COMPOSITIONS AND METHODS FOR REGULATING PROTEINS AND NUCLEIC ACIDS ACTIVITIES
20200239879 ยท 2020-07-30
Inventors
- Amit CHOUDHARY (Boston, MA, US)
- Kurt Cox (Cambridge, MA, US)
- Hari Subramanian (Oakland, CA, US)
- Elisa Franco (Oakland, CA, US)
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
A61K38/465
HUMAN NECESSITIES
C12N2800/80
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
C12N15/111
CHEMISTRY; METALLURGY
C12N2320/50
CHEMISTRY; METALLURGY
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
C12N15/67
CHEMISTRY; METALLURGY
A61K31/00
HUMAN NECESSITIES
International classification
Abstract
Compositions and methods for conditionally regulating activities of CRISPR-Cas systems. In some embodiments, the methods comprise providing an inactive guide RNA comprising a regulatory domain bound by a lock nucleic acid different from the guide RNA; and displacing the lock nuclei acid from the regulatory domain by a trigger nucleic acid, thereby activating the guide RNA, wherein the activated guide RNA forms a complex with a Cas enzyme.
Claims
1. A method for regulating activity of a CRISPR-Cas system, comprising: providing an inactive guide RNA comprising a regulatory domain bound by a lock nucleic acid different from the guide RNA; and displacing the lock nuclei acid from the regulatory domain by a trigger nucleic acid, thereby activating the guide RNA, wherein the activated guide RNA forms a complex with a Cas enzyme.
2. The method of claim 1, wherein the regulatory domain is at a 5 end of the guide RNA.
3. The method of claim 1, wherein the regulatory domain comprises a toehold sequence.
4. The method of claim 3, wherein the toehold sequence is from 6 nt to 10 nt in length.
5. The method of claim 1, wherein the regulatory domain is capable of binding to a target nucleic acid.
6. The method of claim 5, wherein the target nucleic acid comprises a fluorescent label.
7. The method of claim 6, further comprising incubating the complex with the target nucleic acid, thereby removing the fluorescent label from the target nucleic acid.
8. The method of claim 1, wherein the lock nucleic acid is RNA.
9. The method of claim 1, wherein the lock nucleic acid is complementary to at least a part of the regulatory domain.
10. The method of claim 8, further comprising producing the lock nucleic acid by inducing expression of a gene encoding the lock nucleic acid.
11. The method of claim 1, wherein the trigger nucleic acid is RNA.
12. The method of claim 11, further comprising producing the trigger nucleic acid by inducing expression a gene encoding the trigger nucleic acid.
13. The method of claim 1, wherein the trigger nucleic acid is complementary to at least a part of the regulatory domain.
14. The method of claim 1, wherein nuclease activity of the Cas enzyme is at least partially inactivated.
15. A composition, comprising: a guide RNA comprising a regulatory domain or a nucleic acid encoding the guide RNA; and one or more of: a lock nucleic acid different from the guide RNA and configured to inactivate the guide RNA when binding to the regulatory domain, or a nucleic acid encoding the lock nucleic acid; and a trigger nucleic acid configured to displace the lock nucleic acid from the regulatory domain and activate the guide RNA, or a nucleic acid encoding the trigger nucleic acid.
16. The composition of claim 15, further comprising a Cas enzyme or a nucleic acid encoding the Cas enzyme.
17. A cell comprising the composition of claim 15.
18. A biomolecular circuit comprising the composition of claim 15.
19. A kit comprising the composition of claim 15.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0013] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings will be provided by the Office upon request and payment of the necessary fee.
[0014] An understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention may be utilized, and the accompanying drawings of which:
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103] The figures herein are for illustrative purposes only and are not necessarily drawn to scale.
DETAILED DESCRIPTION OF THE EXAMPLE EMBODIMENTS
General Definitions
[0104] Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. Definitions of common terms and techniques in molecular biology may be found in Molecular Cloning: A Laboratory Manual, 2nd edition (1989) (Sambrook, Fritsch, and Maniatis); Molecular Cloning: A Laboratory Manual, 4th edition (2012) (Green and Sambrook); Current Protocols in Molecular Biology (1987) (F. M. Ausubel et al. eds.); the series Methods in Enzymology (Academic Press, Inc.): PCR 2: A Practical Approach (1995) (M. J. MacPherson, B. D. Hames, and G. R. Taylor eds.): Antibodies, A Laboratory Manual (1988) (Harlow and Lane, eds.): Antibodies A Laboratory Manual, 2nd edition 2013 (E. A. Greenfield ed.); Animal Cell Culture (1987) (R.I. Freshney, ed.); Benjamin Lewin, Genes I X, published by Jones and Bartlet, 2008 (ISBN 0763752223); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0632021829); Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 9780471185710); Singleton et al., Dictionary of Microbiology and Molecular Biology 2nd ed., J. Wiley & Sons (New York, N.Y. 1994), March, Advanced Organic Chemistry Reactions, Mechanisms and Structure 4th ed., John Wiley & Sons (New York, N.Y. 1992); and Marten H. Hofker and Jan van Deursen, Transgenic Mouse Methods and Protocols, 2nd edition (2011).
[0105] As used herein, the singular forms a, an, and the include both singular and plural referents unless the context clearly dictates otherwise.
[0106] The term optional or optionally means that the subsequent described event, circumstance or substituent may or may not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.
[0107] The recitation of numerical ranges by endpoints includes all numbers and fractions subsumed within the respective ranges, as well as the recited endpoints.
[0108] The terms about or approximately as used herein when referring to a measurable value such as a parameter, an amount, a temporal duration, and the like, are meant to encompass variations of and from the specified value, such as variations of +/10% or less, +/5% or less, +/1% or less, and +/0.1% or less of and from the specified value, insofar such variations are appropriate to perform in the disclosed invention. It is to be understood that the value to which the modifier about or approximately refers is itself also specifically, and preferably, disclosed.
[0109] As used herein, a biological sample may contain whole cells and/or live cells and/or cell debris. The biological sample may contain (or be derived from) a bodily fluid. The present invention encompasses embodiments wherein the bodily fluid is selected from amniotic fluid, aqueous humour, vitreous humour, bile, blood serum, breast milk, cerebrospinal fluid, cerumen (earwax), chyle, chyme, endolymph, perilymph, exudates, feces, female ejaculate, gastric acid, gastric juice, lymph, mucus (including nasal drainage and phlegm), pericardial fluid, peritoneal fluid, pleural fluid, pus, rheum, saliva, sebum (skin oil), semen, sputum, synovial fluid, sweat, tears, urine, vaginal secretion, vomit and mixtures of one or more thereof. Biological samples include cell cultures, bodily fluids, cell cultures from bodily fluids. Bodily fluids may be obtained from a mammal organism, for example by puncture, or other collecting or sampling procedures.
[0110] The terms subject, individual, and patient are used interchangeably herein to refer to a vertebrate, preferably a mammal, more preferably a human. Mammals include, but are not limited to, murines, simians, humans, farm animals, sport animals, and pets. Tissues, cells and their progeny of a biological entity obtained in vivo or cultured in vitro are also encompassed.
[0111] Various embodiments are described hereinafter. It should be noted that the specific embodiments are not intended as an exhaustive description or as a limitation to the broader aspects discussed herein. One aspect described in conjunction with a particular embodiment is not necessarily limited to that embodiment and can be practiced with any other embodiment(s). Reference throughout this specification to one embodiment, an embodiment, an example embodiment, means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention. Thus, appearances of the phrases in one embodiment, in an embodiment, or an example embodiment in various places throughout this specification are not necessarily all referring to the same embodiment, but may. Furthermore, the particular features, structures or characteristics may be combined in any suitable manner, as would be apparent to a person skilled in the art from this disclosure, in one or more embodiments. Furthermore, while some embodiments described herein include some but not other features included in other embodiments, combinations of features of different embodiments are meant to be within the scope of the invention. For example, in the appended claims, any of the claimed embodiments can be used in any combination. Unless specifically stated or obvious from context, as used herein, the term or is understood to be inclusive. The term including is used herein to mean, and is used interchangeably with, the phrase including but not limited to.
[0112] All publications, published patent documents, and patent applications cited herein are hereby incorporated by reference to the same extent as though each individual publication, published patent document, or patent application was specifically and individually indicated as being incorporated by reference.
Overview
[0113] The present disclosure provides compositions and methods for conditionally regulating activities of CRISPR-Cas systems. In general, a guide RNA with a regulatory domain is provided. The regulatory domain may bind to a lock nucleic acid that is different from the guide RNA. When bound to the lock nucleic acid, the guide RNA is inactivated and cannot bind to any Cas enzyme. A trigger nucleic acid may be provided to activate the guide RNA. The trigger nucleic acid may dissociate the lock nucleic acid from the guide RNA and form a complex with the lock nucleic acid. When dissociated from the lock nucleic acid, the guide RNA is activated and capable of forming a complex with a Cas enzyme.
[0114] Embodiments disclosed herein provide compositions, systems and methods screening assay that exploit PAM recognition by CRISPR-Cas effector proteins to identify inhibitors of CRISPR-Cas proteins. As discussed above, an active search is ongoing for off-switches of SpCas9. Currently, the best SpCas9 inhibitor (reported by Rauch et al.) is an Anti-CRISPR protein with a paltry efficacy of 25% inhibition in mammalian cells. Further, this protein is highly-negatively charged with poor PK/PD properties, and has shown delivery and immunogenicity problems. Identification of small-molecule CRISPR-Cas inhibitors may resolve some of these issues. However, the identification of small molecule inhibitors of Cas proteins poses many challenges. First, inhibitor identification requires robust, orthogonal, sensitive, high-throughput, miniature, and inexpensive assays, which are currently unavailable. Second, Cas proteins are single turnover enzymes that hold on to its DNA substrate with pM affinity, making the development of such assays challenging. Third, the inhibition of some Cas protein activity requires inhibition of two nuclease domains. Fourth, Cas proteins have many novel protein folds that limit the ability to leverage existing rational design approaches. To circumvent these challenges, the embodiments provided herein may focus on targeting the Cas-substrate PAM motif interaction as a way to identify novel small molecule inhibitors of Cas proteins. To this end, several high-throughput biochemical assays for Cas proteins were developed and a preliminary screen was performed to identify small molecules that inhibit Cas protein activity.
[0115] The embodiments disclosed herein utilize fluorescence polarization based preliminary screen to identify a putative set of Cas inhibitors from an initial set of candidate inhibitors. The primary screening assay is followed by secondary screening assay to validate the putative set of inhibitors selected by the preliminary screen. In certain example embodiments, the first cell-based assay is a knockdown assay that measures changes in Cas-mediated knockdown of a reporter gene relative to control. In certain other example embodiments, the second cell-based assay measures changes in Cas editing activity using a frame-shift reporter. The first cell based assay, when deployed to identify inhibitors, is a gain-of-signal assay which has a much lower probability of false positives and are complementary to the second cell-based loss-of-signal assay. In certain example embodiments, a further screening step may be employed to assess inhibition of nuclease activity in eukaryotic or prokaryotic cells.
[0116] Further provided herein include computer-based methods and systems for designing and/or identifying inhibitors of a CRISPR-Cas effector protein (CRISPR protein). In general, the methods may include fitting (e.g., using a computer) a candidate molecule to one or more target regions in a three-dimensional structure of a PAM interaction (PI) domain of the CRISPR protein. The fitting results may then be evaluated to determine the ability of the candidate molecule to interact with the target region(s).
[0117] The present disclosure provides compositions and methods for inhibiting the activity of RNA guided endonucleases (e.g., Cas9, Cpf1), and methods of use therefore, as well as methods to inhibit or prevent Cas9 genome editing. The invention is based, at least in part, on the discovery of small molecule inhibitors of RNA guided endonucleases. As described herein, high-throughput biochemical and cellular assays, and workflows comprising combinations of such assays, were developed for screening and identifying small molecules with the ability to inhibit one or more activities of RNA guided endonucleases. Methods involving small molecule inhibitors of RNA guided endonucleases are useful for the modulation of RNA guided endonuclease activity, including rapid, reversible, dosage, and/or temporal control of RNA guided endonuclease technologies.
Compositions and Methods of Regulating Crispr-Cas System Activities
[0118] Provided herein include compositions and methods for conditionally activating or inhibiting the activity of a CRISPR-Cas system. In general, the activity of a CRISPR-Cas system may be switched on or off by a trigger signal. The trigger signal may induce expression of one or more trigger nucleic acids that can in turn regulate the activity of a CRISPR-Cas system. In some examples, the compositions for regulating the activity of a CRISPR-Cas system may comprise a guide RNA comprising a regulatory domain. The regulatory domain may bind to a lock molecule, e.g., a lock nucleic acid. The binding of the lock molecule to the regulatory domain may inhibit the activity of the guide RNA. The binding of the lock molecule may be dissociated by a trigger molecule, e.g., a trigger nucleic acid. Once the lock molecule dissociates from the guide RNA, the guide RNA is activated and can form a complex with a Cas enzyme or a Cas enzyme whose nuclease activity is at least partially inactivated.
Compositions for Regulating CRISPR-Cas Systems
[0119] In some embodiments, compositions for conditionally regulating the activity of a CRISPR-Cas system comprise a guide RNA with a regulatory domain, a lock molecule, a trigger molecule, or any combination thereof. In some examples, the compositions may comprise a regulatory domain or a nucleic acid encoding the guide RNA; and one or more of: (i) a lock nucleic acid different from the guide RNA and configured to inactivate the guide RNA when binding to the regulatory domain, or a nucleic acid encoding the lock nucleic acid; and (ii) a trigger nucleic acid configured to displace the lock nucleic acid from the regulatory domain and activate the guide RNA, or a nucleic acid encoding the trigger nucleic acid.
Guide RNA with Regulatory Domain(s)
[0120] In some embodiments, the compositions for regulating a CRISPR-Cas system comprise a guide RNA with one or more regulatory domains. The regulatory domain may be targeted (e.g., bound) by modulating molecules that control the activity of the guide RNA.
[0121] In some cases, a lock molecule binds to the regulatory domain and inactivates the guide RNA. When inactivated, the guide RNA cannot form complex with a Cas enzyme, thus cannot guide the Cas enzyme to a target sequence. Alternatively or additionally, an inactive guide RNA cannot recognize a target sequence.
[0122] In some embodiments, a regulatory domain in a guide RNA comprises a nucleic acid sequence of the guide RNA. Such regulatory domain may be from about 2 nt to about 20 nt, e.g., from about 5 nt to about 15 nt, from about 5 nt to about 10 nt, from about 6 nt to about 9 nt, from about 5 nt to about 7 nt, from about 6 nt to about 8 nt, from about 7 nt to about 9 nt, from about 8 nt to about 10 nt, or from about 9 nt to about 11 nt in length. For example, the regulatory domain may be 2 nt, 3 nt, 4 nt, 5 nt, 6 nt, 7 nt, 8 nt, 9 nt, 10 nt, 11 nt, 12 nt, 13 nt, 14 nt, 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, or 20 nt in length. In some examples, the regulatory domain is from about 7 nt to about 9 nt in length. In some examples, the regulatory domain is 8 nt in length.
[0123] A regulatory domain may be at a suitable location in the guide RNA. In some examples, the regulatory domain may be at or close (e.g., less than 20 nt, 15 nt, 10 nt, 5 nt, 4 nt, 3 nt, or 2 nt from the 5 end) to the 5 end of the guide RNA. In certain examples, the regulatory domain may be at or close to (e.g., less than 20 nt, 15 nt, 10 nt, 5 nt, 4 nt, 3 nt, or 2 nt from the 3 end) the 3 end of the guide RNA. In some cases, the guide RNA comprises multiple regulatory domains. In such cases, one or more regulatory domains are at or close to the 5 end of the guide RNA and one or more regulatory domains are at or close to the 3 end of the guide RNA.
Toehold Sequence
[0124] In some embodiments, the regulatory domain may comprise a toehold sequence. A toehold sequence in the regulatory domain may be a nucleic acid sequence designed to facilitate the hybridization of the regulatory domain with another nucleic acid sequence (e.g., a complementary nucleic acid sequence). In some cases, the toehold sequence may be an RNA sequence. For example, the toehold sequence may be a single strand RNA toehold sequence. Alternatively or additionally, the toehold sequence may be a DNA sequence.
[0125] The toehold sequence may be of any suitable length. For example, a toehold sequence may be from about 2 nt to about 20 nt, e.g., from about 5 nt to about 15 nt, from about 5 nt to about 10 nt, from about 6 nt to about 9 nt, from about 5 nt to about 7 nt, from about 6 to about 8, from about 7 nt to about 9 nt, from about 8 nt to about 10 nt, or from about 9 nt to about 11 nt in length. For example, the toehold sequence may be 2 nt, 3 nt, 4 nt, 5 nt, 6 nt, 7 nt, 8 nt, 9 nt, 10 nt, 11 nt, 12 nt, 13 nt, 14 nt, 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, or 20 nt in length. In some examples, the toehold sequence is from about 7 nt to about 9 nt in length. In some examples, the toehold sequence is 8 nt in length.
Lock Nucleic Acids
[0126] The compositions herein may further comprise one or more lock nucleic acids. In some embodiments, a lock nucleic acid may bind to the regulatory domain, e.g., bind to the toehold sequence, of the guide RNA. Binding of the lock nucleic acid may render the guide RNA inactivated. For example, when bound to a lock nucleic acid, the guide RNA may not form a complex with a Cas enzyme. In some cases, a lock nucleic acid is a molecule different from the guide RNA. In certain cases, a lock nucleic acid may be a portion of the guide RNA.
[0127] The lock nucleic acid may be DNA, RNA, a DNA-RNA hybrid, or a combination thereof. In some examples, the lock nucleic acid may be RNA.
[0128] A lock nucleic acid may be of any suitable length. In some cases, a lock nucleic acid may be from about 3 nt to about 100 nt, e.g., from about 3 nt to about 10 nt, from about 5 nt to about 15 nt, from about 10 nt to about 20 nt, from about 15 nt to about 25 nt, from about 20 nt to about 30 nt, from about 25 nt to about 35 nt, from about 30 nt to about 40 nt, from about 35 nt to about 45 nt, from about 40 nt to about 50 nt, from about 45 nt to about 55 nt, from about 50 nt to about 60 nt, from about 55 nt to about 65 nt, from about 60 nt to about 70 nt, from about 65 nt to about 75 nt, from about 70 nt to about 80 nt, from about 75 nt to about 85 nt, from about 80 nt to about 90 nt, from about 85 nt to about 95 nt, or from about 90 nt to about 100 nt in length.
[0129] The lock nucleic acid may be complementary to at least a portion of the regulatory domain of the guide RNA, e.g., the toehold sequence. As used herein, the term complementary refers to the capacity for precise pairing between two nucleotides. For example, if a nucleotide at a given position of a nucleic acid is capable of hydrogen bonding with a nucleotide of another nucleic acid, then the two nucleic acids are considered to be complementary to one another at that position. Complementarity between two single-stranded nucleic acid molecules may be partial, in which only some of the nucleotides bind, or it may be complete when total complementarity exists between the single-stranded molecules. The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands. In some embodiments, the lock nucleic acid may be 100% complementary to at least a portion of the regulatory domain of the guide RNA. In certain embodiments, the lock nucleic acid may be at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% complementary to at least a portion of the regulatory domain of the guide RNA.
[0130] Expression of the lock nucleic acid may be inducible. For example, a lock nucleic acid may be encoded by a gene under the control of a promoter. The promoter may be inducible by a signal or treatment. When the signal is present, the expression of the lock nucleic acid is induced, i.e., the lock nucleic acid is expressed and inactivates the guide RNA. In cases where the signal is absent, the lock nucleic acid is not expressed.
Trigger Nucleic Acid
[0131] The compositions may further comprise one or more trigger nucleic acids. A guide nucleic acid may activate an inactive guide RNA. For example, when a guide RNA is bound by a lock nucleic acid and inactivated, a trigger nucleic acid may displace the lock nucleic acid from the guide RNA. When the lock nucleic acid is displaced, the guide RNA may be capable of forming a complex with a Cas enzyme. In some cases, a trigger nucleic acid is a molecule different from the guide RNA. In certain cases, a trigger nucleic acid may be a portion of the guide RNA.
[0132] The trigger nucleic acid may be DNA, RNA, a DNA-RNA hybrid, or a combination thereof. In some examples, the trigger nucleic acid may be RNA. In some examples, the trigger nucleic acid may be DNA.
[0133] A trigger nucleic acid may be of any suitable length. In some cases, a trigger nucleic acid may be from about 3 nt to about 100 nt, e.g., from about 3 nt to about 10 nt, from about 5 nt to about 15 nt, from about 10 nt to about 20 nt, from about 15 nt to about 25 nt, from about 20 nt to about 30 nt, from about 25 nt to about 35 nt, from about 30 nt to about 40 nt, from about 35 nt to about 45 nt, from about 40 nt to about 50 nt, from about 45 nt to about 55 nt, from about 50 nt to about 60 nt, from about 55 nt to about 65 nt, from about 60 nt to about 70 nt, from about 65 nt to about 75 nt, from about 70 nt to about 80 nt, from about 75 nt to about 85 nt, from about 80 nt to about 90 nt, from about 85 nt to about 95 nt, or from about 90 nt to about 100 nt in length.
[0134] The trigger nucleic acid may be complementary to at least a portion of a lock nucleic acid. In some embodiments, the trigger nucleic acid may be 100% complementary to at least a portion of the lock nucleic acid. In certain embodiments, the trigger nucleic acid may be at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% complementary to at least a portion of the lock nucleic acid.
[0135] Expression of the trigger nucleic acid may be inducible. For example, a trigger nucleic acid may be encoded by a gene under the control of a promoter. The promoter may be inducible promoter. An inducible promoter may be a promoter that can be switched on and off under the influence of an external factor. Such a switching factor can be a physiological factor e.g., heat. Such a factor can also be of chemical nature. Examples of inducible promoters include heat-shock promoters, IPTG-inducible Lac-promoters, tetracycline-controlled transactivation systems, or ecdysone-inducible expression systems. When the inducing factor is present, the expression of the trigger nucleic acid is induced, i.e., the trigger nucleic acid is expressed and activate a target guide RNA that was inactive. In cases where the signal is absent, the trigger nucleic acid is not expressed.
[0136] The compositions herein may further comprise one or more Cas enzymes described herein. In some cases, the Cas enzyme may have its nuclease cavity partially inactivated. Such Cas enzyme may be a nickase.
[0137] In some embodiments, the present disclosure includes one or more cells, tissues, organs, or animals comprising one or more components of the compositions herein.
[0138] In some embodiments, the present disclosure includes kits comprising one or more components of the compositions herein. The kits may further comprise one or more suitable reagents and instructions.
Biomolecular Circuit
[0139] The compositions herein may be used to form a biomolecular circuit. A biomolecular circuit may comprise a collection of molecular components connected one to another by biochemical reactions according to a circuit design. In particular, in a genetic circuit the molecular components are connected one to another by the biochemical reactions so that the collection of molecular components is capable to provide a specific output in response to one or more inputs. A molecular component in the biomolecular circuit may be a chemical compound comprised that can be found in a cellular environment. Exemplary molecular components thus comprise nucleic acid (e.g., DNA or RNA, proteins, polysaccharides, lipids, amino acids, peptides, sugars and/or other small or large molecules and/or polymers that can be found in a cellular environment. The molecular components forming parts of the biomolecular circuit may be genetic molecular components and/or cellular molecular components.
[0140] One or more components in the compositions herein, e.g., the guide RNA, the lock nucleic acid, the trigger nucleic acid, any nucleic acid encoding thereof, or any combination thereof, may be molecular components in a bimolecular circuit.
Methods for Regulating CRISPR-Cas Systems
[0141] The present disclosure also provides methods for regulating CRISPR-Cas systems, e.g., using the compositions described herein.
[0142] In some embodiments, the methods comprise inactivating a guide RNA by binding a regulatory domain in the guide RNA with a lock nucleic acid. The methods may further comprise providing the inactive guide RNA. The methods may further comprise displacing the lock nucleic acid bound to the guide RNA with a trigger nucleic acid. In the displacement step, the complex of the lock nucleic acid and the guide RNA is dissociated, and the lock nucleic acid forms a complex with the trigger nucleic acid. The guide RNA dissociated from the lock nucleic acid is activated and can form a complex with a Cas enzyme.
[0143] The compositions and methods of regulating activities of CRISPR-Cas systems may be used in combination with other methods (e.g., screening methods, methods of designing and/or identifying compounds described herein). For example, the methods of regulating CRISPR-Cas systems may be combined with methods for screening inhibitors of the CRISPR-Cas system. In some examples, the guide RNA (e.g., the regulatory domain of the guide RNA) is capable of binding to a target nucleic acid (e.g., a reporter gene). The target nucleic acid may comprise a detectable label, e.g., a fluorescent label. The complex of Cas enzyme and the activated guide RNA may be incubated with the target nucleic acid. The target nucleic acid may be cleaved and the fluorescent label may be removed from the target nucleic acid.
CRISPR Systems
[0144] The embodiments disclosed herein may be used to regulate the activity and/or screen a wide array of CRISPR-Cas systems. The molecules identified and/or designed using the methods herein may modulate activities of one or more components of a CRISPR system, e.g., a CRISPR protein. Cas, CRISPR effector protein, CRISPR effector, CRISPR protein, Cas protein, CRISPR enzyme, Cas enzyme, CRISPR-Cas enzyme, and CRISPR effector protein) are used interchangeably herein.
[0145] In general, a CRISPR-Cas system as used in herein and in documents, such as WO 2014/093622 (PCT/US2013/074667), refers collectively to transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated (Cas) genes, including sequences encoding a Cas gene, a tracr (trans-activating CRISPR) sequence (e.g., tracrRNA or an active partial tracrRNA), a tracr-mate sequence (encompassing a direct repeat and a tracrRNA-processed partial direct repeat in the context of an endogenous CRISPR system), a guide sequence (also referred to as a spacer in the context of an endogenous CRISPR system), or RNA(s) as that term is herein used (e.g., RNA(s) to guide Cas, such as Cas9, e.g. CRISPR RNA and transactivating (tracr) RNA or a single guide RNA (sgRNA) (chimeric RNA)) or other sequences and transcripts from a CRISPR locus. In general, a CRISPR system is characterized by elements that promote the formation of a CRISPR complex at the site of a target sequence (also referred to as a protospacer in the context of an endogenous CRISPR system). See, e.g., Shmakov et al. (2015) Discovery and Functional Characterization of Diverse Class 2 CRISPR-Cas Systems, Molecular Cell, DOI: dx.doi.org/10.1016/j.molce1.2015.10.008.
[0146] In certain embodiments, a protospacer adjacent motif (PAM) or PAM-like motif directs binding of the effector protein complex as disclosed herein to the target locus of interest. In some embodiments, the PAM may be a 5 PAM (i.e., located upstream of the 5 end of the protospacer). In other embodiments, the PAM may be a 3 PAM (i.e., located downstream of the 5 end of the protospacer). The term PAM may be used interchangeably with the term PFS or protospacer flanking site or protospacer flanking sequence.
[0147] In a preferred embodiment, the Cas protein may recognize a 3 PAM. In certain embodiments, the Cas protein may recognize a 3 PAM which is 5H, wherein H is A, C or U.
[0148] In the context of formation of a CRISPR complex, target sequence refers to a sequence to which a guide sequence is designed to have complementarity, where hybridization between a target sequence and a guide sequence promotes the formation of a CRISPR complex. A target sequence may comprise RNA polynucleotides. The term target RNA refers to a RNA polynucleotide being or comprising the target sequence. In other words, the target RNA may be a RNA polynucleotide or a part of a RNA polynucleotide to which a part of the gRNA, i.e. the guide sequence, is designed to have complementarity and to which the effector function mediated by the complex comprising CRISPR effector protein and a gRNA is to be directed. In some embodiments, a target sequence is located in the nucleus or cytoplasm of a cell.
[0149] In certain example embodiments, the CRISPR effector protein may be delivered using a nucleic acid molecule encoding the CRISPR effector protein. The nucleic acid molecule encoding a CRISPR effector protein may advantageously be a codon optimized CRISPR effector protein. An example of a codon optimized sequence, is in this instance a sequence optimized for expression in eukaryote, e.g., humans (i.e., being optimized for expression in humans), or for another eukaryote, animal or mammal as herein discussed; See, e.g., SaCas9 human codon optimized sequence in WO 2014/093622 (PCT/US2013/074667). Whilst this is preferred, it will be appreciated that other examples are possible and codon optimization for a host species other than human, or for codon optimization for specific organs is known. In some embodiments, an enzyme coding sequence encoding a CRISPR effector protein is a codon optimized for expression in particular cells, such as eukaryotic cells. The eukaryotic cells may be those of or derived from a particular organism, such as a plant or a mammal, including but not limited to human, or non-human eukaryote or animal or mammal as herein discussed, e.g., mouse, rat, rabbit, dog, livestock, or non-human mammal or primate. In some embodiments, processes for modifying the germ line genetic identity of human beings and/or processes for modifying the genetic identity of animals which are likely to cause them suffering without any substantial medical benefit to man or animal, and also animals resulting from such processes, may be excluded. In general, codon optimization refers to a process of modifying a nucleic acid sequence for enhanced expression in the host cells of interest by replacing at least one codon (e.g., about or more than about 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more codons) of the native sequence with codons that are more frequently or most frequently used in the genes of that host cell while maintaining the native amino acid sequence. Various species exhibit particular bias for certain codons of a particular amino acid. Codon bias (differences in codon usage between organisms) often correlates with the efficiency of translation of messenger RNA (mRNA), which is in turn believed to be dependent on, among other things, the properties of the codons being translated and the availability of particular transfer RNA (tRNA) molecules. The predominance of selected tRNAs in a cell is generally a reflection of the codons used most frequently in peptide synthesis. Accordingly, genes can be tailored for optimal gene expression in a given organism based on codon optimization. Codon usage tables are readily available, for example, at the Codon Usage Database available at kazusa.orjp/codon/and these tables can be adapted in a number of ways. See Nakamura, Y., et al. Codon usage tabulated from the international DNA sequence databases: status for the year 2000 Nucl. Acids Res. 28:292 (2000). Computer algorithms for codon optimizing a particular sequence for expression in a particular host cell are also available, such as Gene Forge (Aptagen; Jacobus, Pa.), are also available. In some embodiments, one or more codons (e.g., 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more, or all codons) in a sequence encoding a Cas correspond to the most frequently used codon for a particular amino acid.
[0150] In certain embodiments, the methods as described herein may comprise providing a Cas transgenic cell in which one or more nucleic acids encoding one or more guide RNAs are provided or introduced operably connected in the cell with a regulatory element comprising a promoter of one or more gene of interest. As used herein, the term Cas transgenic cell refers to a cell, such as a eukaryotic cell, in which a Cas gene has been genomically integrated. The nature, type, or origin of the cell are not particularly limiting according to the present invention. Also the way the Cas transgene is introduced in the cell may vary and can be any method as is known in the art. In certain embodiments, the Cas transgenic cell is obtained by introducing the Cas transgene in an isolated cell. In certain other embodiments, the Cas transgenic cell is obtained by isolating cells from a Cas transgenic organism. By means of example, and without limitation, the Cas transgenic cell as referred to herein may be derived from a Cas transgenic eukaryote, such as a Cas knock-in eukaryote. Reference is made to WO 2014/093622 (PCT/US13/74667), incorporated herein by reference. Methods of US Patent Publication Nos. 20120017290 and 20110265198 assigned to Sangamo BioSciences, Inc. directed to targeting the Rosa locus may be modified to utilize the CRISPR Cas system of the present invention. Methods of US Patent Publication No. 20130236946 assigned to Cellectis directed to targeting the Rosa locus may also be modified to utilize the CRISPR Cas system of the present invention. By means of further example reference is made to Platt et. al. (Cell; 159(2):440-455 (2014)), describing a Cas9 knock-in mouse, which is incorporated herein by reference. The Cas transgene can further comprise a Lox-Stop-polyA-Lox(LSL) cassette thereby rendering Cas expression inducible by Cre recombinase. Alternatively, the Cas transgenic cell may be obtained by introducing the Cas transgene in an isolated cell. Delivery systems for transgenes are well known in the art. By means of example, the Cas transgene may be delivered in for instance eukaryotic cell by means of vector (e.g., AAV, adenovirus, lentivirus) and/or particle and/or nanoparticle delivery, as also described herein elsewhere.
[0151] It will be understood by the skilled person that the cell, such as the Cas transgenic cell, as referred to herein may comprise further genomic alterations besides having an integrated Cas gene or the mutations arising from the sequence specific action of Cas when complexed with RNA capable of guiding Cas to a target locus.
[0152] In certain aspects the invention involves vectors, e.g., for delivering or introducing in a cell Cas and/or RNA capable of guiding Cas to a target locus (i.e. guide RNA), but also for propagating these components (e.g. in prokaryotic cells). A used herein, a vector is a tool that allows or facilitates the transfer of an entity from one environment to another. It is a replicon, such as a plasmid, phage, or cosmid, into which another DNA segment may be inserted so as to bring about the replication of the inserted segment. Generally, a vector is capable of replication when associated with the proper control elements. In general, the term vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. Vectors include, but are not limited to, nucleic acid molecules that are single-stranded, double-stranded, or partially double-stranded; nucleic acid molecules that comprise one or more free ends, no free ends (e.g. circular); nucleic acid molecules that comprise DNA, RNA, or both; and other varieties of polynucleotides known in the art. One type of vector is a plasmid, which refers to a circular double stranded DNA loop into which additional DNA segments can be inserted, such as by standard molecular cloning techniques. Another type of vector is a viral vector, wherein virally-derived DNA or RNA sequences are present in the vector for packaging into a virus (e.g., retroviruses, replication defective retroviruses, adenoviruses, replication defective adenoviruses, and adeno-associated viruses (AAVs)). Viral vectors also include polynucleotides carried by a virus for transfection into a host cell. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively-linked. Such vectors are referred to herein as expression vectors. Common expression vectors of utility in recombinant DNA techniques are often in the form of plasmids.
[0153] Recombinant expression vectors can comprise a nucleic acid of the invention in a form suitable for expression of the nucleic acid in a host cell, which means that the recombinant expression vectors include one or more regulatory elements, which may be selected on the basis of the host cells to be used for expression, that is operatively-linked to the nucleic acid sequence to be expressed. Within a recombinant expression vector, operably linked is intended to mean that the nucleotide sequence of interest is linked to the regulatory element(s) in a manner that allows for expression of the nucleotide sequence (e.g., in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell). With regards to recombination and cloning methods, mention is made of U.S. patent application Ser. No. 10/815,730, published Sep. 2, 2004 as US 2004-0171156 A1, the contents of which are herein incorporated by reference in their entirety. Thus, the embodiments disclosed herein may also comprise transgenic cells comprising the CRISPR effector system. In certain example embodiments, the transgenic cell may function as an individual discrete volume. In other words samples comprising a masking construct may be delivered to a cell, for example in a suitable delivery vesicle and if the target is present in the delivery vesicle the CRISPR effector is activated and a detectable signal generated.
[0154] The vector(s) can include the regulatory element(s), e.g., promoter(s). The vector(s) can comprise Cas encoding sequences, and/or a single, but possibly also can comprise at least 3 or 8 or 16 or 32 or 48 or 50 guide RNA(s) (e.g., sgRNAs) encoding sequences, such as 1-2, 1-3, 1-4 1-5, 3-6, 3-7, 3-8, 3-9, 3-10, 3-8, 3-16, 3-30, 3-32, 3-48, 3-50 RNA(s) (e.g., sgRNAs). In a single vector there can be a promoter for each RNA (e.g., sgRNA), advantageously when there are up to about 16 RNA(s); and, when a single vector provides for more than 16 RNA(s), one or more promoter(s) can drive expression of more than one of the RNA(s), e.g., when there are 32 RNA(s), each promoter can drive expression of two RNA(s), and when there are 48 RNA(s), each promoter can drive expression of three RNA(s). By simple arithmetic and well-established cloning protocols and the teachings in this disclosure one skilled in the art can readily practice the invention as to the RNA(s) for a suitable exemplary vector such as AAV, and a suitable promoter such as the U6 promoter. For example, the packaging limit of AAV is 4.7 kb. The length of a single U6-gRNA (plus restriction sites for cloning) is 361 bp. Therefore, the skilled person can readily fit about 12-16, e.g., 13 U6-gRNA cassettes in a single vector. This can be assembled by any suitable means, such as a golden gate strategy used for TALE assembly (genome-engineering.org/taleffectors/). The skilled person can also use a tandem guide strategy to increase the number of U6-gRNAs by approximately 1.5 times, e.g., to increase from 12-16, e.g., 13 to approximately 18-24, e.g., about 19 U6-gRNAs. Therefore, one skilled in the art can readily reach approximately 18-24, e.g., about 19 promoter-RNAs, e.g., U6-gRNAs in a single vector, e.g., an AAV vector. A further means for increasing the number of promoters and RNAs in a vector is to use a single promoter (e.g., U6) to express an array of RNAs separated by cleavable sequences. And an even further means for increasing the number of promoter-RNAs in a vector, is to express an array of promoter-RNAs separated by cleavable sequences in the intron of a coding sequence or gene; and, in this instance it is advantageous to use a polymerase II promoter, which can have increased expression and enable the transcription of long RNA in a tissue specific manner. (See, e.g., nar.oxfordjournals.org/content/34/7/e53.short and nature.com/mt/journal/v16/n9/abs/mt2008144a.html). In an advantageous embodiment, AAV may package U6 tandem gRNA targeting up to about 50 genes. Accordingly, from the knowledge in the art and the teachings in this disclosure the skilled person can readily make and use vector(s), e.g., a single vector, expressing multiple RNAs or guides under the control or operatively or functionally linked to one or more promotersespecially as to the numbers of RNAs or guides discussed herein, without any undue experimentation.
[0155] The guide RNA(s) encoding sequences and/or Cas encoding sequences can be functionally or operatively linked to regulatory element(s) and hence the regulatory element(s) drive expression. The promoter(s) can be constitutive promoter(s) and/or conditional promoter(s) and/or inducible promoter(s) and/or tissue specific promoter(s). The promoter can be selected from the group consisting of RNA polymerases, pol I, pol II, pol III, T7, U6, H1, retroviral Rous sarcoma virus (RSV) LTR promoter, the cytomegalovirus (CMV) promoter, the SV40 promoter, the dihydrofolate reductase promoter, the -actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EF1 promoter. An advantageous promoter is the promoter is U6.
[0156] Additional effectors for use according to the invention can be identified by their proximity to cas1 genes, for example, though not limited to, within the region 20 kb from the start of the cas1 gene and 20 kb from the end of the cas1 gene. In certain embodiments, the effector protein comprises at least one HEPN domain and at least 500 amino acids, and wherein the C2c2 effector protein is naturally present in a prokaryotic genome within 20 kb upstream or downstream of a Cas gene or a CRISPR array. Non-limiting examples of Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, homologues thereof, or modified versions thereof.
[0157] The terms ortholog and homolog are well known in the art. By means of further guidance, a homolog of a protein as used herein is a protein of the same species which performs the same or a similar function as the protein it is a homologue of Homologous proteins may but need not be structurally related, or are only partially structurally related. An ortholog of a protein as used herein is a protein of a different species which performs the same or a similar function as the protein it is an orthologue of Orthologous proteins may but need not be structurally related, or are only partially structurally related.
Guide Molecules
[0158] The methods and compositions described herein may be used to regulate the activity of guide molecules. The methods and compositions herein may also be used to screen inhibition of CRISPR systems employing different types of guide molecules. As used herein, the term guide sequence and guide molecule in the context of a CRISPR-Cas system, comprises any polynucleotide sequence having sufficient complementarity with a target nucleic acid sequence to hybridize with the target nucleic acid sequence and direct sequence-specific binding of a nucleic acid-targeting complex to the target nucleic acid sequence. The guide sequences made using the methods disclosed herein may be a full-length guide sequence, a truncated guide sequence, a full-length sgRNA sequence, a truncated sgRNA sequence, or an E+F sgRNA sequence. In some embodiments, the degree of complementarity of the guide sequence to a given target sequence, when optimally aligned using a suitable alignment algorithm, is about or more than about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, or more. In certain example embodiments, the guide molecule comprises a guide sequence that may be designed to have at least one mismatch with the target sequence, such that a RNA duplex formed between the guide sequence and the target sequence. Accordingly, the degree of complementarity is preferably less than 99%. For instance, where the guide sequence consists of 24 nucleotides, the degree of complementarity is more particularly about 96% or less. In particular embodiments, the guide sequence is designed to have a stretch of two or more adjacent mismatching nucleotides, such that the degree of complementarity over the entire guide sequence is further reduced. For instance, where the guide sequence consists of 24 nucleotides, the degree of complementarity is more particularly about 96% or less, more particularly, about 92% or less, more particularly about 88% or less, more particularly about 84% or less, more particularly about 80% or less, more particularly about 76% or less, more particularly about 72% or less, depending on whether the stretch of two or more mismatching nucleotides encompasses 2, 3, 4, 5, 6 or 7 nucleotides, etc. In some embodiments, aside from the stretch of one or more mismatching nucleotides, the degree of complementarity, when optimally aligned using a suitable alignment algorithm, is about or more than about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, or more. Optimal alignment may be determined with the use of any suitable algorithm for aligning sequences, non-limiting example of which include the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the Burrows-Wheeler Transform (e.g., the Burrows Wheeler Aligner), ClustalW, Clustal X, BLAT, Novoalign (Novocraft Technologies; available at www.novocraft.com), ELAND (Illumina, San Diego, Calif.), SOAP (available at soap.genomics.org.cn), and Maq (available at maq.sourceforge.net). The ability of a guide sequence (within a nucleic acid-targeting guide RNA) to direct sequence-specific binding of a nucleic acid-targeting complex to a target nucleic acid sequence may be assessed by any suitable assay. For example, the components of a nucleic acid-targeting CRISPR system sufficient to form a nucleic acid-targeting complex, including the guide sequence to be tested, may be provided to a host cell having the corresponding target nucleic acid sequence, such as by transfection with vectors encoding the components of the nucleic acid-targeting complex, followed by an assessment of preferential targeting (e.g., cleavage) within the target nucleic acid sequence, such as by Surveyor assay as described herein. Similarly, cleavage of a target nucleic acid sequence (or a sequence in the vicinity thereof) may be evaluated in a test tube by providing the target nucleic acid sequence, components of a nucleic acid-targeting complex, including the guide sequence to be tested and a control guide sequence different from the test guide sequence, and comparing binding or rate of cleavage at or in the vicinity of the target sequence between the test and control guide sequence reactions. Other assays are possible, and will occur to those skilled in the art. A guide sequence, and hence a nucleic acid-targeting guide RNA may be selected to target any target nucleic acid sequence.
[0159] In certain embodiments, the guide sequence or spacer length of the guide molecules is from 15 to 50 nt. In certain embodiments, the spacer length of the guide RNA is at least 15 nucleotides. In certain embodiments, the spacer length is from 15 to 17 nt, e.g., 15, 16, or 17 nt, from 17 to 20 nt, e.g., 17, 18, 19, or 20 nt, from 20 to 24 nt, e.g., 20, 21, 22, 23, or 24 nt, from 23 to 25 nt, e.g., 23, 24, or 25 nt, from 24 to 27 nt, e.g., 24, 25, 26, or 27 nt, from 27-30 nt, e.g., 27, 28, 29, or 30 nt, from 30-35 nt, e.g., 30, 31, 32, 33, 34, or 35 nt, or 35 nt or longer. In certain example embodiment, the guide sequence is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 40, 41, 42, 43, 44, 45, 46, 47 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 nt.
[0160] In some embodiments, the guide sequence is an RNA sequence of between 10 to 50 nt in length, but more particularly of about 20-30 nt advantageously about 20 nt, 23-25 nt or 24 nt. The guide sequence is selected so as to ensure that it hybridizes to the target sequence. This is described more in detail below. Selection can encompass further steps which increase efficacy and specificity.
[0161] In some embodiments, the guide sequence has a canonical length (e.g., about 15-30 nt) is used to hybridize with the target RNA or DNA. In some embodiments, a guide molecule is longer than the canonical length (e.g., >30 nt) is used to hybridize with the target RNA or DNA, such that a region of the guide sequence hybridizes with a region of the RNA or DNA strand outside of the Cas-guide target complex. This can be of interest where additional modifications, such deamination of nucleotides is of interest. In alternative embodiments, it is of interest to maintain the limitation of the canonical guide sequence length.
[0162] In some embodiments, the sequence of the guide molecule (direct repeat and/or spacer) is selected to reduce the degree secondary structure within the guide molecule. In some embodiments, about or less than about 75%, 50%, 40%, 30%, 25%, 20%, 15%, 10%, 5%, 1%, or fewer of the nucleotides of the nucleic acid-targeting guide RNA participate in self-complementary base pairing when optimally folded. Optimal folding may be determined by any suitable polynucleotide folding algorithm. Some programs are based on calculating the minimal Gibbs free energy. An example of one such algorithm is mFold, as described by Zuker and Stiegler (Nucleic Acids Res. 9 (1981), 133-148). Another example folding algorithm is the online webserver RNAfold, developed at Institute for Theoretical Chemistry at the University of Vienna, using the centroid structure prediction algorithm (See e.g., A. R. Gruber et al., 2008, Cell 106(1): 23-24; and PA Carr and GM Church, 2009, Nature Biotechnology 27(12): 1151-62).
[0163] In some embodiments, it is of interest to reduce the susceptibility of the guide molecule to RNA cleavage, such as to cleavage by Cas13. Accordingly, in particular embodiments, the guide molecule is adjusted to avoid cleavage by Cas13 or other RNA-cleaving enzymes.
