segments and a single hJ gene segment.

    [0202] Thus, this first approach positions one or more hV gene segments at the endogenous light chain locus contiguous with a single hJ gene segment (FIG. 4A). Further modifications to the modified endogenous light chain locus can be achieved with using similar techniques to insert more hV gene segments. For example, schematic illustrations of two additional targeting constructs (+16- and +12- Targeting Vectors) used for progressive insertion of addition human hV gene segments are provided in FIG. 5A. As illustrated, additional genomic fragments containing specific human hV gene segments are inserted into the modified endogenous light chain locus in successive steps using homology provided by the previous insertion of human light chain sequences. Upon recombination with each targeting construct illustrated, in sequential fashion, 28 additional hV gene segments are inserted into the modified endogenous light chain locus. This creates a chimeric locus that produces a light chain protein that comprises human V-J gene segments linked to a mouse C gene.

    [0203] The above approaches to insert human light chain gene segments at the mouse locus, maintains the enhancers positioned downstream of the C2-J 4-C 4 gene segments (designated Enh 2.4, Enh and Enh 3.1 FIG. 4A and FIG. 5A). This approach results in a single modified allele at the endogenous mouse light chain locus (FIG. 7A).

    [0204] Compositions and methods for making a mouse that expresses a light chain comprising hV and J gene segments operably linked to a mouse C gene segment, are provided, including compositions and method for making a mouse that expresses such genes from an endogenous mouse light chain locus. The methods include selectively rendering one endogenous mouse V-J-C gene cluster nonfunctional (e.g., by a targeted deletion), and employing a hV and J gene segments at the endogenous mouse light chain locus to express a hV domain in a mouse.

    [0205] Alternatively, in a second approach, human light chain gene segments may be positioned at the endogenous light chain locus. The genetic modification, in various embodiments, comprises a deletion of the endogenous light chain locus. For example, to eliminate mouse light chains from the endogenous antibody repertoire a deletion of the mouse V and J gene segments can be made. Genetically modified mouse embryos, cells, and targeting constructs for making the mice, mouse embryos, and cells are also provided.

    [0206] For the reasons stated above, the deletion of the mouse V and J gene segments employs a relatively minimal disruption. A schematic illustration (not to scale) of deleted mouse V and J gene segments is provided in FIG. 3. The endogenous mouse V and J gene segments are deleted via recombinase-mediated deletion of mouse sequences position between two precisely positioned targeting vectors each employing site-specific recombination sites. A first targeting vector (J Targeting Vector) is employed in a first targeting event to delete the mouse J gene segments. A second targeting vector (V Targeting Vector) is employed in a second, sequential targeting event to delete a sequence located 5 of the most distal mouse V gene segment. Both targeting vectors contain site-specific recombination sites thereby allowing for the selective deletion of both selection cassettes and all intervening mouse light chain sequences after a successful targeting has been achieved. The resulting deleted locus is functionally silenced in that no endogenous light chain can be produced. This modified locus can be used for the insertion of hV and J gene segments to create an endogenous mouse locus comprising hV and J gene segments, whereby, upon recombination at the modified locus, the animal produces light chains comprising rearranged hV and J gene segments operably linked to an endogenous mouse C gene segment. Various targeting vectors comprising human light chain sequences can be used in conjunction with this deleted mouse locus to create a hybrid light chain locus containing human gene segments operably linked with a mouse C region.

    [0207] Thus, a second approach positions one or more human V gene segments are positioned at the mouse light chain locus contiguous with a single human J gene segment (12/1- Targeting Vector, FIG. 4B).

    [0208] In various embodiments, modifications to this approach can be made to add gene segments and/or regulatory sequences to optimize the usage of the human light chain sequences from the mouse locus within the mouse antibody repertoire.

    [0209] In a third approach, one or more hV, gene segments are positioned at the mouse light chain locus contiguous with four hJ gene sequences (12/4- Targeting Vector FIG. 4B).

    [0210] In a third approach, one or more hV gene segments are positioned at the mouse light chain locus contiguous with a human intergenic sequence and a single hJ gene sequence (12()1- Targeting Vector, FIG. 4B).

    [0211] In a fourth approach, one or more hV gene segments are positioned at the mouse light chain locus contiguous with a human intergenic sequence four hJ gene sequences (12()4- Targeting Vector FIG. 4B).

    [0212] All of the above approaches to insert human light chain gene segments at the mouse locus, maintain the intronic enhancer element upstream of the C gene (designated Ei, FIG. 4B and FIG. 5B) and the 3 K enhancer downstream of the C gene (designated E3, FIG. 4B and FIG. 5B). The approaches result in four separate modified alleles at the endogenous mouse light chain locus (FIG. 7B).

    [0213] In various embodiments, genetically modified mouse comprise a knockout of the endogenous mouse light chain locus. In one embodiment, the light chain locus is knocked out by a strategy that deletes the region spanning V2 to J2, and the region spanning V1 to C1 (FIG. 2). Any strategy that reduces or eliminates the ability of the endogenous light chain locus to express endogenous domains is suitable for use with embodiments in this disclosure.

    Lambda Domain Antibodies from Genetically Modified Mice

    [0214] Mice comprising human sequences at either the mouse or light chain locus will express a light chain that comprises a hV region fused to a mouse C.sub.L (C or C) region. These are advantageously bred to mice that (a) comprise a functionally silenced light chain locus (e.g., a knockout of the endogenous mouse or light chain locus); (b) comprise an endogenous mouse light chain locus that comprises hV and hJ gene segments operably linked to an endogenous mouse C gene; (c) comprise an endogenous mouse light chain locus that comprises hV and hJ gene segments operably linked to an endogenous mouse C gene; and, (d) a mouse in which one K allele comprises hVs and hJs; the other K allele comprising hVs and hJs; one allele comprising hVs and hJs and one allele silenced or knocked out, or both alleles comprising hVs and hJs; and, two heavy chain alleles that each comprise hV.sub.HS, hD.sub.Hs, and hJ.sub.HS.

    [0215] The antibodies that comprise the hV domains expressed in the context of either C or C are used to make fully human antibodies by cloning the nucleic acids encoding the hV domains into expression constructs that bear genes encoding human CX. Resulting expression constructs are transfected into suitable host cells for expressing antibodies that display a fully hV domain fused to hC.

    EXAMPLES

    [0216] The following examples are provided so as to describe how to make and use methods and compositions of the invention, and are not intended to limit the scope of what the inventors regard as their invention. Unless indicated otherwise, temperature is indicated in Celsius, and pressure is at or near atmospheric.