[0164] In certain embodiments, the guide molecule comprises non-naturally occurring nucleic acids and/or non-naturally occurring nucleotides and/or nucleotide analogs, and/or chemically modifications. Preferably, these non-naturally occurring nucleic acids and non-naturally occurring nucleotides are located outside the guide sequence. Non-naturally occurring nucleic acids can include, for example, mixtures of naturally and non-naturally occurring nucleotides. Non-naturally occurring nucleotides and/or nucleotide analogs may be modified at the ribose, phosphate, and/or base moiety. In an embodiment of the invention, a guide nucleic acid comprises ribonucleotides and non-ribonucleotides. In one such embodiment, a guide comprises one or more ribonucleotides and one or more deoxyribonucleotides. In an embodiment of the invention, the guide comprises one or more non-naturally occurring nucleotide or nucleotide analog such as a nucleotide with phosphorothioate linkage, a locked nucleic acid (LNA) nucleotides comprising a methylene bridge between the 2 and 4 carbons of the ribose ring, or bridged nucleic acids (BNA). Other examples of modified nucleotides include 2-O-methyl analogs, 2-deoxy analogs, or 2-fluoro analogs. Further examples of modified bases include, but are not limited to, 2-aminopurine, 5-bromo-uridine, pseudouridine, inosine, 7-methylguanosine. Examples of guide RNA chemical modifications include, without limitation, incorporation of 2-O-methyl (M), 2-O-methyl 3 phosphorothioate (MS), S-constrained ethyl(cEt), or 2-O-methyl 3 thioPACE (MSP) at one or more terminal nucleotides. Such chemically modified guides can comprise increased stability and increased activity as compared to unmodified guides, though on-target vs. off-target specificity is not predictable. (See, Hendel, 2015, Nat Biotechnol. 33(9):985-9, doi: 10.1038/nbt.3290, published online 29 Jun. 2015 Ragdarm et al., 0215, PNAS, E7110-E7111; Allerson et al., J. Med. Chem. 2005, 48:901-904; Bramsen et al., Front. Genet., 2012, 3:154; Deng et al., PNAS, 2015, 112:11870-11875; Sharma et al., MedChemComm., 2014, 5:1454-1471; Hendel et al., Nat. Biotechnol. (2015) 33(9): 985-989; Li et al., Nature Biomedical Engineering, 2017, 1, 0066 DOI:10.1038/s41551-017-0066). In some embodiments, the 5 and/or 3 end of a guide RNA is modified by a variety of functional moieties including fluorescent dyes, polyethylene glycol, cholesterol, proteins, or detection tags. (See Kelly et al., 2016, J. Biotech. 233:74-83). In certain embodiments, a guide comprises ribonucleotides in a region that binds to a target RNA and one or more deoxyribonucleotides and/or nucleotide analogs in a region that binds to Cas13. In an embodiment of the invention, deoxyribonucleotides and/or nucleotide analogs are incorporated in engineered guide structures, such as, without limitation, stem-loop regions, and the seed region. For Cas13 guide, in certain embodiments, the modification is not in the 5-handle of the stem-loop regions. Chemical modification in the 5-handle of the stem-loop region of a guide may abolish its function (see Li, et al., Nature Biomedical Engineering, 2017, 1:0066). In certain embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, or 75 nucleotides of a guide is chemically modified. In some embodiments, 3-5 nucleotides at either the 3 or the 5 end of a guide is chemically modified. In some embodiments, only minor modifications are introduced in the seed region, such as 2-F modifications. In some embodiments, 2-F modification is introduced at the 3 end of a guide. In certain embodiments, three to five nucleotides at the 5 and/or the 3 end of the guide are chemically modified with 2-O-methyl (M), 2-O-methyl 3 phosphorothioate (MS), S-constrained ethyl(cEt), or 2-O-methyl 3 thioPACE (MSP). Such modification can enhance genome editing efficiency (see Hendel et al., Nat. Biotechnol. (2015) 33(9): 985-989). In certain embodiments, all of the phosphodiester bonds of a guide are substituted with phosphorothioates (PS) for enhancing levels of gene disruption. In certain embodiments, more than five nucleotides at the 5 and/or the 3 end of the guide are chemically modified with 2-O-Me, 2-F or S-constrained ethyl(cEt). Such chemically modified guide can mediate enhanced levels of gene disruption (see Ragdarm et al., 0215, PNAS, E7110-E7111). In an embodiment of the invention, a guide is modified to comprise a chemical moiety at its 3 and/or 5 end. Such moieties include, but are not limited to amine, azide, alkyne, thio, dibenzocyclooctyne (DBCO), or Rhodamine. In certain embodiment, the chemical moiety is conjugated to the guide by a linker, such as an alkyl chain. In certain embodiments, the chemical moiety of the modified guide can be used to attach the guide to another molecule, such as DNA, RNA, protein, or nanoparticles. Such chemically modified guide can be used to identify or enrich cells generically edited by a CRISPR system (see Lee et al., eLife, 2017, 6:e25312, DOI:10.7554).
[0165] In some embodiments, the modification to the guide is a chemical modification, an insertion, a deletion or a split. In some embodiments, the chemical modification includes, but is not limited to, incorporation of 2O-methyl (M) analogs, 2-deoxy analogs, 2-thiouridine analogs, N6-methyladenosine analogs, 2fluoro analogs, 2-aminopurine, 5-bromo-uridine, pseudouridine (), N1-methylpseudouridine (mel), 5-methoxyuridine(5 moU), inosine, 7-methylguanosine, 2-O-methyl 3phosphorothioate (MS), S-constrained ethyl(cEt), phosphorothioate (PS), or 2-O-methyl 3thioPACE (MSP). In some embodiments, the guide comprises one or more of phosphorothioate modifications. In certain embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 25 nucleotides of the guide are chemically modified. In certain embodiments, one or more nucleotides in the seed region are chemically modified. In certain embodiments, one or more nucleotides in the 3-terminus are chemically modified. In certain embodiments, none of the nucleotides in the 5-handle is chemically modified. In some embodiments, the chemical modification in the seed region is a minor modification, such as incorporation of a 2-fluoro analog. In a specific embodiment, one nucleotide of the seed region is replaced with a 2-fluoro analog. In some embodiments, 5 to 10 nucleotides in the 3-terminus are chemically modified. Such chemical modifications at the 3-terminus of the Cas13 CrRNA may improve Cas13 activity. In a specific embodiment, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides in the 3-terminus are replaced with 2-fluoro analogues. In a specific embodiment, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides in the 3-terminus are replaced with 2-O-methyl (M) analogs.
[0166] In some embodiments, the loop of the 5-handle of the guide is modified. In some embodiments, the loop of the 5-handle of the guide is modified to have a deletion, an insertion, a split, or chemical modifications. In certain embodiments, the modified loop comprises 3, 4, or 5 nucleotides. In certain embodiments, the loop comprises the sequence of UCUU, UUUU, UAUU, or UGUU.
[0167] In some embodiments, the guide molecule forms a stemloop with a separate non-covalently linked sequence, which can be DNA or RNA. In particular embodiments, the sequences forming the guide are first synthesized using the standard phosphoramidite synthetic protocol (Herdewijn, P., ed., Methods in Molecular Biology Col 288, Oligonucleotide Synthesis: Methods and Applications, Humana Press, New Jersey (2012)). In some embodiments, these sequences can be functionalized to contain an appropriate functional group for ligation using the standard protocol known in the art (Hermanson, G. T., Bioconjugate Techniques, Academic Press (2013)). Examples of functional groups include, but are not limited to, hydroxyl, amine, carboxylic acid, carboxylic acid halide, carboxylic acid active ester, aldehyde, carbonyl, chlorocarbonyl, imidazolylcarbonyl, hydrozide, semicarbazide, thio semicarbazide, thiol, maleimide, haloalkyl, sufonyl, ally, propargyl, diene, alkyne, and azide. Once this sequence is functionalized, a covalent chemical bond or linkage can be formed between this sequence and the direct repeat sequence. Examples of chemical bonds include, but are not limited to, those based on carbamates, ethers, esters, amides, imines, amidines, aminotrizines, hydrozone, disulfides, thioethers, thioesters, phosphorothioates, phosphorodithioates, sulfonamides, sulfonates, fulfones, sulfoxides, ureas, thioureas, hydrazide, oxime, triazole, photolabile linkages, CC bond forming groups such as Diels-Alder cyclo-addition pairs or ring-closing metathesis pairs, and Michael reaction pairs.
[0168] In some embodiments, these stem-loop forming sequences can be chemically synthesized. In some embodiments, the chemical synthesis uses automated, solid-phase oligonucleotide synthesis machines with 2-acetoxyethyl orthoester (2-ACE) (Scaringe et al., J. Am. Chem. Soc. (1998) 120: 11820-11821; Scaringe, Methods Enzymol. (2000) 317: 3-18) or 2-thionocarbamate (2-TC) chemistry (Dellinger et al., J. Am. Chem. Soc. (2011) 133: 11540-11546; Hendel et al., Nat. Biotechnol. (2015) 33:985-989).
[0169] In certain embodiments, the guide molecule comprises (1) a guide sequence capable of hybridizing to a target locus and (2) a tracr mate or direct repeat sequence whereby the direct repeat sequence is located upstream (i.e., 5) from the guide sequence. In a particular embodiment the seed sequence (i.e. the sequence essential critical for recognition and/or hybridization to the sequence at the target locus) of the guide sequence is approximately within the first 10 nucleotides of the guide sequence.
[0170] In a particular embodiment the guide molecule comprises a guide sequence linked to a direct repeat sequence, wherein the direct repeat sequence comprises one or more stem loops or optimized secondary structures. In particular embodiments, the direct repeat has a minimum length of 16 nts and a single stem loop. In further embodiments the direct repeat has a length longer than 16 nts, preferably more than 17 nts, and has more than one stem loops or optimized secondary structures. In particular embodiments the guide molecule comprises or consists of the guide sequence linked to all or part of the natural direct repeat sequence. A typical Type V or Type VI CRISPR-cas guide molecule comprises (in 3 to 5 direction or in 5 to 3 direction): a guide sequence a first complimentary stretch (the repeat), a loop (which is typically 4 or 5 nucleotides long), a second complimentary stretch (the anti-repeat being complimentary to the repeat), and a poly A (often poly U in RNA) tail (terminator). In certain embodiments, the direct repeat sequence retains its natural architecture and forms a single stem loop. In particular embodiments, certain aspects of the guide architecture can be modified, for example by addition, subtraction, or substitution of features, whereas certain other aspects of guide architecture are maintained. Preferred locations for engineered guide molecule modifications, including but not limited to insertions, deletions, and substitutions include guide termini and regions of the guide molecule that are exposed when complexed with the CRISPR-Cas protein and/or target, for example the stemloop of the direct repeat sequence.
[0171] In particular embodiments, the stem comprises at least about 4 bp comprising complementary X and Y sequences, although stems of more, e.g., 5, 6, 7, 8, 9, 10, 11 or 12 or fewer, e.g., 3, 2, base pairs are also contemplated. Thus, for example X2-10 and Y2-10 (wherein X and Y represent any complementary set of nucleotides) may be contemplated. In one aspect, the stem made of the X and Y nucleotides, together with the loop will form a complete hairpin in the overall secondary structure; and, this may be advantageous and the amount of base pairs can be any amount that forms a complete hairpin. In one aspect, any complementary X:Y basepairing sequence (e.g., as to length) is tolerated, so long as the secondary structure of the entire guide molecule is preserved. In one aspect, the loop that connects the stem made of X:Y basepairs can be any sequence of the same length (e.g., 4 or 5 nucleotides) or longer that does not interrupt the overall secondary structure of the guide molecule. In one aspect, the stemloop can further comprise, e.g. an MS2 aptamer. In one aspect, the stem comprises about 5-7 bp comprising complementary X and Y sequences, although stems of more or fewer basepairs are also contemplated. In one aspect, non-Watson Crick basepairing is contemplated, where such pairing otherwise generally preserves the architecture of the stemloop at that position.
[0172] In particular embodiments the natural hairpin or stemloop structure of the guide molecule is extended or replaced by an extended stemloop. It has been demonstrated that extension of the stem can enhance the assembly of the guide molecule with the CRISPR-Cas protein (Chen et al. Cell. (2013); 155(7): 1479-1491). In particular embodiments the stem of the stemloop is extended by at least 1, 2, 3, 4, 5 or more complementary basepairs (i.e. corresponding to the addition of 2, 4, 6, 8, 10 or more nucleotides in the guide molecule). In particular embodiments these are located at the end of the stem, adjacent to the loop of the stemloop.
[0173] In particular embodiments, the susceptibility of the guide molecule to RNAses or to decreased expression can be reduced by slight modifications of the sequence of the guide molecule which do not affect its function. For instance, in particular embodiments, premature termination of transcription, such as premature transcription of U6 Pol-III, can be removed by modifying a putative Pol-III terminator (4 consecutive U's) in the guide molecules sequence. Where such sequence modification is required in the stemloop of the guide molecule, it is preferably ensured by a basepair flip.
[0174] In a particular embodiment the direct repeat may be modified to comprise one or more protein-binding RNA aptamers. In a particular embodiment, one or more aptamers may be included such as part of optimized secondary structure. Such aptamers may be capable of binding a bacteriophage coat protein as detailed further herein.
[0175] In some embodiments, the guide molecule forms a duplex with a target RNA comprising at least one target cytosine residue to be edited. Upon hybridization of the guide RNA molecule to the target RNA, the cytidine deaminase binds to the single strand RNA in the duplex made accessible by the mismatch in the guide sequence and catalyzes deamination of one or more target cytosine residues comprised within the stretch of mismatching nucleotides.
[0176] A guide sequence, and hence a nucleic acid-targeting guide RNA may be selected to target any target nucleic acid sequence. The target sequence may be mRNA.
[0177] In certain embodiments, the target sequence should be associated with a PAM (protospacer adjacent motif) or PFS (protospacer flanking sequence or site); that is, a short sequence recognized by the CRISPR complex. Depending on the nature of the CRISPR-Cas protein, the target sequence should be selected such that its complementary sequence in the DNA duplex (also referred to herein as the non-target sequence) is upstream or downstream of the PAM. In the embodiments of the present invention where the CRISPR-Cas protein is a Cas13 protein, the complementary sequence of the target sequence is downstream or 3 of the PAM or upstream or 5 of the PAM. The precise sequence and length requirements for the PAM differ depending on the Cas13 protein used, but PAMs are typically 2-5 base pair sequences adjacent the protospacer (that is, the target sequence). Examples of the natural PAM sequences for different Cas13 orthologues are provided herein below and the skilled person will be able to identify further PAM sequences for use with a given Cas13 protein.
[0178] Further, engineering of the PAM Interacting (PI) domain may allow programing of PAM specificity, improve target site recognition fidelity, and increase the versatility of the CRISPR-Cas protein, for example as described for Cas9 in Kleinstiver B P et al. Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature. 2015 Jul. 23; 523(7561):481-5. doi: 10.1038/nature14592. As further detailed herein, the skilled person will understand that Cas13 proteins may be modified analogously.
[0179] In particular embodiment, the guide is an escorted guide. By escorted is meant that the CRISPR-Cas system or complex or guide is delivered to a selected time or place within a cell, so that activity of the CRISPR-Cas system or complex or guide is spatially or temporally controlled. For example, the activity and destination of the 3 CRISPR-Cas system or complex or guide may be controlled by an escort RNA aptamer sequence that has binding affinity for an aptamer ligand, such as a cell surface protein or other localized cellular component. Alternatively, the escort aptamer may for example be responsive to an aptamer effector on or in the cell, such as a transient effector, such as an external energy source that is applied to the cell at a particular time.
[0180] The escorted CRISPR-Cas systems or complexes have a guide molecule with a functional structure designed to improve guide molecule structure, architecture, stability, genetic expression, or any combination thereof. Such a structure can include an aptamer.
[0181] Aptamers are biomolecules that can be designed or selected to bind tightly to other ligands, for example using a technique called systematic evolution of ligands by exponential enrichment (SELEX; Tuerk C, Gold L: Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 1990, 249:505-510). Nucleic acid aptamers can for example be selected from pools of random-sequence oligonucleotides, with high binding affinities and specificities for a wide range of biomedically relevant targets, suggesting a wide range of therapeutic utilities for aptamers (Keefe, Anthony D., Supriya Pai, and Andrew Ellington. Aptamers as therapeutics. Nature Reviews Drug Discovery 9.7 (2010): 537-550). These characteristics also suggest a wide range of uses for aptamers as drug delivery vehicles (Levy-Nissenbaum, Etgar, et al. Nanotechnology and aptamers: applications in drug delivery. Trends in biotechnology 26.8 (2008): 442-449; and, Hicke B J, Stephens A W. Escort aptamers: a delivery service for diagnosis and therapy. J Clin Invest 2000, 106:923-928.). Aptamers may also be constructed that function as molecular switches, responding to a que by changing properties, such as RNA aptamers that bind fluorophores to mimic the activity of green fluorescent protein (Paige, Jeremy S., Karen Y. Wu, and Samie R. Jaffrey. RNA mimics of green fluorescent protein. Science 333.6042 (2011): 642-646). It has also been suggested that aptamers may be used as components of targeted siRNA therapeutic delivery systems, for example targeting cell surface proteins (Zhou, Jiehua, and John J. Rossi. Aptamer-targeted cell-specific RNA interference. Silence 1.1 (2010): 4).
[0182] Accordingly, in particular embodiments, the guide molecule is modified, e.g., by one or more aptamer(s) designed to improve guide molecule delivery, including delivery across the cellular membrane, to intracellular compartments, or into the nucleus. Such a structure can include, either in addition to the one or more aptamer(s) or without such one or more aptamer(s), moiety(ies) so as to render the guide molecule deliverable, inducible or responsive to a selected effector. The invention accordingly comprehends an guide molecule that responds to normal or pathological physiological conditions, including without limitation pH, hypoxia, O.sub.2 concentration, temperature, protein concentration, enzymatic concentration, lipid structure, light exposure, mechanical disruption (e.g. ultrasound waves), magnetic fields, electric fields, or electromagnetic radiation.
[0183] Light responsiveness of an inducible system may be achieved via the activation and binding of cryptochrome-2 and CIB1. Blue light stimulation induces an activating conformational change in cryptochrome-2, resulting in recruitment of its binding partner CIB1. This binding is fast and reversible, achieving saturation in <15 sec following pulsed stimulation and returning to baseline <15 min after the end of stimulation. These rapid binding kinetics result in a system temporally bound only by the speed of transcription/translation and transcript/protein degradation, rather than uptake and clearance of inducing agents. Crytochrome-2 activation is also highly sensitive, allowing for the use of low light intensity stimulation and mitigating the risks of phototoxicity. Further, in a context such as the intact mammalian brain, variable light intensity may be used to control the size of a stimulated region, allowing for greater precision than vector delivery alone may offer.
[0184] The invention contemplates energy sources such as electromagnetic radiation, sound energy or thermal energy to induce the guide. Advantageously, the electromagnetic radiation is a component of visible light. In a preferred embodiment, the light is a blue light with a wavelength of about 450 to about 495 nm. In an especially preferred embodiment, the wavelength is about 488 nm. In another preferred embodiment, the light stimulation is via pulses. The light power may range from about 0-9 mW/cm.sup.2. In a preferred embodiment, a stimulation paradigm of as low as 0.25 sec every 15 sec should result in maximal activation.
[0185] The chemical or energy sensitive guide may undergo a conformational change upon induction by the binding of a chemical source or by the energy allowing it act as a guide and have the CRISPR-Cas system or complex function. The invention can involve applying the chemical source or energy so as to have the guide function and the Cas13 CRISPR-Cas system or complex function, and optionally further determining that the expression of the genomic locus is altered.
[0186] There are several different designs of this chemical inducible system: 1. ABI-PYL based system inducible by Abscisic Acid (ABA) (See, e.g., stke.sciencemag.org/cgi/content/abstract/sigtrans; 4/164/rs2), 2. FKBP-FRB based system inducible by rapamycin (or related chemicals based on rapamycin) (See, e.g., www.nature.com/nmeth/journal/v2/n6/full/nmeth763.html), 3. GID1-GAI based system inducible by Gibberellin (GA) (See, e.g., www.nature.com/nchembio/journal/v8/n5/full/nchembio.922.html).
[0187] A chemical inducible system can be an estrogen receptor (ER) based system inducible by 4-hydroxytamoxifen (4OHT) (See, e.g., www.pnas.org/content/104/3/1027.abstract). A mutated ligand-binding domain of the estrogen receptor called ERT2 translocates into the nucleus of cells upon binding of 4-hydroxytamoxifen. In further embodiments of the invention any naturally occurring or engineered derivative of any nuclear receptor, thyroid hormone receptor, retinoic acid receptor, estrogen receptor, estrogen-related receptor, glucocorticoid receptor, progesterone receptor, and androgen receptor may be used in inducible systems analogous to the ER based inducible system.
[0188] Another inducible system is based on the design using Transient receptor potential (TRP) ion channel based system inducible by energy, heat or radio-wave (see, e.g., www.sciencemag.org/content/336/6081/604). These TRP family proteins respond to different stimuli, including light and heat. When this protein is activated by light or heat, the ion channel will open and allow the entering of ions such as calcium into the plasma membrane. This influx of ions will bind to intracellular ion interacting partners linked to a polypeptide including the guide and the other components of the CRISPR-Cas complex or system, and the binding will induce the change of sub-cellular localization of the polypeptide, leading to the entire polypeptide entering the nucleus of cells. Once inside the nucleus, the guide protein and the other components of the CRISPR-Cas complex will be active and modulating target gene expression in cells.
[0189] While light activation may be an advantageous embodiment, sometimes it may be disadvantageous especially for in vivo applications in which the light may not penetrate the skin or other organs. In this instance, other methods of energy activation are contemplated, in particular, electric field energy and/or ultrasound which have a similar effect.
[0190] Electric field energy is preferably administered substantially as described in the art, using one or more electric pulses of from about 1 Volt/cm to about 10 kVolts/cm under in vivo conditions. Instead of or in addition to the pulses, the electric field may be delivered in a continuous manner. The electric pulse may be applied for between 1 s and 500 milliseconds, preferably between 1 s and 100 milliseconds. The electric field may be applied continuously or in a pulsed manner for 5 about minutes.
[0191] As used herein, electric field energy is the electrical energy to which a cell is exposed. Preferably the electric field has a strength of from about 1 Volt/cm to about 10 kVolts/cm or more under in vivo conditions (see WO97/49450).
[0192] As used herein, the term electric field includes one or more pulses at variable capacitance and voltage and including exponential and/or square wave and/or modulated wave and/or modulated square wave forms. References to electric fields and electricity should be taken to include reference the presence of an electric potential difference in the environment of a cell. Such an environment may be set up by way of static electricity, alternating current (AC), direct current (DC), etc., as known in the art. The electric field may be uniform, non-uniform or otherwise, and may vary in strength and/or direction in a time dependent manner.
[0193] Single or multiple applications of electric field, as well as single or multiple applications of ultrasound are also possible, in any order and in any combination. The ultrasound and/or the electric field may be delivered as single or multiple continuous applications, or as pulses (pulsatile delivery).
[0194] Electroporation has been used in both in vitro and in vivo procedures to introduce foreign material into living cells. With in vitro applications, a sample of live cells is first mixed with the agent of interest and placed between electrodes such as parallel plates. Then, the electrodes apply an electrical field to the cell/implant mixture. Examples of systems that perform in vitro electroporation include the Electro Cell Manipulator ECM600 product, and the Electro Square Porator T820, both made by the BTX Division of Genetronics, Inc (see U.S. Pat. No. 5,869,326).
[0195] The known electroporation techniques (both in vitro and in vivo) function by applying a brief high voltage pulse to electrodes positioned around the treatment region. The electric field generated between the electrodes causes the cell membranes to temporarily become porous, whereupon molecules of the agent of interest enter the cells. In known electroporation applications, this electric field comprises a single square wave pulse on the order of 1000 V/cm, of about 100.mu.s duration. Such a pulse may be generated, for example, in known applications of the Electro Square Porator T820.
[0196] Preferably, the electric field has a strength of from about 1 V/cm to about 10 kV/cm under in vitro conditions. Thus, the electric field may have a strength of 1 V/cm, 2 V/cm, 3 V/cm, 4 V/cm, 5 V/cm, 6 V/cm, 7 V/cm, 8 V/cm, 9 V/cm, 10 V/cm, 20 V/cm, 50 V/cm, 100 V/cm, 200 V/cm, 300 V/cm, 400 V/cm, 500 V/cm, 600 V/cm, 700 V/cm, 800 V/cm, 900 V/cm, 1 kV/cm, 2 kV/cm, 5 kV/cm, 10 kV/cm, 20 kV/cm, 50 kV/cm or more. More preferably from about 0.5 kV/cm to about 4.0 kV/cm under in vitro conditions. Preferably the electric field has a strength of from about 1 V/cm to about 10 kV/cm under in vivo conditions. However, the electric field strengths may be lowered where the number of pulses delivered to the target site are increased. Thus, pulsatile delivery of electric fields at lower field strengths is envisaged.
[0197] Preferably the application of the electric field is in the form of multiple pulses such as double pulses of the same strength and capacitance or sequential pulses of varying strength and/or capacitance. As used herein, the term pulse includes one or more electric pulses at variable capacitance and voltage and including exponential and/or square wave and/or modulated wave/square wave forms.
[0198] Preferably the electric pulse is delivered as a waveform selected from an exponential wave form, a square wave form, a modulated wave form and a modulated square wave form.
[0199] A preferred embodiment employs direct current at low voltage. Thus, Applicants disclose the use of an electric field which is applied to the cell, tissue or tissue mass at a field strength of between 1V/cm and 20V/cm, for a period of 100 milliseconds or more, preferably 15 minutes or more.
[0200] Ultrasound is advantageously administered at a power level of from about 0.05 W/cm2 to about 100 W/cm2. Diagnostic or therapeutic ultrasound may be used, or combinations thereof.
[0201] As used herein, the term ultrasound refers to a form of energy which consists of mechanical vibrations the frequencies of which are so high they are above the range of human hearing. Lower frequency limit of the ultrasonic spectrum may generally be taken as about 20 kHz. Most diagnostic applications of ultrasound employ frequencies in the range 1 and 15 MHz (From Ultrasonics in Clinical Diagnosis, P. N. T. Wells, ed., 2nd. Edition, Publ. Churchill Livingstone [Edinburgh, London & NY, 1977]).
[0202] Ultrasound has been used in both diagnostic and therapeutic applications. When used as a diagnostic tool (diagnostic ultrasound), ultrasound is typically used in an energy density range of up to about 100 mW/cm2 (FDA recommendation), although energy densities of up to 750 mW/cm2 have been used. In physiotherapy, ultrasound is typically used as an energy source in a range up to about 3 to 4 W/cm2 (WHO recommendation). In other therapeutic applications, higher intensities of ultrasound may be employed, for example, HIFU at 100 W/cm up to 1 kW/cm2 (or even higher) for short periods of time. The term ultrasound as used in this specification is intended to encompass diagnostic, therapeutic and focused ultrasound.
[0203] Focused ultrasound (FUS) allows thermal energy to be delivered without an invasive probe (See, Morocz et al 1998 Journal of Magnetic Resonance Imaging Vol. 8, No. 1, pp. 136-142. Another form of focused ultrasound is high intensity focused ultrasound (HIFU) which is reviewed by Moussatov et al in Ultrasonics (1998) Vol. 36, No. 8, pp. 893-900 and TranHuuHue et al in Acustica (1997) Vol. 83, No. 6, pp. 1103-1106.
[0204] Preferably, a combination of diagnostic ultrasound and a therapeutic ultrasound is employed. This combination is not intended to be limiting, however, and the skilled reader will appreciate that any variety of combinations of ultrasound may be used. Additionally, the energy density, frequency of ultrasound, and period of exposure may be varied.
[0205] Preferably the exposure to an ultrasound energy source is at a power density of from about 0.05 to about 100 Wcm-2. Even more preferably, the exposure to an ultrasound energy source is at a power density of from about 1 to about 15 Wcm-2.
[0206] Preferably the exposure to an ultrasound energy source is at a frequency of from about 0.015 to about 10.0 MHz. More preferably the exposure to an ultrasound energy source is at a frequency of from about 0.02 to about 5.0 MHz or about 6.0 MHz. Most preferably, the ultrasound is applied at a frequency of 3 MHz.
[0207] Preferably the exposure is for periods of from about 10 milliseconds to about 60 minutes. Preferably the exposure is for periods of from about 1 second to about 5 minutes. More preferably, the ultrasound is applied for about 2 minutes. Depending on the particular target cell to be disrupted, however, the exposure may be for a longer duration, for example, for 15 minutes.
[0208] Advantageously, the target tissue is exposed to an ultrasound energy source at an acoustic power density of from about 0.05 Wcm-2 to about 10 Wcm-2 with a frequency ranging from about 0.015 to about 10 MHz (see WO 98/52609). However, alternatives are also possible, for example, exposure to an ultrasound energy source at an acoustic power density of above 100 Wcm-2, but for reduced periods of time, for example, 1000 Wcm-2 for periods in the millisecond range or less.
[0209] Preferably the application of the ultrasound is in the form of multiple pulses; thus, both continuous wave and pulsed wave (pulsatile delivery of ultrasound) may be employed in any combination. For example, continuous wave ultrasound may be applied, followed by pulsed wave ultrasound, or vice versa. This may be repeated any number of times, in any order and combination. The pulsed wave ultrasound may be applied against a background of continuous wave ultrasound, and any number of pulses may be used in any number of groups.
[0210] Preferably, the ultrasound may comprise pulsed wave ultrasound. In a highly preferred embodiment, the ultrasound is applied at a power density of 0.7 Wcm-2 or 1.25 Wcm-2 as a continuous wave. Higher power densities may be employed if pulsed wave ultrasound is used.
[0211] Use of ultrasound is advantageous as, like light, it may be focused accurately on a target. Moreover, ultrasound is advantageous as it may be focused more deeply into tissues unlike light. It is therefore better suited to whole-tissue penetration (such as but not limited to a lobe of the liver) or whole organ (such as but not limited to the entire liver or an entire muscle, such as the heart) therapy. Another important advantage is that ultrasound is a non-invasive stimulus which is used in a wide variety of diagnostic and therapeutic applications. By way of example, ultrasound is well known in medical imaging techniques and, additionally, in orthopedic therapy. Furthermore, instruments suitable for the application of ultrasound to a subject vertebrate are widely available and their use is well known in the art.
[0212] In particular embodiments, the guide molecule is modified by a secondary structure to increase the specificity of the CRISPR-Cas system and the secondary structure can protect against exonuclease activity and allow for 5 additions to the guide sequence also referred to herein as a protected guide molecule.
[0213] In one aspect, the invention provides for hybridizing a protector RNA to a sequence of the guide molecule, wherein the protector RNA is an RNA strand complementary to the 3 end of the guide molecule to thereby generate a partially double-stranded guide RNA. In an embodiment of the invention, protecting mismatched bases (i.e. the bases of the guide molecule which do not form part of the guide sequence) with a perfectly complementary protector sequence decreases the likelihood of target RNA binding to the mismatched basepairs at the 3 end. In particular embodiments of the invention, additional sequences comprising an extended length may also be present within the guide molecule such that the guide comprises a protector sequence within the guide molecule. This protector sequence ensures that the guide molecule comprises a protected sequence in addition to an exposed sequence (comprising the part of the guide sequence hybridizing to the target sequence). In particular embodiments, the guide molecule is modified by the presence of the protector guide to comprise a secondary structure such as a hairpin. Advantageously there are three or four to thirty or more, e.g., about 10 or more, contiguous base pairs having complementarity to the protected sequence, the guide sequence or both. It is advantageous that the protected portion does not impede thermodynamics of the CRISPR-Cas system interacting with its target. By providing such an extension including a partially double stranded guide molecule, the guide molecule is considered protected and results in improved specific binding of the CRISPR-Cas complex, while maintaining specific activity.
[0214] In particular embodiments, use is made of a truncated guide (tru-guide), i.e. a guide molecule which comprises a guide sequence which is truncated in length with respect to the canonical guide sequence length. As described by Nowak et al. (Nucleic Acids Res (2016) 44 (20): 9555-9564), such guides may allow catalytically active CRISPR-Cas enzyme to bind its target without cleaving the target RNA. In particular embodiments, a truncated guide is used which allows the binding of the target but retains only nickase activity of the CRISPR-Cas enzyme.
[0215] The present invention may be further illustrated and extended based on aspects of CRISPR-Cas development and use as set forth in the following articles and particularly as relates to delivery of a CRISPR protein complex and uses of an RNA guided endonuclease in cells and organisms: [0216] Multiplex genome engineering using CRISPR-Cas systems. Cong, L., Ran, F.A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P.D., Wu, X., Jiang, W., Marraffini, L.A., & Zhang, F. Science February 15; 339(6121):819-23 (2013); [0217] RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Jiang W., Bikard D., Cox D., Zhang F, Marraffini L A. Nat Biotechnol March; 31(3):233-9 (2013); [0218] One-Step Generation of Mice Carrying Mutations in Multiple Genes by CRISPR-Cas-Mediated Genome Engineering. Wang H., Yang H., Shivalila C S., Dawlaty M M., Cheng A W., Zhang F., Jaenisch R. Cell May 9; 153(4):910-8 (2013); [0219] Optical control of mammalian endogenous transcription and epigenetic states. Konermann S, Brigham M D, Trevino A E, Hsu P D, Heidenreich M, Cong L, Platt R J, Scott D A, Church G M, Zhang F. Nature. August 22; 500(7463):472-6. doi: 10.1038/Nature12466. Epub 2013 Aug. 23 (2013); [0220] Double Nicking by RNA-Guided CRISPR Cas9 for Enhanced Genome Editing Specificity. Ran, F A., Hsu, P D., Lin, C Y., Gootenberg, J S., Konermann, S., Trevino, A E., Scott, D A., Inoue, A., Matoba, S., Zhang, Y., & Zhang, F. Cell August 28. pii: S0092-8674(13)01015-5 (2013-A); [0221] DNA targeting specificity of RNA-guided Cas9 nucleases. Hsu, P., Scott, D., Weinstein, J., Ran, F A., Konermann, S., Agarwala, V., Li, Y., Fine, E., Wu, X., Shalem, O., Cradick, T J., Marraffini, L A., Bao, G., & Zhang, F. Nat Biotechnol doi:10.1038/nbt.2647 (2013); [0222] Genome engineering using the CRISPR-Cas9 system. Ran, F A., Hsu, P D., Wright, J., Agarwala, V., Scott, D A., Zhang, F. Nature Protocols November; 8(11):2281-308 (2013-B); [0223] Genome-Scale CRISPR-Cas9 Knockout Screening in Human Cells. Shalem, O., Sanjana, N E., Hartenian, E., Shi, X., Scott, D A., Mikkelson, T., Heckl, D., Ebert, B L., Root, D E., Doench, J G., Zhang, F. Science December 12. (2013); [0224] Crystal structure of cas9 in complex with guide RNA and target DNA. Nishimasu, H., Ran, F A., Hsu, P D., Konermann, S., Shehata, S I., Dohmae, N., Ishitani, R., Zhang, F., Nureki, O. Cell February 27, 156(5):935-49 (2014); [0225] Genome-wide binding of the CRISPR endonuclease Cas9 in mammalian cells. Wu X., Scott D A., Kriz A J., Chiu A C., Hsu P D., Dadon D B., Cheng A W., Trevino A E., Konermann S., Chen S., Jaenisch R., Zhang F., Sharp P A. Nat Biotechnol. April 20. doi: 10.1038/nbt.2889 (2014); [0226] CRISPR-Cas9 Knockin Mice for Genome Editing and Cancer Modeling. Platt R J, Chen S, Zhou Y, Yim M J, Swiech L, Kempton H R, Dahlman J E, Parnas O, EisenhaureT M, Jovanovic M, Graham D B, Jhunjhunwala S, Heidenreich M, Xavier R J, Langer R, Anderson D G, Hacohen N, Regev A, Feng G, Sharp P A, Zhang F. Cell 159(2): 440-455 DOI: 10.1016/j.cell.2014.09.014(2014); [0227] Development and Applications of CRISPR-Cas9 for Genome Engineering, Hsu P D, Lander E S, Zhang F., Cell. June 5; 157(6):1262-78 (2014). [0228] Genetic screens in human cells using the CRISPR-Cas9 system, Wang T, Wei J J, Sabatini D M, Lander E S., Science. January 3; 343(6166): 80-84. doi:10.1126/science.1246981 (2014); [0229] Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation, Doench J G, Hartenian E, Graham D B, Tothova Z, Hegde M, Smith I, Sullender M, Ebert B L, Xavier R J, Root D E., (published online 3 Sep. 2014) Nat Biotechnol. December; 32(12):1262-7 (2014); [0230] In vivo interrogation of gene function in the mammalian brain using CRISPR-Cas9, Swiech L, Heidenreich M, Banerjee A, Habib N, Li Y, Trombetta J, Sur M, Zhang F., (published online 19 Oct. 2014) Nat Biotechnol. January; 33(1):102-6 (2015); [0231] Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex, Konermann S, Brigham M D, Trevino A E, Joung J, Abudayyeh O O, Barcena C, Hsu P D, Habib N, Gootenberg J S, Nishimasu H, Nureki O, Zhang F., Nature. January 29; 517(7536):583-8 (2015). [0232] A split-Cas9 architecture for inducible genome editing and transcription modulation, Zetsche B, Volz S E, Zhang F., (published online 2 Feb. 2015) Nat Biotechnol. February; 33(2):139-42 (2015); [0233] Genome-wide CRISPR Screen in a Mouse Model of Tumor Growth and Metastasis, Chen S, Sanjana N E, Zheng K, Shalem O, Lee K, Shi X, Scott D A, Song J, Pan J Q, Weissleder R, Lee H, Zhang F, Sharp P A. Cell 160, 1246-1260, Mar. 12, 2015 (multiplex screen in mouse), and [0234] In vivo genome editing using Staphylococcus aureus Cas9, Ran F A, Cong L, Yan W X, Scott D A, Gootenberg J S, Kriz A J, Zetsche B, Shalem O, Wu X, Makarova K S, Koonin E V, Sharp P A, Zhang F., (published online 1 Apr. 2015), Nature. April 9; 520(7546):186-91 (2015). [0235] Shalem et al., High-throughput functional genomics using CRISPR-Cas9, Nature Reviews Genetics 16, 299-311 (May 2015). [0236] Xu et al., Sequence determinants of improved CRISPR sgRNA design, Genome Research 25, 1147-1157 (August 2015). [0237] Parnas et al., A Genome-wide CRISPR Screen in Primary Immune Cells to Dissect Regulatory Networks, Cell 162, 675-686 (Jul. 30, 2015). [0238] Ramanan et al., CRISPR-Cas9 cleavage of viral DNA efficiently suppresses hepatitis B virus, Scientific Reports 5:10833. doi: 10.1038/srep10833 (Jun. 2, 2015) [0239] Nishimasu et al., Crystal Structure of Staphylococcus aureus Cas9, Cell 162, 1113-1126 (Aug. 27, 2015) [0240] BCL11A enhancer dissection by Cas9-mediated in situ saturating mutagenesis, Canver et al., Nature 527(7577):192-7 (Nov. 12, 2015) doi: 10.1038/nature15521. Epub 2015 Sep. 16. [0241] Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System, Zetsche et al., Cell 163, 759-71 (Sep. 25, 2015). [0242] Discovery and Functional Characterization of Diverse Class 2 CRISPR-Cas Systems, Shmakov et al., Molecular Cell, 60(3), 385-397 doi: 10.1016/j.molce1.2015.10.008 Epub Oct. 22, 2015. [0243] Rationally engineered Cas9 nucleases with improved specificity, Slaymaker et al., Science 2016 Jan. 1 351(6268): 84-88 doi: 10.1126/science.aad5227. Epub 2015 Dec. 1. [0244] Gao et al, Engineered Cpf1 Enzymes with Altered PAM Specificities, bioRxiv 091611; doi: dx.doi.org/10.1101/091611 (Dec. 4, 2016).
[0245] each of which is incorporated herein by reference, may be considered in the practice of the instant invention, and discussed briefly below: [0246] Cong et al. engineered type II CRISPR-Cas systems for use in eukaryotic cells based on both Streptococcus thermophilus Cas9 and also Streptococcus pyogenes Cas9 and demonstrated that Cas9 nucleases can be directed by short RNAs to induce precise cleavage of DNA in human and mouse cells. Their study further showed that Cas9 as converted into a nicking enzyme can be used to facilitate homology-directed repair in eukaryotic cells with minimal mutagenic activity. Additionally, their study demonstrated that multiple guide sequences can be encoded into a single CRISPR array to enable simultaneous editing of several at endogenous genomic loci sites within the mammalian genome, demonstrating easy programmability and wide applicability of the RNA-guided nuclease technology. This ability to use RNA to program sequence specific DNA cleavage in cells defined a new class of genome engineering tools. These studies further showed that other CRISPR loci are likely to be transplantable into mammalian cells and can also mediate mammalian genome cleavage. Importantly, it can be envisaged that several aspects of the CRISPR-Cas system can be further improved to increase its efficiency and versatility. [0247] Jiang et al. used the clustered, regularly interspaced, short palindromic repeats (CRISPR)-associated Cas9 endonuclease complexed with dual-RNAs to introduce precise mutations in the genomes of Streptococcus pneumoniae and Escherichia coli. The approach relied on dual-RNA:Cas9-directed cleavage at the targeted genomic site to kill unmutated cells and circumvents the need for selectable markers or counter-selection systems. The study reported reprogramming dual-RNA:Cas9 specificity by changing the sequence of short CRISPR RNA (crRNA) to make single- and multinucleotide changes carried on editing templates. The study showed that simultaneous use of two crRNAs enabled multiplex mutagenesis. Furthermore, when the approach was used in combination with recombineering, in S. pneumoniae, nearly 100% of cells that were recovered using the described approach contained the desired mutation, and in E. coli, 65% that were recovered contained the mutation. [0248] Wang et al. (2013) used the CRISPR-Cas system for the one-step generation of mice carrying mutations in multiple genes which were traditionally generated in multiple steps by sequential recombination in embryonic stem cells and/or time-consuming intercrossing of mice with a single mutation. The CRISPR-Cas system will greatly accelerate the in vivo study of functionally redundant genes and of epistatic gene interactions. [0249] Konermann et al. (2013) addressed the need in the art for versatile and robust technologies that enable optical and chemical modulation of DNA-binding domains based CRISPR Cas9 enzyme and also Transcriptional Activator Like Effectors [0250] Ran et al. (2013-A) described an approach that combined a Cas9 nickase mutant with paired guide RNAs to introduce targeted double-strand breaks. This addresses the issue of the Cas9 nuclease from the microbial CRISPR-Cas system being targeted to specific genomic loci by a guide sequence, which can tolerate certain mismatches to the DNA target and thereby promote undesired off-target mutagenesis. Because individual nicks in the genome are repaired with high fidelity, simultaneous nicking via appropriately offset guide RNAs is required for double-stranded breaks and extends the number of specifically recognized bases for target cleavage. The authors demonstrated that using paired nicking can reduce off-target activity by 50- to 1,500-fold in cell lines and to facilitate gene knockout in mouse zygotes without sacrificing on-target cleavage efficiency. This versatile strategy enables a wide variety of genome editing applications that require high specificity. [0251] Hsu et al. (2013) characterized SpCas9 targeting specificity in human cells to inform the selection of target sites and avoid off-target effects. The study evaluated >700 guide RNA variants and SpCas9-induced indel mutation levels at >100 predicted genomic off-target loci in 293T and 293FT cells. The authors that SpCas9 tolerates mismatches between guide RNA and target DNA at different positions in a sequence-dependent manner, sensitive to the number, position and distribution of mismatches. The authors further showed that SpCas9-mediated cleavage is unaffected by DNA methylation and that the dosage of SpCas9 and guide RNA can be titrated to minimize off-target modification. Additionally, to facilitate mammalian genome engineering applications, the authors reported providing a web-based software tool to guide the selection and validation of target sequences as well as off-target analyses. [0252] Ran et al. (2013-B) described a set of tools for Cas9-mediated genome editing via non-homologous end joining (NHEJ) or homology-directed repair (HDR) in mammalian cells, as well as generation of modified cell lines for downstream functional studies. To minimize off-target cleavage, the authors further described a double-nicking strategy using the Cas9 nickase mutant with paired guide RNAs. The protocol provided by the authors experimentally derived guidelines for the selection of target sites, evaluation of cleavage efficiency and analysis of off-target activity. The studies showed that beginning with target design, gene modifications can be achieved within as little as 1-2 weeks, and modified clonal cell lines can be derived within 2-3 weeks. [0253] Shalem et al. described a new way to interrogate gene function on a genome-wide scale. Their studies showed that delivery of a genome-scale CRISPR-Cas9 knockout (GeCKO) library targeted 18,080 genes with 64,751 unique guide sequences enabled both negative and positive selection screening in human cells. First, the authors showed use of the GeCKO library to identify genes essential for cell viability in cancer and pluripotent stem cells. Next, in a melanoma model, the authors screened for genes whose loss is involved in resistance to vemurafenib, a therapeutic that inhibits mutant protein kinase BRAF. Their studies showed that the highest-ranking candidates included previously validated genes NF1 and MED12 as well as novel hits NF2, CUL3, TADA2B, and TADA1. The authors observed a high level of consistency between independent guide RNAs targeting the same gene and a high rate of hit confirmation, and thus demonstrated the promise of genome-scale screening with Cas9. [0254] Nishimasu et al. reported the crystal structure of Streptococcus pyogenes Cas9 in complex with sgRNA and its target DNA at 2.5 A resolution. The structure revealed a bilobed architecture composed of target recognition and nuclease lobes, accommodating the sgRNA:DNA heteroduplex in a positively charged groove at their interface. Whereas the recognition lobe is essential for binding sgRNA and DNA, the nuclease lobe contains the HNH and RuvC nuclease domains, which are properly positioned for cleavage of the complementary and non-complementary strands of the target DNA, respectively. The nuclease lobe also contains a carboxyl-terminal domain responsible for the interaction with the protospacer adjacent motif (PAM). This high-resolution structure and accompanying functional analyses have revealed the molecular mechanism of RNA-guided DNA targeting by Cas9, thus paving the way for the rational design of new, versatile genome-editing technologies. [0255] Wu et al. mapped genome-wide binding sites of a catalytically inactive Cas9 (dCas9) from Streptococcus pyogenes loaded with single guide RNAs (sgRNAs) in mouse embryonic stem cells (mESCs). The authors showed that each of the four sgRNAs tested targets dCas9 to between tens and thousands of genomic sites, frequently characterized by a 5-nucleotide seed region in the sgRNA and an NGG protospacer adjacent motif (PAM). Chromatin inaccessibility decreases dCas9 binding to other sites with matching seed sequences; thus 70% of off-target sites are associated with genes. The authors showed that targeted sequencing of 295 dCas9 binding sites in mESCs transfected with catalytically active Cas9 identified only one site mutated above background levels. The authors proposed a two-state model for Cas9 binding and cleavage, in which a seed match triggers binding but extensive pairing with target DNA is required for cleavage. [0256] Platt et al. established a Cre-dependent Cas9 knockin mouse. The authors demonstrated in vivo as well as ex vivo genome editing using adeno-associated virus (AAV)-, lentivirus-, or particle-mediated delivery of guide RNA in neurons, immune cells, and endothelial cells. [0257] Hsu et al. (2014) is a review article that discusses generally CRISPR-Cas9 history from yogurt to genome editing, including genetic screening of cells. [0258] Wang et al. (2014) relates to a pooled, loss-of-function genetic screening approach suitable for both positive and negative selection that uses a genome-scale lentiviral single guide RNA (sgRNA) library. [0259] Doench et al. created a pool of sgRNAs, tiling across all possible target sites of a panel of six endogenous mouse and three endogenous human genes and quantitatively assessed their ability to produce null alleles of their target gene by antibody staining and flow cytometry. The authors showed that optimization of the PAM improved activity and also provided an on-line tool for designing sgRNAs. [0260] Swiech et al. demonstrate that AAV-mediated SpCas9 genome editing can enable reverse genetic studies of gene function in the brain. [0261] Konermann et al. (2015) discusses the ability to attach multiple effector domains, e.g., transcriptional activator, functional and epigenomic regulators at appropriate positions on the guide such as stem or tetraloop with and without linkers. [0262] Zetsche et al. demonstrates that the Cas9 enzyme can be split into two and hence the assembly of Cas9 for activation can be controlled. [0263] Chen et al. relates to multiplex screening by demonstrating that a genome-wide in vivo CRISPR-Cas9 screen in mice reveals genes regulating lung metastasis. [0264] Ran et al. (2015) relates to SaCas9 and its ability to edit genomes and demonstrates that one cannot extrapolate from biochemical assays. [0265] Shalem et al. (2015) described ways in which catalytically inactive Cas9 (dCas9) fusions are used to synthetically repress (CRISPRi) or activate (CRISPRa) expression, showing. advances using Cas9 for genome-scale screens, including arrayed and pooled screens, knockout approaches that inactivate genomic loci and strategies that modulate transcriptional activity. [0266] Xu et al. (2015) assessed the DNA sequence features that contribute to single guide RNA (sgRNA) efficiency in CRISPR-based screens. The authors explored efficiency of CRISPR-Cas9 knockout and nucleotide preference at the cleavage site. The authors also found that the sequence preference for CRISPRi/a is substantially different from that for CRISPR-Cas9 knockout. [0267] Parnas et al. (2015) introduced genome-wide pooled CRISPR-Cas9 libraries into dendritic cells (DCs) to identify genes that control the induction of tumor necrosis factor (Tnf) by bacterial lipopolysaccharide (LPS). Known regulators of Tlr4 signaling and previously unknown candidates were identified and classified into three functional modules with distinct effects on the canonical responses to LPS. [0268] Ramanan et al (2015) demonstrated cleavage of viral episomal DNA (cccDNA) in infected cells. The HBV genome exists in the nuclei of infected hepatocytes as a 3.2 kb double-stranded episomal DNA species called covalently closed circular DNA (cccDNA), which is a key component in the HBV life cycle whose replication is not inhibited by current therapies. The authors showed that sgRNAs specifically targeting highly conserved regions of HBV robustly suppresses viral replication and depleted cccDNA. [0269] Nishimasu et al. (2015) reported the crystal structures of SaCas9 in complex with a single guide RNA (sgRNA) and its double-stranded DNA targets, containing the 5-TTGAAT-3 PAM and the 5-TTGGGT-3 PAM. A structural comparison of SaCas9 with SpCas9 highlighted both structural conservation and divergence, explaining their distinct PAM specificities and orthologous sgRNA recognition. [0270] Canver et al. (2015) demonstrated a CRISPR-Cas9-based functional investigation of non-coding genomic elements. The authors developed pooled CRISPR-Cas9 guide RNA libraries to perform in situ saturating mutagenesis of the human and mouse BCL11A enhancers which revealed critical features of the enhancers. [0271] Zetsche et al. (2015) reported characterization of Cpf1, a class 2 CRISPR nuclease from Francisella novicida U112 having features distinct from Cas9. Cpf1 is a single RNA-guided endonuclease lacking tracrRNA, utilizes a T-rich protospacer-adjacent motif, and cleaves DNA via a staggered DNA double-stranded break. [0272] Shmakov et al. (2015) reported three distinct Class 2 CRISPR-Cas systems. Two system CRISPR enzymes (C2c1 and C2c3) contain RuvC-like endonuclease domains distantly related to Cpf1. Unlike Cpf1, C2c1 depends on both crRNA and tracrRNA for DNA cleavage. The third enzyme (C2c2) contains two predicted HEPN RNase domains and is tracrRNA independent. [0273] Slaymaker et al (2016) reported the use of structure-guided protein engineering to improve the specificity of Streptococcus pyogenes Cas9 (SpCas9). The authors developed enhanced specificity SpCas9 (eSpCas9) variants which maintained robust on-target cleavage with reduced off-target effects.