    Example I

    Deletion of the Mouse Immunoglobulin Light Chain Loci

    [0217] Various targeting constructs were made using VELOCIGENE technology (see, e.g., U.S. Pat. No. 6,586,251 and Valenzuela et al. (2003) High-throughput engineering of the mouse genome coupled with high-resolution expression analysis, Nature Biotech. 21(6):652-659) to modify mouse genomic Bacterial Artificial Chromosome (BAC) libraries to inactivate the mouse and light chain loci.

    [0218] Deletion of the Mouse Light Chain Locus.

    [0219] DNA from mouse BAC clone RP23-135k15 (Invitrogen) was modified by homologous recombination to inactivate the endogenous mouse light chain locus through targeted deletion of the V-J-C gene clusters (FIG. 2).

    [0220] Briefly, the entire proximal cluster comprising V1-J3-C3-J1-C1 gene segments was deleted in a single targeting event using a targeting vector comprising a neomycin cassette flanked by loxP sites with a 5 mouse homology arm containing sequence 5 of the V1 gene segment and a 3 mouse homology arm containing sequence 3 of the C1 gene segment (FIG. 2, Targeting Vector 1).

    [0221] A second targeting construct was prepared to precisely delete the distal endogenous mouse gene cluster containing V2-J2-C2-J4-C4 except that the targeting construct contained a 5 mouse homology arm that contained sequence 5 of the V2 gene segment and a 3 mouse homology arm that contained sequence 5 to the endogenous C2 gene segment (FIG. 2, Targeting Vector 2). Thus, the second targeting construct precisely deleted V2-J2, while leaving C2-J4-C4 intact at the endogenous mouse locus. ES cells containing an inactivated endogenous locus (as described above) were confirmed by karyotyping and screening methods (e.g., TAQMAN) known in the art. DNA was then isolated from the modified ES cells and subjected to treatment with CRE recombinase thereby mediating the deletion of the proximal targeting cassette containing the neomycin marker gene, leaving only a single loxP site at the deletion point (FIG. 2, bottom).

    [0222] Deletion of the Mouse Light Chain Locus.

    [0223] Several targeting constructs were made using similar methods described above to modify DNA from mouse BAC clones RP23-302912 and RP23-254m04 (Invitrogen) by homologous recombination to inactivate the mouse light chain locus in a two-step process (FIG. 3).

    [0224] Briefly, the J gene segments (1-5) of the endogenous mouse light chain locus were deleted in a single targeting event using a targeting vector comprising a hygromycin-thymidine kinase (hyg-TK) cassette containing a single loxP site 3 to the hyg-TK cassette (FIG. 3, J Targeting Vector). The homology arms used to make this targeting vector contained mouse genomic sequence 5 and 3 of the endogenous mouse J gene segments. In a second targeting event, a second targeting vector was prepared to delete a portion of mouse genomic sequence upstream (5) to the most distal endogenous mouse V gene segment (FIG. 3, V Targeting Vector). This targeting vector contained an inverted lox511 site, a loxP site and a neomycin cassette. The homology arms used to make this targeting vector contained mouse genomic sequence upstream of the most distal mouse V gene segment. The targeting vectors were used in a sequential fashion (i.e., J then V) to target DNA in ES cells. ES bearing a double-targeted chromosome (i.e., a single endogenous mouse locus targeted with both targeting vectors) were confirmed by karyotyping and screening methods (e.g., Taqman) known in the art. DNA was then isolated from the modified ES cells and subjected to treatment with Cre recombinase thereby mediating the deletion of endogenous mouse V gene segments and both selection cassettes, while leaving two juxtaposed lox sites in opposite orientation relative to one another (FIG. 3, bottom; SEQ ID NO:1).

    [0225] Thus, two modified endogenous light chain loci ( and ) containing intact enhancer and constant regions were created for progressively inserting unrearranged human germline gene segments in a precise manner using targeting vectors described below.

    Example II

    Replacement of Mouse Light Chain Loci with a Human Light Chain Mini-Locus

    [0226] Multiple targeting vectors were engineered for progressive insertion of human gene segments into the endogenous mouse and light chain loci using similar methods as described above. Multiple independent initial modifications were made to the endogenous light chain loci each producing a chimeric light chain locus containing hV and J gene segments operably linked to mouse light chain constant genes and enhancers.

    [0227] A Human Mini-Locus Containing 12 Human V and One Human J Gene Segment.

    [0228] A series of initial targeting vectors were engineered to contain the first 12 consecutive human V gene segments from cluster A and a hJ1 gene segment or four hJ gene segments using a human BAC clone named RP11-729g4 (Invitrogen). FIGS. 4A and 4B show the targeting vectors that were constructed for making an initial insertion of human light chain gene segments at the mouse and light chain loci, respectively.

    [0229] For a first set of initial targeting vectors, a 124,125 bp DNA fragment from the 729g4 BAC clone containing 12 hV gene segments and a hJ1 gene segment was engineered to contain a PI-SceI site 996 bp downstream (3) of the hJ1 gene segment for ligation of a 3 mouse homology arm. Two different sets of homology arms were used for ligation to this human fragment; one set of homology arms contained endogenous mouse sequences from the 135k15 BAC clone (FIG. 4A) and another set contained endogenous sequence 5 and 3 of the mouse V and J gene segments from mouse BAC clones RP23-302g12 and RP23-254m04, respectively (FIG. 4B).

    [0230] For the 12/1- Targeting Vector (FIG. 4A), a PI-SceI site was engineered at the 5 end of a 27,847 bp DNA fragment containing the mouse C2-J4-C4 and enhancer 2.4 of the modified mouse locus described in Example 1. The 28 kb mouse fragment was used as a 3 homology arm by ligation to the 124 kb human fragment, which created a 3 junction containing, from 5 to 3, a hJ 1 gene segment, 996 bp of human sequence 3 of the hJ1 gene segment, 1229 bp of mouse sequence 5 to the mouse C2 gene, the mouse C2 gene and the remaining portion of the 28 kb mouse fragment. Upstream (5) from the human V3-12 gene segment was an additional 1456 bp of human sequence before the start of the 5 mouse homology arm, which contained 23,792 bp of mouse genomic DNA corresponding to sequence 5 of the endogenous mouse locus. Between the 5 homology arm and the beginning of the human sequence was a neomycin cassette flanked by Frt sites.

    [0231] Thus, the 12/1- Targeting Vector included, from 5 to 3, a 5 homology arm containing 24 kb of mouse genomic sequence 5 of the endogenous locus, a 5 Frt site, a neomycin cassette, a 3 Frt site, 123 kb of human genomic sequence containing the first 12 consecutive hV gene segments and a hJ1 gene segment, a PI-SceI site, and a 3 homology arm containing 28 kb of mouse genomic sequence including the endogenous C2-J4-C4 gene segments, the mouse enhancer 2.4 sequence and additional mouse genomic sequence downstream (3) of the enhancer 2.4 (FIG. 4A).