[0274] In particular embodiments, such methods for identifying novel CRISPR effector proteins may comprise the steps of selecting sequences from the database encoding a seed which identifies the presence of a CRISPR Cas locus, identifying loci located within 10 kb of the seed comprising Open Reading Frames (ORFs) in the selected sequences, selecting therefrom loci comprising ORFs of which only a single ORF encodes a novel CRISPR effector having greater than 700 amino acids and no more than 90% homology to a known CRISPR effector. In particular embodiments, the seed is a protein that is common to the CRISPR-Cas system, such as Cas1. In further embodiments, the CRISPR array is used as a seed to identify new effector proteins.
[0275] Also, Dimeric CRISPR RNA-guided Fok1 nucleases for highly specific genome editing, Shengdar Q. Tsai, Nicolas Wyvekens, Cyd Khayter, Jennifer A. Foden, Vishal Thapar, Deepak Reyon, Mathew J. Goodwin, Martin J. Aryee, J. Keith Joung Nature Biotechnology 32(6): 569-77 (2014), relates to dimeric RNA-guided FokI Nucleases that recognize extended sequences and can edit endogenous genes with high efficiencies in human cells.
[0276] With respect to general information on CRISPR/Cas Systems, components thereof, and delivery of such components, including methods, materials, delivery vehicles, vectors, particles, and making and using thereof, including as to amounts and formulations, as well as CRISPR-Cas-expressing eukaryotic cells, CRISPR-Cas expressing eukaryotes, such as a mouse, reference is made to: U.S. Pat. Nos. 8,999,641, 8,993,233, 8,697,359, 8,771,945, 8,795,965, 8,865,406, 8,871,445, 8,889,356, 8,889,418, 8,895,308, 8,906,616, 8,932,814, and 8,945,839; US Patent Publications US 2014-0310830 (U.S. application Ser. No. 14/105,031), US 2014-0287938 A1 (U.S. application Ser. No. 14/213,991), US 2014-0273234 A1 (U.S. application Ser. No. 14/293,674), US2014-0273232 A1 (U.S. application Ser. No. 14/290,575), US 2014-027323 A1 (U.S. application Ser. No. 14/259,420), US 2014-0256046 A1 (U.S. application Ser. No. 14/226,274), US 2014-0248702 A1 (U.S. application Ser. No. 14/258,458), US 2014-0242700 A1 (U.S. application Ser. No. 14/222,930), US 2014-0242699 A1 (U.S. application Ser. No. 14/183,512), US 2014-0242664 A1 (U.S. application Ser. No. 14/104,990), US 2014-0234972 A1 (U.S. application Ser. No. 14/183,471), US 2014-0227787 A1 (U.S. application Ser. No. 14/256,912), US 2014-0189896 A1 (U.S. application Ser. No. 14/105,035), US 2014-0186958 (U.S. application Ser. No. 14/105,017), US 2014-0186919 A1 (U.S. application Ser. No. 14/104,977), US 2014-0186843 A1 (U.S. application Ser. No. 14/104,900), US 2014-0179770 A1 (U.S. application Ser. No. 14/104,837) and US 2014-0179006 A1 (U.S. application Ser. No. 14/183,486), US 2014-0170753 (U.S. application Ser. No. 14/183,429); US 2015-0184139 A1 (U.S. application Ser. No. 14/324,960); Ser. No. 14/054,414 European Patent Applications EP 2 771 468 (EP13818570.7), EP 2 764 103 (EP13824232.6), and EP 2 784 162 (EP14170383.5); and PCT Patent Publications WO2014/093661 (PCT/US2013/074743), WO2014/093694 (PCT/US2013/074790), WO2014/093595 (PCT/US2013/074611), WO2014/093718 (PCT/US2013/074825), WO2014/093709 (PCT/US2013/074812), WO2014/093622 (PCT/US2013/074667), WO2014/093635 (PCT/US2013/074691), WO2014/093655 (PCT/US2013/074736), WO2014/093712 (PCT/US2013/074819), WO2014/093701 (PCT/US2013/074800), WO2014/018423 (PCT/US2013/051418), WO2014/204723 (PCT/US2014/041790), WO2014/204724 (PCT/US2014/041800), WO2014/204725 (PCT/US2014/041803), WO2014/204726 (PCT/US2014/041804), WO2014/204727 (PCT/US2014/041806), WO2014/204728 (PCT/US2014/041808), WO2014/204729 (PCT/US2014/041809), WO2015/089351 (PCT/US2014/069897), WO2015/089354 (PCT/US2014/069902), WO2015/089364 (PCT/US2014/069925), WO2015/089427 (PCT/US2014/070068), WO2015/089462 (PCT/US2014/070127), WO2015/089419 (PCT/US2014/070057), WO2015/089465 (PCT/US2014/070135), WO2015/089486 (PCT/US2014/070175), WO2015/058052 (PCT/US2014/061077), WO2015/070083 (PCT/US2014/064663), WO2015/089354 (PCT/US2014/069902), WO2015/089351 (PCT/US2014/069897), WO2015/089364 (PCT/US2014/069925), WO2015/089427 (PCT/US2014/070068), WO2015/089473 (PCT/US2014/070152), WO2015/089486 (PCT/US2014/070175), WO2016/049258 (PCT/US2015/051830), WO2016/094867 (PCT/US2015/065385), WO2016/094872 (PCT/US2015/065393), WO2016/094874 (PCT/US2015/065396), WO2016/106244 (PCT/US2015/067177).
[0277] Mention is also made of U.S. Provisional Application No. 62/180,709, filed 17 Jun. 2015, PROTECTED GUIDE RNAS (PGRNAS); U.S. Provisional Application No. 62/091,455, filed 12 Dec. 2014, PROTECTED GUIDE RNAS (PGRNAS); U.S. application 62/096,708, 24 Dec. 2014, PROTECTED GUIDE RNAS (PGRNAS); US Provisional Application Nos. 62/091,462, filed 12 Dec. 2014, 62/096,324, filed 23 Dec. 2014, 62/180,681, filed 17 Jun. 2015, and 62/237,496, filed 5 Oct. 2015, DEAD GUIDES FOR CRISPR TRANSCRIPTION FACTORS; US Provisional Application Nos. 62/091,456, filed 12 Dec. 2014 and 62/180,692, filed 17 Jun. 2015, ESCORTED AND FUNCTIONALIZED GUIDES FOR CRISPR-CAS SYSTEMS; U.S. Provisional Application No. 62/091,461, filed 12 Dec. 2014, DELIVERY, USE AND THERAPEUTIC APPLICATIONS OF THE CRISPR-CAS SYSTEMS AND COMPOSITIONS FOR GENOME EDITING AS TO HEMATOPOETIC STEM CELLS (HSCs); U.S. Provisional Application No. 62/094,903, filed 19 Dec. 2014, UNBIASED IDENTIFICATION OF DOUBLE-STRAND BREAKS AND GENOMIC REARRANGEMENT BY GENOME-WISE INSERT CAPTURE SEQUENCING; U.S. Provisional Application No. 62/096,761, filed 24 Dec. 2014, ENGINEERING OF SYSTEMS, METHODS AND OPTIMIZED ENZYME AND GUIDE SCAFFOLDS FOR SEQUENCE MANIPULATION; US Provisional Application Nos. 62/098,059, filed 30 Dec. 2014, 62/181,641, filed 18 Jun. 2015, and 62/181,667, filed 18 Jun. 2015, RNA-TARGETING SYSTEM; US Provisional Application Nos. 62/096,656, filed 24 Dec. 2014 and 62/181,151, filed 17 Jun. 2015, CRISPR HAVING OR ASSOCIATED WITH DESTABILIZATION DOMAINS; U.S. Provisional Application No. 62/096,697, filed 24 Dec. 2014, CRISPR HAVING OR ASSOCIATED WITH AAV; U.S. Provisional Application No. 62/098,158, filed 30 Dec. 2014, ENGINEERED CRISPR COMPLEX INSERTIONAL TARGETING SYSTEMS; U.S. Provisional Application No. 62/151,052, filed 22 Apr. 2015, CELLULAR TARGETING FOR EXTRACELLULAR EXOSOMAL REPORTING; U.S. Provisional Application No. 62/054,490, filed 24 Sep. 2014, DELIVERY, USE AND THERAPEUTIC APPLICATIONS OF THE CRISPR-CAS SYSTEMS AND COMPOSITIONS FOR TARGETING DISORDERS AND DISEASES USING PARTICLE DELIVERY COMPONENTS; U.S. Provisional Application No. 61/939,154, 12 Feb. 2014, SYSTEMS, METHODS AND COMPOSITIONS FOR SEQUENCE MANIPULATION WITH OPTIMIZED FUNCTIONAL CRISPR-CAS SYSTEMS; U.S. Provisional Application No. 62/055,484, filed 25 Sep. 2014, SYSTEMS, METHODS AND COMPOSITIONS FOR SEQUENCE MANIPULATION WITH OPTIMIZED FUNCTIONAL CRISPR-CAS SYSTEMS; U.S. Provisional Application No. 62/087,537, filed 4 Dec. 2014, SYSTEMS, METHODS AND COMPOSITIONS FOR SEQUENCE MANIPULATION WITH OPTIMIZED FUNCTIONAL CRISPR-CAS SYSTEMS; U.S. Provisional Application No. 62/054,651, filed 24 Sep. 2014, DELIVERY, USE AND THERAPEUTIC APPLICATIONS OF THE CRISPR-CAS SYSTEMS AND COMPOSITIONS FOR MODELING COMPETITION OF MULTIPLE CANCER MUTATIONS IN VIVO; U.S. Provisional Application No. 62/067,886, filed 23 Oct. 2014, DELIVERY, USE AND THERAPEUTIC APPLICATIONS OF THE CRISPR-CAS SYSTEMS AND COMPOSITIONS FOR MODELING COMPETITION OF MULTIPLE CANCER MUTATIONS IN VIVO; US Provisional Application Nos. 62/054,675, filed 24 Sep. 2014 and 62/181,002, filed 17 Jun. 2015, DELIVERY, USE AND THERAPEUTIC APPLICATIONS OF THE CRISPR-CAS SYSTEMS AND COMPOSITIONS IN NEURONAL CELLS/TISSUES; U.S. Provisional Application No. 62/054,528, filed 24 Sep. 2014, DELIVERY, USE AND THERAPEUTIC APPLICATIONS OF THE CRISPR-CAS SYSTEMS AND COMPOSITIONS IN IMMUNE DISEASES OR DISORDERS; U.S. Provisional Application No. 62/055,454, filed 25 Sep. 2014, DELIVERY, USE AND THERAPEUTIC APPLICATIONS OF THE CRISPR-CAS SYSTEMS AND COMPOSITIONS FOR TARGETING DISORDERS AND DISEASES USING CELL PENETRATION PEPTIDES (CPP); U.S. Provisional Application No. 62/055,460, filed 25 Sep. 2014, MULTIFUNCTIONAL-CRISPR COMPLEXES AND/OR OPTIMIZED ENZYME LINKED FUNCTIONAL-CRISPR COMPLEXES; US Provisional Application Nos. 62/087,475, filed 4 Dec. 2014 and 62/181,690, filed 18 Jun. 2015, FUNCTIONAL SCREENING WITH OPTIMIZED FUNCTIONAL CRISPR-CAS SYSTEMS; U.S. Provisional Application No. 62/055,487, filed 25 Sep. 2014, FUNCTIONAL SCREENING WITH OPTIMIZED FUNCTIONAL CRISPR-CAS SYSTEMS; US Provisional Application Nos. 62/087,546, filed 4 Dec. 2014 and 62/181,687, filed 18 Jun. 2015, MULTIFUNCTIONAL CRISPR COMPLEXES AND/OR OPTIMIZED ENZYME LINKED FUNCTIONAL-CRISPR COMPLEXES; and U.S. Provisional Application No. 62/098,285, filed 30 Dec. 2014, CRISPR MEDIATED IN VIVO MODELING AND GENETIC SCREENING OF TUMOR GROWTH AND METASTASIS.
[0278] Mention is made of US Provisional Application Nos. 62/181,659, filed 18 Jun. 2015 and 62/207,318, filed 19 Aug. 2015, ENGINEERING AND OPTIMIZATION OF SYSTEMS, METHODS, ENZYME AND GUIDE SCAFFOLDS OF CAS9 ORTHOLOGS AND VARIANTS FOR SEQUENCE MANIPULATION. Mention is made of U.S. Provisional Application No. 62/181,663, filed 18 Jun. 2015 and 62/245,264, filed 22 Oct. 2015, NOVEL CRISPR ENZYMES AND SYSTEMS, US Provisional Application Nos. 62/181,675, filed 18 Jun. 2015, 62/285,349, filed 22 Oct. 2015, 62/296,522, filed 17 Feb. 2016, and 62/320,231, filed 8 Apr. 2016, NOVEL CRISPR ENZYMES AND SYSTEMS, U.S. Provisional Application No. 62/232,067, filed 24 Sep. 2015, U.S. application Ser. No. 14/975,085, filed 18 Dec. 2015, European application No. 16150428.7, U.S. Provisional Application No. 62/205,733, filed 16 Aug. 2015, U.S. Provisional Application No. 62/201,542, filed 5 Aug. 2015, U.S. Provisional Application No. 62/193,507, filed 16 Jul. 2015, and U.S. Provisional Application No. 62/181,739, filed 18 Jun. 2015, each entitled NOVEL CRISPR ENZYMES AND SYSTEMS and of U.S. Provisional Application No. 62/245,270, filed 22 Oct. 2015, NOVEL CRISPR ENZYMES AND SYSTEMS. Mention is also made of U.S. Provisional Application No. 61/939,256, filed 12 Feb. 2014, and International Application No. WO 2015/089473 (PCT/US2014/070152), filed 12 Dec. 2014, each entitled ENGINEERING OF SYSTEMS, METHODS AND OPTIMIZED GUIDE COMPOSITIONS WITH NEW ARCHITECTURES FOR SEQUENCE MANIPULATION. Mention is also made of International Application No. PCT/US2015/045504, filed 15 Aug. 2015, U.S. Provisional Application No. 62/180,699, filed 17 Jun. 2015, and U.S. Provisional Application No. 62/038,358, filed 17 Aug. 2014, each entitled GENOME EDITING USING CAS9 NICKASES.
[0279] The embodiment disclosed herein may be used to screen a wide array of CRISPR-systems. In certain example embodiments, the Cas protein is Cas9 or an ortholog thereof, an engineered Cas9, Cpf1 ortholog thereof, an engineered Cpf1, a naturally occurring or engineered single strand or double strand nickase. In certain example embodiments, the Cas protein is a Cpf1 variant with altered PAM specificities such as those disclosed in Gao et al. Nature Biotechnology, 2017. 35(8):789-792.
CRISPR Evolution
[0280] An extension of the embodiment disclosed herein, is CRISPR evolution of new Cas variants. For example, once a set of inhibitors is identified a given CRISPR system may be expressed in a prokaryotic cell in growth media containing said inhibitors. Screening of the CRISPR system, for example by sequencing, may be used to assess for development of new CRISPR variants that evolve in the presence of the inhibitors.
Surveyor Nuclease Assay
[0281] In various embodiments, SURVEYOR nuclease assay is used to assess genome modification (see e.g., US20150356239, which is herein incorporated by reference in its entirety. In one protocol, 293FT cells are transfected with plasmid DNA. Cells were incubated at 37 C. for 72 hours post-transfection prior to genomic DNA extraction. Genomic DNA is extracted using the QuickExtract DNA Extraction Solution (Epicentre) following the manufacturer's protocol. Briefly, pelleted cells are resuspended in QuickExtract solution and incubated at 65 C. for 15 minutes and 98 C. for 10 minutes.
The genomic region flanking the CR1SPR target site for each gene is PCR amplified, and products are purified using QiaQuick Spin Column (Qiagen) following the manufacturer's protocol. 400 ng total of the purified PCR products are mixed with 2 l 10 Taq DNA Polymerase PCR buffer (Enzytrsaties) and ultrapure water to a final volume of 20 l, and subjected to a re-annealing process to enable heteroduplex formation: 95 C. for 10 min, 95 C. to 85 C. ramping at 2 C./s, 85 C. to 25 C. at 0.25 C./s, and 25 C. hold for 1 minute. After re-annealing, products are treated with SURVEYOR nuclease and SURVEYOR enhancer S (Transgenomics) following the manufacturer's recommended protocol, and analyzed on 4-20% Novex TBE poly-acrylamide gels (Life Technologies). Gels re stained with SYBR Gold DNA stain (Life Technologies) for 30 minutes and imaged with a Gel Doe gel imaging system (Bio-rad). Quantification is based on relative band intensities.
Base Editing
[0282] The compositions and methods herein may be used for regulating the activity of a base editing system. In general, a base editing system may comprise a deaminase (e.g., an adenosine deaminase or cytidine deaminase) fused with a Cas protein. The Cas protein may be a dead Cas protein or a Cas nickase protein. In certain examples, the system comprises a mutated form of an adenosine deaminase fused with a dead CRISPR-Cas or CRISPR-Cas nickase. The mutated form of the adenosine deaminase may have both adenosine deaminase and cytidine deaminase activities. The compositions and methods may
[0283] In one aspect, the present disclosure provides an engineered adenosine deaminase. The engineered adenosine deaminase may comprise one or more mutations herein. In some embodiments, the engineered adenosine deaminase has cytidine deaminase activity. In certain examples, the engineered adenosine deaminase has both cytidine deaminase activity and adenosine deaminase. In some cases, the modifications by base editors herein may be used for targeting post-translational signaling or catalysis. In some embodiments, compositions herein comprise nucleotide sequence comprising encoding sequences for one or more components of a base editing system. A base-editing system may comprise a deaminase (e.g., an adenosine deaminase or cytidine deaminase) fused with a Cas protein or a variant thereof. In certain examples, the system comprises a mutated form of an adenosine deaminase fused with a dead CRISPR-Cas or CRISPR-Cas nickase. The mutated form of the adenosine deaminase may have both adenosine deaminase and cytidine deaminase activities. Examples of base editing systems include those described in WO2019071048, WO2019084063, WO2019126716, WO2019126709, WO2019126762, WO2019126774, Cox D B T, et al., RNA editing with CRISPR-Cas13, Science. 2017 Nov. 24; 358(6366):1019-1027; Abudayyeh 00, et al., A cytosine deaminase for programmable single-base RNA editing, Science 26 Jul. 2019: Vol. 365, Issue 6451, pp. 382-386; Gaudelli N M et al., Programmable base editing of A.Math.T to G.Math.C in genomic DNA without DNA cleavage, Nature volume 551, pages 464-471 (23 Nov. 2017); Komor A C, et al., Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage. Nature. 2016 May 19; 533(7603):420-4.
Methods of Screening Compounds
[0284] In another aspect, the present disclosure provides a method for screening inhibitors of a CRISPR-Cas system. The methods of screening may be used in combination with other methods (e.g., methods of regulating activities of CRISPR-Cas systems described herein). In general, the method may comprise one or more of: incubating a set of candidate inhibitors with components of a CRISPR-Cas system, selecting one or more putative inhibitors (e.g., based on a preliminary screen), validating the putative inhibitors (e.g., using cell-based assays), and selecting one or more final inhibitors based on the validation.
Preliminary Screen
[0285] In certain example embodiments, the method may comprise a preliminary screen. The preliminary screen comprises incubating a set of candidate inhibitors in individual discrete volumes. Each individual discrete volume may comprise a different candidate inhibitor, different combination of candidate inhibitors, and/or different concentrations thereof. Each individual volume may further comprise a Cas protein to be screened, a guide molecule, and a labeled PAM-rich target oligonucleotide. The guide molecule targets binding of the CRISPR-Cas effector protein to the labeled PAM-rich target oligonucleotide. The assay may be conducted in a cellular, acellular, or cell-free environment. The Cas protein and guide molecule may be delivered as a ribonucleoprotein complex, or may delivered to the individual discrete volumes as an inducible construct. The Cas protein and guide molecule may be on the same or different guide constructs. In certain example embodiments, the Cas protein may be delivered directly to the individual discrete volumes and the guide molecule may delivered as a construct. The Cas protein and guide molecule to be screened may be any combination of Cas protein and guide molecule described above.
High-Throughput Screening
[0286] In some embodiments, the method may comprise incubating a set of candidate inhibitors in individual discrete volumes. The embodiments disclosed herein are designed to allow for screening multiple inhibitor in a high throughput manner. Accordingly, for both the preliminary screen and the cell-based screens multiple individual inhibitors, combinations of inhibitors, and/or different concentrations thereof may screen in individual discrete volumes.
Discrete Volumes
[0287] An individual discrete volume may be a discrete volume or discrete space, such as a container, receptacle, or other defined volume or space that can be defined by properties that prevent and/or inhibit migration of nucleic acids and reagents necessary to carry out the methods disclosed herein, for example a volume or space defined by physical properties such as walls, for example the walls of a well, tube, or a surface of a droplet, which may be impermeable or semipermeable, or as defined by other means such as chemical, diffusion rate limited, electro-magnetic, or light illumination, or any combination thereof. By diffusion rate limited (for example diffusion defined volumes) is meant spaces that are only accessible to certain molecules or reactions because diffusion constraints effectively defining a space or volume as would be the case for two parallel laminar streams where diffusion will limit the migration of a target molecule from one stream to the other. By chemical defined volume or space is meant spaces where only certain target molecules can exist because of their chemical or molecular properties, such as size, where for example gel beads may exclude certain species from entering the beads but not others, such as by surface charge, matrix size or other physical property of the bead that can allow selection of species that may enter the interior of the bead. By electro-magnetically defined volume or space is meant spaces where the electro-magnetic properties of the target molecules or their supports such as charge or magnetic properties can be used to define certain regions in a space such as capturing magnetic particles within a magnetic field or directly on magnets. By optically defined volume is meant any region of space that may be defined by illuminating it with visible, ultraviolet, infrared, or other wavelengths of light such that only target molecules within the defined space or volume may be labeled. One advantage to the used of non-walled, or semipermeable is that some reagents, such as buffers, chemical activators, or other agents maybe passed in through the discrete volume, while other material, such as target molecules, maybe maintained in the discrete volume or space.
[0288] Typically, a discrete volume may include a fluid medium, (for example, an aqueous solution, an oil, a buffer, and/or a media capable of supporting cell growth) suitable for labeling of the target molecule with the indexable nucleic acid identifier under conditions that permit labeling. Exemplary discrete volumes or spaces useful in the disclosed methods include droplets (for example, microfluidic droplets and/or emulsion droplets), hydrogel beads or other polymer structures (for example poly-ethylene glycol di-acrylate beads or agarose beads), tissue slides (for example, fixed formalin paraffin embedded tissue slides with particular regions, volumes, or spaces defined by chemical, optical, or physical means), microscope slides with regions defined by depositing reagents in ordered arrays or random patterns, tubes (such as, centrifuge tubes, microcentrifuge tubes, test tubes, cuvettes, conical tubes, and the like), bottles (such as glass bottles, plastic bottles, ceramic bottles, Erlenmeyer flasks, scintillation vials and the like), wells (such as wells in a plate), plates, pipettes, or pipette tips among others. In certain example embodiments, the individual discrete volumes are the wells of a microplate. In certain example embodiments, the microplate is a 96 well, a 384 well, or a 1536 well microplate. In certain examples, the individual discrete volumes are droplets. In certain examples, the individual discrete volumes are wells of a multi-well plate.
Selection of Putative Inhibitors
[0289] The method may further comprise selecting one or more putative inhibitors from the set of candidate inhibitors. In some examples, the selection of the putative inhibitors may be performed by measuring the effect of an inhibitor on the interaction between the Cas protein and the guide sequence, and/or the interaction between the Cas protein and the PAM-rich target oligonucleotide. For example, the putative inhibitors may be selected at least in part by detecting change in fluorescence polarization of the labeled PAM-rich target oligonucleotide, where inhibition of formation of a complex of the CRISPR-Cas and the guide molecule by the one or more of the candidate inhibitors leads to a decrease in fluorescence polarization of the labeled PAM-rich target oligonucleotide.
[0290] Disrupting PAM-sequence binding by Cas (or mutating Cas or the PAM-site) can render Cas inactive. Further, Cas proteins generally have a low affinity for the PAM-sequence, making the Cas-PAM interaction an Achille's heel for inhibitor discovery. However, the low affinity creates a challenge in developing robust Cas-PAM binding assays, which are overcome in the present application by leveraging the principle of multi-valency. A DNA sequence bearing multiple PAM sites has high affinity for Cas proteins. Fluorescence polarization may be used to monitor protein-DNA interaction. The binding of the labeled PAM-rich target molecule to a much larger Cas:guide molecule complex lowers the target molecule's tumbling rate, which can be monitored by fluorescence polarization (
[0291] The labeled PAM-rich target oligonucleotide comprises multiple PAM sites. In certain example embodiments, the labeled PAM-rich target oligonucleotide comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 PAM regions per molecule. In certain example embodiments, the labeled PAM-rich target oligonucleotide comprises between 2 and 40, e.g., 2 and 30, 2 and 20, 4 and 20, 5 and 20, 6 and 20, 7 and 20, 8 and 20, 9 and 20, 10 and 20, 11 and 20, 12 and 20, 13 and 20, 14 and 20, 15 and 20, PAM sites per molecule. In one example embodiment, the labeled PAM-rich target sequence comprises 12 PAM sites per molecule. The labeled PAM-rich target oligonucleotide may be double stranded DNA, RNA, or hybrid thereof.
[0292] The labeled PAM-rich target oligonucleotide may be labeled with any fluorophore known in the art and recognized by one of ordinary skill in the art as suitable for use in a fluorescence polarization assay. In certain example embodiments, the fluorophore is FAM. In certain other example embodiments, the fluorophore is FITC. An exemplary labeled PAM rich target oligonucleotide is provided in and further shown below. (SEQ ID Nos. 1 and 2)
TABLE-US-00001 5-GGCTGGACCACGCGGGAAAATCCACCTAGGTGGTTCCTCTTCGGAT GTTCCATCCTTT/36-FAM-3 3-CCGACCTGGTGCGCCCTTTTAGGTGGATCCACCAAGGAGAAGCCTA CAAGGTAGGAAA-5
[0293] As understood by one of ordinary skill in the art the composition of each PAM site will depend on the Cas protein to be screened, as different Cas proteins are recognized as having different PAM site preferences. The guide molecule used in the preliminary assay is designed to target the Cas:guide molecule complex to the labeled PAM-rich target oligonucleotide. The size of the labeled PAM-rich target oligonucleotide may vary. Design considerations include the number of PAM sites to be included and the size of any target sequence adjacent to the PAM site to facilitate formation of the Cas:guide-molecule:target-sequence complex. The size of any target sequence adjacent to each PAM may vary based on the guide molecule used.
[0294] After incubating the inhibitors in the presence of Cas, guide molecule, and labelled PAM-rich target molecule for time sufficient to allow Cas:guide molecule complex formation and binding with the target molecule, changes in fluorescence polarization are measured in each individual discrete volume. For example, the fluorescence polarization may be measured using a standard fluorescence microplate reader. In certain example embodiment, the Cas protein and inhibitor are added to each individual volume first and incubated. In certain example embodiments, the incubation is at room temperature. Then, the candidate inhibitors and labeled PAM-rich target molecule are added to each individual discrete volume and incubated further. In certain example embodiments, the second incubation takes place at room temperature. In certain example embodiments putative inhibitors are defined as those compounds have > than 3 of Z-score.
Counter Screen
[0295] In certain example embodiment, the method may further comprise performing a counter-screening assay. A counter-screening assay may be performed after the preliminary screen. A counter-screening assay may be performed in a similar format as the preliminary compound screen. For example, a counter-screening assay may comprise measuring change in fluorescence polarization of the labeled PAM-rich target oligonucleotide in presence of the one or more putative inhibitors alone, wherein candidate inhibitors that increase fluorescence polarization beyond a defined cut-off value are excluded from the one or more putative inhibitors.
[0296] In the counter screen the labelled PAM-rich target molecule is first transferred to each individual discrete volume and then incubated with the candidate inhibitor compounds prior to acquiring a fluorescence polarization signal. The change in the fluorescence polarization signal may be calculated in percentile and plotted against compounds' average Z-score values obtained from the original compound-screening assay. Compounds that resulted in greater than 3a change in the Z-score but do not alter the fluorescence polarization signal by greater than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, or 15% are selected as putative inhibitor compounds and subjected to further cell-based screening as described herein.
Validating Assays
[0297] After the preliminary screen, an optionally after the counter screen, the set of identified putative compounds may be further assessed by one or more validating assays. When there are multiple validating assays, the assays may be performed in any order. The method may then comprise selecting one or more final inhibitors based at least in part on the validating assay(s). In some examples, a validating assay may be performed by delivering one or more components of a CRISPR-Cas system manipulating expression and/or activity of a reporter gene, and detecting inhibitor activity by measuring the change of expression and/or activity of the reporter gene. IN certain examples, detecting inhibitor activity is performed using high-content imaging and automated data analysis
Knockdown Assay
[0298] In some cases, the validating assay may be a cell-based knock-down assay. In general, a cell-based knock-down assay may be performed by delivering a CRISPR-Cas effector protein, a guide sequence, and a nucleotide sequence encoding a reporter (e.g., a polypeptide reporter) into one or more cells (e.g., a population of cells) in a discrete volume with putative inhibitor(s). The knock-down assay may further comprise detecting a change in the expression and/or activity of the reporter. In some cases, the guide sequence targets the nucleotide sequence encoding the reporter and recruits the Cas effector protein to knock-down the expression of the reporter. In these cases, an increase in the expression and/or activity may indicate the inhibitor activity. In some cases, the CRISPR-Cas effector protein, the nucleotide sequence encoding the polypeptide reporter, and the guide sequence targeting the nucleotide sequence encoding the polypeptide reporter are all encoded on a single construct.
[0299] The assay may use high-throughput readout using a high content, automated microscope and automated image analysis (e.g.,
[0300] In certain example embodiments, compounds showing at least 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or 90% inhibition relative to a control are selected for further analysis. In certain example embodiments, compounds showing at least 60% inhibition relative to control are selected for further analysis. In some examples, a control may be one or more cells that contain the nucleotide sequence encoding the polypeptide reporter, but does not contain the Cas effector protein or the guide sequence, or contains neither the Cas effector protein nor the guide sequence. Alternatively or additionally, the control may be one or more cells in a discrete volume that does not have any inhibitor.
Nuclease Activity Assay
[0301] In some cases, the validating assay may be a cell-based nuclease activity assay. It should be understood the knock-down assay and nuclease activity assay may be conducted in any order. In general, a nuclease activity assay (also referred to as a Cas activity assay) may comprise delivering a first construct and a second construct in one or more cells (e.g., a population of cells). The one or more cells may be in individual discrete volumes. Each of the discrete volumes may comprise one or more putative inhibitors. The first construct may encode an out-of-frame first reporter. The second construct may encode a CRISPR-Cas effector protein and a guide molecule. In certain examples, the nuclease activity assay may comprise a first construct as described herein, a second construct encoding a CRISPR-Cas effector protein and a third construct encoding a guide molecule. The guide molecule may target the first reporter or a regulatory element thereof, thereby recruiting the CRISPR-Cas effector protein to introduce a frameshift that shifts the first reporter in-frame. In certain examples, the first construct encodes an out-of-frame first reporter and a downstream in-frame second reporter separated by a linker comprising a stop codon, and the second construct encodes the CRISPR-Cas effector protein and a guide molecule targeting the linker, wherein the CRISPR-Cas effector protein introduces a frameshift edit at the stop codon that shifts the first reporter in-frame. The nuclease activity assay may further comprise detecting inhibitor activity by measuring changes in the expression and/or activity of the first reporter relative to a control. Decreased expression of the first reporter relative to the control may indicate inhibition of CRISPR-Cas mediated nuclease activity.
[0302] The first construct and the second construct may be delivered at a suitable molar ratio. For example, the molar ratio between the first construct and the second construct may be from 1:10 to 10:1, e.g., from 1:5 to 5:1, from 1:3 to 3:1, or from 1:2 to 2:1. For example, the molar ratio between the first construct and the second construct may be 1:10, 1:5, 1:3, 1:2, 1:1, 2:1, 3:1 5:1 or 10:1. In certain cases, the molar ratio between the first construct and the second construct may be 1:1, i.e., equimolar ratio.
[0303] In some cases, a nuclease activity assay may be a frame-shift reporter assay, e.g., performed using a frame-shift reporter. Cells are cultured in individual discrete volumes. As above multiple cell lines may be used including the same cell line as used in the Knock-down assay. Cells are transfected with a frameshift reporter, the Cas protein to be screen, and guide molecules. The frameshift reporter is a nucleic acid construct encoding a first type of reporter molecule that is out-of-frame and not initially expressed, and a second type of reporter molecule that is in frame and initially expressed. A linker sequence separate the first type and second type of reporter molecule and encodes a stop codon. The guide molecules direct the Cas protein to the linker comprising the stop codon in the frameshift reporters. Introduction of a frameshift edit at the stop codon by the Cas protein results in the first type of reporter molecule being shifted in frame. Thus, inhibitory activity will limit expression of the first type of reporter molecule by limiting Cas-mediated frameshift edits.
[0304] In certain example embodiments, the first type of reporter molecule is a first type of fluorescent polypeptide detectable at a first wavelength or range of wavelengths, and the second type of reporter molecule is a second type of fluorescent polypeptide detectable at a second wavelength or range of wavelengths. After an initial incubation, the cells may be fixed and counterstained with a nucleus counterstain. As with the knockdown assay an automated high content microscope may be used to obtain images at different excitation wavelengths of each individual discrete volumes and those images analysis, for example using the MetaXpress or similar software, to determine the % NHEJ. In certain example embodiments, compounds showing at least 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or 90% inhibition relative to control are selected for further analysis. In certain example embodiments, compounds showing at least 60% inhibition relative to control are selected. In certain cases, the control may be a population cells contain the first construct but does not contain the construct encoding the CRISPR-Cas effector protein or the guide molecule. Alternatively or additionally, the control may be one or more cells in a discrete volume that does not have any inhibitor.
[0305] The final inhibitor set may comprise those inhibitors passing the preliminary compound screen and exhibiting the desire level of inhibitory activity in one or both cell-based assays.
Additional Inhibitor Screens
[0306] In addition to the screens described above, the methods may further comprise one or more of the following screens. The assays described below are further described in U.S. Provisional Application No. 62/416,017 filed Nov. 1, 2016 and a PCT application to be filed claiming priority thereto and entitled Inhibitors of RNA Guided Nucleases And Uses Thereof and having attorney docket no. 167741.014101/PCT. The contents of both applications are incorporated herein by reference. In some examples, the method may further comprise performing a transcription assay (e.g., a spinach transcription assay), a strand displacement assay, or both. These assay(s) may be performed to identify one or more final inhibitors.
Spinach Transcription Assay
[0307] In one aspect, the invention provides a transcription assay to detect the activity of an RNA guided endonuclease. In one embodiment, the level of transcription is suppressed by Cas9 nuclease activity in an in vitro assay. In various embodiments, the transcription assay involves expression of a nucleic acid aptamer that binds a molecular fluorophore to generate a fluorescent signal. Such aptamer-fluorophore combinations are known in the art, including for example, the Spinach aptamer having the sequence
TABLE-US-00002 5-GGGAGACGCAACUGAAUGAAAUGGUGAAGGACGGGUCCAGGUGUGG CUGCUUCGGCAGUGCAGCUUGUUGAGUAGAGUGUGAGCUCCGCGUAACU AGUCGCGUCAC-3
(SEQ ID NO:8) and the fluorophore 4-(3,5-difluoro-4-hydroxybenzylidene)-1,2-dimethyl-1H-imidazol-5-one (DFHBI) (see, e.g., US20120252699 and US20140220560, each of which is incorporated herein in their entirety). In the Spinach assay, Cas9 can cleave the DNA template and thus inhibit in vitro transcription of the nucleic acid aptamer. In certain embodiments, the guide RNA targeting the Spinach aptamer has the sequence (SEQ ID NO:9)
TABLE-US-00003 5-GCUAUAGGACGCGACCGAAAGUUUUAGAGCUAGAAAUAGCAAGUUA AAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUG CUUUU-3
[0308] In the presence of fluorophore, suppression in transcription results in the reduction of RNA aptamer-fluorophore concentration and hence in the fluorescence signal. In vitro transcription reactions may comprise a purified linear DNA template containing a promoter operatively linked to a nucleic acid sequence encoding an RNA aptamer, ribonucleotide triphosphates, a buffer system (e.g., including DTT and magnesium ions, and an appropriate phage RNA polymerase (e.g., T7 polymerase).
[0309] In certain other example embodiments, the DNA templates for the Spinach IVT transcription assay are:
TABLE-US-00004 (SEQIDNO:10) GCGCGC
GACGCGACCGAAA
TGAAGG
CCAGTGCTT
CACTGTTGAGTAGAGTGTGAGCT CCGTAAC
TCGCGTC
[0310] Red=T7 Promoter
[0311] Green=Cpf1 PAM
[0312] Blue=SpCas9 PAM
[0313] Orange=SaCas9 PAM
[0314] Produces a Spinach RNA aptamer upon transcription with the sequence
TABLE-US-00005 (SEQIDNO:11) 5 GACGCGACCGAAA
UGAAGG
CCAGUGCUU
CACUGUUGAGUAGAGUGUGAGCUCCGUAAC
UCGCGUC-3'
[0315] A more generalizable DNA Template for Spinach IVT transcription:
TABLE-US-00006 (SEQIDNO:12) GCGCGC
GACGCGACCGAAA
TGAAGG
CCAGTGCTT
CACTGTTGAGTAGAGTGTGA GCTCCGTAAC
[0316] Produces a Spinach RNA aptamer upon transcription with the sequence
TABLE-US-00007 (SEQIDNO:13) 5' GACGCGACCGAAA
UGAAGG
CCAGUGCUU
CACUGUUGAGUAGAGUGUGAGCUCCGUAAC
UCGCGUC-3
[0317] Where either represents any nucleotide A, G, T, or C. The length of the string of NNNN is arbitrary, and can be expanded to accommodate the PAM consensus motif of any RNA-programmable DNA nuclease. The first NNNN site accommodates distal-PAM binding nucleases such as those of the Cpf1 family, while the second NNNN site accommodates both distal and proximal PAM binding nucleases (such as those of the Cpf1 family and Cas9 family, respectively).
Strand Invasion Assay
[0318] To measure the Cas9 nuclease activity, a technique was designed based on DNA strand invasion. It was hypothesized that, after a DSB by Cas9 on the substrate DNA, the fluorophore labeled (FAM) 5-end of the non-target strand can be replaced by a corresponding single-stranded cold DNA (
Strand Displacement Assay
[0319] In another approach, the previously described strand invasion assay may be modified to make it more sensitive and effective with an orthogonal readout of fluorescence instead of fluorescence polarization. In this assay, the substrate DNA remained the same as the strand invasion assay, though the sequence of the invading cold DNA is changed so that it can hybridize with the 5-end free DNA available only after the Cas9 mediated cleavage. Moreover, the DNA strand may be conjugated with a fluorescence quencher at the 3-end which can readily quench FAM fluorescence only when it hybridizes with the labile non-target strand.
[0320] In certain example embodiments, DNA substrates for the strand displacement assay are shown below and are double stranded, and only include a fluorophore (6-FAM) on the strand shown:
TABLE-US-00008 SpCas9: (SEQIDNO:14) 5-6-FAM/TAATACGACTCA TGG TGAAGGACGGGT-3 SaCas9: (SEQIDNO:15) 5-6-FAM/ACTCACTATAGG
ACGGGTCCAGTGCTTCGG-3 Cpf1(allspecies): (SEQIDNO:16) 5CGTCCTTCACCATTTC
TATTAGTTCCAT/6-FAM-3 And (SEQIDNO:17) 5-6-FAM/ATGGAACTAATA
GAAA TGGTGAAGGACG-3
Quencher strand sequences for the strand displacement assay shown below are single stranded, and include a quencher (Iowa Black FQ):
TABLE-US-00009 SpCas9: (SEQIDNO:18) 5-ATAGTGAGTCGTATTA/3IABkFQ-3 SaCas9: (SEQIDNO:19) 5-CGTCCCTATAGTGAGT/3IABkFQ-3 Cpf1(allspecies): (SEQIDNO:20) 5-5IABkFQ/ATGGAACTAATACGAC-3 And (SEQIDNO:21) 5-GTCGTATTAGTTCCAT/3IABkFQ-3
Cell Cas Inhibition Assays
[0321] In certain example embodiments, further screening may be done by measuring the inhibitory activity in a eukaryotic or prokaryotic cell, for example, using the assays described in further detail below
Methods of Designing and/or Identifying Compounds
[0322] Provided herein includes a method for designing or identifying a compound that regulates a CRISPR protein's activity. In some cases, the compound may be an inhibitor that inhibits (partially or completely) one or more activities (e.g., nuclease activity) of the CRISPR protein. In certain cases, the compound may be an activator that increases one or more activities (e.g., nuclease activity) of the CRISPR protein.
[0323] In some aspects, the method may be a computer-based method of rational design of CRISPR ligands. This rational design can comprise: providing the structure of the CRISPR protein or complex as defined by some or all (e.g., at least 2 or more, e.g., at least 5, advantageously at least 10, more advantageously at least 50 and even more advantageously at least 100 atoms) of the structure co-ordinates. The method or fitting of the method may use the co-ordinates of atoms of interest of the CRISPR complex as defined by some or all co-ordinates which are in the vicinity of an active site or binding region (e.g., at least 2 or more, e.g., at least 5, advantageously at least 10, more advantageously at least 50 and even more advantageously at least 100 atoms) of the structure in order to model the vicinity of the active site or binding region. These co-ordinates may be used to define a space which is then screened in silico against a desired or candidate nucleic acid molecule. Thus, the invention provides a computer-based method of rational design of CRISPR complexes. This method may include: providing the co-ordinates of at least two atoms of the CRISPR protein or complex; providing the structure of a candidate or desired ligand; and fitting the structure of the candidate to the selected co-ordinates. In this fashion, the skilled person may also fit a functional group and a candidate or desired nucleic acid molecule. For example, providing the structure of the CRISPR complex as defined by some or all (e.g., at least 2 or more, e.g., at least 5, advantageously at least 10, more advantageously at least 50 and even more advantageously at least 100) atoms of the structure co; providing a structure of a desired ligand as to which a CRISPR complex is desired; fitting the structure of the CRISPR complex as defined by some or all co-ordinates to the desired ligand, including in said fitting obtaining putative modification(s) of the CRISPR complex. The methods of the invention can employ a sub-domain of interest of the CRISPR protein or complex.
[0324] The methods can optionally include synthesizing the candidate or desired ligand and/or the CRISPR systems from the in silico output and testing binding and/or activity of wet or actual a functional group linked to a wet or actual CRISPR system bound to a wet or actual candidate or desired ligand. The methods can include synthesizing the CRISPR systems (including a functional group) from the in silico output and testing binding and/or activity of wet or actual a functional group linked to a wet or actual CRISPR system bound to an in vivo wet or actual candidate or desired nucleic acid molecule, e.g., contacting wet or actual CRISPR system including a functional group from the in silico output with a cell containing the desired or candidate ligand. These methods can include observing the cell or an organism containing the cell for a desired reaction, e.g., reduction of symptoms or condition or disease. The step of providing the structure of a candidate ligand may involve selecting the compound by computationally screening a database containing ligand data, e.g., such data as to conditions or diseases. A 3-D descriptor for binding of the candidate ligand may be derived from geometric and functional constraints derived from the architecture and chemical nature of the CRISPR protein or complex or domains or regions thereof from the herein crystal structure. In effect, the descriptor can be a type of virtual modification(s) of the CRISPR complex structure for binding CRISPR to the candidate or desired nucleic acid molecule. The descriptor may then be used to interrogate the ligand database to ascertain those ligands of the database that have putatively good binding to the descriptor. The herein wet steps can then be performed using the descriptor and ligands that have putatively good binding.
Fitting
[0325] The methods herein may comprise fitting a candidate molecule to a three-dimensional structure of one or more target regions. The target regions may be on a PAM interaction (PI) domain of a CRISPR protein.
[0326] Fitting can mean determining, by automatic or semi-automatic means, interactions between at least one atom of the candidate and at least one atom of the CRISPR protein or complex and calculating the extent to which such an interaction is stable. Interactions can include attraction, repulsion, brought about by charge, steric considerations, and the like. A sub-domain can mean at least one, e.g., one, two, three, or four, complete element(s) of secondary structure.