    [0232] In a similar fashion, the 12/1- Targeting Vector (FIG. 4B) employed the same 124 human fragment with the exception that mouse homology arms containing mouse sequence were used such that targeting to the endogenous locus could be achieved by homologous recombination. Thus, the 12/1- Targeting Vector included, from 5 to 3, a 5 homology arm containing 23 kb of mouse genomic sequence 5 of the endogenous locus, an I-Ceul site, a 5 Frt site, a neomycin cassette, a 3 Frt site, 124 kb of human genomic sequence containing the first 12 consecutive hV gene segments and a hJ1 gene segment, a PI-SceI site, and a 3 homology arm containing 28 kb of mouse genomic sequence including the endogenous the mouse C gene, Ei and E3 and additional mouse genomic sequence downstream (3) of E3 (FIG. 4B, 12/1- Targeting Vector).

    [0233] Homologous recombination with either of these two initial targeting vectors created a modified mouse light chain locus ( or ) containing 12 hV gene segments and a hJ1 gene segment operably linked to the endogenous mouse light chain constant gene and enhancers (C or C2 and Ei/E3 or Enh 2.4/Enh 3.1) gene which, upon recombination, leads to the formation of a chimeric light chain.

    [0234] A Human Mini-Locus with 12 Human V and Four Human J Gene Segments.

    [0235] In another approach to add diversity to a chimeric light chain locus, a third initial targeting vector was engineered to insert the first 12 consecutive human V gene segments from cluster A and hJ1, 2, 3 and 7 gene segments into the mouse light chain locus (FIG. 4B, 12/4- Targeting Vector). A DNA segment containing hJ1, J2, J3 and J7 gene segments was made by de novo DNA synthesis (Integrated DNA Technologies) including each J gene segment and human genomic sequence of 100 bp from both the immediate 5 and 3 regions of each J gene segment. A PI-SceI site was engineered into the 3 end of this 1 kb DNA fragment and ligated to a chloramphenicol cassette. Homology arms were PCR amplified from human sequence at 5 and 3 positions relative to the hJ1 gene segment of the human BAC clone 729g4. Homologous recombination with this intermediate targeting vector was performed on a modified 729g4 BAC clone that had been previously targeted upstream (5) of the human V3-12 gene segment with a neomycin cassette flanked by Frt sites, which also contained an I-Ceul site 5 to the 5 Frt site. The double-targeted 729g4 BAC clone included from 5 to 3 an I-Ceul site, a 5 Frt site, a neomycin cassette, a 3 Frt site, a 123 kb fragment containing the first 12 hV gene segments, a 1 kb fragment containing human J1, 2, 3 and 7 gene segments, a PI-SceI site, and a chloramphenicol cassette. This intermediate targeting vector was digested together with I-Ceul and PI-SceI and subsequently ligated into the modified mouse BAC clone (described above) to create the third targeting vector.

    [0236] This ligation resulted in a third targeting vector for insertion of human sequences into the endogenous light chain locus, which included, from 5 to 3, a 5 mouse homology arm containing 23 kb of genomic sequence 5 of the endogenous mouse locus, an I-Ceul site, a 5 Frt site, a neomycin cassette, a 3 Frt site, a 123 kb fragment containing the first 12 hV gene segments, a 1 kb fragment containing hJ1, 2, 3 and 7 gene segments, a PI-SceI site and a 3 homology arm containing 28 kb of mouse genomic sequence including the endogenous the mouse C gene, Ei and E3 and additional mouse genomic sequence downstream (3) of E3 (FIG. 4B, 12/4- Targeting Vector). Homologous recombination with this third targeting vector created a modified mouse light chain locus containing 12 hV gene segments and four hJ gene segments operably linked to the endogenous mouse C gene which, upon recombination, leads to the formation of a chimeric human/mouse light chain.

    [0237] A Human Mini-Locus with an Integrated Human Light Chain Sequence.

    [0238] In a similar fashion, two additional targeting vectors similar to those engineered to make an initial insertion of human gene segments into the endogenous light chain locus (FIG. 4B, 12/1- and 12/4- Targeting Vectors) were engineered to progressively insert human light chain gene segments using uniquely constructed targeting vectors containing contiguous human and genomic sequences. These targeting vectors were constructed to include a 23 kb human genomic sequence naturally located between human V4-1 and J1 gene segments. This human genomic sequence was specifically positioned in these two additional targeting vectors between human V and human J gene segments (FIG. 4B, 12()1- and 12()4- Targeting Vectors).

    [0239] Both targeting vectors containing the human genomic sequence were made using the modified RP11-729g4 BAC clone described above (FIG. 6). This modified BAC clone was targeted with a spectinomycin selection cassette flanked by NotI and AsiSI restriction sites (FIG. 6, top left). Homologous recombination with the spectinomycin cassette resulted in a double-targeted 729g4 BAC clone which included, from 5 to 3, an I-Ceul site, a 5 Frt site, a neomycin cassette, a 3 Frt site, a 123 kb fragment containing the first 12 hV gene segments, a NotI site about 200 bp downstream (3) to the nonamer sequence of the hV3-1 gene segment, a spectinomycin cassette and an AsiSI site. A separate human BAC clone containing human sequence (CTD-2366j12) was targeted two independent times to engineer restriction sites at locations between hV4-1 and hJ1 gene segments to allow for subsequent cloning of a 23 kb fragment for ligation with the hV gene segments contained in the double targeted modified 729g4 BAC clone (FIG. 6, top right).

    [0240] Briefly, the 2366j12 BAC clone is about 132 kb in size and contains hV gene segments 1-6, 1-5, 2-4, 7-3, 5-2, 4-1, human genomic sequence down stream of the V gene segments, hJ gene segments 1-5, the hC and about 20 kb of additional genomic sequence of the human locus. This clone was first targeted with a targeting vector containing a hygromycin cassette flanked by Frt sites and a NotI site downstream (3) of the 3 Frt site. The homology arms for this targeting vector contained human genomic sequence 5 and 3 of the V gene segments within the BAC clone such that upon homologous recombination with this targeting vector, the V gene segments were deleted and a NotI site was engineered 133 bp downstream of the hV4-1 gene segment (FIG. 6, top right). This modified 2366j12 BAC clone was targeted independently with two targeting vectors at the 3 end to delete the hJ gene segments with a chloroamphenicol cassette that also contained either a hJ1 gene segment, a PI-SceI site and an AsiSI site or a human genomic fragment containing four hJ gene segments (supra), a PI-SceI site and an AsiSI site (FIG. 6, top right). The homology arms for these two similar targeting vectors contained sequence 5 and 3 of the hJ gene segments. Homologous recombination with these second targeting vectors and the modified 2366j12 BAC clone yielded a double-targeted 2366j12 clone which included, from 5 to 3, a 5 Frt site, a hygromycin cassette, a 3 Frt site, a NotI site, a 22,800 bp genomic fragment of the human locus containing the intergenic region between the V4-1 and J1 gene segments, either a hJ1 gene segment or a human genomic fragment containing hJ1, J2, J3 and J7, a PI-SceI site and a chloroamphenicol cassette (FIG. 6, top right). Two final targeting vectors to make the two additional modifications were achieved by two ligation steps using the double-targeted 729g4 and 2366j12 clones.

    [0241] Double targeted 729g4 and 2366j12 clones were digested with NotI and AsiSI yielding one fragment containing the neomycin cassette and hV gene segments and another fragment containing the 23 kb genomic fragment of the human locus containing the intergenic region between the V4-1 and J1 gene segments, either a hJ1 gene segment or a genomic fragment containing hJ1, J2, J3 and J7 gene segments, the PI-SceI site and the chloroamphenicol cassette, respectively. Ligation of these fragments generated two unique BAC clones containing from 5 to 3 the hV gene segments, the human genomic sequence between the V4-1 and J1 gene segments, either a hJ1 gene segment or a genomic fragment containing hJ1, J2, J3 and J7 gene segments, a PI-SceI site and a chloroamphenicol cassette (FIG. 6, bottom). These new BAC clones were then digested with I-Ceul and PI-SceI to release the unique fragments containing the upstream neomycin cassette and the contiguous human and sequences and ligated into a modified mouse BAC clone 302g12 which contained from 5 to 3 mouse genomic sequence 5 of the endogenous locus, an I-Ceul site, a 5 Frt site, a neomycin cassette, a 3 Frt site, hV gene segments (3-12 to 3-1), a NotI site 200 bp downstream of V3-1, 23 kb of human sequence naturally found between the human V4-1 and J1 gene segments, either a hJ1 gene segment or a genomic fragment containing hJ1, J2, J3 and J7 gene segments, the mouse Ei, the mouse C gene and E3 (FIG. 4, 12hV-VJ-hJ1 and 12hV-VJ-4hJ Targeting Vectors). Homologous recombination with both of these targeting vectors created two separate modified mouse light chain loci containing 12 hV gene segments, human genomic sequence, and either one or four hJ gene segments operably linked to the endogenous mouse C gene which, upon recombination, leads to the formation of a chimeric human /mouse light chain.

    Example III

    Engineering Additional Human V Genes Segments into a Human Light Chain Mini-Locus

    [0242] Additional hV gene segments were added independently to each of the initial modifications described in Example 2 using similar targeting vectors and methods (FIG. 5A, +16- Targeting Vector and FIG. 5B, +16- Targeting Vector).

    [0243] Introduction of 16 Additional Human V Gene Segments.

    [0244] Upstream (5) homology arms used in constructing targeting vectors for adding 16 additional hV gene segments to the modified light chain loci described in Example 2 contained mouse genomic sequence 5 of either the endogenous or light chain loci. The 3 homology arms were the same for all targeting vectors and contained human genomic sequence overlapping with the 5 end of the human sequence of the modifications as described in Example 2.

    [0245] Briefly, two targeting vectors were engineered for introduction of 16 additional hV gene segments to the modified mouse light chain loci described in Example 2 (FIGS. 5A and 5B, +16- or +16- Targeting Vector). A 172 kb DNA fragment from human BAC clone RP11-761I13 (Invitrogen) containing 21 consecutive hV gene segments from cluster A was engineered with a 5 homology arm containing mouse genomic sequence 5 to either the endogenous or light chain loci and a 3 homology arm containing human genomic sequence. The 5 mouse or homology arms used in these targeting constructs were the same 5 homology arms described in Example 2 (FIGS. 5A and 5B). The 3 homology arm included a 53,057 bp overlap of human genomic sequence corresponding to the equivalent 5 end of the 123 kb fragment of human genomic sequence described in Example 2. These two targeting vectors included, from 5 to 3, a 5 mouse homology arm containing either 23 kb of genomic sequence 5 of the endogenous mouse c light chain locus or 24 kb of mouse genomic sequence 5 of the endogenous light chain locus, a 5 Frt site, a hygromycin cassette, a 3 Frt site and 171,457 bp of human genomic sequence containing 21 consecutive hV gene segments, 53 kb of which overlaps with the 5 end of the human sequence described in Example 3 and serves as the 3 homology arm for this targeting construct (FIGS. 5A and 5B, +16- or +16- Targeting Vectors). Homologous recombination with these targeting vectors created independently modified mouse and light chain loci each containing 28 hV gene segments and a hJ1 gene segment operably linked to endogenous mouse constant genes (C or C2) which, upon recombination, leads to the formation of a chimeric light chain.

    [0246] In a similar fashion, the +16- Targeting Vector was also used to introduce the 16 additional hV gene segments to the other initial modifications described in Example 2 that incorporated multiple hJ gene segments with and without an integrated human sequence (FIG. 4B). Homologous recombination with this targeting vector at the endogenous mouse locus containing the other initial modifications created mouse light chain loci containing 28 hV gene segments and hJ1, 2, 3 and 7 gene segments with and without a human V-J genomic sequence operably linked to the endogenous mouse C gene which, upon recombination, leads to the formation of a chimeric - light chain.

    [0247] Introduction of 12 Additional Human V Gene Segments.

    [0248] Additional hV gene segments were added independently to each of the modifications described above using similar targeting vectors and methods. The final locus structure resulting from homologous recombination with targeting vectors containing additional hV gene segments are shown in FIGS. 7A and 7B.

    [0249] Briefly, a targeting vector was engineered for introduction of 12 additional hV gene segments to the modified mouse and light chain loci described above (FIGS. 5A and 5B, +12- or 12- Targeting Vectors). A 93,674 bp DNA fragment from human BAC clone RP11-22I18 (Invitrogen) containing 12 consecutive hV gene segments from cluster B was engineered with a 5 homology arm containing mouse genomic sequence 5 to either the endogenous mouse or light chain loci and a 3 homology arm containing human genomic K sequence. The 5 homology arms used in this targeting construct were the same 5 homology arms used for the addition of 16 hV gene segments described above (FIGS. 5A and 5B). The 3 homology arm was made by engineering a PI-SceI site 3431 bp 5 to the human V3-29P gene segment contained in a 27,468 bp genomic fragment of human sequence from BAC clone RP11-761I13. This PI-SceI site served as a ligation point to join the 94 kb fragment of additional human sequence to the 27 kb fragment of human sequence that overlaps with the 5 end of the human sequence in the previous modification using the +16- or +16- Targeting Vectors (FIGS. 5A and 5B). These two targeting vectors included, from 5 to 3, a 5 homology arm containing either 23 kb of mouse genomic sequence 5 of the endogenous light chain locus or 24 kb of mouse genomic sequence 5 of the endogenous light chain locus, a 5 Frt site, a neomycin cassette, a 3 Frt site and 121,188 bp of human genomic sequence containing 16 hV gene segments and a PI-SceI site, 27 kb of which overlaps with the 5 end of the human sequence from the insertion of 16 addition hV gene segments and serves as the 3 homology arm for this targeting construct (FIGS. 5A and 5B, +12- or 12- Targeting Vectors). Homologous recombination with these targeting vectors independently created modified mouse and light chain loci containing 40 hV gene segments and human J1 operably linked to the endogenous mouse constant genes (C or C2) which, upon recombination, leads to the formation of a chimeric light chain (bottom of FIGS. 5A and 5B).