[0327] Computational modeling technologies can be used to assess the potential modulating or binding effect of a PI domain ligand on a CRISPR protein or complex. If computer modeling indicates a strong interaction, the molecule may then be synthesized and tested for its ability to bind to a CRISPR PI domain and inhibit its activity. Modulating or other binding agents may be computationally evaluated and designed by means of a series of steps in which chemical groups or fragments are screened and selected for their ability to associate with the individual binding pockets or other areas of a CRISPR protein. This process may begin by visual inspection of, for example, the CRISPR PI domain based on the structural coordinates. Selected fragments or chemical groups may then be positioned in a variety of orientations, or docked. Manual docking may be accomplished using software such as Insight II (Accelrys, San Diego, Calif.) MOE; CE (Shindyalov, Ind., Bourne, P E, Protein Structure Alignment by Incremental Combinatorial Extension (CE) of the Optimal Path, Protein Engineering, 11:739-47, 1998); and SYBYL (Molecular Modeling Software, Tripos Associates, Inc., St. Louis, Mo., 1992), followed by energy minimization and molecular dynamics with standard molecular mechanics force fields, such as CHARMM (Brooks, et al., J. Comp. Chem. 4:187-217, 1983). More automated docking may be accomplished by using programs such as DOCK (Kuntz et al., J. Mol. Biol., 161:269-88, 1982; DOCK is available from University of California, San Francisco, Calif.); AUTODOCK (Goodsell & Olsen, Proteins: Structure, Function, and Genetics 8:195-202, 1990; AUTODOCK is available from Scripps Research Institute, La Jolla, Calif); GOLD (Cambridge Crystallographic Data Centre (CCDC); Jones et al., J. Mol. Biol. 245:43-53, 1995); and FLEXX (Tripos, St. Louis, Mo.; Rarey, M., et al., J. Mol. Biol. 261:470-89, 1996); AMBER (Weiner, et al., J. Am. Chem. Soc. 106: 765-84, 1984) and C.sup.2 MMFF (Merck Molecular Force Field; Accelrys, San Diego, Calif.). In a preferred embodiment, Glide docking can be used.
PAM Interacting Domains
[0328] The target regions(s) for fitting the candidate molecules may be on the PI domain of the CRISPR protein.
[0329] In some examples, the PI domain is a PI domain of SaCas9. SaCas9 recognizes the 5-NNGRRN-3 PAM with a preference for a thymine base at the 6th position (Ran et al., 2015), which is distinct from the 5-NGG-3 PAM of SpCas9. In the present structures containing either the 5-TTGAAT-3 PAM or the 5-TTGGGT-3 PAM, the PAM duplex is sandwiched between the WED and PI domains, and the PAM in the non-target DNA strand is read out from the major groove side by the PI domain. dT1* and dT2* form no direct contact with the protein. Consistent with the observed requirement for the 3rd G in the 5-NNGRRT-3 PAM, the 06 and N7 of dG3* forms bidentate hydrogen bonds with the side chain of Arg1015, which is anchored via salt bridges with Glu993 in both complexes. In the 5-TTGAAT-3 PAM complex, the N7 atoms of dA4* and dA5* form direct and water-mediated hydrogen bonds with Asn985 and Asn985/Asn986/Arg991, respectively. In addition, the N6 of dA5* forms a water-mediated hydrogen bond with Asn985. Similarly, in the 5-TTGGGT-3 PAM complex, the N7 atoms of dG4* and dG5* form direct and water-mediated hydrogen bonds with Asn985 and Asn985/Asn986/Arg991, respectively. The O6 of dG5* forms a water-mediated hydrogen bond with Asn985. These structural findings explain the ability of SaCas9 to recognize the purine nucleotides at positions 4 and 5 in the 5-NNGRRT-3 PAM. The O4 of dT6* hydrogen bonds with Arg991, explaining the preference of SaCas9 to the 6th T in the 5-NNGRRT-3 PAM. Single alanine mutants of these PAM-interacting residues reduced cleavage activities in vivo, and double mutations abolished the activity, confirming the importance of Asn985, Asn986, Arg991, Glu993 and Arg1015 for PAM recognition. In addition, the phosphate backbone of the PAM duplex is recognized from the minor groove side by the WED domain (Tyr789, Tyr882, Lys886, Ans888, Ala889 and Leu909) in a manner distinct from SpCas9. Together, the structural and functional data reveal the mechanism of relaxed recognition of the 5-NNGRRT-3 PAM by SaCas9.
[0330] WO 2014/093635 provides phylogenetic analyses of families of Cas9 orthologs and a sequence alignment of 12 Cas9 orthologs.
[0331] In FnCas9 the PAM duplex is sandwiched between the WED and PI domains and the PAM sequences are read by the PI domain. The O6 and N7 of dG2* form bidentate hydrogen bonds with Arg1585 in the PI domain, while the N3 of dG2* forms a hydrogen bond with Ser1473 in the WED-PI linker. In the 5-TGG-3 PAM complex, the O6 and N7 of dG3* form bidentate hydrogen bonds with Arg1556, whereas in the 5-TGA-3 PAM complex, the N7 of dA3* forms only a single hydrogen bond with Arg1556, consistent with the higher activity of FnCas9 with the 5-NGG-3 PAM compared to the 5-NGA-3 PAM. In addition, dA(1) in the target DNA strand forms a stacking interaction with Arg1474 in the WED-PI linker. The mutations of these residues reduced the in vitro DNA cleavage activity of FnCas9, confirming the functional significance of Ser1473, Arg1474, Arg1556, and Arg1585. In addition to these direct interactions, dC(2), dG2*, and dG3* form water-mediated hydrogen bonds with Glu1449, Asp1470, and Lys1451 in the WED domain, respectively. Together, these structural findings explain the mechanism of the 5-NGG-3 PAM recognition by FnCas9.
[0332] The PI domains of SpCas9 and SaCas9 share a similar core fold comprising two distorted, anti-parallel sheets (1-3 and (4-9), with the 5-7 region responsible for the PAM recognition. In SpCas9, the 5-NGG-3 PAM is recognized by Arg1333/Arg1335 in the 7 loop, whereas in SaCas9, the 5-NNGRRT-3 PAM is recognized by Asn985/Asn986/Arg991/Arg1015 in the 5-7 region. The PI domain of FnCas9 adopts a similar core fold to those of SpCas9 and SaCas9. Whereas, in SpCas9 and SaCas9, the (38 and (39 strands in the PI domain are responsible for the interaction with the RuvC domain, the FnCas9 PI domain lacks the equivalent strands, consistent with the structural observation that the RuvC and PI domains do not interact in FnCas9.
[0333] In FnCas9, the 5-NGG-3 PAM is recognized by Arg1556 in the 5-6 loop and Arg1585 in the 6-7 loop. Although both SpCas9 and FnCas9 recognize the 5-NGG-3 PAM with a pair of arginine residues (Arg1333/Arg1335 in SpCas9 and Arg1585/Arg1556 in FnCas9), these arginine pairs are located at different positions, due to the substantial difference in their relative arrangement between the PI domain and the PAM duplex. In SpCas9, the third G in the 5-NGG-30 PAM is recognized by the Arg1335 side chain, which is anchored by a salt bridge with Glu1219, consistent with the specific recognition of the third G by SpCas9. In contrast, in FnCas9, the Arg1556 side chain does not form such a contact with the proximal residues, explaining why, unlike SpCas9, FnCas9 can also recognize the third A in the PAM, albeit with low efficiency. Together, these structural findings reinforced the notion that the Cas9 orthologs recognize diverse PAM sequences using distinct sets of PAM-interacting residues in the PI domains. See
[0334] In the present structure, the 5-AGAAACC-3 PAM-containing DNA duplex is bound to the cleft between the WED and PI domains. The nucleobases of dA1*-dA3* do not directly contact the protein, consistent with the lack of specificity for positions 1-3 in the 5-NNNVRYM-3 PAM. The N7 of dA4* in the non-target strand forms a water-mediated hydrogen bond with the side-chain hydroxyl group of Thr913. Modeling suggested that a steric clash could occur between the methyl group of dT4* and the side chain of Thr913, consistent with the preference of CjCas9 for the fourth V (A/G/C). The N7 of dA5*in the nontarget strand forms a hydrogen bond with the side-chain hydroxyl group of Ser915. Because N7 is common among the purine nucleotides, the interaction can explain the requirement for the fifth R (A/G). Notably, the nucleobase of dC6* in the non-target strand is not recognized by the protein. Instead, the N7 of dG(6) in the target strand forms a hydrogen bond with the side-chain hydroxyl group of Ser951. These structural findings revealed that CjCas9 does not recognize the Y (T/C) nucleotides at position 6 in the non-target strand as the PAM but detects their complementary R (A/G) nucleotides in the target strand. Similarly, the nucleobase of dC7* in the non-target strand is not recognized by the protein, whereas the O6 and N7 of dG(7) in the target strand form bidentate hydrogen bonds with the side chain of Arg866. In addition to the 5-AGAAACC-3 PAM complex, Applicants determined the crystal structure of CjCas9-DHNH in complex with the sgRNA and the DNA target containing the 5-AGAAACA-3 PAM. In the 5-AGAAACA-3 PAM complex, the dT(7):dA7* pair in the PAM duplex undergoes a slight displacement toward the PI domain, compared with the dG(7):dC7* pair in the 5-AGAAACC-3 PAM complex. This displacement in the PAM duplex allows Arg866 to form a hydrogen bond with the O4 of dT(7) in the target strand. These observations revealed that Cj Cas9 does not recognize the M (A/C) nucleotides at position 7 in the non-target strand as the PAM but detects their complementary K (T/G) nucleotides in the target strand. The preference of CjCas9 for C over A at position 7 can be explained by the bidentate hydrogen-bonding interaction between dG(7) and Arg866, in contrast to the single hydrogen-bonding interaction between dT(7) and Arg866. The single mutations of Arg866, Thr913, Ser915, and Ser951 reduced or abolished the in vitro cleavage activity, confirming their functional importance. Together, the structural and functional data revealed that CjCas9 forms sequence-specific contacts with both the target and non-target DNA strands, to achieve the recognition of the 5-NNNVRYM-3 PAM.
[0335] In AsCpf1, the PAM duplex adopts a distorted conformation with a narrow minor groove, as often observed in AT-rich DNA, and is bound to the groove formed by the WED, REC1 and PI domains. The PAM duplex is recognized by the WED-REC1 and PI domains from the major and minor groove sides, respectively. The dT(1):dA(1*) base pair in the PAM duplex does not form base-specific contacts with the protein, consistent with the lack of specificity in the 4th position of the 5-TTTN-3 PAM. Lys607 in the PI domain is inserted into the narrow minor groove, and plays critical roles in the PAM recognition. The O2 of dT(2*) forms a hydrogen bond with the side chain of Lys607, whereas the nucleobase and deoxyribose moieties of dA(2) form van der Waals interactions with the side chains of Lys607 and Pro599/Met604, respectively. Modeling of the dG(2):dC(2*) base pair indicated that there is a steric clash between the N2 of dG(2) and the side chain of Lys607, suggesting that dA(2):dT(2*), but not dG(2):dC(2*), is accepted at this position. These structural observations can explain the requirement of the 3rd T in the 5-TTTN-3 PAM. The 5-methyl group of dT(3*) forms a van der Waals interaction with the side-chain methyl group of Thr167, whereas the N3 and N7 of dA(3) form hydrogen bonds with Lys607 and Lys548, respectively. Modeling of the dG(3):dC(3*) base pair indicated that there is a steric clash between the N2 of dG(3) and the side chain of Lys607. These observations are consistent with the requirement of the 2nd T in the PAM. The 5-methyl group of dT(4*) is surrounded by the side-chain methyl groups of Thr167 and Thr539, whereas the O4 of dA(4) forms a hydrogen bond with the side chain of Lys607. Notably, the N3 and O4 of dT(4*) form hydrogen bonds with the N1 of dA(4) and the N6 of dA(3), respectively. Modeling indicated that dA(3) would form steric clashes with the modeled base pairs, dT(4):dA(4*), dG(4):dC(4*) and dC(4):dG(4*). These structural observations are consistent with the requirement of the 1st T in the PAM. The K548A and M604A mutants exhibited reduced activities, confirming that Lys548 and Met604 participate in the PAM recognition. More importantly, the K607A mutant showed almost no activity, indicating that Lys607 is critical for the PAM recognition. Together, these results indicate that AsCpf1 recognizes the 5-TTTN-3 PAM via a combination of base and shape readout mechanisms. Thr167 and Lys607 are conserved throughout the Cpf1 family, and Lys548, Pro599, and Met604 are partially conserved. These observations indicate that the Cpf1 homologs from diverse bacteria recognize their T-rich PAMs in similar manners, although the fine details of the interaction could vary.
[0336] WO 2016/205711 provides a set of Cpf1 orthologs and consensus sequence. Preferred mutated Cpf1 and associated recognized PAM sequences are indicated in the Table 1 below of AsCpf1 and LbCpf1.
TABLE-US-00010 TABLE 1 Exemplary mutations of amino acid residues and associated PAMs of AsCpf1 and LbCpf1 AsCpf1 LbCpf1 amino acid residue PAM amino acid residue PAM S542 (or S542R) TYCN and TTTN G532 (or G532R) TYCN and TTTN S542 (or S542R) and AYV and TYV G532 (or G532R) and YCN and TTTN K548 (or K548V) and TGYV K538 (or K538V) S542 (or S542R) and RCN and TTTN G532 (or G532R) and RCN and TTTN K548 (or K548V) and K538 (or K538V) and N552 (or N552R) Y542 (or Y542R) S542 (or S542R) and YCV and TYCV G532 (or G532R) and RCN and TTTN K607 (or K607R) and VYCV (and K595 (or K595R) TYTV)
[0337] Interacting amino acids refers to amino acids of a CRISPR protein that interact with a ligand such as but not limited to an inhibitor. The interaction may include any subatomic element, atom or groups of atoms that form, for example, but not limited to, hydrogen bond donors, hydrogen bond acceptors, hydrophobic regions, hydrophilic regions, ionizable regions, aromatic rings. The interaction can comprise ionic, polar, and/or van der Waals interactions. The interaction may further be described by distance. For example, an interaction may involve a hydrogen bond donor that is 3 Angstroms away from a hydrogen bond acceptor. Interactions may be arranged in three-dimensional space with points of interaction defined by residues lining a binding site. In addition, interactions may further be described by torsional degrees of freedom of an atom or groups of atoms that define distinct, low energy conformations.
Nucleic Acid Modifications
[0338] In some further comprising determining the candidate molecule as an inhibitor of target nucleic acid modification by a CRISPR system which comprises the CRISPR protein. In some cases, the target nucleic acid modification comprises cleavage of the target nucleic acid. The target nucleic acid modification may comprise non-homologous end joining (NHEJ). Alternatively or additionally, the target nucleic acid modification may comprise the target nucleic acid modification comprises homologous repair (HR).
Target Regions
[0339] The target region(s) may comprise one or more amino acids. Alternatively or additionally, the target region(s) may comprise one or more first amino acids having or within certain distance of one or more second amino acids. For example, the target region(s) may comprise one or more first amino acids with certain distance, e.g., within about 1 angstroms, within about 5 angstroms, within about 10 angstroms, within about 15 angstroms, within about 20 angstroms, within about 25 angstroms, or within about 30 angstroms of one or more second amino acids.
[0340] In some examples, the CRISPR protein is Streptococcus pyogenes Cas9 (SpCas9) and the one or more target regions comprises one or more of Lys1107, Arg1333, and Arg1335. Alternatively or additionally, the one or more target regions comprises interacting amino acids having an alpha-carbon within 20 angstroms of Lys1107, Arg1333, and/or Arg1335.
[0341] In some examples, the CRISPR protein is Staphylococcus aureus Cas9 (SaCas9) and the one or more target region comprises one or more of Asn985, Asn986, Arg991, Glu993, and Arg1015. Alternatively or additionally, the one or more target regions comprises interacting amino acids having an alpha-carbon within 20 angstroms of Asn985, Asn986, Arg991, Glu993, and/or Arg1015. In some cases, the one or more target regions further comprises Tyr789, Tyr882, Lys886, Ans888, Ala889, and/or Leu909.
[0342] In some examples, the CRISPR protein is Francisella novicida Cas9 (FnCas9) and the one or more target regions comprises one or more of Ser1473, Arg1474, Arg1556, and Arg1585.
[0343] Alternatively or additionally, the one or more target regions further comprises interacting amino acids having an alpha-carbon within 20 angstroms of Ser1473, Arg1474, Arg1556, and/or Arg1585. In some cases, the one or more target regions further comprises Glu1449, Asp1470, and/or Lys1451. In some cases, wherein the protein is a Cas9 ortholog and the one or more target regions comprises one or more amino acids corresponding to Lys1107, Arg1333, or Arg1335 of SpCas9, or Asn985, Asn986, Arg991, Glu993, or Arg1015 of SaCas9, or Ser1473, Arg1474, Arg1556, of Arg1585 of FnCas9.
[0344] In some examples, the CRISPR protein is Acidaminococcus sp. Cpf1 (AsCpf1) and the one or more target regions comprises one or more of Thr167, Ser542, Lys548, Asn552, Met604, and Lys607. Alternatively or additionally, wherein the one or more target regions further comprises interacting amino acids having an alpha-carbon within 20 angstroms of Thr167, Ser542, Lys548, Asn552, Met604, and/or Lys607.
[0345] In some examples, the CRISPR protein is Lachnospiraceae bacterium Cpf1 (LsCpf1) and the one or more target regions comprises one or more of Gly532, Lys538, Tyr542, and Lys595. Alternatively or additionally, wherein the one or more target regions further comprises interacting amino acids having an alpha-carbon within 20 angstroms of Gly532, Lys538, Tyr542, and/or Lys595. In some cases, the protein is a Cpf1 ortholog and the target region comprises one or more amino acids corresponding to Thr167, Ser542, Lys548, Asn552, Met604, or Lys607 of AsCpf1, or Gly532, Lys538, Tyr542, or Lys595 of LsCpf1.
Uses of Crystal Structures and Atomic Structure Co-Ordinates
[0346] Crystal structures of the CRISPR protein or a part thereof may be used for the fitting. In some cases, the fitting takes advantage the crystal structure of the PI domain or a part thereof of a CRISPR protein.
[0347] Compounds disclosed herein have been discovered to interact to CRISPR proteins and inhibit CRISPR function. In certain embodiments, the compounds interact with amino acids of a PAM interacting (PI) domain of a CRISPR protein and inhibit function. The compounds can be used with CRISPR protein structure information to identify, measure, and/or model such interactions. Moreover, the interactions can be used to identify new compounds capable of inhibiting CRISPR function. In an embodiment of the invention, a compound is compared to the atomic coordinates of the PAM of a CRISPR protein. The atomic coordinates of the CRISPR protein can be from, e.g., crystallography or NMR studies, or in silico models.
[0348] Atomic coordinates and models of CRISPR proteins include, without limitation:
TABLE-US-00011 TABLE 2 Model PDB Ref S. pyogenes Cas9 4CMP Streptococcus pyogenes Cas9 in complex 4OO8 with guide RNA and target DNA S. aureus Cas9 (TTGGGT PAM) 5AXW S. aureus Cas9 (TTGAAT PAM) 5CZZ F. novicida Cas9 (TGG PAM) 5B2O F. novicida Cas9 (TGA PAM) 5B2P F. novicida Cas9 (TGG PAM) 5B2Q C. Jejuni Cas9 (AGAAACC PAM) 5X2G C. Jejuni Cas9 (AGAAACA PAM) 5X2H AsCpf1 5B43 Acidaminococcus sp. BV3L6 Cpf1 (TATA PAM) 5XH6 Acidaminococcus sp. BV3L6 Cpf1 (TCCA PAM) 5XH7 LbCpf1 (TTTA PAM) 5XUS LbCpf1 (TCTA PAM) 5XUT LbCpf1 (TCCA PAM) 5XUU LbCpf1 (CCCA PAM) 5XUZ
[0349] It will be recognized that there is variability among naturally occurring CRISPR proteins as to PAM specificity and further that changes in PAM specificity can be engineered. Thus, in certain embodiments, PI amino acids are identified in the art. In other embodiments, PI amino acids can be identified by their location in a CRISPR protein, for example at a position near to or in contact with PAM nucleotides in a CRISPR complex. In other embodiments, PI amino acids are evident from sequence alignments to CRISPR proteins whose structures have been solved. In still other embodiments, PI amino acids are evident from mutations which shift PAM specificity. Accordingly, the invention provides methods of designing or identifying inhibitors of naturally occurring and engineered CRISPR proteins.
[0350] The three-dimensional structures and atomic structure co-ordinates obtained therefrom, have a wide variety of uses. The crystals and structure co-ordinates are particularly useful for identifying compounds that interact with and/or bind to CRISPR-Cas9, CRISPR-Cpf1, and orthologs thereof. The structures of CRISPR proteins complexed with guides and target nucleic acids further provide the skilled artisan with insights into mechanisms of action of CRISPR proteins.
Methods of Use
[0351] The present disclosure may also include using the compounds that regulating one or more activities of a CRISPR protein designed or identified using the methods described herein. In some cases, the compounds may be used for treating or diagnosing a health condition, e.g., a disease. For example, the present disclosure may include a method for treating a health condition, e.g., a disease using a CRISPR protein with one or more of the compounds identified or designed using the methods herein. In some examples, the method may comprise further screening and/or validating the designed or identified compound(s) with one or more additional assays, e.g., assays for testing a CRISPR activity and the effect of the compound(s) on the activity. Examples of such assay include affinity assay, knock-down assay, nuclease activity assay, spinach transcription assay, strand invasion assay, strand displacement assay, cell cas inhibition assay, or any combination thereof.
[0352] Small molecule inhibitors of RNA guided endonucleases (e.g., Cas9, Cpf1) were developed that have the potential to allow rapid, dosable, and/or temporal control of CRISPR protein activities. Reports of small-molecule controlled CRISPR protein activity are present in literature (Senis et al., Biotechnol J 2014, 9, 1402-12; Wright et al., Proc Natl Acad Sci USA. 2015 Mar. 10; 112(10):2984-9; Gonzalez et al., Cell Stem Cell 2014, 15, 215-26; Davis et al., Nat Chem Biol 2015, 11, 316-8). However, none of them ensure dosabilitythe small molecules act merely as inducers of CRISPR protein activity. Further, most of these small molecule systems are not reversible upon removal of the small molecule (Zetsche et al., Nat Biotech 2015, 33, 139-142; Davis et al., Nat Chem Biol 2015, 11, 316-8), and therefore, do not allow precise temporal control in transcriptional regulatory technologies.
[0353] Small molecule inhibitors of RNA guided endonucleases (e.g., Cas9, Cpf1) have potential therapeutic uses for regulating genome editing technologies involving RNA guided endonucleases. Dosable control of the therapeutic activity of RNA guided endonucleases introduced into a subject or cell of a subject is important for effective genome editing therapeutic strategies. Small molecule inhibitors of RNA guided endonucleases can be administered to a subject undergoing RNA guided endonuclease based gene therapy or any other RNA guided endonuclease based therapy. In certain embodiments, the subject is a human or mammal. Small molecule inhibitors of RNA guided endonucleases eliminate or reduce undesirable off-target editing and chromosomal translocations when present at high concentrations Furthermore, small molecule inhibitors of RNA guided endonucleases can be used to rapidly terminate constitutively active CRISPR protein, following on-target gene-editing.
[0354] Small molecule inhibitors of RNA guided endonucleases can also be used to regulate genome editing technologies in other organisms, including invertebrates, plants, and unicellular organisms (e.g., bacteria). Potential uses include regulating gene drives for entomological and agricultural uses. In addition, it is anticipated that CRISPR protein inhibitors will be valuable probes to understand the role of the protein in CRISPR-mediated bacterial immunity (e.g., spacer acquisition) (Nunez et al., Nature. 2015 Mar. 12; 519(7542):193-8; Heler et al., Nature 2015, 519, 199-202). Along similar lines, CRISPR protein inhibitors can be deployed for directed evolution of the CRISPR protein. It is hypothesized that CRISPR protein inhibitors will disrupt bacterial immunity against bacteriophages (or toxic DNA) by interfering with the CRISPR-Cas-based immune surveillance system in bacteria. Akin to the development of antibiotic resistance, bacteria will be forced to evolve CRISPR protein.
Formulations
[0355] Agents described herein, including analogs thereof, and/or agents discovered to have medicinal value using the methods described herein are useful as a drug for treating diabetes. For therapeutic uses, the compositions or agents identified using the methods disclosed herein may be administered systemically, for example, formulated in a pharmaceutically-acceptable buffer such as physiological saline. Preferable routes of administration include, for example, subcutaneous, intravenous, interperitoneally, intramuscular, or intradermal injections that provide continuous, sustained levels of the drug in the patient. Treatment of human patients or other animals will be carried out using a therapeutically effective amount of a therapeutic identified herein in a physiologically-acceptable carrier. Suitable carriers and their formulation are described, for example, in Remington's Pharmaceutical Sciences by E. W. Martin. The amount of the therapeutic agent to be administered varies depending upon the manner of administration, the age and body weight of the patient, and with the clinical symptoms. Generally, amounts will be in the range of those used for other agents used in the treatment of other diseases associated with diabetes.
[0356] The disclosed compounds may be administered alone (e.g., in saline or buffer) or using any delivery vehicles known in the art. For instance the following delivery vehicles have been described: Cochleates; Emulsomes, ISCOMs; Liposomes; Live bacterial vectors (e.g., Salmonella, Escherichia coli, Bacillus calmatte-guerin, Shigella, Lactobacillus); Live viral vectors (e.g., Vaccinia, adenovirus, Herpes Simplex); Microspheres; Nucleic acid vaccines; Polymers; Polymer rings; Proteosomes; Sodium Fluoride; Transgenic plants; Virosomes; Virus-like particles. Other delivery vehicles are known in the art and some additional examples are provided below.
[0357] The disclosed compounds may be administered by any route known, such as, for example, orally, transdermally, intravenously, cutaneously, subcutaneously, nasally, intramuscularly, intraperitoneally, intracranially, and intracerebroventricularly.
[0358] In certain embodiments, disclosed compounds are administered at dosage levels greater than about 0.001 mg/kg, such as greater than about 0.01 mg/kg or greater than about 0.1 mg/kg. For example, the dosage level may be from about 0.001 mg/kg to about 50 mg/kg such as from about 0.01 mg/kg to about 25 mg/kg, from about 0.1 mg/kg to about 10 mg/kg, or from about 1 mg/kg to about 5 mg/kg of subject body weight per day, one or more times a day, to obtain the desired therapeutic effect. It will also be appreciated that dosages smaller than about 0.001 mg/kg or greater than about 50 mg/kg (for example about 50-100 mg/kg) can also be administered to a subject.
[0359] In one embodiment, the compound is administered once-daily, twice-daily, or three-times daily. In one embodiment, the compound is administered continuously (i.e., every day) or intermittently (e.g., 3-5 days a week). In another embodiment, administration could be on an intermittent schedule.
[0360] Further, administration less frequently than daily, such as, for example, every other day may be chosen. In additional embodiments, administration with at least 2 days between doses may be chosen. By way of example only, dosing may be every third day, bi-weekly or weekly. As another example, a single, acute dose may be administered. Alternatively, compounds can be administered on a non-regular basis e.g., whenever symptoms begin. For any compound described herein the effective amount can be initially determined from animal models.
[0361] Toxicity and efficacy of the compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Compounds that exhibit large therapeutic indices may have a greater effect when practicing the methods as disclosed herein. While compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.
[0362] Data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage of the compounds disclosed herein for use in humans. The dosage of such agents lies within a range of circulating concentrations that include the ED.sub.50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the disclosed methods, the effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC.sub.50 (i.e., the concentration of the test compound that achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography. In certain embodiments, pharmaceutical compositions may comprise, for example, at least about 0.1% of an active compound. In other embodiments, the active compound may comprise between about 2% to about 75% of the weight of the unit, or between about 25% to about 60%, for example, and any range derivable therein. Multiple doses of the compounds are also contemplated.
[0363] The formulations disclosed herein are administered in pharmaceutically acceptable solutions, which may routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers, and optionally other therapeutic ingredients.
[0364] For use in therapy, an effective amount of one or more disclosed compounds can be administered to a subject by any mode that delivers the compound(s) to the desired surface, e.g., mucosal, systemic. Administering the pharmaceutical composition of the present disclosure may be accomplished by any means known to the skilled artisan. Disclosed compounds may be administered orally, transdermally, intravenously, cutaneously, subcutaneously, nasally, intramuscularly, intraperitoneally, intracranially, or intracerebroventricularly.
[0365] For oral administration, one or more compounds can be formulated readily by combining the active compound(s) with pharmaceutically acceptable carriers well-known in the art. Such carriers enable the compounds to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a subject to be treated.
[0366] Pharmaceutical preparations for oral use can be obtained as solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate. Optionally, the oral formulations may also be formulated in saline or buffers, i.e., EDTA for neutralizing internal acid conditions or may be administered without any carriers.
[0367] Also specifically contemplated are oral dosage forms of one or more disclosed compounds. The compound(s) may be chemically modified so that oral delivery of the derivative is efficacious. Generally, the chemical modification contemplated is the attachment of at least one moiety to the compound itself, where said moiety permits (a) inhibition of proteolysis; and (b) uptake into the blood stream from the stomach or intestine. Also desired is the increase in overall stability of the compound(s) and increase in circulation time in the body. Examples of such moieties include: polyethylene glycol, copolymers of ethylene glycol and propylene glycol, carboxymethyl cellulose, dextran, polyvinyl alcohol, polyvinyl pyrrolidone and polyproline. Other polymers that could be used are poly-1,3-dioxolane and poly-1,3,6-tioxocane. In some aspects for pharmaceutical usage, as indicated above, are polyethylene glycol moieties.
[0368] The location of release may be the stomach, the small intestine (the duodenum, the jejunum, or the ileum), or the large intestine. One skilled in the art has available formulations which will not dissolve in the stomach, yet will release the material in the duodenum or elsewhere in the intestine. In some aspects, the release will avoid the deleterious effects of the stomach environment, either by protection of the compound or by release of the biologically active material beyond the stomach environment, such as in the intestine.
[0369] To ensure full gastric resistance a coating impermeable to at least pH 5.0 is important. Examples of the more common inert ingredients that are used as enteric coatings are cellulose acetate trimellitate (CAT), hydroxypropylmethylcellulose phthalate (HPMCP), HPMCP 50, HPMCP 55, polyvinyl acetate phthalate (PVAP), Eudragit L30D, Aquateric, cellulose acetate phthalate (CAP), Eudragit L, Eudragit S, and Shellac. These coatings may be used as mixed films.
[0370] A coating or mixture of coatings can also be used on tablets, which are not intended for protection against the stomach. This can include sugar coatings, or coatings which make the tablet easier to swallow. Capsules may consist of a hard shell (such as gelatin) for delivery of dry therapeutic i.e. powder; for liquid forms, a soft gelatin shell may be used. The shell material of cachets could be thick starch or other edible paper. For pills, lozenges, molded tablets or tablet triturates, moist massing techniques can be used.
[0371] The disclosed compounds can be included in the formulation as fine multiparticulates in the form of granules or pellets of particle size about 1 mm. The formulation of the material for capsule administration could also be as a powder, lightly compressed plugs or even as tablets. The compound could be prepared by compression.
[0372] Colorants and flavoring agents may all be included. For example, the compound may be formulated (such as by liposome or microsphere encapsulation) and then further contained within an edible product, such as a refrigerated beverage containing colorants and flavoring agents.
[0373] One may dilute or increase the volume of compound delivered with an inert material. These diluents could include carbohydrates, especially mannitol, -lactose, anhydrous lactose, cellulose, sucrose, modified dextrans and starch. Certain inorganic salts may be also be used as fillers including calcium triphosphate, magnesium carbonate and sodium chloride. Some commercially available diluents are Fast-Flo, Emdex, STA-Rx 1500, Emcompress and Avicell. Disintegrants may be included in the formulation of the therapeutic into a solid dosage form. Materials used as disintegrates include but are not limited to starch, including the commercial disintegrant based on starch, Explotab. Sodium starch glycolate, Amberlite, sodium carboxymethylcellulose, ultramylopectin, sodium alginate, gelatin, orange peel, acid carboxymethyl cellulose, natural sponge and bentonite may all be used. Another form of the disintegrants is the insoluble cationic exchange resins. Powdered gums may be used as disintegrants and as binders and these can include powdered gums such as agar, Karaya or tragacanth. Alginic acid and its sodium salt are also useful as disintegrants.
[0374] Binders may be used to hold the therapeutic together to form a hard tablet and include materials from natural products such as acacia, tragacanth, starch and gelatin. Others include methyl cellulose (MC), ethyl cellulose (EC) and carboxymethyl cellulose (CMC). Polyvinyl pyrrolidone (PVP) and hydroxypropylmethyl cellulose (HPMC) could both be used in alcoholic solutions to granulate the therapeutic.
[0375] An anti-frictional agent may be included in the formulation of the compound to prevent sticking during the formulation process. Lubricants may be used as a layer between the compound and the die wall, and these can include but are not limited to; stearic acid including its magnesium and calcium salts, polytetrafluoroethylene (PTFE), liquid paraffin, vegetable oils and waxes. Soluble lubricants may also be used such as sodium lauryl sulfate, magnesium lauryl sulfate, polyethylene glycol of various molecular weights, Carbowax 4000 and 6000. Glidants that might improve the flow properties of the drug during formulation and to aid rearrangement during compression might be added. The glidants may include starch, talc, pyrogenic silica and hydrated silicoaluminate.
[0376] To aid dissolution of the compound into the aqueous environment a surfactant might be added as a wetting agent. Surfactants may include anionic detergents such as sodium lauryl sulfate, dioctyl sodium sulfosuccinate and dioctyl sodium sulfonate. Cationic detergents might be used and could include benzalkonium chloride or benzethomium chloride. The list of potential non-ionic detergents that could be included in the formulation as surfactants are lauromacrogol 400, polyoxyl 40 stearate, polyoxyethylene hydrogenated castor oil 10, 50 and 60, glycerol monostearate, polysorbate 40, 60, 65 and 80, sucrose fatty acid ester, methyl cellulose and carboxymethyl cellulose. These surfactants could be present in the formulation of the compound either alone or as a mixture in different ratios.
[0377] Pharmaceutical preparations which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added. Microspheres formulated for oral administration may also be used. Such microspheres have been well defined in the art. All formulations for oral administration should be in dosages suitable for such administration.
[0378] For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner.
[0379] For administration by inhalation, the compounds for use according to the present disclosure may be conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of e.g. gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
[0380] Also contemplated herein is pulmonary delivery of the compounds of the disclosure. The compound is delivered to the lungs of a mammal while inhaling and traverses across the lung epithelial lining to the blood stream using methods well known in the art.
[0381] Contemplated for use in the practice of methods disclosed herein are a wide range of mechanical devices designed for pulmonary delivery of therapeutic products, including but not limited to nebulizers, metered dose inhalers, and powder inhalers, all of which are familiar to those skilled in the art. Some specific examples of commercially available devices suitable for the practice of these methods are the Ultravent nebulizer, manufactured by Mallinckrodt, Inc., St. Louis, Mo.; the Acorn II nebulizer, manufactured by Marquest Medical Products, Englewood, Colo.; the Ventolin metered dose inhaler, manufactured by Glaxo Inc., Research Triangle Park, N.C.; and the Spinhaler powder inhaler, manufactured by Fisons Corp., Bedford, Mass.
[0382] All such devices require the use of formulations suitable for the dispensing of compound. Typically, each formulation is specific to the type of device employed and may involve the use of an appropriate propellant material, in addition to the usual diluents, and/or carriers useful in therapy. Also, the use of liposomes, microcapsules or microspheres, inclusion complexes, or other types of carriers is contemplated. Chemically modified compound may also be prepared in different formulations depending on the type of chemical modification or the type of device employed. Formulations suitable for use with a nebulizer, either jet or ultrasonic, will typically comprise compound dissolved in water at a concentration of about 0.1 to about 25 mg of biologically active compound per mL of solution. The formulation may also include a buffer and a simple sugar (e.g., for stabilization and regulation of osmotic pressure). The nebulizer formulation may also contain a surfactant, to reduce or prevent surface induced aggregation of the compound caused by atomization of the solution in forming the aerosol.
[0383] Formulations for use with a metered-dose inhaler device will generally comprise a finely divided powder containing the compound suspended in a propellant with the aid of a surfactant. The propellant may be any conventional material employed for this purpose, such as a chlorofluorocarbon, a hydrochlorofluorocarbon, a hydrofluorocarbon, or a hydrocarbon, including trichlorofluoromethane, dichlorodifiuoromethane, dichlorotetrafluoroethanol, and 1,1,1,2-tetrafluoroethane, or combinations thereof. Suitable surfactants include sorbitan trioleate and soya lecithin. Oleic acid may also be useful as a surfactant.
[0384] Formulations for dispensing from a powder inhaler device will comprise a finely divided dry powder containing compound and may also include a bulking agent, such as lactose, sorbitol, sucrose, or mannitol in amounts which facilitate dispersal of the powder from the device, e.g., about 50 to about 90% by weight of the formulation. The compound should most advantageously be prepared in particulate form with an average particle size of less than 10 mm (or microns), such as about 0.5 to about 5 mm, for an effective delivery to the distal lung.
[0385] Nasal delivery of a disclosed compound is also contemplated. Nasal delivery allows the passage of a compound to the blood stream directly after administering the therapeutic product to the nose, without the necessity for deposition of the product in the lung. Formulations for nasal delivery include those with dextran or cyclodextran.
[0386] For nasal administration, a useful device is a small, hard bottle to which a metered dose sprayer is attached. In one embodiment, the metered dose is delivered by drawing the pharmaceutical composition solution into a chamber of defined volume, which chamber has an aperture dimensioned to aerosolize and aerosol formulation by forming a spray when a liquid in the chamber is compressed. The chamber is compressed to administer the pharmaceutical composition. In a specific embodiment, the chamber is a piston arrangement. Such devices are commercially available.
[0387] Alternatively, a plastic squeeze bottle with an aperture or opening dimensioned to aerosolize an aerosol formulation by forming a spray when squeezed is used. The opening is usually found in the top of the bottle, and the top is generally tapered to partially fit in the nasal passages for efficient administration of the aerosol formulation. In some aspects, the nasal inhaler will provide a metered amount of the aerosol formulation, for administration of a measured dose of the drug.
[0388] The compound, when it is desirable to deliver them systemically, may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. The compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
[0389] Pharmaceutical formulations for parenteral administration include aqueous solutions of the active compounds in water-soluble form. Additionally, suspensions of the active compounds may be prepared as appropriate oily injection suspensions.
[0390] Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
[0391] Alternatively, the active compounds may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
[0392] The compounds may also be formulated in rectal or vaginal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.
[0393] In addition to the formulations described previously, the compounds may also be formulated as a depot preparation. Such long acting formulations may be formulated with suitable polymeric or hydrophobic materials (for example, as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
[0394] The pharmaceutical compositions also may comprise suitable solid or gel phase carriers or excipients. Examples of such carriers or excipients include but are not limited to calcium carbonate, calcium phosphate, various sugars, starches, cellulose derivatives, gelatin, and polymers such as polyethylene glycols.
[0395] Suitable liquid or solid pharmaceutical preparation forms are, for example, aqueous or saline solutions for inhalation, microencapsulated, encochleated, coated onto microscopic gold particles, contained in liposomes, nebulized, aerosols, pellets for implantation into the skin, or dried onto a sharp object to be scratched into the skin. The pharmaceutical compositions also include granules, powders, tablets, coated tablets, (micro)capsules, suppositories, syrups, emulsions, suspensions, creams, drops or preparations with protracted release of active compounds, in whose preparation excipients and additives and/or auxiliaries such as disintegrants, binders, coating agents, swelling agents, lubricants, flavorings, sweeteners or solubilizers are customarily used as described above. The pharmaceutical compositions are suitable for use in a variety of drug delivery systems.
[0396] The compounds may be administered per se (neat) or in the form of a pharmaceutically acceptable salt. When used in medicine the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically acceptable salts thereof. Such salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulphuric, nitric, phosphoric, maleic, acetic, salicylic, p-toluene sulphonic, tartaric, citric, methane sulphonic, formic, malonic, succinic, naphthalene-2-sulphonic, and benzene sulphonic. Also, such salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts of the carboxylic acid group.
[0397] Suitable buffering agents include: acetic acid and a salt (about 1-2% w/v); citric acid and a salt (about 1-3% w/v); boric acid and a salt (about 0.5-2.5% w/v); and phosphoric acid and a salt (about 0.8-2% w/v). Suitable preservatives include benzalkonium chloride (about 0.003-0.03% w/v); chlorobutanol (about 0.3-0.9% w/v); parabens (about 0.01-0.25% w/v) and thimerosal (about 0.004-0.02% w/v).
[0398] The pharmaceutical compositions contain an effective amount of a disclosed compound optionally included in a pharmaceutically acceptable carrier. The term pharmaceutically acceptable carrier means one or more compatible solid or liquid filler, diluents or encapsulating substances which are suitable for administration to a human or other vertebrate animal. The term carrier denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application. The components of the pharmaceutical compositions also are capable of being commingled with the compounds, and with each other, in a manner such that there is no interaction which would substantially impair the desired pharmaceutical efficiency.
[0399] Provided herein are methods of synthesizing disclosed compounds. A compound provided herein can be synthesized using a variety of methods known in the art. The schemes and description below depict general routes for the preparation of disclosed compounds.
Kits
[0400] The present compositions may be assembled into kits or pharmaceutical systems. The kits can include instructions for the treatment regime, reagents, equipment (test tubes, reaction vessels, needles, syringes, etc.) and standards for calibrating or conducting the treatment. The instructions provided in a kit according to the invention may be directed to suitable operational parameters in the form of a label or a separate insert. Optionally, the kit may further comprise a standard or control information so that the test sample can be compared with the control information standard to determine if whether a consistent result is achieved.
[0401] The container means of the kits will generally include at least one vial, test tube, flask, bottle, or other container means, into which a component may be placed, and preferably, suitably aliquoted. Where there is more than one component in the kit, the kit also will generally contain additional containers into which the additional components may be separately placed. However, various combinations of components may be comprised in a container. The kits of the present invention also will typically include a means for packaging the component containers in close confinement for commercial sale. Such packaging may include injection or blow-molded plastic containers into which the desired component containers are retained.
[0402] The practice of the present invention employs, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are well within the purview of the skilled artisan. Such techniques are explained fully in the literature, such as, Molecular Cloning: A Laboratory Manual, second edition (Sambrook, 1989); Oligonucleotide Synthesis (Gait, 1984); Animal Cell Culture (Freshney, 1987); Methods in Enzymology Handbook of Experimental Immunology (Weir, 1996); Gene Transfer Vectors for Mammalian Cells (Miller and Calos, 1987); Current Protocols in Molecular Biology (Ausubel, 1987); PCR: The Polymerase Chain Reaction, (Mullis, 1994); Current Protocols in Immunology (Coligan, 1991). These techniques are applicable to the production of the polynucleotides and polypeptides of the invention, and, as such, may be considered in making and practicing the invention. Particularly useful techniques for particular embodiments will be discussed in the sections that follow.
[0403] Although the present invention and its advantages have been described in detail, it should be understood that various changes, substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined in the appended claims.
[0404] Example embodiments are further described in the following numbered statements.
1. A method for screening inhibitors of CRISPR-Cas systems comprising:
[0405] incubating a set of candidate inhibitors in individual discrete volumes, each individual discrete volume comprising (i) a different candidate inhibitor, different concentration of an inhibitor, different combination of inhibitors, or different concentrations of the combination of inhibitors, and (ii) a labeled PAM-rich target oligonucleotide, a CRISPR-Cas effector protein, and a guide molecule, wherein the guide molecule targets binding of the CRISPR-Cas effector protein to the labeled PAM-rich target oligonucleotide;
[0406] selecting one or more putative inhibitors from the set of candidate inhibitors at least in part by detecting change in fluorescence polarization of the labeled PAM-rich target oligonucleotide, wherein inhibition of formation of a complex of the CRISPR-Cas and the guide molecule by the one or more of the candidate inhibitors leads to a decrease in fluorescence polarization of the labeled PAM-rich target oligonucleotide;
[0407] validating the one or more putative inhibitors based on a cell-based knockdown assay and a cell-based nuclease activity assay comprising use of a frame-shift reporter; and
[0408] selecting one or more final inhibitors based at least in part on the cell-based knockdown assay and the cell-based nuclease activity assay.
2. The method of statement 1, further comprising a counter-screen of the one or more putative inhibitors comprising measuring change in fluorescence polarization of the labeled PAM-rich target oligonucleotide in presence of the one or more putative inhibitors alone, wherein candidate inhibitors that increase fluorescence polarization beyond a defined cut-off value are excluded from the one or more putative inhibitors.
3. The method of statement 1 or 2, wherein the cell-based knockdown assay is performed by:
[0409] delivering the CRISPR-Cas effector protein, a nucleotide sequence encoding a polypeptide reporter, and a guide sequence targeting the nucleotide sequence encoding the polypeptide reporter to a population of cells in the individual discrete volumes, each individual discrete volume comprising the one or more putative inhibitors; and
[0410] detecting inhibitor activity by measuring changes in fluorescence, wherein an increase in fluorescence relative to a control indicates inhibition of CRISPR-Cas mediated knockdown of the polypeptide reporter.
4. The method of any one of statements 1-3, wherein the cell-based nuclease activity assay comprises:
[0411] delivering a first construct and a second construct to a population of cells in individual discrete volumes, each individual discrete volume comprising the one or more putative inhibitors, wherein the first construct encodes an out-of-frame first reporter and a downstream in-frame second reporter separated by a linker comprising a stop codon, and the second construct encodes the CRISPR-Cas effector protein and a guide molecule targeting the linker, wherein the CRISPR-Cas effector protein introduces a frameshift edit at the stop codon that shifts the first reporter in-frame; and
[0412] detecting inhibitor activity by measuring changes in expression of the first reporter, wherein decreased expression of the first reporter relative to a control indicates inhibition of CRISPR-Cas mediated nuclease activity.
5. The method of any one of statements 1-4, wherein detecting inhibitor activity is performed using high-content imaging and automated data analysis.
6. The method of any one of statements 1-5, wherein the polypeptide reporter is a fluorescent protein.
7. The method of statement 6, wherein the fluorescent protein is mKate2.
8. The method of any one of statements 1-7, wherein the first construct and the second construct are delivered in equimolar ratios.
9. The method of any one of statements 1-8, wherein the first reporter is a first fluorescent polypeptide detectable at a first wavelength or range of wavelengths, and the second reporter is a second fluorescent polypeptide detectable at a second wavelength or range of wavelengths.
10. The method of any one of statements 1-9, wherein the CRISPR-Cas effector protein, the nucleotide sequence encoding the polypeptide reporter, and the guide sequence targeting the nucleotide sequence encoding the polypeptide reporter are all encoded on a single construct.
11. The method of any one of statements 1-10, wherein the labeled PAM-rich target oligonucleotide comprises between 2 and 20 PAM regions per oligonucleotide.
12. The method of statement 11, wherein the labeled PAM-rich target oligonucleotide comprises 12PAM regions.
13. The method of any one of statements 1-12, where in the individual discrete volumes are droplets or wells of a multi-well plate.
14. The method of any one of statements 1-13, further comprising performing a transcription assay and/or a strand displacement assay to identify one or more final inhibitors.
15. A method of designing or identifying an inhibitor of a CRISPR protein, the method comprising: [0413] fitting a candidate molecule to a three-dimensional structure of one or more target regions of a PAM interaction (PI) domain of the CRISPR protein; and [0414] evaluating results of the fitting to determine ability of the candidate molecule to interact with the one or more target regions of the PI domain.