    [0250] In a similar fashion, the +12- Targeting Vector was also used to introduce the 12 additional hV gene segments to the other initial modifications that incorporated multiple hJ gene segments with and without an integrated human sequence (FIG. 4B). Homologous recombination with this targeting vector at the endogenous mouse locus containing the other modifications created a mouse light chain locus containing 40 hV gene segments and hJ1, 2, 3 and 7 gene segments with and without a human V-J genomic sequence operably linked to the endogenous mouse C gene which, upon recombination, leads to the formation of a chimeric - light chain.

    Example IV

    Identification of Targeted ES Cells Bearing Human Light Chain Gene Segments

    [0251] Targeted BAC DNA made according to the foregoing Examples was used to electroporate mouse ES cells to create modified ES cells for generating chimeric mice that express human light chain gene segments. ES cells containing an insertion of unrearranged human light chain gene segments were identified by a quantitative TAQMAN assay. Specific primers sets and probes were design for insertion of human sequences and associated selection cassettes (gain of allele, GOA), loss of endogenous mouse sequences and any selection cassettes (loss of allele, LOA) and retention of flanking mouse sequences (allele retention, AR). For each additional insertion of human sequences, additional primer sets and probes were used to confirm the presence of the additional human sequences as well as the previous primer sets and probes used to confirm retention of the previously targeted human sequences. Table 1 sets forth the primers and associated probes used in the quantitative PCR assays. Table 2 sets forth the combinations used for confirming the insertion of each section of human light chain gene segments in ES cell clones.

    [0252] ES cells bearing the human light chain gene segments are optionally transfected with a construct that expresses FLP in order to remove the Frt'ed neomycin cassette introduced by the insertion of the targeting construct containing human V5-52-V1-40 gene segments (FIGS. 5A and 5B). The neomycin cassette may optionally be removed by breeding to mice that express FLP recombinase (e.g., U.S. Pat. No. 6,774,279). Optionally, the neomycin cassette is retained in the mice.

    TABLE-US-00001 TABLE 1 Primer SEQ ID NO: Probe SEQ ID NO: hL2F 2 hL2P 24 hL2R 3 hL3F 4 hL3P 25 hL3R 5 NeoF 6 NeoP 26 NeoR 7 61hJ1F 8 61hJ1P 27 61hJ1R 9 67hT1F 10 61hT1P 28 67hT1R 11 67hT3F 12 67hT3P 29 67hT3R 13 HygF 14 HygP 30 HygR 15 MKD2F 16 MKD2P 31 MKD2R 17 MKP8F 18 MKP8P 32 MKP8R 19 MKP15F 20 MKP15P 33 MKP15R 21 MK20F 22 MKP4R 23 68h2F 34 68h2P 38 68h2R 35 68h5F 36 68h5P 39 68h5R 37 mL1F 75 mL1P rnL1R 76 83 mL2F 77 mL2P 84 mL2R 78 mL11F 79 mL11P 85 mL11R 80 mL12F 81 mL12P 86 rnL12R 82

    TABLE-US-00002 TABLE 2 Forward/Reverse Modification Assay Primer Set Probe Sequence Location Insertion of GOA hL2F/hL2R hL2P hV3-12 hV3-1 12 hV & hJ1 hL3F/hL3R hL3P 61hJ1F/61hJ1R 61hJ1P hJ sequence NeoF/NeoR NeoP Neomycin cassette LOA MK20F/MKP4R Iox511/IoxP sequence of inactivated locus HygF/HygR HygP Hygromycin cassette from inactivated locus mL1F/mL1R mL1P Mouse Vl-C1 Cluster mL2F/mL2R mL2P mL11F/mL11R mL11P Mouse V2-C2 Cluster mL12F/mL12R mL12P AR/LOA MKD2F/MKD2R MKD2P Mouse sequence in 5' V locus MKP15F/MKP15R MKP15P Mouse sequence in 3' V locus Insertion of GOA 67hT1F/67hT1R 67hT1P hV3-27 hV3-12 16 hV 67hT3F/67hT3R 67hT3P HygF/HygR HygP Hygromycin cassette LOA NeoF/NeoR NeoP Neomycin cassette mL1F/mL1R mL1P Mouse V1-C1 Cluster mL2F/mL2R mL2P mL11F/mL11R mL11P Mouse V2-C2 Cluster mL12F/mL12R mL12P AR hL2F/hL2R hL2P hV3-12 hV3-1 hL3F/hL3R hL3P AR/LOA MKD2F/MKD2R MKD2P Mouse sequence in 5' V locus MKP15F/MKP15R MKP15P Mouse sequence in 3' V locus Insertion of GOA 68h2F/68h2R 68h2P hV5-52 hV1-40 12 hV 68h5F/68h5R 68h5P NeoF/NeoR NeoP Neomycin cassette LOA HygF/HygR HygP Hygromycin cassette mL1F/mL1R mL1P Mouse Vl-C1 Cluster mL2F/mL2R mL2P mL11F/mL11R mL11P Mouse V2-C2 Cluster mL12F/mL12R mL12P AR hL2F/hL2R hL2P hV3-12 hV3-1 hL3F/hL3R hL3P 67hT1F/67hT1R 67hT1P hV3-27 hV3-12 67hT3F/67hT3R 67hT3P AR/LOA MKD2F/MKD2R MKD2P Mouse sequence in 5' V locus MKP15F/MKP15R MKP15P Mouse sequence in 3' V locus

    Example V

    Generation of Mice Expressing Human Light Chains from an Endogenous Light Chain Locus

    [0253] Targeted ES cells described above were used as donor ES cells and introduced into an 8-cell stage mouse embryo by the VELOCIMOUSE method (see, e.g., U.S. Pat. No. 7,294,754 and Poueymirou et al. (2007) F0 generation mice that are essentially fully derived from the donor gene-targeted ES cells allowing immediate phenotypic analyses Nature Biotech. 25(1):91-99. VELOCIMICE (F0 mice fully derived from the donor ES cell) independently bearing human gene segments were identified by genotyping using a modification of allele assay (Valenzuela et al., supra) that detected the presence of the unique human gene segments (supra).