16. The method of statement 15, wherein the fitting is carried out on a computer.
17. The method of statement 15 or 16, further comprising determining the candidate molecule as an inhibitor of target nucleic acid modification by a CRISPR system which comprises the CRISPR protein.
18. The method of any one of statements 15-17, wherein the target nucleic acid modification comprises cleavage of the target nucleic acid.
19. The method of any one of statements 15-18, wherein the target nucleic acid modification comprises non-homologous end joining (NHEJ).
20. The method of any one of statements 15-19, wherein the target nucleic acid modification comprises homologous repair (HR).
21. The method of any one of statements 15-20, wherein the CRISPR protein is Cas9 and the PI domain is a PI domain of Cas9.
22. The method of any one of statements 15-21, wherein the CRISPR protein is Streptococcus pyogenes Cas9 (SpCas9) and the one or more target regions comprises one or more of Lys1107, Arg1333, and Arg1335.
23. The method of statement 22, wherein the one or more target regions comprises interacting amino acids having an alpha-carbon within 20 angstroms of Lys1107, Arg1333, and/or Arg1335.
24. The method of any one of statements 15-23, wherein the CRISPR protein is Staphylococcus aureus Cas9 (SaCas9) and the one or more target region comprises one or more of Asn985, Asn986, Arg991, Glu993, and Arg1015.
25. The method of statement 24, wherein the one or more target regions comprises interacting amino acids having an alpha-carbon within 20 angstroms of Asn985, Asn986, Arg991, Glu993, and/or Arg1015.
26. The method of statement 24 or 25, wherein the one or more target regions further comprises Tyr789, Tyr882, Lys886, Ans888, Ala889, and/or Leu909.
27. The method of any one of statements 15-26, wherein the CRISPR protein is Francisella novicida Cas9 (FnCas9) and the one or more target regions comprises one or more of Ser1473, Arg1474, Arg1556, and Arg1585.
28. The method of statement 27, wherein the one or more target regions further comprises interacting amino acids having an alpha-carbon within 20 angstroms of Ser1473, Arg1474, Arg1556, and/or Arg1585.
29. The method of statement 27 or 28, wherein the one or more target regions further comprises Glu1449, Asp1470, and/or Lys1451.
30. The method of any one of statements 15-29, wherein the protein is a Cas9 ortholog and the one or more target regions comprises one or more amino acids corresponding to Lys1107, Arg1333, or Arg1335 of SpCas9, or Asn985, Asn986, Arg991, Glu993, or Arg1015 of SaCas9, or Ser1473, Arg1474, Arg1556, of Arg1585 of FnCas9.
31. The method of any one of statements 15-29, wherein the CRISPR protein is Acidaminococcus sp. Cpf1 (AsCpf1) and the one or more target regions comprises one or more of Thr167, Ser542, Lys548, Asn552, Met604, and Lys607.
32. The method of statement 31, wherein the one or more target regions further comprises interacting amino acids having an alpha-carbon within 20 angstroms of Thr167, Ser542, Lys548, Asn552, Met604, and/or Lys607.
33. The method of any one of statements 15-32, wherein the CRISPR protein is Lachnospiraceae bacterium Cpf1 (LsCpf1) and the one or more target regions comprises one or more of Gly532, Lys538, Tyr542, and Lys595.
34. The method of statement 33, wherein the one or more target regions further comprises interacting amino acids having an alpha-carbon within 20 angstroms of Gly532, Lys538, Tyr542, and/or Lys595.
35. The method of any one of statements 15-34, wherein the protein is a Cpf1 ortholog and the target region comprises one or more amino acids corresponding to Thr167, Ser542, Lys548, Asn552, Met604, or Lys607 of AsCpf1, or Gly532, Lys538, Tyr542, or Lys595 of LsCpf1.
36. A method for regulating activity of a CRISPR-Cas system, comprising:
[0415] providing an inactive guide RNA comprising a regulatory domain bound by a lock nucleic acid different from the guide RNA; and
[0416] displacing the lock nuclei acid from the regulatory domain by a trigger nucleic acid, thereby activating the guide RNA, wherein the activated guide RNA forms a complex with a Cas enzyme.
37. The method of statement 36, wherein the regulatory domain is at a 5 end of the guide RNA.
38. The method of statement 36 or 37, the regulatory domain comprises a toehold sequence.
39. The method of statement 38, wherein the toehold sequence is from 6 nt to 10 nt in length.
40. The method of any one of statements 36-39, wherein the regulatory domain is capable of binding to a target nucleic acid.
41. The method of statement 40, wherein the target nucleic acid comprises a fluorescent label.
42. The method of statement 41, further comprising incubating the complex with the target nucleic acid, thereby removing the fluorescent label from the target nucleic acid.
43. The method of any one of statements 36-42, wherein the lock nucleic acid is RNA.
44. The method of any one of statements 36-43, wherein the lock nucleic acid is complementary to at least a part of the regulatory domain.
45. The method of statement 44, further comprising producing the lock nucleic acid by inducing expression of a gene encoding the lock nucleic acid.
46. The method of any one of statements 36-45, wherein the trigger nucleic acid is RNA.
47. The method of statement 46, further comprising producing the trigger nucleic acid by inducing expression a gene encoding the trigger nucleic acid.
48. The method of any one of statements 36-47, wherein the trigger nucleic acid is complementary to at least a part of the regulatory domain.
49. The method of any one of statements 36-48, wherein nuclease activity of the Cas enzyme is at least partially inactivated.
50. A composition comprising: a guide RNA comprising a regulatory domain or a nucleic acid encoding the guide RNA; and one or more of: a lock nucleic acid different from the guide RNA and configured to inactivate the guide RNA when binding to the regulatory domain, or a nucleic acid encoding the lock nucleic acid; and a trigger nucleic acid configured to displace the lock nucleic acid from the regulatory domain and activate the guide RNA, or a nucleic acid encoding the trigger nucleic acid.
51. The composition of statement 50, further comprising a Cas enzyme or a nucleic acid encoding the Cas enzyme.
52. A cell comprising the composition of statement 50 or 51.
53. A biomolecular circuit comprising the composition of statement 50 or 51.
54. A kit comprising the composition of statement 50 or 51.
[0417] The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.
EXAMPLES
Example 1Assay Development and Identification of Small Molecule Inhibitors of Cas9
[0418] Rationale and Preliminary Studies.
[0419] As discussed above, an active search is ongoing for off-switches of SpCas9. Currently, the best SpCas9 inhibitor (reported by Rauch et al.) is an Anti-CRISPR protein with a paltry efficacy of 25% inhibition in mammalian cells.50 Further, this protein is highly-negatively charged with poor PK/PD properties, and has shown delivery and immunogenicity problems. Applicants believed that a small-molecule SpCas9 inhibitor will resolve some of these issues. However, the identification of small molecule inhibitors of SpCas9 poses many challenges. First, inhibitor identification requires robust, orthogonal, sensitive, high-throughput, miniature, and inexpensive assays, which are currently unavailable. Second, SpCas9 is a single turnover enzyme that holds on to its DNA substrate with pM affinity, making the development of such assays challenging.51 Third, the inhibition of SpCas9 activity requires inhibition of two nuclease domains.3 Fourth, SpCas9 has many novel protein folds that limit our ability to leverage existing rational design approaches.52 To circumvent these challenges, Applicants focused on targeting the SpCas9-substrate PAM motif interaction as a way to identify novel small molecule inhibitors of Cas9. To this end, Applicants developed a several high-throughput biochemical assays for SpCas9 and performed a preliminary screen to identify small molecules that inhibit >50% of SpCas9 activity. Further, Applicants also found these molecules to inhibit SpCas9 activity in mammalian and bacterial cells at low micromolar concentrations.
Development of High-Throughput Primary and Secondary Assays.
[0420] SpCas9-PAM Binding Assays.
[0421] Disrupting PAM-sequence binding by SpCas9 (e.g., by mutating SpCas9 or the PAM-site) renders SpCas9 inactive..sup.53 Further, SpCas9 has a low affinity for the PAM-sequence, making the SpCas9-PAM interaction an Achilles' heel for inhibitor discovery. However, the low affinity creates a challenge in developing robust SpCas9-PAM binding assays, which Applicants overcame by leveraging the principle of multivalency; a DNA sequence bearing multiple PAM sites will have high affinity for SpCas9. Fluorescence polarization can be used to monitor protein-DNA interaction..sup.54 The binding of this PAM-rich DNA to a much larger SpCas9:gRNA complex will lower DNA's tumbling rate, which can be monitored by fluorescence polarization (
[0422] Cell-Based SpCas9 Activity Assays.
[0423] Applicants have also optimized several cell-based high-throughput assays to measure SpCas9 activity. Recently, Joung and co-workers have reported a U2OS.eGFP.PEST cell-line where eGFP knockout by SpCas9 leads to loss of fluorescence..sup.53, 57 By quantifying the percentage of eGFP negative cells using flow cytometry, one can estimate SpCas9 activity. Applicants have modified this assay by replacing the flow-cytometry readout with a more reproducible and high-throughput readout using a high-content, automated microscope and automated image analysis (
[0424] Small Molecule Screening and Hit Validation.
[0425] Applicants decided to leverage Broad Institute's performance diverse set as well as 100,000 diversity-oriented synthetic (DOS) compound library as these natural-product like molecules have proved effective against microbial proteins..sup.60 However, screening all of these compounds will be inefficient as compounds within a single library are relatively similar to each other, and may perform similarly in assays. The Computational Chemical Biology group at the Broad Institute has established a list of 10,000 compounds, called the Informer set, that maximally represent the diversity across all DOS compounds. For the pilot screening, Applicants decided to use this informer set (
[0426] Following the conventional norm, Applicants selected small molecules that lowered the fluorescence polarization signal by >3 of that of DMSO as candidates and categorized them according to their compound-class to generate an enrichment plot (
[0427] Applicants deployed biolayer inferometry (BLI) to determine the binding affinity of BRD7087 and SpCas9:gRNA complex by tethering the compound onto the sensor. Towards this end, Applicants synthesized a biotin-conjugate of BRD7087 (
[0428] After biophysical validation of the interaction of BRD7087 with SpCas9, Applicants performed cellular studies with this compound. First, Applicants determined if BRD7087 and BRD5779 were cytotoxic. Treatment of U2OS and HEK293T cells with these compounds did not significantly alter the cellular ATP-levels upon incubation up to 20 M concentration for 24 h (
[0429] Since BRD7087 and BRD5779 alter PAM-binding, they should inhibit dCas9-based technologies, including base-editing and transcriptional activation technologies. Applicants undertook the dCas9-cytidine deaminase conjugate (BE3).sup.19 targeting the EMX1 gene toward C.fwdarw.T conversion in the presence and absence of inhibitors at different concentrations. In this assay a ribonucleoprotein complex (BE3:gRNA) was incubated with either DMSO or compound at the specified concentration and delivered into HEK239T cells maintaining the corresponding compound concentration in the media. The base-editing efficiency was determined by isolating the genomic DNA followed by two-step barcoding the EMX1 gene and running on the MiSeq (Illumina) sequencer. Both the compounds BRD7087 and BRD5779 showed an efficient and dose-dependent inhibition of BE3-mediated base-editing (
[0430] After demonstrating inhibition of Cas9 and dCas9-based technologies, Applicants determined if BRD7087 and BRD5779 can block CRISPR-immunity of bacteria from phages. Applicants anticipated that SpCas9 inhibitors will disrupt the bacterial immunity and trigger lysis in the presence of phage. To test this hypothesis, Applicants exposed the immune bacterial cell S. aureus RN4220 strain62 to CRISPR targeting lytic phage NM44 in the presence and absence of SpCas9 inhibitor BRD7087 and BRD5779 at different concentrations. Bacterial cell lysis, which was followed by OD600 measurements, was observed in the presence of our SpCas9 inhibitors and phage (
[0431] BRD7087 and BRD5779 possess three chiral centers (3aR,4S,9bR) and Applicants wished to determine if different stereoisomers have similar nuclease inhibition activity. Applicants tested four isomers of each compound BRD7087 and BRD5779 in EGFP-disruption assay (not shown). Strikingly, the enantiomer of BRD7087 (3aR,4S,9bR), that is BRD5039 (3aS,4R,9bS), was equipotent as BRD7087 in EGFP-disruption assay. However, the other two diastereomers BRD2161 (3aR,4R,9bR) and BRD0750 (3aS,4S,9bS) were less potent (not shown). Similar trend was observed for BRD5779 and its stereoisomers (not shown).
[0432] Small molecule inhibitors of CRISPR-Cas9 will find multifactorial use in basic, biomedical, and defense research. Applicants report a suite of assays and workflow for discovery of small molecule inhibitors of SpCas9, and demonstrate the utility of these assays by identifying small molecule inhibitors of SpCas9. The availability of such workflow will catalyze discovery of inhibitors for not only SpCas9 but also several other next-generation CRISPR-associated nucleases. Our screening strategy involved disrupting PAM-binding by SpCas9 and Applicants were able to demonstrate >60% inhibition of nuclease activity of SpCas9 in mammalian and bacterial cells, as well as inhibition of dCas9 based transcriptional and base editing technologies. Thus, Applicants envision our SpCas9 inhibitors to find utility in wide variety of applications. Our future studies will involve identification of binding sites of our inhibitors and structure-guided potency optimization. Further, Applicants are interested in determining if the disruption of CRISPR-immunity by our SpCas9 inhibitors will propel bacteria to evolve CRISPR system.
Materials and Methods
[0433] SpCas9 expression and purification. SpCas9 was expressed and purified following a previously reported protocol 1.
[0434] BL21 Star (DE3)-competent E. coli cells were transformed with plasmids encoding the bacterial codon-optimized SpCas9 with a His6 N-terminal purification tag. A single colony was grown overnight in TB containing 25 g ml-1 kanamycin at 37 C. The cells were diluted 1:1000 into 1 L of the same media and grown at 37 C. until OD600=0.600.7. The cultures were cooled down to 18 C. for 30 min and protein expression was induced with 1 mM isopropyl--D-1-thiogalactopyranoside (GoldBio). Expression was sustained for 16-18 h with shaking at 18 C. The subsequent purification steps were carried out at 4 C. Cells were collected by centrifugation and resuspended in cell collection buffer (100 mM tris(hydroxymethyl)-aminomethane (Tris)-HCl, pH 8.0, 1 M KCl, 20% glycerol, 5 mM tris(2-carboxyethyl)phosphine (TCEP; GoldBio), 1 mM phenylmethane sulfonyl fluoride (Sigma-Aldrich) and 1 mg/mL Lysozyme. Cells were lysed by sonication (10 min total, 30 s on, 30 s off) and the lysate cleared by centrifugation at 15,000 g (1 h).
[0435] The cleared lysate was incubated with His-Pur nickel-nitriloacetic acid (nickel-NTA) resin with rotation at 4 C. for 2 h. The resin was washed with 215 column volumes of cell collection buffer before bound protein was eluted with elution buffer (100 mM tris(hydroxymethyl)-aminomethane (Tris)-HCl, pH 8.0, 100 mM KCl, 20% glycerol, 5 mM TCEP (GoldBio), 250 mM imidazole). The resulting protein fraction was further treated with TEV protease at 4 C. for 24 h in 20 mM (Tris)-HCl, pH 8.0, 100 mM KCl, 20% glycerol, 5 mM TCEP and then purified on a 5 mL Hi-Trap HP SP (GE Healthcare) cation exchange column with KCl gradient from 0.1 M to 1 M using an Akta Pure FPLC. Protein-containing fractions were concentrated using a column with a 100 kDa cutoff (Millipore) centrifuged at 3,000 g. The Hi-Trap purified followed by running through a HiLoad Superdex 200 column using 20 mM (Tris)-HCl, pH 8.0, 100 mM KCl, 20% glycerol, 5 mM TCEP buffer. The purified protein was validated by running a denaturing gel and snap-frozen in liquid nitrogen and stored at 80 C.
[0436] In vitro transcription of sgRNA. Linear DNA fragments containing the T7 RNA polymerase promoter sequence upstream of the desired 20 bp sgRNA protospacer and the sgRNA backbone were generated by PCR (Q5 Hot Start MasterMix, New England Biolabs) using primers forward: AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTT AACTTGCTATTTCTAGCTCTAAAAC-3 and reverse: 5-TAATACGACTCACTATAGCTATAGGACGCGACCGAAAGTTTTAGAGCTAGAAAT-3 (SEQ ID Nos. 3 and 4). sgRNA was transcribed with the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) at 37 C. for 16 h with 150 ng of linear template per 20 l reaction. sgRNA was purified using the MEGAClear Transcription Clean Up Kit (Thermo Fisher), according to the manufacturer's instructions. Purified sgRNAs were stored in aliquots at 80 C.
[0437] FP Assay.
[0438] Fluorescence Polarization assay was performed in a 384-well plate (Corning 3575) format using a total reaction volume of 30 L. A 25 nM FITC-labeled 12PAM DNA was titrated against increasing concentration of Cas9:gRNA (1:1.2) complex in a 20 mM Tris-HCl buffer of pH 7.5 containing 150 mM KCl, 5 mM MgCl.sub.2, 1 mM DTT. The fluorescence polarization signal was measured using a microplate reader (PerkinElmer, EnVision). The experiments were performed in triplicates and the data were processed in GraphPad Prism 7. The Z-value was calculated following the formula:
[0439] Where 1 and 2 are the standard deviations of DMSO control and Cas9:gRNA control respectively. 1 and 2 are the mean FP-signal intensities for DMSO control and Cas9:gRNA control respectively.
[0440] Competition Assay. In a 384-well plate (Corning 3575), 25 nM FITC-labeled 12PAM DNA was incubated with 50 nM SpCas9:gRNA (1:1.2) complex in the presence and absence of unlabeled DNA in excess (10 and 50) in a 20 mM Tris-HCl buffer of pH 7.5 containing 150 mM KCl, 5 mM MgCl.sub.2, 1 mM DTT. The fluorescence polarization signal was measured using a microplate reader (PerkinElmer, EnVision). The number of PAM sequence in the unlabeled competitor DNA was varied from 0, 4, 8, and 12 PAMs. The experiments were performed in triplicates and the data were processed in GraphPad Prism 7.
[0441] Differential Scanning Fluorimetry (DSF). Protein melting experiments were performed in a 384-well format using a 6 L reaction volume in a LightCycler 480 instrument. A 3.7 M SpCas9:gRNA (1:1.2) was incubated with equimolar concentration of DNA with different PAM density (0, 4, 8, and 12) for 15 min in a 20 mM Tris-HCl buffer of pH 7.5 containing 150 mM KCl, 5 mM MgCl.sub.2, 1 mM DTT. Then, 2 L of 50SYPRO Orange was added before running the melting cycle with a temperature gradient of 4.8 C./min. The experiments were performed in triplicates and data were processed in Roche LightCycler 480 Protein Melting software.
[0442] Bio-Layer Interferometry (BLI). DNA-Cas9 interactions were also probed using BLI experiments in an Octet Red384 (Pall ForteBio) instrument. The experiments were performed in a 96-well format with 180 L reaction volume using biotinylated ds-DNA and streptavidin sensors. A 300 nM of biotinylated DNA with different PAM density (0, 2, 4, and 8) were loaded onto the sensors for 180 s in 20 mM Tris buffer of pH 7.4, 100 mM KCl, 5 mM MgCl.sub.2, 1 mM DTT, 0.01% Tween, 50 g/mL Heparin. Excess DNA was washed off for 60 s in reaction buffer followed by association with 200 nM of Cas9-gRNA (1:1.2) for 300 s. The complex was then allowed to dissociate for 3600 s in the reaction buffer. All the response curves were normalized against the reference sensor without Cas9:gRNA.
[0443] Compound Screening. The compound library screening was performed in two steps. Initially, the DOS informer set of library (10,000 compounds) was screened in the FP-based assay to identify the enriched hit libraries. Then, the specific enriched libraries were also screened using the same assay. The screening assay was performed in a 384-well plate format with a total reaction volume of 30 L. Initially, a 25 L of 60 nM of SpCas9 was transferred to the compound testing lanes of the 384-well plate except for the positive control wells. However, a 25 L of solution containing 60 nM SpCas9 and 300 nM unlabeled 12PAM ds-DNA was transferred to the positive control wells. In the next step, 25 nL of DMSO alone or 10 mM compounds in DMSO were transferred to the reaction mixture and incubated for 30 min at room temperature. Next, a 5 L solution containing 360 nM gRNA and 150 nM FAM-labeled 12PAM ds-DNA was added and incubated for 15 min at room temperature before acquiring the fluorescence polarization signal under a microplate reader (PerkinElmer, EnVision). Compounds were screened in duplicates and the data were processed to calculate the Z-score () values and plotted in Spotfire analysis software (TIBCO). The hit compounds (Z-score >3) were then clustered according to the class of compound and a hit-rate plot was generated. The entire specific libraries of the enriched ones were then screened in the same FP-assay.
[0444] Counter-screening. Counter-screening assay was performed in a similar format as followed in the compound-screening assay. In a 384-well plate, a 30 L of 25 nM FAM-labeled 12PAM ds-DNA was transferred to each well. Next, 25 nL of either DMSO or compound in DMSO were transferred and incubated for 15 min before the fluorescence polarization signal was acquired in a microplate reader (PerkinElmer, EnVision). The change in the FP signal was calculated in percentile and plotted against compounds' average Z-score values obtained from the original compound-screening assay. Compound that resulted in a >3 change in the Z-score but did not alter the FP-signal by >10% in the counter-screen assay were selected as the potential hits. A molecular structure based similarity search was also performed and compounds with >0.8 similarity index was included in the hit list.
[0445] Compound-Cas9 interaction in BLI. The experiments were performed in a 96-well format with 180 L reaction volume using biotinylated compound BRD7087-Biotin and streptavidin sensors. 1 M of the biotinylated compound was loaded onto the sensors for 180 s in 20 mM Tris buffer of pH 7.4, 100 mM KCl, 5 mM MgCl.sub.2, 1 mM DTT, 0.01% Tween. The compound loaded sensors were then allowed to associate with the different concentration of SpCas9:gRNA complex (1-0.15 M) for 300 s followed by dissociation in the reaction buffer. Reference sensor was loaded with compound and allowed to associate and dissociate in the reaction buffer alone. The response curves were fitted with a 2:1 stoichiometric model and a global fit steady-state analysis were performed using manufacturer inbuilt protocol. The experiment was performed in three replicates.
[0446] The competitive experiments were performed using Biotin-linker fragment. In this experiment, streptavidin sensors were pre-incubated with 10 M of Biotin-linker before dipping into a solution of either 1 M BRD7087-Biotin or reaction buffer alone. Sensors were then allowed to associate with different concentration of SpCas9:gRNA complex or buffer alone.
[0447] NMR binding assay. All samples were prepared with 50 M BRD7087 in 20 mM Tris buffer (pH=7.4) with varying concentrations of SpCas9:gRNA in a 3 mm NMR tube. Experiments were performed on a 600 MHz (19F: 564.71 MHz) Bruker Avance III NMR spectrometer equipped with a 5 mm QCI-F CryoProbe and a SampleJet for automated sample handling. To acquire spectra, a standard one-pulse 19F experiment with WALTZ-16 for proton decoupling during acquisition, a 5 second recycle delay, and 256 scans was used. All spectra were recorded at 280 K. NMR data were apodized with a 1 Hz exponential function prior to Fourier transformation. All spectra were baseline corrected; peak widths and intensities were extracted using the automated line-fitting feature provided with the MNova software package. Determination of the value of Kd was accomplished using least squares fitting to the expression given in Equation 8 in the paper by Shortridge et al.2.
[0448] Kd values obtained by NMR rely on the assumption that ligand binding is in fast-exchange, which typically holds true for ligands with Kd in the 0.5 M to 20 mM range. Additional sources of error could be variations in the concentrations of the protein and ligand, an incomplete curve that does not reach complete occupancy, or incomplete relaxation leading to underestimation of the fractional occupancy.
[0449] Cell culture. All cells were cultured at 37 C. in a humidified 5% CO2 atmosphere. HEK293T cells (Life Technologies) used in transcriptional activation, NHEJ, and mCherry expression assays were cultured in Dulbecco's modified Eagle's medium (CellGro) supplemented with 10% fetal bovine serum (CellGro) and 1 penicillin/streptomycin/glutamax (CellGro). U2OS.eGFP-PEST cells stably integrated with an eGFP-PEST fusion gene were maintained in Dulbecco's modified Eagle's medium (Life Technologies) supplemented with 10% FBS, 1 penicillin/streptomycin/glutamax (Life Technologies) and 400 g/mL of the selection antibiotic G418. Cells were continuously maintained at <90% confluency. All cell lines were sourced commercially or were functionally validated. Cells were periodically tested for mycoplasma contamination using the MycoAlert PLUS Mycoplasma Detection Kit (Lonza).
[0450] Cas9 Nuclease activity in EGFP disruption assay. Approximately 200,000 U2OS.eGFP-PEST cells were nucleofected with 400 ng of SpCas9 (Addgene Plasmid #43861) and 40 ng of sgRNA (pFYF1320 EGFP Site #1, Addgene Plasmid #47511) expressing plasmids along with a Td-tomato-encoding plasmid using the SE Cell Line 4D-Nucleofector X Kit (Lonza) according to the manufacturer's protocol. Approximately 20,000 transfected cells/well in 3 replicates were plated in a 96-well plate (Corning 3904). Cells were allowed to grow in the indicated amount of compound or DMSO for 24 h post transfection. Cells were then fixed using 4% paraformaldehyde and imaged with the HCS NuclearMask Blue Stain (Life Technologies) as the nuclear counter-staining agent. Imaging was performed with an IXM 137204 ImageXpress Automated High Content Microscope (Molecular Devices) at 10 magnification under three excitation channels (blue, green and red) with 9 acquiring sites per well. Images were analyzed in the MetaXpress software and data were plotted using GraphPad Prism 6. The Z-value was calculated following the formula:
[0451] Where 1 and 2 are the standard deviations of DMSO control and Cas9:gRNA control respectively. 1 and 2 are the mean % GFP-cell population for DMSO control and Cas9:gRNA control respectively.
[0452] Western blot analysis. U2OS.eGFP.PEST cells stably expressing EGFP were incubated either in the absence or presence of compound BRD7087 and BRD5779 for 24 h at 37 C. prior to harvesting the cells. Cell suspensions were spun down at 1000g for 5 min and processed for cell lysis. Cells were resuspended in RIPA total cell lysis buffer (abcam) and incubated at 4 C. for 10 min. The cell suspensions were then vortexed for 10 min at 4 C. followed by spinning down at 16,000g for 15 min at 4 C. The supernatant was transferred to a fresh tube and processed for western-blotting.
[0453] Western blotting was performed following SDS-PAGE gel electrophoresis. In a typical experimental protocol, 40 g of normalized proteins were electrophoresed on a 4-12% Bis/Tris gel. The protein bands were transferred to a PVDF membrane and probed with primary -HSF1(c) (Abcam # ab52757) and/or -CRISPR/Cas9 antibody (Abcam # ab191468). -Actin antibody (Sigma) was used as a protein loading control.
[0454] NHEJ assay. Approximately 8,000 cells/well were plated in a 96-well format 24 h before transiently transfected with a total 100 ng of DN66 (mCherry-TAG-GFP reporter) and DN78 (SpCas9 and gRNA) plasmids (1:1) using lipofectamine 2000 (Life Technologies) 3. Transfected cells were allowed to grow in the indicated amount of compound or DMSO for 24 h. Cells were then fixed using 4% paraformaldehyde and imaged with the HCS NuclearMask Blue Stain (Life Technologies) as the nuclear counter-staining agent. Imaging was performed with an IXM 137204 ImageXpress Automated High Content Microscope (Molecular Devices) at 20 magnification under three excitation channels (blue, green and red) with 9 acquiring sites per well. Images were analyzed in the MetaXpress software to determine the % NHEJ and the data were plotted using GraphPad Prism 6. The Z-value was calculated following the formula:
[0455] Where 1 and 2 are the standard deviations of DN66 transfected wells and (DN66+DN78) transfected wells respectively. 1 and 2 are the mean % GFP-cell population for DN66 transfected wells and (DN66+DN78) transfected wells respectively.
[0456] mKate2 expression assay. Approximately 8,000 cells/well were plated in a 96-well format 24 h before transiently transfected with 100 ng of either CgRNA (Addgene Plasmid #64955) or T1gRNA (Addgene Plasmid #62717) plasmids using lipofectamine 2000 (Life Technologies). Transfected cells were allowed to grow in the indicated amount of compound or DMSO for 24 h. Cells were then fixed using 4% paraformaldehyde and imaged with the HCS NuclearMask Blue Stain (Life Technologies) as the nuclear counter-staining agent. Imaging was performed with an IXM 137204 ImageXpress Automated High Content Microscope (Molecular Devices) at 20 magnification under two excitation channels (blue and red) with 9 acquiring sites per well. Images were analyzed in the MetaXpress software to determine the % mKate2 positive cells and the % NHEJ was calculated following a reported protocol and plotted using GraphPad Prism 6. The Z-value was calculated following the formula:
[0457] Where 1 and 2 are the standard deviations of cgRNA transfected wells and T1-gRNA transfected wells respectively. 1 and 2 are the mean % RFP+ cell population for CgRNA transfected wells and T1gRNA transfected wells respectively.
[0458] Transcription activation experiments and quantitative RT-PCR analyses. For transcription activation experiments 250,000 cells/well were plated in a 12 well plate. The cells were transiently transfected with a 1:1:1 mass ratio of the dCas9 plasmid, MS2-P65-HSF1 effector plasmid and the sgRNA plasmid targeting the HBG1 gene or an RFP control plasmid. A total of 1.6 g plasmid DNA was transfected using Lipofectamine 2000 (Life Technologies) according to manufacturer's protocol. Immediately after transfection, the cells were treated with an appropriate dose of the small molecule inhibitors for 48 hours following which the cells were harvested and RNA was extracted using the EZNA Total RNA kit I (Omega) as per manufacturer's instructions. 1 g total cellular RNA was used to perform reverse transcription using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) or the qScript cDNA Synthesis Kit (QuantaBio). qPCR reactions were performed to quantify RNA expression using the TaqMan probes (Life Technologies, HBG1/HBG2: Hs00361131_g1 and ACTB: Hs01060665_g1) and TaqMan Fast Advanced Master Mix (Life Technologies) in 54 multiplexed reactions and 384-well format using the LightCycler 480 Instrument II (Roche). For each sample, six technical replicates were performed. Data were analyzed using the LightCycler 480 software (Roche) by the Ct method: Ct values for the gene of interest (HBG1) were normalized to Ct values for the housekeeping gene (ACTB) and fold-changes in the expression level of the gene of interest were normalized to RFP-transfected control. The data are reported as meanS.E.M. for technical replicates.
[0459] Base-Editing Experiment.
[0460] BE3 expression and purification. BE3 was expressed and purified as previously reported 4. BL21 Star (DE3)-competent E. coli cells were transformed with plasmids encoding the bacterial codon-optimized base editor with a His6 N-terminal purification tag. A single colony was grown overnight in 2YT broth containing 50 g ml-1 kanamycin at 37 C. The cells were diluted 1:400 into 4 L of the same media and grown at 37 C. until OD600=0.70-0.75. The cultures were incubated on ice for 3 h and protein expression was induced with 1 mM isopropyl--D-1-thiogalactopyranoside (GoldBio). Expression was sustained for 16-18 h with shaking at 18 C. The subsequent purification steps were carried out at 4 C. Cells were collected by centrifugation and resuspended in cell collection buffer (100 mM tris(hydroxymethyl)-aminomethane (Tris)-HCl, pH 8.0, 1 M NaCl, 20% glycerol, 5 mM tris(2-carboxyethyl)phosphine (TCEP; GoldBio), 0.4 mM phenylmethane sulfonyl fluoride (Sigma-Aldrich) and 1 EDTA-free protease inhibitor pellet (Roche)). Cells were lysed by sonication (6 min total, 3 s on, 3 s off) and the lysate cleared by centrifugation at 25,000 g (20 min).
[0461] The cleared lysate was incubated with His-Pur nickel-nitriloacetic acid (nickel-NTA) resin with rotation at 4 C. for 90 min. The resin was washed with 215 column volumes of cell collection buffer before bound protein was eluted with elution buffer (100 mM tris(hydroxymethyl)-aminomethane (Tris)-HCl, pH 8.0, 0.5 M NaCl, 20% glycerol, 5 mM TCEP (GoldBio), 200 mM imidazole). The resulting protein fraction was further purified on a 5 ml Hi-Trap HP SP (GE Healthcare) cation exchange column using an Akta Pure FPLC. Protein-containing fractions were concentrated using a column with a 100 kDa cutoff (Millipore) centrifuged at 3,000 g, and the concentrated solution was sterile-filtered through a 22-m polyvinylidene difluoride membrane (Millipore).
[0462] After sterile filtration, proteins were quantified with Reducing Agent Compatible Bicinchoninic acid assay (Pierce Biotechnology), snap-frozen in liquid nitrogen and stored in aliquots at 80 C.
[0463] In vitro transcription of sgRNA. Linear DNA fragments containing the T7 RNA polymerase promoter sequence upstream of the desired 20 bp sgRNA protospacer and the sgRNA backbone were generated by PCR (Q5 Hot Start MasterMix, New England Biolabs) using primers forward: (SEQ ID Nos. 5 and 6) 5-TAATACGACTCACTATAGGGAGTCCGAGCAGAAGAAGAAGTTTTAGAGCTAG AAATAGCA-3 and reverse: 5-AAAAAAAGCACCGACTCGGTGCCAC-3 and concentrated on minelute columns (Qiagen). sgRNA was transcribed with the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) at 37 C. for 14-16 h with 400 ng of linear template per 20 l reaction. sgRNA was purified using the MEGAClear Transcription Clean Up Kit (Thermo Fisher), according to the manufacturer's instructions. Purified sgRNAs were stored in aliquots at 80 C.
[0464] Protein transfection of base editor BE3 into HEK293T cells. HEK293T cells were seeded on 48-well BioCoat poly-D-lysine plates (Corning) in 250 L of antibiotic-free medium and transfected at 70% confluency. Prior to protein transfection, cells were incubated with 2 L of DMSO-suspended BRD7087 or BRD5779 at the indicated concentration for 2-3 hours. BE3 protein was incubated with 1.1 molar excess of EMX1-targeting sgRNA at a final concentration ratio of 200 nM:220 nM (based on a total well volume of 275 L). The complex was mixed with 0.2 L of compound for five minutes, incubated with 1.5 L Lipofectamine 2000 (Thermo Fisher) and transfected according to the manufacturer's protocol plasmid delivery. The cells and ribonucleoprotein complex were incubated with compounds at final concentrations of 1.25 M, 2.5 M, 5 M, 10 M or 20 M.
[0465] Purifications and sequencing of genomic DNA. Transfected cells were harvested after 72 h in 50 L of lysis buffer (10 mM Tris-HCl pH 8.0, 0.05% SDS, 25 g/mL proteinase K) and incubated at 37 C. for 1 h. Cell lysates were heated at 85 C. for 15 min to denature proteinase K. For the first PCR, genomic DNA was amplified to the top of the linear range using Phusion Hot Start II DNA polymerase (New England Biolabs) according to the manufacturer's instructions. For all amplicons, the PCR protocol used was an initial heating step for 1 min at 98 C. followed by an optimized number of amplification cycles (10 s at 98 C., 20 s at 68 C., 15 s at 72 C.). qPCR was performed to determine the optimum number of cycles for each amplicon. Amplified DNA was purified using RapidTip2 (Diffinity Genomics) and barcoded with a further PCR. Sequencing adapters and dual-barcoding sequences are based on the TruSeq Indexing Adapters (Illumina). Barcoded samples were pooled and purified by gel extraction (Qiagen) before quantification using the Qubit dsDNA HS Kit (Thermo Fisher) and qPCR (KAPA BioSystems) according to the manufacturer's instructions. Sequencing of pooled samples was performed using a single-end read from 260 to 300 bases on the MiSeq (Illumina) according to the manufacturer's instructions.
[0466] Analysis of base-edited sequences. Nucleotide frequencies were analyzed using a previously described MATLAB script 5. Briefly, the reads were aligned to the reference sequence via the Smith-Waterman algorithm. Base calls with Q-scores below 30 were replaced with a placeholder nucleotide (N). This quality threshold results in nucleotide frequencies with an expected theoretical error rate of 1 in 1,000.
[0467] To distinguish small molecule-induced inhibition of C.fwdarw.T editing from artefactual C.fwdarw.T editing, Applicants compared the sequencing reads from cells treated with base-editor in the presence of small molecule to the sequencing reads from base-edited cells not exposed to small molecule. A Student's two-tailed t-test was used to determine if inhibition of C.fwdarw.T editing by small-molecule is statistically significant with P<0.05 as the threshold.
[0468] Bacterial study. Plasmid pRH248 harboring SpCas9, tracrRNA and a single-spacer array (CGTGTAAAGACATATTAGATCGAGTCAAGG) (SEQ ID NO:7) targeting phage NM44 was constructed via BsaI cloning onto pDB114 as described in Heler et al 6. Plate reader growth curves of bacteria infected with phage were conducted as described previously with minor modifications 7. Overnight cultures were diluted 1:100 into 2 ml of fresh BHI supplemented with appropriate antibiotics and 5 mM CaCl2 and grown to an OD600 of 0.2. Immune cells carrying pRH248 were diluted with cells lacking CRISPR-Cas in a 1:10,000 ratio. Following a 15-minute pre-incubation with DMSO or with varying amounts of inhibitors (5-20 M), the cultures were infected with NM44 at an initial MOI of 1. To produce plate reader growth curves, 200 L of infected cultures, normalized for OD600, were transferred to a 96-well plate in triplicate. OD600 measurements were collected every 10 minutes for 16 hours. Similarly, growth curves to evaluate the toxicity of the compounds at 20 M (
TABLE-US-00012 TABLE 3 List of hit compounds from the counter-screening assay of Pictet- Spengler library and their structurally similar analogs. Index Compound ID 1 BRD3326 2 BRD1701 3 BRD2911 4 BRD1368 5 BRD7682 6 BRD1830 7 BRD2473 8 BRD0159 9 BRD5813 10 BRD4249 11 BRD7299 12 BRD8786 13 BRD0568 14 BRD7713 15 BRD3389 16 BRD4048 17 BRD2679 18 BRD3326
TABLE-US-00013 TABLE 3 List of hit compounds from the counter-screening assay of Povarov library and their structurally similar analogs. Index Compound ID 1 BRD7087 2 BRD5779 3 BRD4592 4 BRD1098 5 BRD7032 6 BRD6688 7 BRD5737 8 BRD7801 9 BRD1476 10 BRD2810 11 BRD6201 12 BRD5762 13 BRD8312 14 BRD7804 15 BRD2878 16 BRD8575 17 BRD7481 18 BRD5903 19 BRD3119 20 BRD2161 21 BRD8480 22 BRD3978 23 BRD6467 24 BRD5039 25 BRD0489 26 BRD1794 27 BRD4326 28 BRD0750 29 BRD7037 30 BRD7147
TABLE-US-00014 TABLE 5 Table containing data that was used to estimate the ligand binding affinity based on the method described by Shortridge et. al. The linewidth (LW) increases with increasing protein concentration, as expected. Peak intensity values were used to measure the Fractional Occupancy using the relationship given in the paper (1-I.sub.bound/I.sub.0), where I.sub.0 is the intensity of the peak with no protein in the sample. The peak area remains relatively constant, as expected for a fixed concentration of ligand. The value of K.sub.d was estimated by nonlinear least-squares fitting of expression from the reference. RAW DATA EXTRACTED FROM SPECTRA [Ligand], [Protein:RNA], LW Peak Fractional (M) (M) (Hz) Intensity Peak Area Occupancy 50 0 4.1 572470.95 3151271.718 0 50 0.75 4.3 497630.81 2968891.536 0.130731769 50 1.0 4.6 468481.06 2999269.636 0.181650947 50 1.25 5.3 398322.72 2964107.303 0.304204484 50 1.5 5.9 375769.97 3176044.761 0.343599933 50 1.75 6.3 342640.49 3020022.312 0.401470957
REFERENCES
[0469] 1. Doudna, J. A.; Charpentier, E., Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science 2014, 346 (6213), 1258096. [0470] 2. Hsu, P. D.; Lander, E. S.; Zhang, F., Development and applications of CRISPR-Cas9 for genome engineering. Cell 2014, 157 (6), 1262-78. [0471] 3. Jinek, M.; Chylinski, K.; Fonfara, I.; Hauer, M.; Doudna, J. A.; Charpentier, E., A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 2012, 337 (6096), 816-21. [0472] 4. Jinek, M.; East, A.; Cheng, A.; Lin, S.; Ma, E.; Doudna, J., RNA-programmed genome editing in human cells. eLife 2013, 2, e00471. [0473] 5. Cong, L.; Ran, F. A.; Cox, D.; Lin, S.; Barretto, R.; Habib, N.; Hsu, P. D.; Wu, X.; Jiang, W.; Marraffini, L. A.; Zhang, F., Multiplex genome engineering using CRISPR/Cas systems. Science 2013, 339 (6121), 819-23. [0474] 6. Mali, P.; Yang, L.; Esvelt, K. M.; Aach, J.; Guell, M.; DiCarlo, J. E.; Norville, J. E.; Church, G. M., RNA-guided human genome engineering via Cas9. Science 2013, 339 (6121), 823-6. [0475] 7. Gasiunas, G.; Barrangou, R.; Horvath, P.; Siksnys, V., Cas9-crRNA ribonucleoprotein complex mediates specific DNA cleavage for adaptive immunity in bacteria. Proceedings of the National Academy of Sciences of the United States of America 2012, 109 (39), E2579-86. [0476] 8. Dahlman, J E; Abudayyeh, O. O.; Joung, J.; Gootenberg, J. S.; Zhang, F.; Konermann, S., Orthogonal gene knockout and activation with a catalytically active Cas9 nuclease. Nat Biotechnol 2015, 33 (11), 1159-61. [0477] 9. Merkle, F. T.; Neuhausser, W. M.; Santos, D.; Valen, E.; Gagnon, J. A.; Maas, K.; Sandoe, J.; Schier, A. F.; Eggan, K., Efficient CRISPR-Cas9-mediated generation of knockin human pluripotent stem cells lacking undesired mutations at the targeted locus. Cell reports 2015, 11 (6), 875-883. [0478] 10. He, X.; Tan, C.; Wang, F.; Wang, Y.; Zhou, R.; Cui, D.; You, W.; Zhao, H.; Ren, J.; Feng, B., Knock-in of large reporter genes in human cells via CRISPR/Cas9-induced homology-dependent and independent DNA repair. Nucleic Acids Res 2016, 44 (9), e85. [0479] 11. Lin, S.; Staahl, B. T.; Alla, R. K.; Doudna, J. A., Enhanced homology-directed human genome engineering by controlled timing of CRISPR/Cas9 delivery. eLife 2014, 3, e04766. [0480] 12. Shalem, O.; Sanjana, N. E.; Hartenian, E; Shi, X.; Scott, D. A.; Mikkelson, T.; Heckl, D.; Ebert, B. L.; Root, D. E.; Doench, J. G.; Zhang, F., Genome-scale CRISPR-Cas9 knockout screening in human cells. Science 2014, 343 (6166), 84-87. [0481] 13. Chen, B.; Gilbert, L. A.; Cimini, B. A.; Schnitzbauer, J.; Zhang, W.; Li, G. W.; Park, J.; Blackburn, E. H.; Weissman, J. S.; Qi, L. S.; Huang, B., Dynamic imaging of genomic loci in living human cells by an optimized CRISPR/Cas system. Cell 2013, 155 (7), 1479-91. [0482] 14. Hilton, I. B.; D'Ippolito, A. M.; Vockley, C. M.; Thakore, P. I.; Crawford, G. E.; Reddy, T. E.; Gersbach, C. A., Epigenome editing by a CRISPR-Cas9-based acetyltransferase activates genes from promoters and enhancers. Nat Biotechnol 2015, 33 (5), 510-7. [0483] 15. Dominguez, A. A.; Lim, W. A.; Qi, L. S., Beyond editing: repurposing CRISPR-Cas9 for precision genome regulation and interrogation. Nat Rev Mol Cell Biol 2016, 17 (1), 5-15. [0484] 16. Shalem, O.; Sanjana, N. E.; Zhang, F., High-throughput functional genomics using CRISPR-Cas9. Nature reviews. Genetics 2015, 16 (5), 299-311. [0485] 17. Ma, H.; Naseri, A.; Reyes-Gutierrez, P.; Wolfe, S. A.; Zhang, S.; Pederson, T., Multicolor CRISPR labeling of chromosomal loci in human cells. Proceedings of the National Academy of Sciences of the United States of America 2015, 112 (10), 3002-7. [0486] 18. Fujita, T.; Fujii, H., Efficient isolation of specific genomic regions and identification of associated proteins by engineered DNA-binding molecule-mediated chromatin immunoprecipitation (enChIP) using CRISPR. Biochemical and biophysical research communications 2013, 439 (1), 132-6. [0487] 19. Komor, A. C.; Kim, Y. B.; Packer, M. S.; Zuris, J. A.; Liu, D. R., Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage. Nature 2016, 533 (7603), 420-4. [0488] 20. Gantz, V. M.; Bier, E., The dawn of active genetics. BioEssays: news and reviews in molecular, cellular and developmental biology 2016, 38 (1), 50-63. [0489] 21. Esvelt, K. M.; Smidler, A. L.; Catteruccia, F.; Church, G. M., Concerning RNA-guided gene drives for the alteration of wild populations. Elife 2014, 3. [0490] 22. Champer, J.; Buchman, A.; Akbari, O. S., Cheating evolution: engineering gene drives to manipulate the fate of wild populations. Nature reviews. Genetics 2016, 17 (3), 146-59. [0491] 23. Cox, D. B.; Platt, R. J.; Zhang, F., Therapeutic genome editing: prospects and challenges. Nat Med 2015, 21 (2), 121-31. [0492] 24. Yin, H.; Xue, W.; Chen, S.; Bogorad, R. L.; Benedetti, E.; Grompe, M.; Koteliansky, V.; Sharp, P. A.; Jacks, T.; Anderson, D. G., Genome editing with Cas9 in adult mice corrects a disease mutation and phenotype. Nature biotechnology 2014, 32 (6), 551-3. [0493] 25. Doudna, J. A., Genomic engineering and the future of medicine. Jama 2015, 313 (8), 791-2. [0494] 26. Ding, Q.; Strong, A.; Patel, K. M.; Ng, S. L.; Gosis, B. S.; Regan, S. N.; Cowan, C. A.; Rader, D. J.; Musunuru, K., Permanent alteration of PCSK9 with in vivo CRISPR-Cas9 genome editing. Circulation research 2014, 115 (5), 488-92. [0495] 27. Saayman, S.; Ali, S. A.; Morris, K. V.; Weinberg, M. S., The therapeutic application of CRISPR/Cas9 technologies for HIV. Expert Opin Biol Ther 2015, 15 (6), 819-30. [0496] 28. Nelson, C. E.; Hakim, C. H.; Ousterout, D. G.; Thakore, P. I.; Moreb, E. A.; Castellanos Rivera, R. M.; Madhavan, S.; Pan, X.; Ran, F. A.; Yan, W. X.; Asokan, A.; Zhang, F.; Duan, D.; Gersbach, C. A., In vivo genome editing improves muscle function in a mouse model of Duchenne muscular dystrophy. Science 2016, 351 (6271), 403-7. [0497] 29. Tabebordbar, M.; Zhu, K.; Cheng, J. K. W.; Chew, W. L.; Widrick, J. J.; Yan, W. X.; Maesner, C.; Wu, E. Y.; Xiao, R.; Ran, F. A.; Cong, L.; Zhang, F.; Vandenberghe, L. H.; Church, G. M.; Wagers, A. J., In vivo gene editing in dystrophic mouse muscle and muscle stem cells. Science 2016, 351 (6271), 407-411. [0498] 30. Long, C.; Amoasii, L.; Mireault, A. A.; McAnally, J. R.; Li, H.; Sanchez-Ortiz, E.; Bhattacharyya, S.; Shelton, J. M.; Bassel-Duby, R.; Olson, E. N., Postnatal genome editing partially restores dystrophin expression in a mouse model of muscular dystrophy. Science 2016, 351 (6271), 400-3. [0499] 31. Bakondi, B.; Lv, W.; Lu, B.; Jones, M. K.; Tsai, Y.; Kim, K. J.; Levy, R.; Akhtar, A. A.; Breunig, J. J.; Svendsen, C. N.; Wang, S., In Vivo CRISPR/Cas9 Gene Editing Corrects Retinal Dystrophy in the S334ter-3 Rat Model of Autosomal Dominant Retinitis Pigmentosa. Molecular therapy: the journal of the American Society of Gene Therapy 2016, 24 (3), 556-63. [0500] 32. Wu, W. H.; Tsai, Y. T.; Justus, S.; Lee, T. T.; Zhang, L.; Lin, C. S.; Bassuk, A. G.; Mahajan, V. B.; Tsang, S. H., CRISPR Repair Reveals Causative Mutation in a Preclinical Model of Retinitis Pigmentosa. Molecular therapy: the journal of the American Society of Gene Therapy 2016, 24 (8), 1388-94. [0501] 33. Zhong, H.; Chen, Y.; Li, Y.; Chen, R.; Mardon, G., CRISPR-engineered mosaicism rapidly reveals that loss of Kcnj13 function in mice mimics human disease phenotypes. Scientific reports 2015, 5, 8366. [0502] 34. Fu, Y.; Foden, J. A.; Khayter, C.; Maeder, M. L.; Reyon, D.; Joung, J. K.; Sander, J. D., High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol 2013, 31 (9), 822-6. [0503] 35. Hsu, P. D.; Scott, D. A.; Weinstein, J. A.; Ran, F. A.; Konermann, S.; Agarwala, V.; Li, Y.; Fine, E. J.; Wu, X.; Shalem, O.; Cradick, T. J.; Marraffini, L. A.; Bao, G.; Zhang, F., DNA targeting specificity of RNA-guided Cas9 nucleases. Nat Biotechnol 2013, 31 (9), 827-32. [0504] 36. Pattanayak, V.; Lin, S.; Guilinger, J. P.; Ma, E.; Doudna, J. A.; Liu, D. R., High-throughput profiling of off-target DNA cleavage reveals RNA-programmed Cas9 nuclease specificity. Nature biotechnology 2013, 31 (9), 839-43. [0505] 37. Pattanayak, V.; Guilinger, J. P.; Liu, D. R., Determining the specificities of TALENs, Cas9, and other genome-editing enzymes. Methods Enzymol 2014, 546, 47-78. [0506] 38. Frock, R. L.; Hu, J.; Meyers, R. M.; Ho, Y. J.; Kii, E.; Alt, F. W., Genome-wide detection of DNA double-stranded breaks induced by engineered nucleases. Nature biotechnology 2015, 33 (2), 179-86. [0507] 39. Tsai, S. Q.; Zheng, Z.; Nguyen, N. T.; Liebers, M.; Topkar, V. V.; Thapar, V.; Wyvekens, N.; Khayter, C.; Iafrate, A. J.; Le, L. P.; Aryee, M. J.; Joung, J. K., GUIDE-seq enables genome-wide profiling of off-target cleavage by CRISPR-Cas nucleases. Nature biotechnology 2015, 33 (2), 187-97. [0508] 40. Davis, K. M.; Pattanayak, V.; Thompson, D. B.; Zuris, J. A.; Liu, D. R., Small molecule-triggered Cas9 protein with improved genome-editing specificity. Nat Chem Biol 2015, 11 (5), 316-8. [0509] 41. Nunez, J. K.; Lee, A. S.; Engelman, A.; Doudna, J. A., Integrase-mediated spacer acquisition during CRISPR-Cas adaptive immunity. Nature 2015, 519 (7542), 193-8. [0510] 42. Maji, B.; Moore, C. L.; Zetsche, B.; Volz, S. E.; Zhang, F.; Shoulders, M. D.; Choudhary, A., Multidimensional chemical control of CRISPR-Cas9. Nature chemical biology 2017, 13 (1), 9-11. [0511] 43. Senis, E.; Fatouros, C.; Grosse, S.; Wiedtke, E.; Niopek, D.; Mueller, A. K.; Borner, K.; Grimm, D., CRISPR/Cas9-mediated genome engineering: an adeno-associated viral (AAV) vector toolbox. Biotechnol J 2014, 9 (11), 1402-12. [0512] 44. Nunez, J. K.; Harrington, L. B.; Doudna, J. A., Chemical and Biophysical Modulation of Cas9 for Tunable Genome Engineering. ACS Chem Biol 2016, 11 (3), 681-8. [0513] 45. Westra, E. R.; Buckling, A.; Fineran, P. C., CRISPR-Cas systems: beyond adaptive immunity. Nature reviews. Microbiology 2014, 12 (5), 317-26. [0514] 46. Barrangou, R., The roles of CRISPR-Cas systems in adaptive immunity and beyond. Current opinion in immunology 2015, 32, 36-41. [0515] 47. Pawluk, A.; Staals, R. H.; Taylor, C.; Watson, B. N.; Saha, S.; Fineran, P. C.; Maxwell, K. L.; Davidson, A. R., Inactivation of CRISPR-Cas systems by anti-CRISPR proteins in diverse bacterial species. Nature microbiology 2016, 1 (8), 16085. [0516] 48. Pawluk, A.; Amrani, N.; Zhang, Y.; Garcia, B.; Hidalgo-Reyes, Y.; Lee, J.; Edraki, A.; Shah, M.; Sontheimer, E. J.; Maxwell, K. L.; Davidson, A. R., Naturally Occurring Off-Switches for CRISPR-Cas9. Cell 2016, 167 (7), 1829-1838.e9. [0517] 49. Shin, J.; Jiang, F.; Liu, J. J.; Bray, N. L.; Rauch, B. J.; Baik, S. H.; Nogales, E.; Bondy-Denomy, J.; Corn, J. E.; Doudna, J. A., Disabling Cas9 by an anti-CRISPR DNA mimic. Science advances 2017, 3 (7), e1701620. [0518] 50. Rauch, B. J.; Silvis, M. R.; Hultquist, J. F.; Waters, C. S.; McGregor, M. J.; Krogan, N. J.; Bondy-Denomy, J., Inhibition of CRISPR-Cas9 with Bacteriophage Proteins. Cell 2017, 168 (1-2), 150-158.e10. [0519] 51. Sternberg, S. H.; Redding, S.; Jinek, M.; Greene, E. C.; Doudna, J. A., DNA interrogation by the CRISPR RNA-guided endonuclease Cas9. Nature 2014, 507 (7490), 62-7. [0520] 52. Nishimasu, H.; Ran, F. A.; Hsu, P. D.; Konermann, S.; Shehata, S. I.; Dohmae, N.; Ishitani, R.; Zhang, F.; Nureki, O., Crystal structure of Cas9 in complex with guide RNA and target DNA. Cell 2014, 156 (5), 935-49. [0521] 53. Kleinstiver, B. P.; Prew, M. S.; Tsai, S. Q.; Topkar, V. V.; Nguyen, N. T.; Zheng, Z.; Gonzales, A. P.; Li, Z.; Peterson, R. T.; Yeh, J. R.; Aryee, M. J.; Joung, J. K., Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature 2015, 523 (7561), 481-5. [0522] 54. Lundblad, J. R.; Laurance, M.; Goodman, R. H., Fluorescence polarization analysis of protein-DNA and protein-protein interactions. Mol Endocrinol 1996, 10 (6), 607-12. [0523] 55. Niesen, F. H.; Berglund, H.; Vedadi, M., The use of differential scanning fluorimetry to detect ligand interactions that promote protein stability. Nature protocols 2007, 2 (9), 2212-21. [0524] 56. Richardson, C. D.; Ray, G. J.; DeWitt, M. A.; Curie, G. L.; Corn, J. E., Enhancing homology-directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA. Nature biotechnology 2016, 34 (3), 339-44. [0525] 57. Fu, Y.; Foden, J. A.; Khayter, C.; Maeder, M. L.; Reyon, D.; Joung, J. K.; Sander, J. D., High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat. Biotechnol. 2013, 31 (9), 822-6. [0526] 58. Moore, R.; Spinhirne, A.; Lai, M. J.; Preisser, S.; Li, Y.; Kang, T.; Bleris, L., CRISPR-based self-cleaving mechanism for controllable gene delivery in human cells. Nucleic Acids Res 2015, 43 (2), 1297-303. [0527] 59. Nguyen, D. P.; Miyaoka, Y.; Gilbert, L. A.; Mayerl, S. J.; Lee, B. H.; Weissman, J. S.; Conklin, B. R.; Wells, J. A., Ligand-binding domains of nuclear receptors facilitate tight control of split CRISPR activity. Nat Commun 2016, 7, 12009. [0528] 60. Burke, M. D.; Schreiber, S. L., A planning strategy for diversity-oriented synthesis. Angew Chem Int Ed Engl 2004, 43 (1), 46-58. [0529] 61. Shortridge, M. D.; Hage, D. S.; Harbison, G. S.; Powers, R., Estimating protein-ligand binding affinity using high-throughput screening by NMR. J Comb Chem 2008, 10 (6), 948-58. [0530] 62. Heler, R.; Samai, P.; Modell, J. W.; Weiner, C.; Goldberg, G. W.; Bikard, D.; Marraffini, L. A., Cas9 specifies functional viral targets during CRISPR-Cas adaptation. Nature 2015, 519 (7542), 199-202.