    [0254] : Light Chain Usage of Mice Bearing Human Light Chain Gene Segments. Mice homozygous for each of three successive insertions of hV gene segments with a single hJ gene segment (FIG. 5B) and mice homozygous for a first insertion of hV gene segments with either a single hJ gene segment or four human J gene segments including a human V-J genomic sequence (FIG. 4B) were analyzed for and light chain expression in splenocytes using flow cytometry.

    [0255] Briefly, spleens were harvested from groups of mice (ranging from three to seven animals per group) and grinded using glass slides. Following lysis of red blood cells (RBCs) with ACK lysis buffer (Lonza Walkersville), splenocytes were stained with fluorescent dye conjugated antibodies specific for mouse CD19 (Clone 1D3; BD Biosciences), mouse CD3 (17A2; Biolegend), mouse Ig (187.1; BD Biosciences) and mouse Ig (RML-42; Biolegend). Data was acquired using a BD LSR II flow cytometer (BD Biosciences) and analyzed using FLOWJO software (Tree Star, Inc.). Table 3 sets forth the average percent values for B cells (CD19.sup.+), light chain (CD19.sup.+Ig.sup.+Ig.sup.), and light chain (CD19.sup.+Ig.sup.Ig.sup.+) expression observed in splenocytes from groups of animals bearing each genetic modification.

    [0256] In a similar experiment, B cell contents of the splenic compartment from mice homozygous for a first insertion of 12 hV and four hJ gene segments including a human V-J genomic sequence operably linked to the mouse C gene (bottom of FIG. 4B) and mice homozygous for 40 hV and one hJ gene segment (bottom of FIG. 5B or top of FIG. 7B) were analyzed for Ig and Ig expression using flow cytometry (as described above). FIG. 8A shows the Ig and Ig expression in CD19.sup.+ B cells for a representative mouse from each group. The number of CD19.sup.+ B cells per spleen was also recorded for each mouse (FIG. 8B).

    [0257] In another experiment, B cell contents of the spleen and bone marrow compartments from mice homozygous for 40 hV and four hJ gene segments including a human V-J genomic sequence operably linked to the mouse C gene (bottom of FIG. 7B) were analyzed for progression through B cell development using flow cytometry of various cell surface markers.

    [0258] Briefly, two groups (N=3 each, 9-12 weeks old, male and female) of wild type and mice homozygous for 40 hV and four hJ gene segments including a human V-J genomic sequence operably linked to the mouse C gene were sacrificed and spleens and bone marrow were harvested. Bone marrow was collected from femurs by flushing with complete RPMI medium (RPMI medium supplemented with fetal calf serum, sodium pyruvate, Hepes, 2-mercaptoethanol, non-essential amino acids, and gentamycin). RBCs from spleen and bone marrow preparations were lysed with ACK lysis buffer (Lonza Walkersville), followed by washing with complete RPMI medium. 110.sup.6 cells were incubated with anti-mouse CD16/CD32 (2.4G2, BD Biosciences) on ice for 10 minutes, followed by labeling with a selected antibody panel for 30 min on ice.

    [0259] Bone marrow panel: anti-mouse FITC-CD43 (1B11, BioLegend), PE-ckit (2B8, BioLegend), PeCy7-IgM (11/41, eBioscience), PerCP-Cy5.5-IgD (11-26c.2a, BioLegend), APC-B220 (RA3-6B2, eBioscience), APC-H7-CD19 (ID3, BD) and Pacific Blue-CD3 (17A2, BioLegend).

    [0260] Bone marrow and spleen panel: anti-mouse FITC-Ig (187.1, BD), PE-Ig (RML-42, BioLegend), PeCy7-IgM (11/41, ebioscience), PerCP-Cy5.5-IgD (11-26c.2a. BioLegend), Pacific Blue-CD3 (17A2, BioLegend), APC-B220 (RA3-6B2, eBioscience), APC-H7-CD19 (ID3, BD).

    [0261] Following staining, cells were washed and fixed in 2% formaldehyde. Data acquisition was performed on a FACSCANTOII flow cytometer (BD Biosciences) and analyzed with FLOWJO software (Tree Star, Inc.). FIGS. 9A-9D show the results for the splenic compartment of one representative mouse from each group. FIGS. 10A-10E show the results for the bone marrow compartment of one representative mouse from each group. Table 4 sets forth the average percent values for B cells (CD19.sup.+), light chain (CD19.sup.+Ig.sup.+Ig.sup.), and light chain (CD19.sup.+Ig.sup.Ig.sup.+) expression observed in splenocytes from groups of animals bearing various genetic modifications. Table 5 sets forth the average percent values for B cells (CD19.sup.+), mature B cells (B220.sup.hiIgM.sup.+), immature B cells (B220.sup.intIgM.sup.+), immature B cells expressing light chain (B220.sup.intIgM.sup.+Ig.sup.+) and immature B cells expressing light chain (B220.sup.intIgM.sup.+Ig.sup.+) observed in bone marrow of wild type and mice homozygous for 40 hV and four hJ gene segments including a human V-J genomic sequence operably linked to the mouse C gene. This experiment was repeated with additional groups of the mice described above and demonstrated similar results (data not shown).

    TABLE-US-00003 TABLE 3 Genotype % B cells % lg.sup.+ % lg.sup.+ Wild Type 46.2 91.0 3.6 12 hV + hJ1 28.3 10.4 62.5 12 hV-VJ-hJ1 12.0 11.0 67.5 12 hV-VJ-4hJ 41.8 17.2 68.4 28 hV + hJ1 22.0 13.3 51.1 40 hV + hJ1 28.2 24.3 53.0

    TABLE-US-00004 TABLE 4 Genotype % B cells % lg.sup.+ % lg.sup.+ Wlid Type 49.8 91.2 3.5 40 hV-VJ-4hJ 33.3 41.6 43.1

    TABLE-US-00005 TABLE 5 % % % % % B Mature Immature Immature Immature Genotype cells B cells B cells lg.sup.+ B cells lg.sup.+ B cells Wild Type 62.2 9.2 12.0 79.0 8.84 40 hV- 60.43 2.59 7.69 38.29 43.29 VJ-4hJ

    [0262] Human V Gene Usage in Mice Bearing Human Light Chain Gene Segments.

    [0263] Mice heterozygous for a first insertion of human sequences (hV3-12-hV3-1 and hJ1, FIG. 5B) and homozygous for a third insertion of human sequences (hV5-52-hV3-1 and hJ 1, FIG. 5B) were analyzed for human light chain gene usage by reverse-transcriptase polymerase chain reaction (RT-PCR) using RNA isolated from splenocytes.