Example 2Methods
[0531] SpCas9 Expression and Purification.
[0532] SpCas9 was expressed and purified following a previously reported protocol. See, Pattanayak et al., High-throughput profiling of off-target DNA cleavage reveals RNA-programmed Cas9 nuclease specificity, Nature biotechnology 2013, 31 (9), 839-43.
[0533] BL21 Star (DE3)-competent E. coli cells were transformed with plasmids encoding the bacterial codon-optimized SpCas9 with a His.sub.6 N-terminal purification tag. A single colony was grown overnight in TB containing 25 g ml.sup.1 kanamycin at 37 C. The cells were diluted 1:1000 into 1 L of the same media and grown at 37 C. until OD.sub.600=0.60-0.7. The cultures were cooled down to 18 C. for 30 min and protein expression was induced with 1 mM isopropyl--D-1-thiogalactopyranoside (GoldBio). Expression was sustained for 16-18 h with shaking at 18 C. The subsequent purification steps were carried out at 4 C. Cells were collected by centrifugation and resuspended in cell collection buffer (100 mM tris(hydroxymethyl)-aminomethane (Tris)-HCl, pH 8.0, 1 M KCl, 20% glycerol, 5 mM tris(2-carboxyethyl)phosphine (TCEP; GoldBio), 1 mM phenylmethane sulfonyl fluoride (Sigma-Aldrich) and 1 mg/mL Lysozyme. Cells were lysed by sonication (10 min total, 30 s on, 30 s off) and the lysate cleared by centrifugation at 15,000 g (1 h).
[0534] The cleared lysate was incubated with His-Pur nickel-nitriloacetic acid (nickel-NTA) resin with rotation at 4 C. for 2 h. The resin was washed with 215 column volumes of cell collection buffer before bound protein was eluted with elution buffer (100 mM tris(hydroxymethyl)-aminomethane (Tris)-HCl, pH 8.0, 100 mM KCl, 20% glycerol, 5 mM TCEP (GoldBio), 250 mM imidazole). The resulting protein fraction was further treated with TEV protease at 4 C. for 24 h in 20 mM (Tris)-HCl, pH 8.0, 100 mM KCl, 20% glycerol, 5 mM TCEP and then purified on a 5 mL Hi-Trap HP SP (GE Healthcare) cation exchange column with KCl gradient from 0.1 M to 1 M using an Akta Pure FPLC. Protein-containing fractions were concentrated using a column with a 100 kDa cutoff (Millipore) centrifuged at 3,000 g. The Hi-Trap purified followed by running through a HiLoad Superdex 200 column using 20 mM (Tris)-HCl, pH 8.0, 100 mM KCl, 20% glycerol, 5 mM TCEP buffer. The purified protein was validated by running a denaturing gel and snap-frozen in liquid nitrogen and stored at 80 C.
[0535] In Vitro Transcription of sgRNA.
[0536] Linear DNA fragments containing the T7 RNA polymerase promoter sequence upstream of the desired 20 bp sgRNA protospacer and the sgRNA backbone were generated by PCR (Q5 Hot Start MasterMix, New England Biolabs) using primers forward: AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTT AACTTGCTATTTCTAGCTCTAAAAC-3 (SEQ ID NO:22) and reverse: 5-TAATACGACTCACTATAGCTATAGGACGCGACCGAAAGTTTTAGAGCTAGAAAT-3 (SEQ ID NO:23). sgRNA was transcribed with the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) at 37 C. for 16 h with 150 ng of linear template per 20 l reaction. sgRNA was purified using the MEGAClear Transcription Clean Up Kit (Thermo Fisher), according to the manufacturer's instructions. Purified sgRNAs were stored in aliquots at 80 C.
[0537] FP Assay.
[0538] In one aspect, the invention provides an assay that monitors the change in the fluorescence polarization of the fluorophore-labelled PAM-rich target DNA (henceforth called 12PAM-DNA) upon binding to [Cas9:guideRNA] complex. Fluorescence Polarization assay was performed in a 384-well plate (Corning 3575) format using a total reaction volume of 30 L. A 25 nM FITC-labeled 12PAM DNA was titrated against increasing concentration of Cas9:gRNA (1:1.2) complex in a 20 mM Tris-HCl buffer of pH 7.5 containing 150 mM KCl, 5 mM MgCl.sub.2, 1 mM DTT. The fluorescence polarization signal was measured using a microplate reader (PerkinElmer, EnVision). The experiments were performed in triplicates and the data were processed in GraphPad Prism 7. The Z-value was calculated following the formula:
[0539] Where 1 and 2 are the standard deviations of DMSO control and Cas9:gRNA control respectively. 1 and 2 are the mean FP-signal intensities for DMSO control and Cas9:gRNA control respectively.
[0540] Competition Assay.
[0541] In a 384-well plate (Corning 3575), 25 nM FITC-labeled 12PAM DNA was incubated with 50 nM SpCas9:gRNA (1:1.2) complex in the presence and absence of unlabeled DNA in excess (10 and 50) in a 20 mM Tris-HCl buffer of pH 7.5 containing 150 mM KCl, 5 mM MgCl.sub.2, 1 mM DTT. The fluorescence polarization signal was measured using a microplate reader (PerkinElmer, EnVision). The number of PAM sequence in the unlabeled competitor DNA was varied from 0, 4, 8, and 12 PAMs. The experiments were performed in triplicates and the data were processed in GraphPad Prism 7.
[0542] Differential Scanning Fluorimetry (DSF).
[0543] Protein melting experiments were performed in a 384-well format using a 6 L reaction volume in a LightCycler 480 instrument. A 3.7 M SpCas9:gRNA (1:1.2) was incubated with equimolar concentration of DNA with different PAM density (0, 4, 8, and 12) for 15 min in a 20 mM Tris-HCl buffer of pH 7.5 containing 150 mM KCl, 5 mM MgCl.sub.2, 1 mM DTT. Then, 2 L of 50SYPRO Orange was added before running the melting cycle with a temperature gradient of 4.8 C./min. The experiments were performed in triplicates and data were processed in Roche LightCycler 480 Protein Melting software.
[0544] Bio-Layer Interferometry (BLI).
[0545] DNA-Cas9 interactions were also probed using BLI experiments in an Octet Red384 (Pall ForteBio) instrument. The experiments were performed in a 96-well format with 180 L reaction volume using biotinylated ds-DNA and streptavidin sensors. A 300 nM of biotinylated DNA with different PAM density (0, 2, 4, and 8) were loaded onto the sensors for 180 s in 20 mM Tris buffer of pH 7.4, 100 mM KCl, 5 mM MgCl.sub.2, 1 mM DTT, 0.01% Tween, 50 g/mL Heparin. Excess DNA was washed off for 60 s in reaction buffer followed by association with 200 nM of Cas9-gRNA (1:1.2) for 300 s. The complex was then allowed to dissociate for 3600 s in the reaction buffer. All the response curves were normalized against the reference sensor without Cas9:gRNA.
[0546] Compound Screening.
[0547] The compound library screening was performed in two steps. Initially, the DOS informer set of library (10,000 compounds) was screened in the FP-based assay to identify the enriched hit libraries. Then, the specific enriched libraries were also screened using the same assay. The screening assay was performed in a 384-well plate format with a total reaction volume of 30 L. Initially, a 25 L of 60 nM of SpCas9 was transferred to the compound testing lanes of the 384-well plate except for the positive control wells. However, a 25 L of solution containing 60 nM SpCas9 and 300 nM unlabeled 12PAM ds-DNA was transferred to the positive control wells. In the next step, 25 nL of DMSO alone or 10 mM compounds in DMSO were transferred to the reaction mixture and incubated for 30 min at room temperature. Next, a 5 L solution containing 360 nM gRNA and 150 nM FAM-labeled 12PAM ds-DNA was added and incubated for 15 min at room temperature before acquiring the fluorescence polarization signal under a microplate reader (PerkinElmer, EnVision). Compounds were screened in duplicates and the data were processed to calculate the Z-score () values and plotted in Spotfire analysis software (TIBCO). The hit compounds (Z-score >3) were then clustered according to the class of compound and a hit-rate plot was generated. The entire specific libraries of the enriched ones were then screened in the same FP-assay.
[0548] Counter-Screening.
[0549] Counter-screening assay was performed in a similar format as followed in the compound-screening assay. In a 384-well plate, a 30 L of 25 nM FAM-labeled 12PAM ds-DNA was transferred to each well. Next, 25 nL of either DMSO or compound in DMSO were transferred and incubated for 15 min before the fluorescence polarization signal was acquired in a microplate reader (PerkinElmer, EnVision). The change in the FP signal was calculated in percentile and plotted against compounds' average Z-score values obtained from the original compound-screening assay. Compound that resulted in a >36 change in the Z-score but did not alter the FP-signal by >10% in the counter-screen assay were selected as the potential hits. A molecular structure based similarity search was also performed and compounds with >0.8 similarity index was included in the hit list.
[0550] Compound-Cas9 Interaction in BLI.
[0551] The experiments were performed in a 96-well format with 180 L reaction volume using biotinylated compound BRD7087-Biotin and streptavidin sensors. 1 M of the biotinylated compound was loaded onto the sensors for 180 s in 20 mM Tris buffer of pH 7.4, 100 mM KCl, 5 mM MgCl.sub.2, 1 mM DTT, 0.01% Tween. The compound loaded sensors were then allowed to associate with the different concentration of SpCas9:gRNA complex (1-0.15 M) for 300 s followed by dissociation in the reaction buffer. Reference sensor was loaded with compound and allowed to associate and dissociate in the reaction buffer alone. The response curves were fitted with a 2:1 stoichiometric model and a global fit steady-state analysis were performed using manufacturer inbuilt protocol. The experiment was performed in three replicates.
[0552] The competitive experiments were performed using Biotin-linker fragment. In this experiment, streptavidin sensors were pre-incubated with 10 M of Biotin-linker before dipping into a solution of either 1 M BRD7087-Biotin or reaction buffer alone. Sensors were then allowed to associate with different concentration of SpCas9:gRNA complex or buffer alone.
[0553] NMR binding assay. All samples were prepared with 50 M BRD7087 in 20 mM Tris buffer (pH=7.4) with varying concentrations of SpCas9:gRNA in a 3 mm NMR tube. Experiments were performed on a 600 MHz (.sup.19F: 564.71 MHz) Bruker Avance III NMR spectrometer equipped with a 5 mm QCI-F CryoProbe and a SampleJet for automated sample handling. To acquire spectra, a standard one-pulse .sup.19F experiment with WALTZ-16 for proton decoupling during acquisition, a 5 second recycle delay, and 256 scans was used. All spectra were recorded at 280 K. NMR data were apodized with a 1 Hz exponential function prior to Fourier transformation. All spectra were baseline corrected; peak widths and intensities were extracted using the automated line-fitting feature provided with the MNova software package. Determination of the value of K.sub.d was accomplished using least squares fitting to the expression given in Equation 8 in the paper by Shortridge et al..sup.2.
[0554] K.sub.d values obtained by NMR rely on the assumption that ligand binding is in fast-exchange, which typically holds true for ligands with K.sub.d in the 0.5 M to 20 mM range. Additional sources of error could be variations in the concentrations of the protein and ligand, an incomplete curve that does not reach complete occupancy, or incomplete relaxation leading to underestimation of the fractional occupancy.
[0555] Cell Culture.
[0556] All cells were cultured at 37 C. in a humidified 5% CO.sub.2 atmosphere. HEK293T cells (Life Technologies) used in transcriptional activation, NHEJ, and mCherry expression assays were cultured in Dulbecco's modified Eagle's medium (CellGro) supplemented with 10% fetal bovine serum (CellGro) and 1 penicillin/streptomycin/glutamax (CellGro). U2OS.eGFP-PEST cells stably integrated with an eGFP-PEST fusion gene were maintained in Dulbecco's modified Eagle's medium (Life Technologies) supplemented with 10% FBS, 1penicillin/streptomycin/glutamax (Life Technologies) and 400 g/mL of the selection antibiotic G418. Cells were continuously maintained at <90% confluency. All cell lines were sourced commercially or were functionally validated. Cells were periodically tested for mycoplasma contamination using the MycoAlert PLUS Mycoplasma Detection Kit (Lonza).
[0557] Cas9 Nuclease Activity in EGFP Disruption Assay.
[0558] In some embodiments, a quantitative human cell-based reporter assay that enables rapid quantitation of targeted nuclease activities is used to characterize off-target cleavage of CRISPR protein-based RNA guided endonucleases. In this assay, the activities of nucleases targeted to a single integrated EGFP reporter gene can be quantified by assessing loss of fluorescence signal in human U2OS.EGFP cells caused by inactivating frameshift insertion/deletion (indel) mutations introduced by error prone non-homologous end-joining (NHEJ) repair of nuclease-induced double-stranded breaks (DSBs).
[0559] Approximately 200,000 U2OS.eGFP-PEST cells were nucleofected with 400 ng of SpCas9 (Addgene Plasmid #43861) and 40 ng of sgRNA (pFYF1320 EGFP Site #1, Addgene Plasmid #47511) expressing plasmids along with a Td-tomato-encoding plasmid using the SE Cell Line 4D-Nucleofector X Kit (Lonza) according to the manufacturer's protocol. Approximately 20,000 transfected cells/well in 3 replicates were plated in a 96-well plate (Corning 3904). Cells were allowed to grow in the indicated amount of compound or DMSO for 24 h post transfection. Cells were then fixed using 4% paraformaldehyde and imaged with the HCS NuclearMask Blue Stain (Life Technologies) as the nuclear counter-staining agent. Imaging was performed with an IXM 137204 ImageXpress Automated High Content Microscope (Molecular Devices) at 10 magnification under three excitation channels (blue, green and red) with 9 acquiring sites per well. Images were analyzed in the MetaXpress software and data were plotted using GraphPad Prism 6. The Z-value was calculated following the formula:
[0560] Where 1 and 2 are the standard deviations of DMSO control and Cas9:gRNA control respectively. 1 and 2 are the mean % GFP.sup. cell population for DMSO control and Cas9:gRNA control respectively.
[0561] Western Blot Analysis
[0562] U2OS.eGFP.PEST cells stably expressing EGFP were incubated either in the absence or presence of compound BRD7087 and BRD5779 for 24 h at 37 C. prior to harvesting the cells. Cell suspensions were spun down at 1000g for 5 min and processed for cell lysis. Cells were resuspended in RIPA total cell lysis buffer (abcam) and incubated at 4 C. for 10 min. The cell suspensions were then vortexed for 10 min at 4 C. followed by spinning down at 16,000g for 15 min at 4 C. The supernatant was transferred to a fresh tube and processed for western-blotting.
[0563] Western blotting was performed following SDS-PAGE gel electrophoresis. In a typical experimental protocol, 40 g of normalized proteins were electrophoresed on a 4-12% Bis/Tris gel. The protein bands were transferred to a PVDF membrane and probed with primary -HSF1(c) (Abcam # ab52757) and/or -CRISPR/Cas9 antibody (Abcam # ab191468). -Actin antibody (Sigma) was used as a protein loading control.
[0564] NHEJ assay.
[0565] Approximately 8,000 cells/well were plated in a 96-well format 24 h before transiently transfected with a total 100 ng of DN66 (mCherry-TAG-GFP reporter) and DN78 (SpCas9 and gRNA) plasmids (1:1) using lipofectamine 2000 (Life Technologies).sup.3. Transfected cells were allowed to grow in the indicated amount of compound or DMSO for 24 h. Cells were then fixed using 4% paraformaldehyde and imaged with the HCS NuclearMask Blue Stain (Life Technologies) as the nuclear counter-staining agent. Imaging was performed with an IXM 137204 ImageXpress Automated High Content Microscope (Molecular Devices) at 20 magnification under three excitation channels (blue, green and red) with 9 acquiring sites per well. Images were analyzed in the MetaXpress software to determine the % NHEJ and the data were plotted using GraphPad Prism 6. The Z-value was calculated following the formula:
[0566] Where 1 and 2 are the standard deviations of DN66 transfected wells and (DN66+DN78) transfected wells respectively. 1 and 2 are the mean % GFP.sup. cell population for DN66 transfected wells and (DN66+DN78) transfected wells respectively.
[0567] mKate2 Expression Assay.
[0568] Approximately 8,000 cells/well were plated in a 96-well format 24 h before transiently transfected with 100 ng of either CgRNA (Addgene Plasmid #64955) or T1gRNA (Addgene Plasmid #62717) plasmids using lipofectamine 2000 (Life Technologies). Transfected cells were allowed to grow in the indicated amount of compound or DMSO for 24 h. Cells were then fixed using 4% paraformaldehyde and imaged with the HCS NuclearMask Blue Stain (Life Technologies) as the nuclear counter-staining agent. Imaging was performed with an IXM 137204 ImageXpress Automated High Content Microscope (Molecular Devices) at 20 magnification under two excitation channels (blue and red) with 9 acquiring sites per well. Images were analyzed in the MetaXpress software to determine the % mKate2 positive cells and the % NHEJ was calculated following a reported protocol and plotted using GraphPad Prism 6. The Z-value was calculated following the formula:
[0569] Where 1 and 2 are the standard deviations of cgRNA transfected wells and T1-gRNA transfected wells respectively. 1 and 2 are the mean % RFP.sup.+ cell population for CgRNA transfected wells and T1gRNA transfected wells respectively.
[0570] Transcription activation experiments and quantitative RT-PCR analyses.
[0571] For transcription activation experiments 250,000 cells/well were plated in a 12 well plate. The cells were transiently transfected with a 1:1:1 mass ratio of the dCas9 plasmid, MS2-P65-HSF1 effector plasmid and the sgRNA plasmid targeting the HBG1 gene or an RFP control plasmid. A total of 1.6 g plasmid DNA was transfected using Lipofectamine 2000 (Life Technologies) according to manufacturer's protocol. Immediately after transfection, the cells were treated with an appropriate dose of the small molecule inhibitors for 48 hours following which the cells were harvested and RNA was extracted using the EZNA Total RNA kit I (Omega) as per manufacturer's instructions. 1 g total cellular RNA was used to perform reverse transcription using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) or the qScript cDNA Synthesis Kit (QuantaBio). qPCR reactions were performed to quantify RNA expression using the TaqMan probes (Life Technologies, HBG1/HBG2: Hs00361131_g1 and ACTB: Hs01060665_g1) and TaqMan Fast Advanced Master Mix (Life Technologies) in 5 L multiplexed reactions and 384-well format using the LightCycler 480 Instrument II (Roche). For each sample, six technical replicates were performed. Data were analyzed using the LightCycler 480 software (Roche) by the C.sub.t method: C.sub.t values for the gene of interest (HBG1) were normalized to C.sub.t values for the housekeeping gene (ACTB) and fold-changes in the expression level of the gene of interest were normalized to RFP-transfected control. The data are reported as meanS.E.M. for technical replicates.
[0572] Base-Editing Experiment.
[0573] BE3 Expression and Purification.
[0574] BE3 was expressed and purified as previously reported.sup.4.
[0575] BL21 Star (DE3)-competent E. coli cells were transformed with plasmids encoding the bacterial codon-optimized base editor with a His.sub.6 N-terminal purification tag. A single colony was grown overnight in 2YT broth containing 50 g ml.sup.1 kanamycin at 37 C. The cells were diluted 1:400 into 4 L of the same media and grown at 37 C. until OD.sub.600=0.70-0.75. The cultures were incubated on ice for 3 h and protein expression was induced with 1 mM isopropyl--D-1-thiogalactopyranoside (GoldBio). Expression was sustained for 16-18 h with shaking at 18 C. The subsequent purification steps were carried out at 4 C. Cells were collected by centrifugation and resuspended in cell collection buffer (100 mM tris(hydroxymethyl)-aminomethane (Tris)-HCl, pH 8.0, 1 M NaCl, 20% glycerol, 5 mM tris(2-carboxyethyl)phosphine (TCEP; GoldBio), 0.4 mM phenylmethane sulfonyl fluoride (Sigma-Aldrich) and 1 EDTA-free protease inhibitor pellet (Roche)). Cells were lysed by sonication (6 min total, 3 s on, 3 s off) and the lysate cleared by centrifugation at 25,000 g (20 min).
[0576] The cleared lysate was incubated with His-Pur nickel-nitriloacetic acid (nickel-NTA) resin with rotation at 4 C. for 90 min. The resin was washed with 215 column volumes of cell collection buffer before bound protein was eluted with elution buffer (100 mM tris(hydroxymethyl)-aminomethane (Tris)-HCl, pH 8.0, 0.5 M NaCl, 20% glycerol, 5 mM TCEP (GoldBio), 200 mM imidazole). The resulting protein fraction was further purified on a 5 ml Hi-Trap HP SP (GE Healthcare) cation exchange column using an Akta Pure FPLC. Protein-containing fractions were concentrated using a column with a 100 kDa cutoff (Millipore) centrifuged at 3,000 g, and the concentrated solution was sterile-filtered through a 22-m polyvinylidene difluoride membrane (Millipore).
[0577] After sterile filtration, proteins were quantified with Reducing Agent Compatible Bicinchoninic acid assay (Pierce Biotechnology), snap-frozen in liquid nitrogen and stored in aliquots at 80 C.
[0578] In Vitro Transcription of sgRNA.
[0579] Linear DNA fragments containing the T7 RNA polymerase promoter sequence upstream of the desired 20 bp sgRNA protospacer and the sgRNA backbone were generated by PCR (Q5 Hot Start MasterMix, New England Biolabs) using primers forward: 5-TAATACGACTCACTATAGGGAGTCCGAGCAGAAGAAGAAGTTTTAGAGCTAG AAATAGCA-3 (SEQ ID NO:24) and reverse: 5-AAAAAAAGCACCGACTCGGTGCCAC-3 (SEQ ID NO:25) and concentrated on minelute columns (Qiagen). sgRNA was transcribed with the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) at 37 C. for 14-16 h with 400 ng of linear template per 20 l reaction. sgRNA was purified using the MEGAClear Transcription Clean Up Kit (Thermo Fisher), according to the manufacturer's instructions. Purified sgRNAs were stored in aliquots at 80 C.
[0580] Protein Transfection of Base Editor BE3 into HEK293T Cells.
[0581] HEK293T cells were seeded on 48-well BioCoat poly-D-lysine plates (Corning) in 250 L of antibiotic-free medium and transfected at 70% confluency. Prior to protein transfection, cells were incubated with 2 L of DMSO-suspended BRD7087 or BRD5779 at the indicated concentration for 2-3 hours. BE3 protein was incubated with 1.1 molar excess of EMX1-targeting sgRNA at a final concentration ratio of 200 nM: 220 nM (based on a total well volume of 275 L). The complex was mixed with 0.2 L of compound for five minutes, incubated with 1.5 L Lipofectamine 2000 (Thermo Fisher) and transfected according to the manufacturer's protocol plasmid delivery. The cells and ribonucleoprotein complex were incubated with compounds at final concentrations of 1.25 M, 2.5 M, 5 M, 10 M or 20 M.
[0582] Purifications and Sequencing of Genomic DNA.
[0583] Transfected cells were harvested after 72 h in 50 L of lysis buffer (10 mM Tris-HCl pH 8.0, 0.05% SDS, 25 g/mL proteinase K) and incubated at 37 C. for 1 h. Cell lysates were heated at 85 C. for 15 min to denature proteinase K. For the first PCR, genomic DNA was amplified to the top of the linear range using Phusion Hot Start II DNA polymerase (New England Biolabs) according to the manufacturer's instructions. For all amplicons, the PCR protocol used was an initial heating step for 1 min at 98 C. followed by an optimized number of amplification cycles (10 s at 98 C., 20 s at 68 C., 15 s at 72 C.). qPCR was performed to determine the optimum number of cycles for each amplicon. Amplified DNA was purified using RapidTip2 (Diffinity Genomics) and barcoded with a further PCR. Sequencing adapters and dual-barcoding sequences are based on the TruSeq Indexing Adapters (Illumina). Barcoded samples were pooled and purified by gel extraction (Qiagen) before quantification using the Qubit dsDNA HS Kit (Thermo Fisher) and qPCR (KAPA BioSystems) according to the manufacturer's instructions. Sequencing of pooled samples was performed using a single-end read from 260 to 300 bases on the MiSeq (Illumina) according to the manufacturer's instructions.
[0584] Analysis of Base-Edited Sequences.
[0585] Nucleotide frequencies were analyzed using a previously described MATLAB script.sup.5. Briefly, the reads were aligned to the reference sequence via the Smith-Waterman algorithm. Base calls with Q-scores below 30 were replaced with a placeholder nucleotide (N). This quality threshold results in nucleotide frequencies with an expected theoretical error rate of 1 in 1,000.
[0586] To distinguish small molecule-induced inhibition of C.fwdarw.T editing from artefactual C.fwdarw.T editing, Applicants compared the sequencing reads from cells treated with base-editor in the presence of small molecule to the sequencing reads from base-edited cells not exposed to small molecule. A Student's two-tailed t-test was used to determine if inhibition of C.fwdarw.T editing by small-molecule is statistically significant with P<0.05 as the threshold.
[0587] Bacterial Study.
[0588] Plasmid pRH248 harboring SpCas9, tracrRNA and a single-spacer array (CGTGTAAAGACATATTAGATCGAGTCAAGG) (SEQ ID NO:26) targeting phage NM44 was constructed via BsaI cloning onto pDB114 as described in Heler et al.sup.6. Plate reader growth curves of bacteria infected with phage were conducted as described previously with minor modifications.sup.7. Overnight cultures were diluted 1:100 into 2 ml of fresh BHI supplemented with appropriate antibiotics and 5 mM CaCl.sub.2 and grown to an OD.sub.600 of 0.2. Immune cells carrying pRH248 were diluted with cells lacking CRISPR-Cas in a 1:10,000 ratio. Following a 15-minute pre-incubation with DMSO or with varying amounts of inhibitors (5-20 M), the cultures were infected with NM44 at an initial MOI of 1. To produce plate reader growth curves, 200 L of infected cultures, normalized for OD600, were transferred to a 96-well plate in triplicate. OD.sub.600 measurements were collected every 10 minutes for 16 hours. Similarly, growth curves to evaluate the toxicity of the compounds at 20 M (
Example 3
[0589] Synthesis and Characterization Data of Compounds
[0590] General Procedure A: Microwave-Assisted Suzuki Coupling to Give Hexahydropyrroloquinoline substrates 13a-h
[0591] The microwave reactions were performed in a Biotage single-mode microwave reactor with a power of 0 to 400 W. A 10-20 mL Biotage microwave reaction vial was charged with the hexahydropyrroloquinoline substrate 12 (1.0 equiv., >90% ee), 3-fluorophenylboronic acid or 4-methoxyphenylboronic acid (1.2 equiv.), potassium carbonate (2.0 equiv.), XPhos Palladium third generation catalyst (5% mol), and a mixture solvent of THF-H.sub.2O (v/v, 2/1). The vial was sealed with a septum cap, degassed under high vacuum, and backfilled with an argon atmosphere. The degassing step was repeated three times, and the resulting reaction mixture was microwave irradiated for 45 min at 100 C. The reaction mixture was then cooled to room temperature and filtered through a short pad of Celite. The filtrate was evaporated under vacuum to give crude substrate, usually as off-yellow oily substance, which was purified by flash column chromatography on silica gel eluting with hexane and ethyl acetate (or dichloromethane and methanol).
[0592] Note:
[0593] The four isomers of benzyl 8-bromo-4-(hydroxymethyl)-2,3,3a,4,5,9b-hexahydro-1H-pyrrolo[3,2-c]quinoline-1-carboxylate 12a-d were synthesized as described by Jacobsen et al. and Marcaurelle et al. using the chiral urea catalyst 9a or 9b (H. Xu, H. Zhang, E. N. Jacobsen, Nat. Protoc. 2014, 9, 1860-1866; B. Gerald, M. W. O'Shea, E. Donckele, S. Kesavan, L. B. Akella, H. Xu, E. N. Jacobsen, L. S. Marcaurelle, ACS Comb. Sci. 2012, 14, 621-630). Urea catalysts 9a and 9b were synthesized as described by Jacobsen et al. The obtained NMR spectral data were consistent with those reported in the literature (K. L. Tan, E. N. Jacobsen, Angew. Chem. Int. Ed. 2007, 46, 1315-1317.).
[0594] General Procedure B: Reductive Amination to Give Pyridinylmethylhexahydropyrroloquinolines 1 to 8
[0595] A round-bottom flash was charged with hexahydropyrroloquinoline substrate 13 (1.0 equiv.), palladium on carbon (10% weight), and methanol (0.05 M). The flask was sealed with a rubber septum, degassed under high vacuum, and backfilled with a hydrogen atmosphere. The degassing and hydrogen refilling step was repeated three times, and the resulting reaction mixture was stirred at room temperature for one hour or until the full conversion of the starting material monitored by TLC (methanol in CH.sub.2Cl.sub.2). The reaction mixture was filtered through a Celite pad and the filtrate was evaporated under vacuum to give the corresponding Cbz-deprotected hexahydropyrroloquinoline substrate.
[0596] A flame-dried round-bottom flash was charged with the Cbz-deprotected hexahydropyrroloquinoline substrate (1.0 equiv.) dissolved in dry CH.sub.2Cl.sub.2 (0.05 M), 4-pyridinecarboxyaldehyde (1.5 equiv.), and acetic acid (2.0 equiv.). The reaction mixture was stirred at room temperature for one hour before the adding of NaBH(OAc).sub.3 (3.0 equiv.). The reaction mixture was stirred at room temperature for another three hours or until the full conversion of the starting material monitored by TLC (methanol in CH.sub.2Cl.sub.2). The reaction mixture was then diluted with CH.sub.2Cl.sub.2, quenched with a saturated NaHCO.sub.3 aqueous solution, and extracted with CH.sub.2CL.sub.2 (three times). Organic layers were combined, washed with brine, dried over anhydrous Na.sub.2SO.sub.4, filtered, and concentrated in vacuo to give a crude residue, usually as off-white or light yellow oily substance, which was purified by flash column chromatography on silica gel eluting with hexane and ethyl acetate (or dichloromethane and methanol).
[0597] ((3aR,4S,9bR)-8-(3-Fluorophenyl)-1-(pyridin-4-ylmethyl)-2,3,3a,4,5,9b-hexahydro-1H-pyrrolo[3,2-c]quinolin-4-yl)methanol (1/BRD7087)
##STR00001##
[0598] Prepared from benzyl (3aR,4S,9bR)-8-(3-fluorophenyl)-4-(hydroxymethyl)-2,3,3a,4,5,9b-hexahydro-1H-pyrrolo[3,2-c]quinoline-1-carboxylate 13a (667 mg, 1.54 mmol) according to General Procedure B. Purification by flash column chromatography eluting with 5% methanol in dichloromethane gave the desired product 3 as a white solid (348 mg, yield 58%).
[0599] R.sub.f=0.38 (silica gel, 10% methanol in dichloromethane, UV).
[0600] .sup.1H NMR (400 MHz, CDCl.sub.3): 8.45 (d, 2H, J=4.8 Hz, aromatic H), 7.35 (d, 2H, J=8.2 Hz, aromatic H), 7.28-7.25 (m, 4H, aromatic H), 7.21 (d, 1H, J=10.5 Hz, aromatic H), 6.97 (t, 1H, J=8.6 Hz, aromatic H), 6.73 (d, 1H, J=8.4 Hz, aromatic H), 4.38 (d, 1H, J=13.8 Hz, CH.sub.2OH), 4.01 (d, 1H, J=8.6 Hz, CH.sub.2NCH), 3.56-3.53 (m, 2H, NHCHCH and CH.sub.2NCH), 3.33 (s, 1H, CH.sub.2NCH), 3.27 (d, 1H, J=13.8 Hz, CH.sub.2OH), 2.97-2.93 (m, 1H, NCH.sub.2CH.sub.2), 2.21-2.19 (m, 1H, NCH.sub.2CH.sub.2), 2.10-2.03 (m, 2H, NCH.sub.2CH.sub.2 and NHCHCH), 1.65-1.62 (m, 1H, NCH.sub.2CH.sub.2).
[0601] .sup.13C NMR (100 MHz, CDCl.sub.3): 164.5 and 162.1 (d, .sup.1J.sub.C,F=243.4 Hz, aromatic C), 150.0 (aromatic C), 149.1 (2) (pyridinyl C), 144.7 (pyridinyl C), 143.6 and 143.5 (d, .sup.3J.sub.C,F=7.8 Hz, aromatic C), 130.3 (aromatic C), 130.1 and 130.0 (d, .sup.3J.sub.C,F=8.8 Hz, aromatic C), 127.8 (aromatic C), 127.6 (aromatic C), 123.6 (2) (pyridinyl C), 121.7 and 121.7 (d, .sup.4J.sub.C,F=2.8 Hz, aromatic C), 118.3 (aromatic C), 114.6 (aromatic C), 113.0 and 112.8 (d, .sup.2J.sub.C,F=21.8 Hz, aromatic C), 112.8 and 112.6 (d, .sup.2J.sub.C,F=21.0 Hz, aromatic C), 64.7 (CH.sub.2NCH), 64.1 (CH.sub.2NCH), 56.0 (CH.sub.2OH), 54.5 (NHCHCH), 51.4 (NCH.sub.2CH.sub.2), 35.8 (NHCHCH), 25.7 (NCH.sub.2CH.sub.2).
[0602] .sup.19F NMR (376 MHz, CDCl.sub.3): 113.5.
[0603] [].sub.D.sup.22=+34.4 (c=0.4, CHCl.sub.3).
[0604] Chiral SFC (AS-H, 1.5 mL/min, MeOH with 0.05% Et.sub.3N in CO.sub.2, =210 nm): t.sub.R(minor)=6.4 min, t.sub.R(major)=7.0 min.
[0605] IR (thin film, cm.sup.1): v.sub.max 3413, 2925, 1608, 1522, 1484, 1325, 1261, 1198, 1159, 1077, 869, 819, 782, 752, 693.
[0606] LCMS (UV Chromatogram, 210 nm, 2.5 min run): Purity >95% by UV, rt=0.92 min, m/z 390.1 (M+H).sup.+, m/z 434.5 (M+FA-H).sup..
[0607] HRMS (ESI, m/z): calcd for C.sub.24H.sub.24FN.sub.30 (M+H).sup.+: 390.1982, found: 390.1976.
((3aR,4S,9bR)-8-(4-Methoxyphenyl)-1-(pyridin-4-ylmethyl)-2,3,3a,4,5,9b-hexahydro-1H-pyrrolo[3,2-c]quinolin-4-yl)methanol (2/BRD5779)
[0608] ##STR00002##
[0609] Prepared from benzyl (3aR,4S,9bR)-4-(hydroxymethyl)-8-(4-methoxyphenyl)-2, 3, 3a, 4, 5, 9b-hexahydro-1H-pyrrolo[3,2-c]quinoline-1-carboxylate 13b (186 mg, 0.42 mmol) according to General Procedure B. Purification by flash column chromatography eluting with 70% ethyl acetate in hexane gave the desired product 2 as an off-white solid (72 mg, yield 43%).
[0610] R.sub.f=0.69 (silica gel, 10% methanol in dichloromethane, UV).
[0611] .sup.1H NMR (400 MHz, CDCl.sub.3): 8.46 (d, 2H, J=4.9 Hz, aromatic H), 7.44 (d, 2H, J=8.2 Hz, aromatic H), 7.33 (d, 1H, J=8.2 Hz, aromatic H), 7.25-7.24 (m, 3H, aromatic H), 6.97 (d, 2H, J=8.2 Hz, aromatic H), 6.74 (d, 1H, J=8.2 Hz, aromatic H), 4.41 (d, 1H, J=13.8 Hz, CH.sub.2OH), 3.99 (d, 1H, J=9.6 Hz, CH.sub.2NCH), 3.85 (s, 3H, OCH.sub.3), 3.59 (d, 1H, J=9.6 Hz, CH.sub.2NCH), 3.53-3.51 (m, 1H, NHCHCH), 3.32 (s, 1H, CH.sub.2NCH), 3.25 (d, 1H, J=13.8 Hz, CH.sub.2OH), 2.97 (t, 1H, J=9.2 Hz, NCH.sub.2CH.sub.2), 2.20-2.18 (m, 1H, NCH.sub.2CH.sub.2), 2.10-2.05 (m, 2H, NCH.sub.2CH.sub.2 and NHCHCH), 1.66-1.62 (m, 1H, NCH.sub.2CH.sub.2).
[0612] .sup.13C NMR (100 MHz, CDCl.sub.3): 158.3 (aromatic C), 149.9 (aromatic C), 149.2 (2) (aromatic C), 143.7 (aromatic C), 134.0 (aromatic C), 130.0 (aromatic C), 129.3 (aromatic C), 127.3 (3) (aromatic C), 123.6 (2) (aromatic C), 118.5 (aromatic C), 114.8 (aromatic C), 114.2 (2) (aromatic C), 64.7 (CH.sub.2NCH), 64.1 (CH.sub.2NCH), 56.1 (CH.sub.2OH), 55.4 (OCH.sub.3), 54.5 (NHCHCH), 51.4 (NCH.sub.2CH.sub.2), 35.9 (NHCHCH), 25.7 (NCH.sub.2CH.sub.2).
[0613] [].sub.D.sup.22=+33.1 (c=0.4, CHCl.sub.3).
[0614] Chiral SFC (AS-H, 1.5 mL/min, MeOH with 0.05% Et.sub.3N in CO.sub.2, =210 nm): t.sub.R(minor)=6.1 min, t.sub.R(major)=7.3 min.