    [0264] Briefly, spleens were harvested and perfused with 10 mL RPMI-1640 (Sigma) with 5% HI-FBS in sterile disposable bags. Each bag containing a single spleen was then placed into a STOMACHER (Seward) and homogenized at a medium setting for 30 seconds. Homogenized spleens were filtered using a 0.7 m cell strainer and then pelleted with a centrifuge (1000 rpm for 10 minutes) and RBCs were lysed in BD PHARM LYSE (BD Biosciences) for three minutes. Splenocytes were diluted with RPMI-1640 and centrifuged again, followed by resuspension in 1 mL of PBS (Irvine Scientific). RNA was isolated from pelleted splenocytes using standard techniques known in the art.

    [0265] RT-PCR was performed on splenocyte RNA using primers specific for human hV gene segments and the mouse C gene (Table 6). PCR products were gel-purified and cloned into pCR2.1-TOPO TA vector (Invitrogen) and sequenced with primers M13 Forward (GTAAAACGAC GGCCAG; SEQ ID NO:55) and M13 Reverse (CAGGAAACAG CTATGAC; SEQ ID NO:56) located within the vector at locations flanking the cloning site. Eighty-four total clones derived from the first and third insertions of human sequences were sequenced to determine hV gene usage (Table 7). The nucleotide sequence of the hV-hJ1-mC junction for selected RT-PCR clones is shown in FIG. 11.

    [0266] In a similar fashion, mice homozygous for a third insertion of human light chain gene sequences (i.e. 40 hV gene segments and four hJ gene segments including a human V-J genomic sequence, bottom of FIG. 7B) operably linked to the endogenous mouse C gene were analyzed for human light chain gene usage by RT-PCR using RNA isolated from splenocytes (as described above). The human light chain gene segment usage for 26 selected RT-PCR clones are shown in Table 8. The nucleotide sequence of the hV-hJ-mC junction for selected RT-PCR clones is shown in FIG. 12.

    [0267] In a similar fashion, mice homozygous for a first insertion of human light chain gene segments (12 hV gene segments and hJ1, FIG. 4A & FIG. 5A) operably linked to the endogenous mouse C2 gene were analyzed for human light chain gene usage by RT-PCR using RNA isolated from splenocytes (as described above). The primers specific for hV gene segments (Table 6) were paired with one of two primers specific for the mouse C2 gene; C2-1 (SEQ ID NO:104) or C2-2 (SEQ ID NO:105).

    [0268] Multiple hV gene segments rearranged to h1 were observed from the RT-PCR clones from mice bearing human light chain gene segments at the endogenous mouse light chain locus. The nucleotide sequence of the hV-hJ-mC2 junction for selected RT-PCR clones is shown in FIG. 13.

    TABLE-US-00006 TABLE6 SEQ ID Sequence(5-3) NO: 5hVPrimer VLL-1 CCTCTCCTCCTCACCCTCCT 40 VLL-1n ATGRCCDGSTYYYCTCTCCT 41 VLL-2 CTCCTCACTCAGGGCACA 42 VLL-2n ATGGCCTGGGCTCTGCTSCT 43 VLL-3 ATGGCCTGGAYCSCTCTCC 44 VLL-4 TCACCATGGCYTGGRYCYCMYTC 45 VLL-4.3 TCACCATGGCCTGGGTCTCCTT 46 VLL-5 TCACCATGGCCTGGAMTCYTCT 47 VLL-6 TCACCATGGCCTGGGCTCCACTACTT 48 VLL-7 TCACCATGGCCTGGACTCCT 49 VLL-8 TCACCATGGCCTGGATGATGCTT 50 VLL-9 TAAATATGGCCTGGGCTCCTCT 51 VLL-10 TCACCATGCCCTGGGCTCTGCT 52 VLL-11 TCACCATGGCCCTGACTCCTCT 53 3Mouse CPrimer mIgKC3-1 CCCAAGCTTACTGGATGGTGGGAAGATGGA 54

    TABLE-US-00007 TABLE 7 Observed No. of hV Clones 3-1 2 4-3 3 2-8 7 3-9 4 3-10 3 2-14 1 3-19 1 2-23 7 3-25 1 1-40 9 7-43 2 1-44 2 5-45 8 7-46 3 9-49 6 1-51 3

    TABLE-US-00008 TABLE 8 Clone hV hJ 1-3 1-44 7 1-5 1-51 3 2-3 9-49 7 2-5 1-40 1 2-6 1-40 7 3b-5 3-1 7 4a-1 4-3 7 4a-5 4-3 7 4b-1 1-47 3 5-1 3-10 3 5-2 1-40 7 5-3 1-40 7 5-4 7-46 2 5-6 1-40 7 5-7 7-43 3 6-1 1-40 1 6-2 1-40 2 6-7 1-40 3 7a-1 3-10 7 7a-2 9-49 2 7a-7 3-10 7 7b-2 7-43 3 7b-7 7-46 7 7b-8 7-43 3 11a-1 5-45 2 11a-2 5-45 7

    [0269] FIG. 11 shows the sequence of the hV-hJ1-mC junction for RT-PCR clones from mice bearing a first and third insertion of hV gene segments with a single hJ gene segment. The sequences shown in FIG. 11 illustrate unique rearrangements involving different hV gene segments with hJ1 recombined to the mouse C gene. Heterozygous mice bearing a single modified endogenous locus containing 12 hV gene segments and hJ1 and homozygous mice bearing two modified endogenous loci containing 40 hV gene segments and hJ1 were both able to produce human gene segments operably linked to the mouse C gene and produce B cells that expressed human light chains. These rearrangements demonstrate that the chimeric loci were able to independently rearrange human gene segments in multiple, independent B cells in these mice. Further, these modifications to the endogenous light chain locus did not render any of the hV gene segments inoperable or prevent the chimeric locus from recombining multiple hV and a hJ (J1) gene segment during B cell development as evidenced by 16 different hV gene segments that were observed to rearrange with hJ1 (Table 7). Further, these mice made functional antibodies containing rearranged human V-J gene segments operably linked to mouse C genes as part of the endogenous immunoglobulin light chain repertoire.

    [0270] FIG. 12 shows the sequence of the hV-hJ-mC junction for selected RT-PCR clones from mice homozygous for 40 hV and four hJ gene segments including a human V-J genomic sequence. The sequences shown in FIG. 12 illustrate additional unique rearrangements involving multiple different hV gene segments, spanning the entire chimeric locus, with multiple different hJ gene segments rearranged and operably linked to the mouse C gene. Homozygous mice bearing modified endogenous loci containing 40 hV and four hJ gene segments were also able to produce human gene segments operably linked to the mouse C gene and produce B cells that expressed human light chains. These rearrangements further demonstrate that the all stages of chimeric loci were able to independently rearrange human gene segments in multiple, independent B cells in these mice. Further, these additional modifications to the endogenous light chain locus demonstrates that each insertion of human gene segments did not render any of the hV and/or J gene segments inoperable or prevent the chimeric locus from recombining the hV and J gene segments during B cell development as evidenced by 12 different hV gene segments that were observed to rearrange with all four hJ gene segments (Table 8) from the 26 selected RT-PCR clone. Further, these mice as well made functional antibodies containing human V-J gene segments operably linked to mouse C regions as part of the endogenous immunoglobulin light chain repertoire.