[0615] IR (thin film, cm.sup.1): v.sub.max 3402, 2929, 1614, 1499, 1480, 1246, 1180, 1028, 817, 753.
[0616] LCMS (UV Chromatogram, 210 nm, 2.5 min run): Purity >95% by UV, rt=0.84 min, m/z 402.2 (M+H).sup.+, m/z 446.5 (M+FA-H).sup..
[0617] HRMS (ESI, m/z): calcd for C.sub.25H.sub.27N.sub.3O.sub.2 (M+H).sup.+: 402.2182, found: 402.2172.
((3aR,4R,9bR)-8-(3-Fluorophenyl)-1-(pyridin-4-ylmethyl)-2,3,3a,4,5,9b-hexahydro-1H-pyrrolo[3,2-c]quinolin-4-yl)methanol (3/BRD2161)
[0618] ##STR00003##
[0619] Prepared from benzyl (3aS,4S,9bS)-8-(3-fluorophenyl)-4-(hydroxymethyl)-2,3,3a,4,5,9b-hexahydro-1H-pyrrolo[3,2-c]quinoline-1-carboxylate 13c (276 mg, 0.64 mmol) according to General Procedure B. Purification by flash column chromatography eluting with 5% methanol in dichloromethane gave the desired product 3 as a white solid (66 mg, yield 27%).
[0620] R.sub.f=0.23 (silica gel, 5% methanol in dichloromethane, UV).
[0621] .sup.1H NMR (400 MHz, CDCl.sub.3): 8.55-8.53 (m, 2H, aromatic H), 7.33-7.26 (m, 6H, aromatic H), 7.21 (d, 1H, J=10.8 Hz, aromatic H), 6.97 (t, 1H, J=8.4 Hz, aromatic H), 6.73 (d, 1H, J=8.4 Hz, aromatic H), 4.40 (d, 1H, J=13.5 Hz, CH.sub.2OH), 3.90-3.86 (m, 1H, CH.sub.2NCH), 3.71-3.65 (m, 2H, NHCHCH and CH.sub.2NCH), 3.51-3.47 (m, 2H, CH.sub.2NCH and CH.sub.2OH), 2.95-2.92 (m, 1H, NCH.sub.2CH.sub.2), 2.83-2.79 (m, 1H, NCH.sub.2CH.sub.2), 2.39-2.35 (m, 1H, NCH.sub.2CH.sub.2), 2.02-1.94 (m, 2H, NHCHCH and NCH.sub.2CH.sub.2).
[0622] .sup.13C NMR (100 MHz, CDCl.sub.3): 164.5 and 162.1 (d, .sup.1J.sub.C,F=244 Hz, aromatic C), 149.5 (2) (pyridinyl C), 148.2 (aromatic C),145.8 (pyridinyl C), 143.5 and 143.4 (d, .sup.3J.sub.C,F=7.9 Hz, aromatic C), 130.1 and 130.0 (d, .sup.3J.sub.C,F=8.2 Hz, aromatic C), 129.4 (aromatic C), 128.8 (aromatic C), 127.5 (aromatic C), 123.9 (2) (pyridinyl C), 121.7 and 121.7 (d, .sup.4J.sub.C,F=2.3 Hz, aromatic C), 119.4 (aromatic C), 115.2 (aromatic C), 113.0 and 112.8 (d, .sup.2J.sub.C,F=21.8 Hz, aromatic C), 112.9 and 112.7 (d, .sup.2J.sub.C,F=21.0 Hz, aromatic C), 64.3 (CH.sub.2NCH), 63.3 (CH.sub.2NCH), 58.1 (CH.sub.2OH), 54.4 (NHCHCH), 51.6 (NCH.sub.2CH.sub.2), 38.1 (NHCHCH), 23.6 (NCH.sub.2CH.sub.2).
[0623] .sup.19F NMR (376 MHz, CDCl.sub.3): 113.4.
[0624] [].sub.D.sup.22=29.8 (c=0.4, CHCl.sub.3).
[0625] Chiral SFC (AS-H, 1.5 mL/min, MeOH with 0.05% Et.sub.3N in CO.sub.2, =210 nm): t.sub.R(minor)=6.2 min, t.sub.R(major)=6.9 min.
[0626] IR (thin film, cm.sup.1): v.sub.max 3364, 2917, 1608, 1516, 1480, 1314, 1262, 1193, 1164, 1076, 869, 822, 788, 752, 691.
[0627] LCMS (UV Chromatogram, 210 nm, 2.5 min run): Purity >95% by UV, rt=0.82 min, m/z 390 (M+H).sup.+, m/z 434 (M+FA-H).sup..
[0628] HRMS (ESI, m/z): calcd for C.sub.24H.sub.24FN.sub.3O (M+H).sup.+: 390.1982, found: 390.1972.
((3 aR,4R,9bR)-8-(4-Methoxyphenyl)-1-(pyridin-4-ylmethyl)-2,3,3a,4,5,9b-hexahydro-1H-pyrrolo[3,2-c]quinolin-4-yl)methanol (4/BRD1490)
[0629] ##STR00004##
[0630] Prepared from benzyl (3aR,4R,9bR)-4-(hydroxymethyl)-8-(4-methoxy-phenyl)-2,3,3a,4,5,9b-hexahydro-1H-pyrrolo[3,2-c]quinoline-1-carboxylate 13d (142 mg, 0.32 mmol) according to General Procedure B. Purification by flash column chromatography eluting with 70% ethyl acetate in hexane gave the desired product 4 as an off-white solid (52 mg, yield 41%).
[0631] Rf=0.40 (silica gel, 5% methanol in dichloromethane, UV).
[0632] 1H NMR (400 MHz, CDCl3): 8.54 (d, 2H, J=4.9 Hz, aromatic H), 7.44 (d, 2H, J=8.4 Hz, aromatic H), 7.32-7.25 (m, 4H, aromatic H), 6.96 (d, 2H, J=8.4 Hz, aromatic H), 6.73 (d, 1H, J=8.0 Hz, aromatic H), 4.43 (d, 1H, J=13.2 Hz, CH2OH), 3.90-3.89 (m, 1H, CH2NCH), 3.85 (s, 3H, OCH3), 3.71-3.65 (m, 2H, CH2NCH and NHCHCH), 3.49-3.45 (m, 2H, CH2NCH and CH2OH), 2.94-2.80 (m, 2H, NCH2CH2 and NHCHCH), 2.36-2.34 (m, 1H, NCH2CH2), 2.00-1.97 (m, 2H, NCH2CH2).
[0633] 13C NMR (100 MHz, CDCl3): 158.4 (aromatic C), 150.3 (aromatic C), 149.9 (2) (aromatic C), 144.9 (aromatic C), 134.0 (aromatic C), 130.1 (aromatic C), 129.1 (aromatic C), 127.3 (2) (aromatic C), 127.2 (aromatic C), 123.8 (2) (aromatic C), 119.4 (aromatic C), 115.2 (aromatic C), 114.2 (2) (aromatic C), 64.4 (CH2NCH), 63.3 (CH2NCH), 58.1 (CH2OH), 55.4 (OCH3), 54.5 (NHCHCH), 51.6 (NCH2CH2), 38.2 (NHCHCH), 23.6 (NCH2CH2).
[0634] []D22=34.1 (c=0.4, CHC13).
[0635] IR (thin film, cm-1): vmax 3364, 2911, 1609, 1495, 1246, 1180, 1045, 1027, 819, 754.
[0636] Chiral SFC (AS-H, 1.5 mL/min, MeOH with 0.05% Et3N in CO2, =210 nm): tR(minor)=6.8 min, tR(major)=7.1 min.
[0637] LCMS (UV Chromatogram, 210 nm, 2.5 min run): Purity >95% by UV, rt=0.79 min, m/z 402.5 (M+H)+, m/z 446.6 (M+FA-H).
[0638] HRMS (ESI, m/z): calcd for C25H27N3O2 (M+H)+: 402.2182, found: 402.2171.
((3aS,4S,9bS)-8-(3-Fluorophenyl)-1-(pyridin-4-ylmethyl)-2,3,3a,4,5,9b-hexahydro-1H-pyrrolo[3,2-c]quinolin-4-yl)methanol (5/BRD0750)
[0639] ##STR00005##
[0640] Prepared from benzyl (3aS,4S,9bS)-8-(3-fluorophenyl)-4-(hydroxymethyl)-2,3,3a,4,5,9b-hexahydro-1H-pyrrolo[3,2-c]quinoline-1-carboxylate 13e (168 mg, 0.39 mmol) according to General Procedure B. Purification by flash column chromatography eluting with 80% ethyl acetate in hexane gave the desired product 5 as an off-white solid (71 mg, yield 47%).
[0641] R.sub.f.sup.=0.25 (silica gel, 5% methanol in dichloromethane, UV)
[0642] .sup.1H NMR (400 MHz, CDCl.sub.3): 8.53 (d, 2H, J=5.0 Hz, aromatic H), 7.34-7.33 (m, 3H, aromatic H), 7.28-7.26 (m, 3H, aromatic H), 7.21 (d, 1H, J=10.6 Hz, aromatic H), 6.96 (t, 1H, J=8.4 Hz, aromatic H), 6.73 (d, 1H, J=8.4 Hz, aromatic H), 4.39 (d, 1H, J=13.2 Hz, CH.sub.2OH), 3.87 (dd, 1H, J=11.6 Hz and 5.0 Hz, CH.sub.2NCH), 3.71-3.67 (m, 2H, NHCHCH and CH.sub.2NCH), 3.51 (d, 1H, J=13.2 Hz, CH.sub.2OH), 3.47-3.45 (m, 1H, CH.sub.2NCH), 2.96-2.90 (m, 1H, NCH.sub.2CH.sub.2), 2.82-2.79 (m, 1H, NCH.sub.2CH.sub.2), 2.39 (dd, 1H, J=17.8 Hz and 8.8 Hz, NCH.sub.2CH.sub.2), 1.99-1.96 (m, 2H, NHCHCH and NCH.sub.2CH.sub.2).
[0643] .sup.13C NMR (100 MHz, CDCl.sub.3): 164.5 and 162.1 (d, .sup.1J.sub.C,F=243 Hz, aromatic C), 149.7 (2) (pyridinyl C), 148.0 (aromatic C),145.9 (pyridinyl C), 143.5 and 143.4 (d, .sup.3J.sub.C,F=7.5 Hz, aromatic C), 130.1 and 130.0 (d, .sup.3J.sub.C,F=8.6 Hz, aromatic C), 129.4 (aromatic C), 128.8 (aromatic C), 127.5 (aromatic C), 123.9 (2) (pyridinyl C), 121.8 and 121.7 (d, .sup.4J.sub.C,F=2.8 Hz, aromatic C), 119.5 (aromatic C), 115.2 (aromatic C), 113.0 and 112.8 (d, .sup.2J.sub.C,F=21.4 Hz, aromatic C), 112.9 and 112.7 (d, .sup.2J.sub.C,F=20.9 Hz, aromatic C), 64.2 (CH.sub.2NCH), 63.3 (CH.sub.2NCH), 58.1 (CH.sub.2OH), 54.4 (NHCHCH), 51.6 (NCH.sub.2CH.sub.2), 38.1 (NHCHCH), 23.6 (NCH.sub.2CH.sub.2).
[0644] .sup.19F NMR (376 MHz, CDCl.sub.3): 113.4.
[0645] [].sub.D.sup.22=+23.6 (c=0.4, CHCl.sub.3).
[0646] Chiral SFC (AS-H, 1.5 mL/min, MeOH with 0.05% Et.sub.3N in CO.sub.2, =210 nm): t.sub.R(major)=6.2 min, t.sub.R(minor)=6.9 min.
[0647] IR (thin film, cm.sup.1): v.sub.max 3332, 2916, 1608, 1517, 1480, 1300, 1262, 1193, 1167, 1077, 867, 821, 784, 753, 692.
[0648] LCMS (UV Chromatogram, 210 nm, 2.5 min run): Purity >95% by UV, rt=0.86 min, m/z 390.5 (M+H).sup.+, m/z 434.5 (M+FA-H).sup..
[0649] HRMS (ESI, m/z): calcd for C.sub.24H.sub.24FN.sub.3O (M+H).sup.+: 390.1982, found: 390.1973.
((3aS,4S,9bS)-8-(4-Methoxyphenyl)-1-(pyridin-4-ylmethyl)-2,3,3a,4,5,9b-hexahydro-1H-pyrrolo[3,2-c]quinolin-4-yl)methanol (6/BRD6201)
[0650] ##STR00006##
[0651] Prepared from benzyl (3aS,4S,9bS)-4-(hydroxymethyl)-8-(4-methoxy-phenyl)-2,3,3a,4,5,9b-hexahydro-1H-pyrrolo[3,2-c]quinoline-1-carboxylate 13f (178 mg, 0.45 mmol) according to General Procedure B. Purification by flash column chromatography eluting with 65% ethyl acetate in hexane gave the desired product 6 as an off-white solid (65 mg, yield 41%).
[0652] R.sub.f=0.43 (silica gel, 5% methanol in dicholoromethane, UV).
[0653] .sup.1H NMR (400 MHz, CDCl.sub.3): 8.54 (d, 2H, J=5.0 Hz, aromatic H), 7.44 (d, 2H, J=8.2 Hz, aromatic H), 7.33-7.25 (m, 4H, aromatic H), 6.96 (d, 2H, J=8.2 Hz, aromatic H), 6.73 (d, 1H, J=8.2 Hz, aromatic H), 4.44 (d, 1H, J=13.2 Hz, CH.sub.2OH), 3.92-3.86 (m, 1H, CH.sub.2NCH), 3.85 (s, 3H, OCH.sub.3), 3.71 (dd, 1H, J=11.3 Hz and 3.6 Hz, CH.sub.2NCH), 3.65-3.64 (m, 1H, NHCHCH), 3.48-3.44 (m, 2H, CH.sub.2NCH and CH.sub.2OH), 2.95-2.91 (m, 1H, NCH.sub.2CH.sub.2), 2.84-2.81 (m, 1H, NCH.sub.2CH.sub.2), 2.36-2.34 (m, 1H, NCH.sub.2CH.sub.2), 2.03-1.95 (m, 2H, NCH.sub.2CH.sub.2).
[0654] .sup.13C NMR (100 MHz, CDCl.sub.3): 158.4 (aromatic C), 149.8 (2) (aromatic C), 148.0 (aromatic C), 144.9 (aromatic C), 134.0 (aromatic C), 130.1 (aromatic C), 129.1 (aromatic C), 127.3 (2) (aromatic C), 127.3 (aromatic C), 123.8 (2) (aromatic C), 119.3 (aromatic C), 115.2 (aromatic C), 114.2 (2) (aromatic C), 64.4 (CH.sub.2NCH), 63.3 (CH.sub.2NCH), 58.1 (CH.sub.2OH), 55.4 (OCH.sub.3), 54.4 (NHCHCH), 51.6 (NCH.sub.2CH.sub.2), 38.1 (NHCHCH), 23.7 (NCH.sub.2CH.sub.2).
[0655] [].sub.D.sup.22=24.6 (c=0.4, CHCl.sub.3).
[0656] Chiral SFC (AS-H, 1.5 mL/min, MeOH with 0.05% Et.sub.3N in CO.sub.2, =210 nm): t.sub.R(major)=6.9 min, t.sub.R(minor)=7.2 min.
[0657] IR (thin film, cm.sup.1): v.sub.max 3365, 2925, 1610, 1496, 1246, 1180, 1045, 1027, 818, 756.
[0658] LCMS (UV Chromatogram, 210 nm, 2.5 min run): Purity >95% by UV, rt=0.80 min, m/z 402.1 (M+H).sup.+, m/z 446.6 (M+FA-H).sup..
[0659] HRMS (ESI, m/z): calcd for C.sub.25H.sub.27N.sub.3O.sub.2 (M+H).sup.+: 402.2182, found: 402.2180.
((3aS,4R,9bS)-8-(3-Fluorophenyl)-1-(pyridin-4-ylmethyl)-2,3,3a,4,5,9b-hexahydro-1H-pyrrolo[3,2-c]quinolin-4-yl)methanol (7/BRD5039)
[0660] ##STR00007##
[0661] Prepared from benzyl (3aS,4R,9bS)-8-(3-fluorophenyl)-4-(hydroxymethyl)-2,3,3a,4,5,9b-hexahydro-1H-pyrrolo[3,2-c]quinoline-1-carboxylate 13 g (168 mg, 0.39 mmol) according to General Procedure B. Purification by flash column chromatography eluting with 80% ethyl acetate in hexane gave the desired product 7 as an off-white solid (83 mg, yield 55%).
[0662] R.sub.f=0.39 (silica gel, 10% methanol in dichloromethane, UV)
[0663] .sup.1H NMR (400 MHz, CDCl.sub.3): 8.46 (d, 2H, J=5.0 Hz, aromatic H), 7.35-7.33 (m, 2H, aromatic H), 7.28-7.25 (m, 4H, aromatic H), 7.21-7.19 (m, 1H, aromatic H), 6.97 (t, 1H, J=8.6 Hz, aromatic H), 6.73 (d, 1H, J=8.4 Hz, aromatic H), 4.37 (d, 1H, J=13.6 Hz, CH.sub.2OH), 4.01 (d, 1H, J=9.4 Hz, CH.sub.2NCH), 3.57-3.53 (m, 2H, NHCHCH and CH.sub.2NCH), 3.37 (s, 1H, CH.sub.2NCH), 3.30 (d, 1H, J=13.8 Hz, CH.sub.2OH), 2.97-2.93 (m, 1H, NCH.sub.2CH.sub.2), 2.24-2.21 (m, 1H, NCH.sub.2CH.sub.2), 2.10-2.04 (m, 2H, NCH.sub.2CH.sub.2 and NHCHCH), 1.67-1.64 (m, 1H, NCH.sub.2CH.sub.2).
[0664] .sup.13C NMR (100 MHz, CDCl.sub.3): 164.5 and 162.1 (d, .sup.1J.sub.C,F=243.4 Hz, aromatic C), 149.8 (aromatic C), 149.0 (2) (pyridinyl C), 144.6 (pyridinyl C), 143.6 and 143.5 (d, .sup.3J.sub.C,F=8.4 Hz, aromatic C), 130.3 (aromatic C), 130.1 and 130.0 (d, .sup.3J.sub.C,F=8.9 Hz, aromatic C), 127.9 (aromatic C), 127.6 (aromatic C), 123.6 (2) (pyridinyl C), 121.7 and 121.7 (d, .sup.4J.sub.C,F=1.7 Hz, aromatic C), 118.2 (aromatic C), 114.7 (aromatic C), 113.0 and 112.8 (d, .sup.2J.sub.C,F=21.5 Hz, aromatic C), 112.8 and 112.6 (d, .sup.2J.sub.C,F=21.0 Hz, aromatic C), 64.7 (CH.sub.2NCH), 64.2 (CH.sub.2NCH), 56.0 (CH.sub.2OH), 54.5 (NHCHCH), 51.4 (NCH.sub.2CH.sub.2), 35.8 (NHCHCH), 25.7 (NCH.sub.2CH.sub.2).
[0665] .sup.19F NMR (376 MHz, CDCl.sub.3): 113.4.
[0666] [].sub.D.sup.22=30.4 (c=0.4, CHCl.sub.3).
[0667] Chiral SFC (AS-H, 1.5 mL/min, MeOH with 0.05% Et.sub.3N in CO.sub.2, =210 nm): t.sub.R(major)=6.4 min, t.sub.R(minor)=7.0 min.
[0668] IR (thin film, cm.sup.1): v.sub.max 3334, 2927, 1608, 1522, 1484, 1326, 1261, 1198, 1160, 1076, 868, 819, 782, 752. 694.
[0669] LCMS (UV Chromatogram, 210 nm, 2.5 min run): Purity >95% by UV, rt=0.87 min, m/z 390.2 (M+H).sup.+, m/z 434.6 (M+FA-H).sup..
[0670] HRMS (ESI, m/z): calcd for C.sub.24H.sub.24FN.sub.3O (M+H).sup.+: 390.1982, found: 390.1976.
((3aS,4R,9bS)-8-(4-Methoxyphenyl)-1-(pyridin-4-ylmethyl)-2,3,3a,4,5,9b-hexahydro-1H-pyrrolo[3,2-c]quinolin-4-yl)methanol (8/BRD0739)
[0671] ##STR00008##
[0672] Prepared from benzyl (3aS,4R,9bS)-4-(hydroxymethyl)-8-(4-methoxy-phenyl)-2,3,3a,4,5,9b-hexahydro-1H-pyrrolo[3,2-c]quinoline-1-carboxylate 13h (143 mg, 0.32 mmol) according to General Procedure B. Purification by flash column chromatography eluting with 70% ethyl acetate in hexane gave the desired product 8 as an off-white solid (62 mg, yield 48%).
[0673] R.sub.f=0.67 (silica gel, 10% methanol in dichloromethane, UV)
[0674] .sup.1H NMR (400 MHz, CDCl.sub.3): 8.46 (d, 2H, J=4.8 Hz, aromatic H), 7.44-7.43 (d, 2H, J=8.2 Hz, aromatic H), 7.32-7.27 (m, 4H, aromatic H), 6.96 (d, 2H, J=8.2 Hz, aromatic H), 6.73 (d, 1H, J=8.2 Hz, aromatic H), 4.39 (d, 1H, J=13.8 Hz, CH.sub.2OH), 3.99 (d, 1H, J=10.0 Hz, CH.sub.2NCH), 3.85 (s, 3H, OCH.sub.3), 3.58-3.52 (m, 2H, CH.sub.2NCH and NHCHCH), 3.37 (s, 1H, CH.sub.2NCH), 3.29 (d, 1H, J=13.8 Hz, CH.sub.2OH), 2.96 (t, 1H, J=9.0 Hz, NCH.sub.2CH.sub.2), 2.24-2.18 (m, 1H, NCH.sub.2CH.sub.2), 2.10-2.07 (m, 2H, NCH.sub.2CH.sub.2 and NHCHCH), 1.68-1.64 (m, 1H, NCH.sub.2CH.sub.2).
[0675] .sup.13C NMR (100 MHz, CDCl.sub.3): 158.3 (aromatic C), 149.8 (aromatic C), 149.1 (2) (aromatic C), 143.7 (aromatic C), 134.0 (aromatic C), 129.9 (aromatic C), 129.3 (aromatic C), 127.4 (aromatic C), 127.3 (2) (aromatic C), 123.7 (2) (aromatic C), 118.2 (aromatic C), 114.8 (aromatic C), 114.2 (2) (aromatic C), 64.6 (CH.sub.2NCH), 64.2 (CH.sub.2NCH), 56.1 (CH.sub.2OH), 55.4 (OCH.sub.3), 54.6 (NHCHCH), 51.4 (NCH.sub.2CH.sub.2), 35.9 (NHCHCH), 25.7 (NCH.sub.2CH.sub.2).
[0676] [].sub.D.sup.22=23.4 (c=0.4, CHCl.sub.3).
[0677] Chiral SFC (AS-H, 1.5 mL/min, MeOH with 0.05% Et.sub.3N in CO.sub.2, =210 nm): t.sub.R(major)=6.1 min, t.sub.R(minor)=7.3 min.
[0678] IR (thin film, cm.sup.1): v.sub.max 3402, 2929, 1614, 1499, 1246, 1180, 1029, 817, 753.
[0679] LCMS (UV Chromatogram, 210 nm, 2.5 min run): Purity >95% by UV, rt=0.80 min, m/z 402.2 (M+H).sup.+, m/z 446.6 (M+FA-H).sup..
[0680] HRMS (ESI, m/z): calcd for C.sub.25H.sub.27N.sub.3O.sub.2 (M+H).sup.+: 402.2182, found: 402.2172.
tert-Butyl (3-((3 aR,4S,9bR)-4-(hydroxymethyl)-1-(pyridin-4-ylmethyl)-2,3,3a,4,5.9b-hexahydro-1H-pyrrolo[3,2-c]quinolin-8-yl)phenyl)carbamate (14)
[0681] ##STR00009##
[0682] Prepared from benzyl (3aR,4S,9bR)-8-(3-((tert-butoxycarbonyl)amino)-phenyl)-4-(hydroxymethyl)-2, 3, 3a, 4, 5, 9b-hexahydro-1H-pyrrolo[3,2-c]quinoline-1-carboxylate 13i (210 mg, 0.53 mmol) according to General Procedure B. Purification by flash column chromatography eluting with 60% to 90% ethyl acetate in hexane gave the desired product 14 as a white solid (205 mg, yield 79%).
[0683] R.sub.f=0.28 (silica gel, 10% methanol in dichloromethane, UV).
[0684] .sup.1H NMR (400 MHz, CDCl.sub.3): 8.45 (d, 2H, J=5.0 Hz, aromatic H), 7.50 (s, 1H, aromatic H), 7.35-7.29 (m, 5H, aromatic H), 7.18 (d, 1H, J=7.3 Hz, aromatic H), 6.71 (d, 1H, J=8.2 Hz, aromatic H), 4.34 (d, 1H, J=13.8 Hz, CH.sub.2OH), 3.98 (d, 1H, J=10.2 Hz, CH.sub.2NCH), 3.58 (d, 1H, J=10.2 Hz, CH.sub.2NCH), 3.53-3.51 (m, 1H, NHCHCH), 3.36-3.32 (m, 2H, CH.sub.2NCH and CH.sub.2OH), 2.99-2.97 (m, 1H, NCH.sub.2CH.sub.2), 2.27-2.25 (m, 1H, NCH.sub.2CH.sub.2), 2.10-2.03 (m, 2H, NCH.sub.2CH.sub.2 and NHCHCH), 1.69-1.67 (m, 1H, NCH.sub.2CH.sub.2), 1.54 (s, 9H, tert-butyl CH.sub.3).
[0685] .sup.13C NMR (100 MHz, CDCl.sub.3): 171.2 (CONH), 152.9 (aromatic C), 148.8 (aromatic C), 144.3 (aromatic C), 142.0 (aromatic C), 138.8 (aromatic C), 130.3 (aromatic C), 129.3 (aromatic C), 127.9 (aromatic C), 123.8 (aromatic C), 121.0 (aromatic C), 116.5 (aromatic C), 116.4 (aromatic C), 114.8 (aromatic C), 80.5 (tert-butyl C), 64.6 (CH.sub.2NCH), 64.3 (CH.sub.2NCH), 56.0 (CH.sub.2OH), 54.4 (NHCHCH), 51.4 (NCH.sub.2CH.sub.2), 35.8 (NHCHCH), 28.4 (tert-butyl CH.sub.3), 25.8 (NCH.sub.2CH.sub.2).
[0686] [].sub.D.sup.22=+57.6 (c=0.5, CHCl.sub.3).
[0687] Chiral SFC (AS-H, 1.5 mL/min, MeOH with 0.05% Et.sub.3N in CO.sub.2, =210 nm): t.sub.R(minor)=6.5 min, t.sub.R(major)=6.9 min.
[0688] IR (thin film, cm.sup.1): v.sub.max 3425, 2930, 1706, 1606, 1514, 1366, 1241, 1162, 1065, 788, 754, 699.
[0689] LCMS (UV Chromatogram, 210 nm, 2.5 min run): Purity >85% by UV, rt=0.99 min, m/z 487.6 (M+H).sup.+, m/z 531.7 (M+FA-H).sup..
[0690] HRMS (ESI, m/z): calcd for C.sub.29H.sub.35N.sub.4O.sub.3 (M+H).sup.+: 487.2709, found: 487.2720.
N-(2-(2-(2-(3-((3aR,4S,9bR)-4-(Hydroxymethyl)-1-(pyridin-4-ylmethyl)-2,3,3a,4,5,9b-hexahydro-1H-pyrrolo[3,2-c]quinolin-8-yl)phenyl)amino)-3-oxopropoxy)ethoxy)ethoxy)ethyl)-5-43aS,4S,6aR)-2-oxohexahydro-1H-thieno[3,4-d]imidazol-4-yl)pentanamide (15)
[0691] A 5 mL reaction vial was charged with tert-Butyl (3-((3aR,4S,9bR)-4-(hydroxymethyl)-1-(pyridin-4-ylmethyl)-2,3,3a,4,5,9b-hexahydro-1H-pyrrolo[3,2-c]quinolin-8-yl)phenyl)carbamate (14, 39 mg) and hydrogen chloride solution (4.0 M in dioxane, 0.5 mL). After stirring at room temperature for 30 min, the solvent was removed under vacuum. The residue was re-suspended in dichloromethane and evaporated to dryness. The obtained crude solid was added to a reaction mixture of biotin-PEG3-acid (36 mg, 0.08 mmol), HATU (30 mg, 0.08 mmol), and DIPEA (28 L, 0.16 mmol) in DMF (1.0 mL), which has been stirred for at room temperature for 2 h before the crude solid addition. The resulting mixture was stirred at room temperature overnight before the removal of solvent under vacuum. The resulting residue was purified through preparative HPLC to afford the desired biotinylated product 15 as a yellow solid (30 mg, 47%).
[0692] R.sub.f=0.27 (silica gel, 17% methanol in dichloromethane, UV).
[0693] .sup.1H NMR (400 MHz, D.sub.2O): 8.70 (d, 2H, J=5.8 Hz), 8.04 (d, 2H, J=5.8 Hz), 7.73 (s, 1H), 7.59 (d, 1H, J=8.4 Hz), 7.51 (t, 1H, J=8.0 Hz), 7.36-7.32 (m, 3H), 6.98 (d, 1H, J=8.4 Hz), 5.02 (d, 1H, J=14.0 Hz), 4.91 (d, 1H, J=6.8 Hz), 4.54 (dd, 1H, J=8.8 and 5.0 Hz), 4.29 (dd, 1H, J=8.8 and 5.0 Hz), 3.94 (t, 2H, J=5.9 Hz), 3.84 (ddd, 1H, J=12.0, 3.0 and 1.5 Hz), 3.75-3.69 (m, 6H), 3.66-3.62 (m, 4H), 3.55-3.53 (m, 2H), 3.47 (t, 2H, J=5.4 Hz), 3.39-3.34 (m, 1H), 3.23 (t, 2H, J=5.2 Hz), 3.18-3.13 (m, 1H), 2.92 (dd, 1H, J=13.2 and 5.0 Hz), 2.81-2.79 (m, 1H), 2.77 (t, 2H, J=5.8 Hz), 2.73 (d, 1H, J=13.2 Hz), 2.67-2.62 (m, 1H), 2.30-2.24 (m, 1H), 2.11 (t, 2H, J=7.2 Hz), 1.61-1.54 (m, 1H), 1.50-1.39 (m, 3H), 1.28-1.20 (m, 2H).
[0694] .sup.13C NMR (100 MHz, D.sub.2O): 176.6, 173.0, 165.2, 151.0, 145.6, 141.7, 140.0, 137.8, 130.0, 130.0, 129.8, 129.1, 127.7, 122.6, 119.8, 118.6, 116.6, 111.0, 69.8, 69.7, 69.6, 69.4, 68.8, 66.7, 62.3, 62.0, 60.2, 55.4, 55.3, 53.5, 39.7, 38.8, 36.9, 35.7, 35.3, 27.9, 27.6, 26.5, 25.1.
[0695] IR (thin film, cm.sup.1): v.sub.max 3308, 2872, 2043, 1667, 1556, 1427, 1178, 1126, 796, 719.
[0696] LCMS (UV Chromatogram, 210 nm, 2.5 min run): Purity >95% by UV, rt=0.81 min, m/z 816.8 (M+H).sup.+, m/z 861.1 (M+FA-H).sup..
[0697] HRMS (ESI, m/z): calcd for C.sub.43H.sub.58N.sub.7O.sub.7S (M+H).sup.+: 816.4118, found: 816.4103.
Example 4
[0698] Fluorescence Polarization-Based Screening Assay Exploiting PAM Recognition
[0699] Since its discovery, the RNA guided endonuclease cas9 has found a wide variety of applications owing to the ease of targeting it to any genomic locus of interest using a single guide RNA.1-6 The recognition of the target DNA by Cas9 is based on complementary base pairing between the target DNA and the guide RNA as well as presence of a protospacer adjacent motif (PAM) sequence adjacent to the target sequence in DNA (Doudna, J. A.; Charpentier, E., Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science 2014, 346 (6213), 1258096; Jinek, M.; Chylinski, K.; Fonfara, I.; Hauer, M.; Doudna, J. A.; Charpentier, E., A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 2012, 337 (6096), 816-21; Jinek, M.; East, A.; Cheng, A.; Lin, S.; Ma, E.; Doudna, J., RNA-programmed genome editing in human cells. eLife 2013, 2, e00471; Cong, L.; Ran, F. A.; Cox, D.; Lin, S.; Barretto, R.; Habib, N.; Hsu, P. D.; Wu, X.; Jiang, W.; Marraffini, L. A.; Zhang, F., Multiplex genome engineering using CRISPR/Cas systems. Science 2013, 339 (6121), 819-23.; Mali, P.; Yang, L.; Esvelt, K. M.; Aach, J.; Guell, M.; DiCarlo, J. E.; Norville, J. E.; Church, G. M., RNA-guided human genome engineering via Cas9. Science 2013, 339 (6121), 823-6; Gasiunas, G.; Barrangou, R.; Horvath, P.; Siksnys, V., Cas9-crRNA ribonucleoprotein complex mediates specific DNA cleavage for adaptive immunity in bacteria. Proceedings of the National Academy of Sciences of the United States of America 2012, 109 (39), E2579-86). Till date, several Cas9 based technologies have been developed which lead to knock-in or knock-out of a specific gene (Dahlman, J. E.; Abudayyeh, O. O.; Joung, J.; Gootenberg, J. S.; Zhang, F.; Konermann, S., Orthogonal gene knockout and activation with a catalytically active Cas9 nuclease. Nat Biotechnol 2015, 33 (11), 1159-61; Merkle, F. T.; Neuhausser, W. M.; Santos, D.; Valen, E.; Gagnon, J. A.; Maas, K.; Sandoe, J.; Schier, A. F.; Eggan, K., Efficient CRISPR-Cas9-mediated generation of knockin human pluripotent stem cells lacking undesired mutations at the targeted locus. Cell reports 2015, 11 (6), 875-883; He, X.; Tan, C.; Wang, F.; Wang, Y.; Zhou, R.; Cui, D.; You, W.; Zhao, H.; Ren, J.; Feng, B., Knock-in of large reporter genes in human cells via CRISPR/Cas9-induced homology-dependent and independent DNA repair. Nucleic Acids Res 2016, 44 (9), e85; Lin, S.; Staahl, B. T.; Alla, R. K.; Doudna, J. A., Enhanced homology-directed human genome engineering by controlled timing of CRISPR/Cas9 delivery. eLife 2014, 3, e04766; Shalem, O.; Sanjana, N. E.; Hartenian, E.; Shi, X.; Scott, D. A.; Mikkelson, T.; Heckl, D.; Ebert, B. L.; Root, D. E.; Doench, J. G.; Zhang, F., Genome-scale CRISPR-Cas9 knockout screening in human cells. Science 2014, 343 (6166), 84-87).
[0700] Catalytically inactive Cas9 (dCas9) has been fused to a variety of effectors for applications in transcriptional activation and repression, genome imaging, epigenome editing as well as base editing (Chen, B.; Gilbert, L. A.; Cimini, B. A.; Schnitzbauer, J.; Zhang, W.; Li, G. W.; Park, J.; Blackburn, E. H.; Weissman, J. S.; Qi, L. S.; Huang, B., Dynamic imaging of genomic loci in living human cells by an optimized CRISPR/Cas system. Cell 2013, 155 (7), 1479-91; Hilton, I. B.; D'Ippolito, A. M.; Vockley, C. M.; Thakore, P. I.; Crawford, G. E.; Reddy, T. E.; Gersbach, C. A., Epigenome editing by a CRISPR-Cas9-based acetyltransferase activates genes from promoters and enhancers. Nat Biotechnol 2015, 33 (5), 510-7; Dominguez, A. A.; Lim, W. A.; Qi, L. S., Beyond editing: repurposing CRISPR-Cas9 for precision genome regulation and interrogation. Nat Rev Mol Cell Biol 2016, 17 (1), 5-15; Shalem, O.; Sanjana, N. E.; Zhang, F., High-throughput functional genomics using CRISPR-Cas9. Nature reviews. Genetics 2015, 16 (5), 299-311; Ma, H.; Naseri, A.; Reyes-Gutierrez, P.; Wolfe, S. A.; Zhang, S.; Pederson, T., Multicolor CRISPR labeling of chromosomal loci in human cells. Proceedings of the National Academy of Sciences of the U.S. Pat. No. 2,015,112 (10), 3002-7; Fujita, T.; Fujii, H., Efficient isolation of specific genomic regions and identification of associated proteins by engineered DNA-binding molecule-mediated chromatin immunoprecipitation (enChIP) using CRISPR. Biochemical and biophysical research communications 2013, 439 (1), 132-6; Komor, A. C.; Kim, Y. B.; Packer, M. S.; Zuris, J. A.; Liu, D. R., Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage. Nature 2016, 533 (7603), 420-4). Further, Cas9 based alterations can also be robustly propagated throughout a species population via gene drives (Gantz, V. M.; Bier, E., The dawn of active genetics. BioEssays: news and reviews in molecular, cellular and developmental biology 2016, 38 (1), 50-63; Esvelt, K. M.; Smidler, A. L.; Catteruccia, F.; Church, G. M., Concerning RNA-guided gene drives for the alteration of wild populations. Elife 2014, 3; Champer, J.; Buchman, A.; Akbari, O. S., Cheating evolution: engineering gene drives to manipulate the fate of wild populations. Nature reviews. Genetics 2016, 17 (3), 146-59). SpCas9 has been extensively investigated for gene therapy in pathologies such as Duchenne Muscular dystrophy (DMD), HIV, hereditary tyrosinemia and vision disorders (Cox, D. B.; Platt, R. J.; Zhang, F., Therapeutic genome editing: prospects and challenges. Nat Med 2015, 21 (2), 121-31; Yin, H.; Xue, W.; Chen, S.; Bogorad, R. L.; Benedetti, E.; Grompe, M.; Koteliansky, V.; Sharp, P. A.; Jacks, T.; Anderson, D. G., Genome editing with Cas9 in adult mice corrects a disease mutation and phenotype. Nature biotechnology 2014, 32 (6), 551-3; Doudna, J. A., Genomic engineering and the future of medicine. Jama 2015, 313 (8), 791-2; Ding, Q.; Strong, A.; Patel, K. M.; Ng, S. L.; Gosis, B. S.; Regan, S. N.; Cowan, C. A.; Rader, D. J.; Musunuru, K., Permanent alteration of PCSK9 with in vivo CRISPR-Cas9 genome editing. Circulation research 2014, 115 (5), 488-92; Saayman, S.; Ali, S. A.; Morris, K. V.; Weinberg, M. S., The therapeutic application of CRISPR/Cas9 technologies for HIV. Expert Opin Biol Ther 2015, 15 (6), 819-30; Nelson, C. E.; Hakim, C. H.; Ousterout, D. G.; Thakore, P. I.; Moreb, E. A.; Castellanos Rivera, R. M.; Madhavan, S.; Pan, X.; Ran, F. A.; Yan, W. X.; Asokan, A.; Zhang, F.; Duan, D.; Gersbach, C. A., In vivo genome editing improves muscle function in a mouse model of Duchenne muscular dystrophy. Science 2016, 351 (6271), 403-7; Tabebordbar, M.; Zhu, K.; Cheng, J. K. W.; Chew, W. L.; Widrick, J. J.; Yan, W. X.; Maesner, C.; Wu, E. Y.; Xiao, R.; Ran, F. A.; Cong, L.; Zhang, F.; Vandenberghe, L. H.; Church, G. M.; Wagers, A. J., In vivo gene editing in dystrophic mouse muscle and muscle stem cells. Science 2016, 351 (6271), 407-411; Long, C.; Amoasii, L.; Mireault, A. A.; McAnally, J. R.; Li, H.; Sanchez-Ortiz, E.; Bhattacharyya, S.; Shelton, J. M.; Bassel-Duby, R.; Olson, E. N., Postnatal genome editing partially restores dystrophin expression in a mouse model of muscular dystrophy. Science 2016, 351 (6271), 400-3; Bakondi, B.; Lv, W.; Lu, B.; Jones, M. K.; Tsai, Y.; Kim, K J.; Levy, R.; Akhtar, A. A.; Breunig, J. J.; Svendsen, C. N.; Wang, S., In Vivo CRISPR/Cas9 Gene Editing Corrects Retinal Dystrophy in the S334ter-3 Rat Model of Autosomal Dominant Retinitis Pigmentosa. Molecular therapy: the journal of the American Society of Gene Therapy 2016, 24 (3), 556-63; Wu, W. H.; Tsai, Y. T.; Justus, S.; Lee, T. T.; Zhang, L.; Lin, C. S.; Bassuk, A. G.; Mahajan, V. B.; Tsang, S. H., CRISPR Repair Reveals Causative Mutation in a Preclinical Model of Retinitis Pigmentosa. Molecular therapy: the journal of the American Society of Gene Therapy 2016, 24 (8), 1388-94; Zhong, H.; Chen, Y.; Li, Y.; Chen, R.; Mardon, G., CRISPR-engineered mosaicism rapidly reveals that loss of Kcnj13 function in mice mimics human disease phenotypes. Scientific reports 2015, 5, 8366).
[0701] In order to be effectively used for therapeutic applications, it is essential to have a dosable control of the therapeutic agent. This is an extremely important consideration for gene editing using Cas9, owing to the high off-target effects and chromosomal translocations observed at elevated Cas9 levels (Fu, Y.; Foden, J. A.; Khayter, C.; Maeder, M. L.; Reyon, D.; Joung, J. K.; Sander, J. D., High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol 2013, 31 (9), 822-6; Hsu, P. D.; Scott, D. A.; Weinstein, J. A.; Ran, F. A.; Konermann, S.; Agarwala, V.; Li, Y.; Fine, E. J.; Wu, X.; Shalem, O.; Cradick, T. J.; Marraffini, L. A.; Bao, G.; Zhang, F., DNA targeting specificity of RNA-guided Cas9 nucleases. Nat Biotechnol 2013, 31(9), 827-32; Pattanayak, V.; Lin, S.; Guilinger, J. P.; Ma, E.; Doudna, J. A.; Liu, D. R., High-throughput profiling of off-target DNA cleavage reveals RNA-programmed Cas9 nuclease specificity. Nature biotechnology 2013, 31 (9), 839-43; Pattanayak, V.; Guilinger, J. P.; Liu, D. R., Determining the specificities of TALENs, Cas9, and other genome-editing enzymes. Methods Enzymol 2014, 546, 47-78; Frock, R. L.; Hu, J.; Meyers, R. M.; Ho, Y. J.; Kii, E.; Alt, F. W., Genome-wide detection of DNA double-stranded breaks induced by engineered nucleases. Nature biotechnology 2015, 33 (2), 179-86; Tsai, S. Q.; Zheng, Z.; Nguyen, N. T.; Liebers, M.; Topkar, V. V.; Thapar, V.; Wyvekens, N.; Khayter, C.; lafrate, A. J.; Le, L. P.; Aryee, M. J.; Joung, J. K., GUIDE-seq enables genome-wide profiling of off-target cleavage by CRISPR-Cas nucleases. Nature biotechnology 2015, 33 (2), 187-97; Davis, K. M.; Pattanayak, V.; Thompson, D. B.; Zuris, J. A.; Liu, D. R., Small molecule-triggered Cas9 protein with improved genome-editing specificity. Nat Chem Biol 2015, 11 (5), 316-8).
[0702] Furthermore, the delivery systems used in gene therapy applications deliver constitutively active Cas9 whose activity must be terminated following the desired gene editing activity. From a gene drive perspective, it is important to develop methods to counter the nefarious use of gene drives or to facilitate its dosable, reversible and temporal control. These controls can be achieved through the precise regulation of Cas9 activity. Previous studies to control Cas9 activity have focused on developing fusions of Cas9 to proteins domains that can be regulated by small molecules (Nunez, J. K.; Lee, A. S.; Engelman, A.; Doudna, J. A., Integrase-mediated spacer acquisition during CRISPR-Cas adaptive immunity. Nature 2015, 519 (7542), 193-8; Maji, B.; Moore, C. L.; Zetsche, B.; Volz, S. E.; Zhang, F.; Shoulders, M. D.; Choudhary, A., Multidimensional chemical control of CRISPR-Cas9. Nature chemical biology 2017, 13 (1), 9-11).
[0703] However, such systems will to be difficult to adapt for therapeutic applications, since fitting these large fusion proteins into currently available delivery systems will be challenging (Senis, E.; Fatouros, C.; Grosse, S.; Wiedtke, E.; Niopek, D.; Mueller, A. K.; Borner, K.; Grimm, D., CRISPR/Cas9-mediated genome engineering: an adeno-associated viral (AAV) vector toolbox. Biotechnol J 2014, 9 (11), 1402-12). Further, most of these systems act merely as turn-on switches for the Cas9 systems and several are not reversible which hinder temporal control (Nunez, J. K.; Harrington, L. B.; Doudna, J. A., Chemical and Biophysical Modulation of Cas9 for Tunable Genome Engineering. ACS Chem Biol 2016, 11 (3), 681-8).
[0704] Small molecule inhibitors of Cas9 will allow both dose and temporal control of its activity and aid in the better application of this system in gene therapy. Given that Cas9 is vital to several bacterial processes including immunity, inhibitors of this protein have the potential to afford novel anti-infective agents to counter the ever-growing challenge of antibiotic resistance (Westra, E. R.; Buckling, A.; Fineran, P. C., CRISPR-Cas systems: beyond adaptive immunity. Nature reviews. Microbiology 2014, 12 (5), 317-26; Barrangou, R., The roles of CRISPR-Cas systems in adaptive immunity and beyond. Current opinion in immunology 2015, 32, 36-41).
[0705] Recent studies have described the discovery of certain anti-CRISPR proteins from phages that inhibit SpCas9 in E. coli and human cells (Pawluk, A.; Staals, R. H.; Taylor, C.; Watson, B. N.; Saha, S.; Fineran, P. C.; Maxwell, K. L.; Davidson, A. R., Inactivation of CRISPR-Cas systems by anti-CRISPR proteins in diverse bacterial species. Nature microbiology 2016, 1 (8), 16085; Pawluk, A.; Amrani, N.; Zhang, Y.; Garcia, B.; Hidalgo-Reyes, Y.; Lee, J.; Edraki, A.; Shah, M.; Sontheimer, E. J.; Maxwell, K. L.; Davidson, A. R., Naturally Occurring Off-Switches for CRISPR-Cas9. Cell 2016, 167 (7), 1829-1838.e9; Shin, J.; Jiang, F.; Liu, J. J.; Bray, N. L.; Rauch, B. J.; Baik, S. H.; Nogales, E.; Bondy-Denomy, J.; Corn, J. E.; Doudna, J. A., Disabling Cas9 by an anti-CRISPR DNA mimic. Science advances 2017, 3 (7), e1701620; Rauch, B. J.; Silvis, M. R.; Hultquist, J. F.; Waters, C. S.; McGregor, M. J.; Krogan, N. J.; Bondy-Denomy, J., Inhibition of CRISPR-Cas9 with Bacteriophage Proteins. Cell 2017, 168 (1-2), 150-158.e10).