    [0271] FIG. 13 shows the sequence of the hV-hJ-mC2 junction for three individual RT-PCR clones from mice homozygous for 12 hV gene segments and hJ1. The sequences shown in FIG. 13 illustrate additional unique rearrangements involving different hV gene segments, spanning the length of the first insertion, with hJ1 rearranged and operably linked to the mouse C2 gene (2D1=V2-8J1; 2D9=V3-10J1; 3E15=V3-1J1). One clone demonstrated a nonproductive rearrangement due to N additions at the hV-hJ junction (2D1, FIG. 13). This is not uncommon in V(D)J recombination, as the joining of gene segments during recombination has been shown to be imprecise. Although this clone represents an unproductive recombinant present in the light chain repertoire of these mice, this demonstrates that the genetic mechanism that contributes to junctional diversity among antibody genes is operating normally in these mice and leading to an antibody repertoire containing light chains with greater diversity.

    [0272] Homozygous mice bearing modified endogenous loci containing 12 hV gene segments and hJ1 were also able to produce human gene segments operably linked to an endogenous mouse C gene and produce B cells that expressed reverse chimeric A light chains containing hV regions linked to mouse C regions. These rearrangements further demonstrate that human light chain gene segments placed at the other light chain locus (i.e., the locus) were able to independently rearrange human gene segments in multiple, independent B cells in these mice. Further, the modifications to the endogenous light chain locus demonstrate that the insertion of human gene segments did not render any of the hV and/or hJ1 gene segments inoperable or prevent the chimeric locus from recombining the hV and hJ1 gene segments during B cell development. Further, these mice also made functional antibodies containing human V-J gene segments operably linked to a mouse C region as part of the endogenous immunoglobulin light chain repertoire.

    [0273] As shown in this Example, mice bearing human light chain gene segments at the endogenous and light chain loci are capable of rearranging human light chain gene segments and expressing them in the context of a mouse C and/or C region as part of the normal antibody repertoire of the mouse because a functional light chain is required at various checkpoints in B cell development in both the spleen and bone marrow. Further, early subsets of B cells (e.g., pre-, pro- and transitional B cells) demonstrate a normal phenotype in these mice as compared to wild type littermates (FIGS. 9D, 10A and 10B). A small deficit in bone marrow and peripheral B cell populations was observed, which may be attributed to a deletion of a subset of auto-reactive immature B cells and/or a suboptimal association of human light chain with mouse heavy chain. However, the Ig/Ig usage observed in these mice demonstrates a situation that is more like human light chain expression than that observed in mice.

    Example VI

    Breeding of Mice Expressing Human Light Chains from an Endogenous Light Chain Locus

    [0274] To optimize the usage of the human gene segments at an endogenous mouse light chain locus, mice bearing the unrearranged human gene segments are bred to another mouse containing a deletion in the opposing endogenous light chain locus (either or ). For example, human gene segments positioned at the endogenous locus would be the only functional light chain gene segments present in a mouse that also carried a deletion in the endogenous light chain locus. In this manner, the progeny obtained would express only human light chains as described in the foregoing examples. Breeding is performed by standard techniques recognized in the art and, alternatively, by commercial companies, e.g., The Jackson Laboratory. Mouse strains bearing human light chain gene segments at the endogenous locus and a deletion of the endogenous light chain locus are screened for presence of the unique reverse-chimeric (human-mouse) light chains and absence of endogenous mouse light chains.

    [0275] Mice bearing an unrearranged human light chain locus are also bred with mice that contain a replacement of the endogenous mouse heavy chain variable gene locus with the human heavy chain variable gene locus (see U.S. Pat. No. 6,596,541, Regeneron Pharmaceuticals, the VELOCIMMUNE genetically engineered mouse). The VELOCIMMUNE mouse includes, in part, having a genome comprising human heavy chain variable regions operably linked to endogenous mouse constant region loci such that the mouse produces antibodies comprising a human heavy chain variable region and a mouse heavy chain constant region in response to antigenic stimulation. The DNA encoding the variable regions of the heavy chains of the antibodies can be isolated and operably linked to DNA encoding the human heavy chain constant regions. The DNA can then be expressed in a cell capable of expressing the fully human heavy chain of the antibody. Upon a suitable breeding schedule, mice bearing a replacement of the endogenous mouse heavy chain locus with the human heavy chain locus and an unrearranged human light chain locus at the endogenous light chain locus is obtained. Antibodies containing somatically mutated human heavy chain variable regions and human light chain variable regions can be isolated upon immunization with an antigen of interest.

    Example VII

    Generation of Antibodies from Mice Expressing Human Heavy Chains and Human Light Chains

    [0276] After breeding mice that contain the unrearranged human light chain locus to various desired strains containing modifications and deletions of other endogenous Ig loci (as described above), selected mice are immunized with an antigen of interest.

    [0277] Generally, a VELOCIMMUNE mouse containing one of the single rearranged human germline light chain regions is challenged with an antigen, and lymphatic cells (such as B-cells) are recovered from serum of the animals. The lymphatic cells may be fused with a myeloma cell line to prepare immortal hybridoma cell lines, and such hybridoma cell lines are screened and selected to identify hybridoma cell lines that produce antibodies containing human heavy chain and human light chain that are specific to the antigen used for immunization. DNA encoding the variable regions of the heavy chains and the light chains may be isolated and linked to desirable isotypic constant regions of the heavy chain and light chain. Due to the presence of the additional hV gene segments as compared to the endogenous mouse locus, the diversity of the light chain repertoire is dramatically increased and confers higher diversity on the antigen-specific repertoire upon immunization. The resulting cloned antibody sequences may be subsequently produced in a cell, such as a CHO cell. Alternatively, DNA encoding the antigen-specific chimeric antibodies or the variable domains of the light and heavy chains may be isolated directly from antigen-specific lymphocytes (e.g., B cells).

    [0278] Initially, high affinity chimeric antibodies are isolated having a human variable region and a mouse constant region. As described above, the antibodies are characterized and selected for desirable characteristics, including affinity, selectivity, epitope, etc. The mouse constant regions are replaced with a desired human constant region to generate the fully human antibody containing a somatically mutated human heavy chain and a human light chain derived from an unrearranged human light chain locus of the invention. Suitable human constant regions include, for example wild type or modified IgG1, IgG2, IgG3, or IgG4.