[0706] However, development of protein inhibitors of Cas9 for therapeutic purposes may prove tedious since proteins are highly sensitive to pH and temperature making them difficult to produce on a large scale and characterize. Additionally, optimizing the potency of such protein-based inhibitors may involve mutagenesis which can prove to be challenging as well as time-consuming. Further, from a therapeutic standpoint, the immunogenicity of proteins becomes a significant challenge. Small molecules, on the other hand, are quite stable under reasonably small changes in pH, temperature, and humidity as well as to the presence of cellular proteases. They are considerably easier to deliver since most enter cells through passive diffusion. Small molecule inhibitors exhibit their effects rapidly which is in stark contrast to genetic methods. Besides offering efficient dose and temporal control, small molecules are cheaper to synthesize and have little variability amongst batches. Finally, the inhibition resulting from a non-covalent small molecule can be readily reversed. All these attributes make small molecule inhibitors of Cas9a very attractive avenue to pursue.
[0707] Here, Applicants describe a novel fluorescence polarization-based screening assay that exploits the PAM recognition by SpCas9 to identify small molecule inhibitors of SpCas9. Applicants demonstrate the application of this assay in screening multiple compound libraries to identify small-molecule inhibitors of SpCas9. Applicants also illustrate the ability of the identified small molecules to inhibit cas9 activity in mammalian and bacterial cells as well as in flies. Applicants also show that these molecules are capable of inhibiting dSpCas9, thus providing a chemogenic control of dSpCas9 based technologies.
[0708] Rationale and Preliminary Studies. As discussed above, an active search is ongoing for off-switches of SpCas9. Currently, the best SpCas9 inhibitor is an Anti-CRISPR protein with a paltry efficacy of 25% inhibition in mammalian cells (Rauch, B. J.; Silvis, M. R.; Hultquist, J. F.; Waters, C. S.; McGregor, M. J.; Krogan, N. J.; Bondy-Denomy, J., Inhibition of CRISPR-Cas9 with Bacteriophage Proteins. Cell 2017, 168 (1-2), 150-158.e10). Further, this protein is highly-negatively charged with poor PK/PD properties, and has shown delivery and immunogenicity problems. Applicants believe that a small-molecule SpCas9 inhibitor will resolve some of these issues. However, the identification of small molecule inhibitors of SpCas9 poses many challenges. First, inhibitor identification requires robust, orthogonal, sensitive, high-throughput, miniature, and inexpensive assays, which are currently unavailable. Second, SpCas9 is a single turnover enzyme that holds on to its DNA substrate with pM affinity, making the development of such assays challenging (Sternberg, S. H.; Redding, S.; Jinek, M.; Greene, E. C.; Doudna, J. A., DNA interrogation by the CRISPR RNA-guided endonuclease Cas9. Nature 2014, 507 (7490), 62-7). Third, the inhibition of SpCas9 activity requires inhibition of two nuclease domains (Jinek, M.; Chylinski, K.; Fonfara, I.; Hauer, M.; Doudna, J. A.; Charpentier, E., A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 2012, 337 (6096), 816-21). Fourth, SpCas9 has many novel protein folds that limit our ability to leverage existing rational design approaches (Nishimasu, H.; Ran, F. A.; Hsu, P. D.; Konermann, S.; Shehata, S. I.; Dohmae, N.; Ishitani, R.; Zhang, F.; Nureki, O., Crystal structure of Cas9 in complex with guide RNA and target DNA. Cell 2014, 156 (5), 935-49).
[0709] To circumvent these challenges, Applicants focused on targeting the SpCas9-substrate PAM motif interaction as a way to identify novel small molecule inhibitors of Cas9. To this end, Applicants developed a several high-throughput biochemical assays for SpCas9 and performed a preliminary screen large compound libraries to identify small molecules that inhibit >50% of SpCas9 activity. Further, Applicants also found these molecules to inhibit SpCas9 activity in mammalian and bacterial cells at low micromolar concentrations.
[0710] Development of High-Throughput Primary and Secondary Assays.
[0711] SpCas9-PAM binding assays. Disrupting PAM-sequence binding by SpCas9 (e.g., by mutating SpCas9 or the PAM-site) renders SpCas9 inactive (Kleinstiver, B. P.; Prew, M. S.; Tsai, S. Q.; Topkar, V. V.; Nguyen, N. T.; Zheng, Z.; Gonzales, A. P.; Li, Z.; Peterson, R. T.; Yeh, J. R.; Aryee, M. J.; Joung, J. K., Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature 2015, 523 (7561), 481-5). Further, SpCas9 has a low affinity for the PAM-sequence, making the SpCas9-PAM interaction an Achilles' heel for inhibitor discovery. However, the low affinity creates a challenge in developing robust SpCas9-PAM binding assays, which Applicants overcame by leveraging the principle of multivalency; a DNA sequence bearing multiple PAM sites will have high affinity for SpCas9. Fluorescence polarization can be used to monitor protein-DNA interaction (Lundblad, J. R.; Laurance, M.; Goodman, R. H., Fluorescence polarization analysis of protein-DNA and protein-protein interactions. Mol Endocrinol 1996, 10 (6), 607-12). The binding of this PAM-rich DNA to a much larger SpCas9:gRNA complex will lower DNA's tumbling rate, which can be monitored by fluorescence polarization (
[0712] In the competition experiment, 12PAM-DNA competed with unlabeled DNA sequences containing a varying number of PAM-sites. As expected, the decrease in fluorescence polarization signal of 12PAM-DNA correlated with the number of PAM-sites on the competitor DNA (
[0713] Cell-based SpCas9 Activity Assays. Applicants have also optimized several cell-based high-throughput assays to measure SpCas9 activity. Recently, Joung and co-workers have reported a U2OS.eGFP.PEST cell-line where eGFP knockout by SpCas9 leads to loss of fluorescence (Kleinstiver, B. P.; Prew, M. S.; Tsai, S. Q.; Topkar, V. V.; Nguyen, N. T.; Zheng, Z.; Gonzales, A. P.; Li, Z.; Peterson, R. T.; Yeh, J. R.; Aryee, M. J.; Joung, J. K., Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature 2015, 523 (7561), 481-5; Fu, Y.; Foden, J. A.; Khayter, C.; Maeder, M. L.; Reyon, D.; Joung, J. K.; Sander, J. D., High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat. Biotechnol. 2013, 31 (9), 822-6). By quantifying the percentage of eGFP negative cells using flow cytometry, one can estimate SpCas9 activity. Applicants have modified this assay by replacing the flow-cytometry readout with a more reproducible and high-throughput readout using a high-content, automated microscope and automated image analysis (
[0714] SpCas9-mediated knockdown of mKate2 expression level results in a loss of mKate signal that can be quantified using high-content imaging and automated data analysis using MetaXpress (
[0715] In this assay, cells are transfected with two plasmids in an equimolar ratio, where one plasmid has an out-of-frame reporter eGFP gene downstream of mCherry gene separated by a stop codon, while the other plasmid has SpCas9 and gRNA genes that can target the stop codon linker and make the eGFP gene in-frame. Thus, SpCas9 mediated DNA cleavage induces eGFP expression which can be quantified by a high-content imaging and automated data analysis (
[0716] Small Molecule Screening and Hit Validation.
[0717] Applicants decided to leverage Broad Institute's performance diverse set as well as 100,000 diversity-oriented synthetic (DOS) compound library as these natural-product like molecules have proved effective against microbial proteins (Burke, M. D.; Schreiber, S. L., A planning strategy for diversity-oriented synthesis. Angew Chem Int Ed Engl 2004, 43 (1), 46-58). However, screening all of these compounds will be inefficient as compounds within a single library are relatively similar to each other, and may perform similarly in assays. The Computational Chemical Biology group at the Broad Institute has established a list of 10,000 compounds, called the Informer set, that maximally represent the diversity across all DOS compounds. For the pilot screening, Applicants decided to use this informer set (
[0718] Following the conventional norm, Applicants selected small molecules that lowered the fluorescence polarization signal by >3 of that of DMSO as candidates and categorized them according to their compound-class to generate an enrichment plot (
TABLE-US-00015 TABLE 6 List of hit compounds from the counter-screening assay of Pictet-Spengler library and their structurally similar analogs. Index Compound ID Structure 1 BRD3326 2 BRD1701
TABLE-US-00016 TABLE 7 List of hit compounds from the counter-screening assay of Povarov library and their structurally similar analogs. Index Compound ID Structure 1 BRD7087
[0719] Applicants deployed biolayer inferometry (BLI) to determine the binding affinity of BRD7087 and SpCas9:gRNA complex by tethering the compound onto the sensor. Towards this end, Applicants synthesized a biotin-conjugate of BRD7087 (
[0720] Table 8: Table containing data that was used to estimate the ligand binding affinity based on the method described by Shortridge et. al. The linewidth (LW) increases with increasing protein concentration, as expected. Peak intensity values were used to measure the Fractional Occupancy using the relationship given in the paper (1I.sub.bound/I.sub.0), where I.sub.0 is the intensity of the peak with no protein in the sample. The peak area remains relatively constant, as expected for a fixed concentration of ligand. The value of K.sub.d was estimated by nonlinear least-squares fitting of expression from the reference.
TABLE-US-00017 TABLE 8 RAW DATA EXTRACTED FROM SPECTRA [Ligand], [Protein:gRNA], LW Peak Fractional (M) (M) (Hz) Intensity Peak Area Occupancy 50 0 4.1 572470.95 3151271.718 0 50 0.75 4.3 497630.81 2968891.536 0.130731769 50 1.0 4.6 468481.06 2999269.636 0.181650947 50 1.25 5.3 398322.72 2964107.303 0.304204484 50 1.5 5.9 375769.97 3176044.761 0.343599933 50 1.75 6.3 342640.49 3020022.312 0.401470957
[0721] After biophysical validation of the interaction of BRD7087 with SpCas9, Applicants performed cellular studies with this compound. First, Applicants determined if BRD7087 and BRD5779 were cytotoxic. Treatment of U2OS and HEK293T cells with these compounds did not significantly alter the cellular ATP-levels upon incubation up to 20 M concentration for 24 h (
[0722] Since BRD7087 and BRD5779 alter PAM-binding, they should inhibit dCas9-based technologies, including base-editing and transcriptional activation technologies. Applicants undertook the dCas9-cytidine deaminase conjugate (BE3)19 targeting the EMX1 gene toward cytosine to thymine (C.fwdarw.T) conversion in the presence and absence of inhibitors at different concentrations. In this assay a ribonucleoprotein complex (BE3:gRNA) was incubated with either DMSO or compound at the specified concentration and delivered into HEK239T cells maintaining the corresponding compound concentration in the media. The base-editing efficiency was determined by isolating the genomic DNA followed by two-step barcoding the EMX1 gene and running on the MiSeq (Illumina) sequencer. Both the compounds BRD7087 and BRD5779 showed an efficient and dose-dependent inhibition of BE3-mediated base-editing (
[0723] After demonstrating inhibition of Cas9 and dCas9-based technologies, Applicants determined if BRD7087 and BRD5779 can block CRISPR-immunity of bacteria from phages. Applicants anticipated that SpCas9 inhibitors will disrupt the bacterial immunity and trigger lysis in the presence of phage. To test this hypothesis, Applicants exposed the immune bacterial cell S. aureus RN4220 strain (Heler, R.; Samai, P.; Modell, J. W.; Weiner, C.; Goldberg, G. W.; Bikard, D.; Marraffini, L. A., Cas9 specifies functional viral targets during CRISPR-Cas adaptation. Nature 2015, 519 (7542), 199-202) to CRISPR targeting lytic phage NM44 in the presence and absence of SpCas9 inhibitor BRD7087 and BRD5779 at different concentrations. Bacterial cell lysis, which was followed by OD600 measurements, was observed in the presence of our SpCas9 inhibitors and phage (
[0724] BRD7087 and BRD5779 possess three chiral centers (3aR,4S,9bR) and Applicants wished to determine if different stereoisomers have similar nuclease inhibition activity. Applicants tested four isomers of each compound BRD7087 and BRD5779 in EGFP-disruption assay (
[0725] Small molecule inhibitors of CRISPR-Cas9 will find multifactorial use in basic, biomedical, and defense research. Applicants report a suite of assays and workflow for discovery of small molecule inhibitors of SpCas9, and demonstrate the utility of these assays by identifying small molecule inhibitors of SpCas9. The availability of such workflow will catalyze discovery of inhibitors for not only SpCas9 but also several other next-generation CRISPR-associated nucleases. Our screening strategy involved disrupting PAM-binding by SpCas9 and Applicants were able to demonstrate >60% inhibition of nuclease activity of SpCas9 in mammalian and bacterial cells, as well as inhibition of dCas9 based transcriptional and base editing technologies. Thus, Applicants envision our SpCas9 inhibitors to find utility in wide variety of applications. Our future studies will involve identification of binding sites of our inhibitors and structure-guided potency optimization. Further, Applicants are interested in determining if the disruption of CRISPR-immunity by our SpCas9 inhibitors will propel bacteria to evolve CRISPR system.
REFERENCES
[0726] 1. Doudna, J. A.; Charpentier, E., Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science 2014, 346 (6213), 1258096. [0727] 2. Hsu, P. D.; Lander, E. S.; Zhang, F., Development and applications of CRISPR-Cas9 for genome engineering. Cell 2014, 157 (6), 1262-78. [0728] 3. Jinek, M.; Chylinski, K.; Fonfara, I.; Hauer, M.; Doudna, J. A.; Charpentier, E., A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 2012, 337 (6096), 816-21. [0729] 4. Jinek, M.; East, A.; Cheng, A.; Lin, S.; Ma, E.; Doudna, J., RNA-programmed genome editing in human cells. eLife 2013, 2, e00471. [0730] 5. Cong, L.; Ran, F. A.; Cox, D.; Lin, S.; Barretto, R.; Habib, N.; Hsu, P. D.; Wu, X.; [0731] Jiang, W.; Marraffini, L. A.; Zhang, F., Multiplex genome engineering using CRISPR/Cas systems. Science 2013, 339 (6121), 819-23. [0732] 6. Mali, P.; Yang, L.; Esvelt, K. M.; Aach, J.; Guell, M.; DiCarlo, J. E.; Norville, J. E.; Church, G. M., RNA-guided human genome engineering via Cas9. Science 2013, 339 (6121), 823-6. [0733] 7. Gasiunas, G.; Barrangou, R.; Horvath, P.; Siksnys, V., Cas9-crRNA ribonucleoprotein complex mediates specific DNA cleavage for adaptive immunity in bacteria. Proceedings of the National Academy of Sciences of the United States of America 2012, 109 (39), E2579-86. [0734] 8. Dahlman, J. E.; Abudayyeh, O. O.; Joung, J.; Gootenberg, J. S.; Zhang, F.; Konermann, S., Orthogonal gene knockout and activation with a catalytically active Cas9 nuclease. Nat Biotechnol 2015, 33 (11), 1159-61. [0735] 9. Merkle, F. T.; Neuhausser, W. M.; Santos, D.; Valen, E.; Gagnon, J. A.; Maas, K.; Sandoe, J.; Schier, A. F.; Eggan, K., Efficient CRISPR-Cas9-mediated generation of knockin human pluripotent stem cells lacking undesired mutations at the targeted locus. Cell reports 2015, 11 (6), 875-883. [0736] 10. He, X.; Tan, C.; Wang, F.; Wang, Y.; Zhou, R.; Cui, D.; You, W.; Zhao, H.; Ren, J.; Feng, B., Knock-in of large reporter genes in human cells via CRISPR/Cas9-induced homology-dependent and independent DNA repair. Nucleic Acids Res 2016, 44 (9), e85. [0737] 11. Lin, S.; Staahl, B. T.; Alla, R. K.; Doudna, J. A., Enhanced homology-directed human genome engineering by controlled timing of CRISPR/Cas9 delivery. eLife 2014, 3, e04766. [0738] 12. Shalem, O.; Sanjana, N. E.; Hartenian, E.; Shi, X.; Scott, D. A.; Mikkelson, T.; Heckl, D.; Ebert, B. L.; Root, D. E.; Doench, J. G.; Zhang, F., Genome-scale CRISPR-Cas9 knockout screening in human cells. Science 2014, 343 (6166), 84-87. [0739] 13. Chen, B.; Gilbert, L. A.; Cimini, B. A.; Schnitzbauer, J.; Zhang, W.; Li, G. W.; Park, J.; Blackburn, E. H.; Weissman, J. S.; Qi, L. S.; Huang, B., Dynamic imaging of genomic loci in living human cells by an optimized CRISPR/Cas system. Cell 2013, 155 (7), 1479-91. [0740] 14. Hilton, I. B.; D'Ippolito, A. M.; Vockley, C. M.; Thakore, P. I.; Crawford, G. E.; Reddy, T. E.; Gersbach, C. A., Epigenome editing by a CRISPR-Cas9-based acetyltransferase activates genes from promoters and enhancers. Nat Biotechnol 2015, 33 (5), 510-7. [0741] 15. Dominguez, A. A.; Lim, W. A.; Qi, L. S., Beyond editing: repurposing CRISPR-Cas9 for precision genome regulation and interrogation. Nat Rev Mol Cell Biol 2016, 17 (1), 5-15. [0742] 16. Shalem, O.; Sanjana, N. E.; Zhang, F., High-throughput functional genomics using CRISPR-Cas9. Nature reviews. Genetics 2015, 16 (5), 299-311. [0743] 17. Ma, H.; Naseri, A.; Reyes-Gutierrez, P.; Wolfe, S. A.; Zhang, S.; Pederson, T., Multicolor CRISPR labeling of chromosomal loci in human cells. Proceedings of the National Academy of Sciences of the United States of America 2015, 112 (10), 3002-7. [0744] 18. Fujita, T.; Fujii, H., Efficient isolation of specific genomic regions and identification of associated proteins by engineered DNA-binding molecule-mediated chromatin immunoprecipitation (enChIP) using CRISPR. Biochemical and biophysical research communications 2013, 439 (1), 132-6. [0745] 19. Komor, A. C.; Kim, Y. B.; Packer, M. S.; Zuris, J. A.; Liu, D. R., Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage. Nature 2016, 533 (7603), 420-4. [0746] 20. Gantz, V. M.; Bier, E., The dawn of active genetics. BioEssays: news and reviews in molecular, cellular and developmental biology 2016, 38 (1), 50-63. [0747] 21. Esvelt, K. M.; Smidler, A. L.; Catteruccia, F.; Church, G. M., Concerning RNA-guided gene drives for the alteration of wild populations. Elife 2014, 3. [0748] 22. Champer, J.; Buchman, A.; Akbari, O. S., Cheating evolution: engineering gene drives to manipulate the fate of wild populations. Nature reviews. Genetics 2016, 17 (3), 146-59. [0749] 23. Cox, D. B.; Platt, R. J.; Zhang, F., Therapeutic genome editing: prospects and challenges. Nat Med 2015, 21 (2), 121-31. [0750] 24. Yin, H.; Xue, W.; Chen, S.; Bogorad, R. L.; Benedetti, E.; Grompe, M.; Koteliansky, V.; Sharp, P. A.; Jacks, T.; Anderson, D. G., Genome editing with Cas9 in adult mice corrects a disease mutation and phenotype. Nature biotechnology 2014, 32 (6), 551-3. [0751] 25. Doudna, J. A., Genomic engineering and the future of medicine. Jama 2015, 313 (8), 791-2. [0752] 26. Ding, Q.; Strong, A.; Patel, K. M.; Ng, S. L.; Gosis, B. S.; Regan, S. N.; Cowan, C. A.; Rader, D. J.; Musunuru, K., Permanent alteration of PCSK9 with in vivo CRISPR-Cas9 genome editing. Circulation research 2014, 115 (5), 488-92. [0753] 27. Saayman, S.; Ali, S. A.; Morris, K. V.; Weinberg, M. S., The therapeutic application of CRISPR/Cas9 technologies for HIV. Expert Opin Biol Ther 2015, 15 (6), 819-30. [0754] 28. Nelson, C. E.; Hakim, C. H.; Ousterout, D. G.; Thakore, P. I.; Moreb, E. A.; Castellanos Rivera, R. M.; Madhavan, S.; Pan, X.; Ran, F. A.; Yan, W. X.; Asokan, A.; Zhang, F.; Duan, D.; Gersbach, C. A., In vivo genome editing improves muscle function in a mouse model of Duchenne muscular dystrophy. Science 2016, 351 (6271), 403-7. [0755] 29. Tabebordbar, M.; Zhu, K.; Cheng, J. K. W.; Chew, W. L.; Widrick, J. J.; Yan, W. X.; Maesner, C.; Wu, E. Y.; Xiao, R.; Ran, F. A.; Cong, L.; Zhang, F.; Vandenberghe, L. H.; Church, G. M.; Wagers, A. J., In vivo gene editing in dystrophic mouse muscle and muscle stem cells. Science 2016, 351 (6271), 407-411. [0756] 30. Long, C.; Amoasii, L.; Mireault, A. A.; McAnally, J. R.; Li, H.; Sanchez-Ortiz, E.; Bhattacharyya, S.; Shelton, J. M.; Bassel-Duby, R.; Olson, E. N., Postnatal genome editing partially restores dystrophin expression in a mouse model of muscular dystrophy. Science 2016, 351 (6271), 400-3. [0757] 31. Bakondi, B.; Lv, W.; Lu, B.; Jones, M. K.; Tsai, Y.; Kim, K. J.; Levy, R.; Akhtar, A. A.; Breunig, J. J.; Svendsen, C. N.; Wang, S., In Vivo CRISPR/Cas9 Gene Editing Corrects Retinal Dystrophy in the S334ter-3 Rat Model of Autosomal Dominant Retinitis Pigmentosa. Molecular therapy: the journal of the American Society of Gene Therapy 2016, 24 (3), 556-63. [0758] 32. Wu, W. H.; Tsai, Y. T.; Justus, S.; Lee, T. T.; Zhang, L.; Lin, C. S.; Bassuk, A. G.; Mahajan, V. B.; Tsang, S. H., CRISPR Repair Reveals Causative Mutation in a Preclinical Model of Retinitis Pigmentosa. Molecular therapy: the journal of the American Society of Gene Therapy 2016, 24 (8), 1388-94. [0759] 33. Zhong, H.; Chen, Y.; Li, Y.; Chen, R.; Mardon, G., CRISPR-engineered mosaicism rapidly reveals that loss of Kcnj13 function in mice mimics human disease phenotypes. Scientific reports 2015, 5, 8366. [0760] 34. Fu, Y.; Foden, J. A.; Khayter, C.; Maeder, M. L.; Reyon, D.; Joung, J. K.; Sander, J. D., High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol 2013, 31 (9), 822-6. [0761] 35. Hsu, P. D.; Scott, D. A.; Weinstein, J. A.; Ran, F. A.; Konermann, S.; Agarwala, V.; Li, Y.; Fine, E. J.; Wu, X.; Shalem, O.; Cradick, T. J.; Marraffini, L. A.; Bao, G.; Zhang, F., DNA targeting specificity of RNA-guided Cas9 nucleases. Nat Biotechnol 2013, 31 (9), 827-32. [0762] 36. Pattanayak, V.; Lin, S.; Guilinger, J. P.; Ma, E.; Doudna, J. A.; Liu, D. R., High-throughput profiling of off-target DNA cleavage reveals RNA-programmed Cas9 nuclease specificity. Nature biotechnology 2013, 31 (9), 839-43. [0763] 37. Pattanayak, V.; Guilinger, J. P.; Liu, D. R., Determining the specificities of TALENs, Cas9, and other genome-editing enzymes. Methods Enzymol 2014, 546, 47-78. [0764] 38. Frock, R. L.; Hu, J.; Meyers, R. M.; Ho, Y. J.; Kii, E.; Alt, F. W., Genome-wide detection of DNA double-stranded breaks induced by engineered nucleases. Nature biotechnology 2015, 33 (2), 179-86. [0765] 39. Tsai, S. Q.; Zheng, Z.; Nguyen, N. T.; Liebers, M.; Topkar, V. V.; Thapar, V.; Wyvekens, N.; Khayter, C.; Iafrate, A. J.; Le, L. P.; Aryee, M. J.; Joung, J. K., GUIDE-seq enables genome-wide profiling of off-target cleavage by CRISPR-Cas nucleases. Nature biotechnology 2015, 33 (2), 187-97. [0766] 40. Davis, K. M.; Pattanayak, V.; Thompson, D. B.; Zuris, J. A.; Liu, D. R., Small molecule-triggered Cas9 protein with improved genome-editing specificity. Nat Chem Biol 2015, 11 (5), 316-8. [0767] 41. Nunez, J. K.; Lee, A. S.; Engelman, A.; Doudna, J. A., Integrase-mediated spacer acquisition during CRISPR-Cas adaptive immunity. Nature 2015, 519 (7542), 193-8. [0768] 42. Maji, B.; Moore, C. L.; Zetsche, B.; Volz, S. E.; Zhang, F.; Shoulders, M. D.; Choudhary, A., Multidimensional chemical control of CRISPR-Cas9. Nature chemical biology 2017, 13 (1), 9-11. [0769] 43. Senis, E.; Fatouros, C.; Grosse, S.; Wiedtke, E.; Niopek, D.; Mueller, A. K.; Borner, K.; Grimm, D., CRISPR/Cas9-mediated genome engineering: an adeno-associated viral (AAV) vector toolbox. Biotechnol J 2014, 9 (11), 1402-12. [0770] 44. Nunez, J. K.; Harrington, L. B.; Doudna, J. A., Chemical and Biophysical Modulation of Cas9 for Tunable Genome Engineering. ACS Chem Biol 2016, 11 (3), 681-8. [0771] 45. Westra, E. R.; Buckling, A.; Fineran, P. C., CRISPR-Cas systems: beyond adaptive immunity. Nature reviews. Microbiology 2014, 12 (5), 317-26. [0772] 46. Barrangou, R., The roles of CRISPR-Cas systems in adaptive immunity and beyond. Current opinion in immunology 2015, 32, 36-41. [0773] 47. Pawluk, A.; Staals, R. H.; Taylor, C.; Watson, B. N.; Saha, S.; Fineran, P. C.; Maxwell, K. L.; Davidson, A. R., Inactivation of CRISPR-Cas systems by anti-CRISPR proteins in diverse bacterial species. Nature microbiology 2016, 1 (8), 16085. [0774] 48. Pawluk, A.; Amrani, N.; Zhang, Y.; Garcia, B.; Hidalgo-Reyes, Y.; Lee, J.; Edraki, A.; Shah, M.; Sontheimer, E. J.; Maxwell, K. L.; Davidson, A. R., Naturally Occurring Off-Switches for CRISPR-Cas9. Cell 2016, 167 (7), 1829-1838.e9. [0775] 49. Shin, J.; Jiang, F.; Liu, J. J.; Bray, N. L.; Rauch, B. J.; Baik, S. H.; Nogales, E.; Bondy-Denomy, J.; Corn, J. E.; Doudna, J. A., Disabling Cas9 by an anti-CRISPR DNA mimic. Science advances 2017, 3 (7), e1701620. [0776] 50. Rauch, B. J.; Silvis, M. R.; Hultquist, J. F.; Waters, C. S.; McGregor, M. J.; Krogan, N. J.; Bondy-Denomy, J., Inhibition of CRISPR-Cas9 with Bacteriophage Proteins. Cell 2017, 168 (1-2), 150-158.e10. [0777] 51. Sternberg, S. H.; Redding, S.; Jinek, M.; Greene, E. C.; Doudna, J. A., DNA interrogation by the CRISPR RNA-guided endonuclease Cas9. Nature 2014, 507 (7490), 62-7. [0778] 52. Nishimasu, H.; Ran, F. A.; Hsu, P. D.; Konermann, S.; Shehata, S. I.; Dohmae, N.; Ishitani, R.; Zhang, F.; Nureki, O., Crystal structure of Cas9 in complex with guide RNA and target DNA. Cell 2014, 156 (5), 935-49. [0779] 53. Kleinstiver, B. P.; Prew, M. S.; Tsai, S. Q.; Topkar, V. V.; Nguyen, N. T.; Zheng, Z.; Gonzales, A. P.; Li, Z.; Peterson, R. T.; Yeh, J. R.; Aryee, M. J.; Joung, J. K., Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature 2015, 523 (7561), 481-5. [0780] 54. Lundblad, J. R.; Laurance, M.; Goodman, R. H., Fluorescence polarization analysis of protein-DNA and protein-protein interactions. Mol Endocrinol 1996, 10 (6), 607-12. [0781] 55. Niesen, F. H.; Berglund, H.; Vedadi, M., The use of differential scanning fluorimetry to detect ligand interactions that promote protein stability. Nature protocols 2007, 2 (9), 2212-21. [0782] 56. Richardson, C. D.; Ray, G. J.; DeWitt, M. A.; Curie, G. L.; Corn, J. E., Enhancing homology-directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA. Nature biotechnology 2016, 34 (3), 339-44. [0783] 57. Fu, Y.; Foden, J. A.; Khayter, C.; Maeder, M. L.; Reyon, D.; Joung, J. K.; Sander, J. D., High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat. Biotechnol. 2013, 31 (9), 822-6. [0784] 58. Moore, R.; Spinhirne, A.; Lai, M. J.; Preisser, S.; Li, Y.; Kang, T.; Bleris, L., CRISPR-based self-cleaving mechanism for controllable gene delivery in human cells. Nucleic Acids Res 2015, 43 (2), 1297-303. [0785] 59. Nguyen, D. P.; Miyaoka, Y.; Gilbert, L. A.; Mayerl, S. J.; Lee, B. H.; Weissman, J. S.; Conklin, B. R.; Wells, J. A., Ligand-binding domains of nuclear receptors facilitate tight control of split CRISPR activity. Nat Commun 2016, 7, 12009. [0786] 60. Burke, M. D.; Schreiber, S. L., A planning strategy for diversity-oriented synthesis. Angew Chem Int Ed Engl 2004, 43 (1), 46-58. [0787] 61. Shortridge, M. D.; Hage, D. S.; Harbison, G. S.; Powers, R., Estimating protein-ligand binding affinity using high-throughput screening by NMR. J Comb Chem 2008, 10 (6), 948-58. [0788] 62. Heler, R.; Samai, P.; Modell, J. W.; Weiner, C.; Goldberg, G. W.; Bikard, D.; Marraffini, L. A., Cas9 specifies functional viral targets during CRISPR-Cas adaptation. Nature 2015, 519 (7542), 199-202.
Example 5Methods for Cas9 Nuclease Assays
[0789] Materials Instruments:
[0790] All oligos were purchased from IDT, and were either purified by HPLC for use in strand displacement assays or by desalting for use in in vitro transcription experiments. Single time point fluorescence measurements were taken using an Envision plate reader with a FITC top mirror (403), FITC 485 excitation filter (102), and BODIPY TMP FP 531 emission filter (105). Gel images were acquired with an Azure Biosystems C400 or C600.
[0791] Oligonucleotide and Plasmid Cleavage Assays.
[0792] Oligonucleotides were annealed by heating to 95 C. for 5 minutes, followed by slow cooling to 25 C. at a rate of 0.1 C./sec to produce a double stranded oligo (DS-oligo). Oligo-annealing solutions were prepared by mixing 10 M of each complementary strand together in the presence of 1 Cas9 assay buffer (20 mM Tris-HCl, pH=7.5, 150 mM KCl, 1 mM EDTA, 50 mM MgCl.sub.2). A T7-promoter spinach sequence cloned into pUC57-Kan and linearized with AsiS1 was used as the plasmid substrate for Cas9 cleavage.
[0793] A Cas9:gRNA complex was first performed by mixing each component at a ratio of 1:1.2 (Cas9:gRNA) and incubating at room temperature for 15 minutes. Cas9:gRNA complexes (500 nM) were mixed with either 100 nM of oligonucleotide or 5 nM (100 ng) of linearized plasmid in 1 assay buffer, and incubated at 37 C. for 1 hour. For oligonucleotide cleavage assays, Proteinase K (Qiagen) and RNAse (Qiagen) were added to final concentrations of 200 g/L and 100 g/L, respectively, and incubated at 37 C. for at least 30 minutes. Samples were boiled in loading buffer and 50 mM EDTA for 10 min, and run on a 15% TBE-Urea gel (ThermoFisher EC68855) for 70 minutes at 200 V. FAM fluorescence was measured prior to staining with SYBR gold (ThermoFisher) to visualize total nucleotide content. For plasmid cleavage assays, loading buffer was directly added to reactions and run on 1.6-2% agarose gels with 0.01% ethidium bromide.
[0794] Fluorescence strand displacement assays (SDA). All assay components and solutions were prepared at 10 working stocks prior to mixing. Concentrations are given as the final concentrations. In a typical assay, a Cas9:gRNA complex was first formed as described above. Cas9 without gRNA (ApoCas9) was treated similarly. DS-oligo (1 nM) was mixed with quencher oligo (Q-oligo, 5 nM) in 1 Cas9 assay buffer. Reactions were initiated by addition of Cas9:gRNA (5 nM), distributed among a 384-well plate (Corning 3575) (3 technical replicates per experiment), and incubated at 37 C. for 2-3 hours. Fluorescence was read on an Envision plate reader, using 485 nm emission and 535 nm excitation wavelengths. Typical controls included replacing Cas9:gRNA with ApoCas9 (maximum possible fluorescence), replacing DS-oligo with the single stranded FAM-labeled oligo (SS-oligo, maximum possible quenching), and omitting FAM labeled oligos altogether (background fluorescence from ApoCas9 and Q-oligo). Fraction cleaved was calculated by subtracting SS-oligo controls from matched Apo-Cas9+DS-oligo and Cas9/gRNA+DS-oligo samples and normalizing to ApoCas9+DS-oligo samples.
[0795] Cas Nuclease Binding In Vitro Transcription Spinach Assay:
[0796] HiScribe T7 High Yield RNA in vitro transcription kits were purchased from NEB (E2040S). The Spinach aptamer template and non-template oligonucleotides were annealed as described above. In a typical assay, a Cas9/Cpf1:gRNA complex was first formed as described above. Cas9/Cpf1 without gRNA (ApoCas9/ApCpf1) was treated similarly. A typical assay was performed by mixing the following components together from the 10 stocks to get the indicated final concentrations: NTPs (6.7 mM), 10 T7 reaction buffer (0.67), murine RNase inhibitor (M0314L) (1.3 U), DFHBI (1 mM), DNA template (0.1 nM), and water to a final volume of 25 mL. ApoCas9 or Cas9:gRNA complexes (10) were added to initiate cleavage and incubated at 37 C. for 30 minutes. Transcription was initiated by adding 2 mL of T7 RNA polymerase, or was omitted to assess background fluorescence. Reactions (27 L) were transferred to a 384-well plate and the fluorescence was monitored at 37 C.
[0797] Although SpCas9 binds to its DNA substrate with nanomolar affinity, even following double stranded cleavage, it was discovered that of the 4 resulting DNA fragments, the distal non-target strand is weakly held, and can be displaced upon addition of excess complementary single stranded DNA (Richardson et al., Enhancing homology-directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA. Nature biotechnology 2016, 34 (3), 339-44)) (
[0798] Next, Applicants generated an oligo complementary to the 5-end of the non-target strand and containing an Iowa-Black FQ quencher on the 3 terminus (Q-oligo). Applicants verified that excess Q-oligo (5 nM) could not disrupt the fluorescence of duplex DS-oligo (1 nM), but was capable of quenching the FAM-labeled strand outside of a duplex (SS-oligo, 1 nM). Applicants then added 5 nM of a SpCas9:gRNA complex and observed a significant loss of fluorescence. This activity was dependent on gRNA-mediated cleavage of DNA and not local DNA melting caused by Cas9 binding to the PAM motif, as addition of ApoCas9 to DS-oligo and Q-oligo did not result in fluorescence loss (
[0799] Applicants optimized the ratio of Q-oligo and Cas9: gRNA to the DS-oligo substrate by testing relative ratios of 1:1, 1:2, 1:5, 1:10, and 1:20, and found that a 5-fold excess of each reagent relative to DS-oligo is sufficient to yield maximum quenching (
[0800] Generalization of the Strand Displacement Assay to SaCas9 and FnCpf1:
[0801] Encouraged by our success at assessing SpCas9 activity, Applicants wondered whether such a scheme would be amenable to other CRISPR nucleases. Such generalizability is hindered by lack of detailed studies on the catalytic mechanisms of Cas9-nucleases from other classes and bacterial species. However, given the similarities between Staphylococcus aureus Cas9 (SaCas9) and SpCas9 protein fold and modes of DNA substrate binding, Applicants wondered if SaCas9 strand displacement would precede in the same manner. Using FAM-labeled oligos containing an SaCas9-recognizable ACGGGT PAM and a ACGGTT non-target PAM with the appropriate Q-oligo, Applicants again observed PAM- and Cas9:gRNA-dependent loss of fluorescence (
[0802] Discussion of Spinach IVT:
[0803] Development of an in vitro transcription spinach assay for measuring Cas9 activity:
[0804] Applicants wished to design a mechanism-independent assay to assess any Cas9 nuclease activity in vitro. Applicants turned to the coupling of an in vitro transcription (IVT) reaction that produces the RNA aptamer Spinach which, upon binding to the small molecule DFHBI, produces a fluorescent complex. A synthetic gene-like construct was designed to use the bacteriophage T7 RNA Polymerase (T7 RNAP) to drive the production of the Spinach RNA aptamer. This dsDNA construct, which Applicants call a genelet, consists of a T7 RNAP promoter upstream of the region that codes for the spinach RNA. By designing Cas9 gRNAs that can bind to and/or cleave PAM-containing sites within the Spinach DNA template (
[0805] As long as the correct PAM sequence is present in the DNA template, it should be possible to use any Cas nuclease with the appropriate gRNA. Analysis of the Spinach sequence revealed a number of NGG sites evenly distributed throughout the sequence, allowing for preliminary optimization of the assay with SpCas9. Indeed, Applicants were able to titer the amount of DNA template used (0.1 nM) to detect nanomolar levels of SpCas9 activity using a guide RNA that targeted site Sp-g1 (
[0806] While this indicated that no modifications would be needed to assess this assay in the context of SpCas9, it hindered the generalizability of the assay to include Cas9 nucleases with more complex PAM recognitions. Indeed, the spinach gene only contained only one NNGGGT and TTTN site each, which are the PAM recognition sequences for SaCas9 and AsCpf1/LbCpf1, respectively. To overcome this limitation, Applicants inserted additional nucleotides that could accommodate arbitrary PAM sitesone between the T7 promoter and the spinach gene (proximal site, intended for 3-PAM binding Cas enzymes), and one upstream of the T7 promoter (distal site, intended for 5-PAM binding Cas enzymes like Cpf1. Our proximal site contained a TAGGGT SaCas9 PAM, and the distal site contained a TTTC Cpf1 PAM (
[0807] To assess the generalizability of our assay, Applicants decided to assess whether Applicants could sensitively detect the activities 3 different Cpf1 orthologs-Acidaminococcus sp. Cpf1 (AsCpf1), Lachnospiraceae bacterium ND2006 Cpf1 (LbCpf1), or Francisella tularensis subsp. novicida Cpf1 (FnCpf1). In general, the Cpf1 orthologs had lower cleavage efficiency compared to the Cas9 nucleases, as was previously reported, although nanomolar detection was observed (
Example 6an Exemplary Method for Sensitive and Cell-Free Detection of CRISPR-Associated Nucleases
[0808] A multitude of biological applications for CRISPR-associated (Cas) nucleases have propelled the development of robust cell-based methods for quantitation of on- and off-target activities of these nucleases. However, emerging applications of these nucleases require cell-free methods that are simple, sensitive, cost effective, high throughput, multiplexable, and generalizable to all classes of Cas nucleases. Current methods for cell-free detection may be cumbersome, expensive, or require sophisticated sequencing technologies, hindering their widespread application beyond the field of life sciences. Developing such cell-free assays may be challenging for multiple reasons, including that Cas nucleases are single-turnover enzymes that must be present in large excess over their substrate and that different classes of Cas nucleases exhibit wildly different operating mechanisms. Here, Applicants report the development of a cell-free method wherein Cas nuclease activity is amplified via an in vitro transcription reaction that produces a fluorescent RNA:small-molecule adduct. The method herein is sensitive, detecting activity from low nanomolar concentrations of several families of Cas nucleases and can be conducted in a high-throughput microplate fashion with a simple fluorescent-based readout. Further, the method provides a mathematical framework for quantifying the activities of these nucleases and demonstrate two applications of the method, namely the development of a logic circuit and the characterization of an anti-CRISPR protein. The method may be valuable to those studying Cas nucleases and will allow application of Cas nuclease beyond the field of life sciences.
[0809] CRISPR-associated (Cas) nucleases are furnishing transformative technologies for genome editing and functional genomics. Commonly employed Cas nucleases that cleave DNA include Cas9 and Cpf1 (or Cas12).(1) These nucleases may recognize their substrate sequence via a Protospacer Adjacent Motif (PAM) sequence and base-pairing of the target sequence by a guide RNA (gRNA) borne by the nuclease. Upon target recognition, Cas nucleases may induce a double-strand break, following which the cell's repair machinery can be co-opted to alter the genomic sequence. Catalytically inactive or impaired Cas-nuclease-bearing effector domains allow loci-specific genome manipulation. (2-5) For example, a fusion of catalytically impaired Cas9 to base-modifying enzymes has produced base editors that allow base conversion (e.g., C/T) at specific genomic sites, while a fusion of catalytically-inactive Cas nucleases to transcriptional activators or repressors has enabled gene transcription and repression.(6)
[0810] There are a slew of sensitive, orthogonal, and high throughput methods that can quantify the on- and off-target activities of these nucleases in cellular and even organismal settings. (7,8) The development of general and high throughput cell-free assays for Cas nucleases has lagged despite several obvious applications.(9) For example, while the well studied Cas9 is from Streptococcus pyogenes (SpCas9), an active search is ongoing for next-generation nucleases as well as anti-CRISPR molecules to control their activity, and these pursuits may benefit from such assays. Chemically modified gRNAs are becoming preferred reagents over natural gRNAs as they provide higher specificity, stability, and lower immunogenicity. (10, 11) Cell-free assays could be used to screen synthetic gRNAs to identify ideal candidates for further cell-based studies, as such screens cannot be directly performed in cell based assays because of the large amount of input material required and high associated costs. The availability of low-cost and efficient assays may also impact several areas of synthetic biology involving the development of synthetic nucleic acid circuits and diagnostics. Circuits using nucleic-acids elements can perform complex logical computations, (12-14) exhibit dynamic behavior, (15) or potentially create biological controllers (16) by leveraging the ability of catalytically impaired SpCas9 to interfere with or regulate transcription. Finally, the availability of cell-free assays will guide the mechanistic understanding of extant and emerging nucleases.
[0811] An example cell-free assay for Cas nucleases may meet the following criteria. First, the assay is sensitive enough to continuously detect low nanomolar amounts of nuclease and, is implementable in a microplate format with an easy readout. This may be challenging as Cas nucleases are single turnover enzymes that tightly bind to their DNA substrates and products,(17,18) and a large excess of enzyme relative to the substrate (typically >10-fold) may be needed for adequate detection of activity. Second, the assay is modular and adaptable to accommodate the complex and diverse attributes of Cas nucleases, such as their enormous diversity of PAM sequences and their relative binding orientationfor example, Cas9 recognizes a 3-PAM, while Cpf1 recognizes a 5-PAM. Third, the assay works well in a broad range of temperatures, as the activity of many Cas nucleases is temperature dependent,(19) and genome editing may be performed in organisms with varying body temperatures. Fourth, the assay allows multiplexed and simultaneous quantitation of several nucleases for the standardized measurement and direct comparison of novel nucleases, allowing one to benchmark and directly compare nuclease activities under several reaction conditions. Finally, such assay is cost-effective and not require specialized instruments or data-analysis methods.
[0812] Current in vitro methods for nuclease-activity detection, including gel-based DNA cleavage assays, PCR and isothermal amplification reactions, (20-22) next-generation sequencing methods, (23) and cell-free transcription-translation assays, (24) do not meet the aforementioned criteria. The use of radiolabeled nucleotides in standard gel-cleavage assays can increase the nuclease detection limit, but such approaches require specific radiation protocols, specialized imaging equipment, and are tedious and time-consuming. Furthermore, continuous kinetic monitoring of reaction rates is challenging using gel-based workflows. Sensitivity can be boosted using the products of nuclease cleavage as templates for DNA-polymerase-based exponential amplification reactions, whereby increasing the amplification cycle time increases the detection limit.(20-22) However, these assays involve multiple liquid-handling steps, including the necessity for heating and denaturing the Cas nuclease before amplification. Furthermore, these assays involve endpoint measurements and preclude real-time monitoring of cleavage, prohibiting their use in a continuous CRISPR-based circuit. Electrochemiluminescent assays, while highly sensitive, also suffer from these two drawbacks.25 Next generation sequencing approaches are expensive and require specialized equipment and knowledge not easily accessible to many laboratories. Cell-free translation/transcription strategies meet some of the criteria, but they are expensive, require multiple components and steps, and are operational in a narrow temperature range.(24) Recent work using fluorophore/quencher pairs to assay Cas9-mediated DNA-cleavage has resulted in powerful high-throughput screening platforms, although these assays still need high concentrations of enzyme (200 nM).(26) The FRET-based Cas beacon assay also satisfies many of these criteria, but it has been optimized to detect DNA-binding interactions with the nuclease/gRNA complex and not cleavage events. (27)
[0813] Towards this end, Applicants developed a sensitive, quantifiable, and continuous cell-free assay that can be generalized to numerous Cas nucleases. Applicants hypothesized that coupling the nuclease activity to an in vitro RNA transcription readout would yield an assay with the aforementioned attributes. Because transcription yields multiple RNA transcripts, the signal stemming from the single-turnover activity of Cas nuclease will be amplified. Applicants report the use of the GFP-mimetic Spinach RNA (28,29) as a fluorescent transcription reporter,(30) which allowed Applicants to perform the assay in a microplate format using easily accessible plate readers. Furthermore, the fluorescent readout made it possible to measure the activities of multiple Cas nucleases at nanomolar concentrations. This effective amplification of the signal with the Spinach RNA reporter allowed the dynamic range of the assay to be tuned according to experimental needs, a feature that is absent in gel-based assays. To enable benchmarking of Cas nucleases, Applicants created a mathematical model to quantify the activities of different nucleases. While the Spinach assay read Cas nuclease activity in a signal-off fashion, the assay detected nuclease inhibition (e.g., by anti-CRISPR proteins) in a signal on fashion and can facilitate the discovery and validation of anti-CRISPR molecules. To demonstrate this utility, Applicants used the Spinach assay to detect SpCas9 inhibition by an anti-CRISPR protein. Finally, Applicants demonstrated a simple conditional switch using SpCas9 activity as a proof-of-concept for logic and dynamic circuits. Such conditional switches are key elements in many nucleic-acid-based synthetic circuits and can potentially turn a gene ON or OFF using internal transcriptional signals.
[0814] Results
[0815] Development of a Cell-Free Assay for Measuring the Activity of Cas Nucleases
[0816] To enhance the detection limit of Cas nuclease activity, Applicants coupled the output of this activity to an in vitro transcription (IVT) reaction that produces the RNA aptamer Spinach (
[0817] These results indicated that no modifications would be needed to assess this assay in the context of SpCas9, although it did not guarantee assay generalizability to Cas nucleases with more complex PAM recognitions. Indeed, the Spinach gene contained only one NNGGGT and TTTN site each, which are the PAM recognition sequences for SaCas9 (32) and AsCpf1/LbCpf1, (33) respectively. To overcome this limitation, Applicants inserted additional sequences in the reporter gene that could accommodate arbitrary PAM sitesone between the T7 promoter and the Spinach gene (3-PAM site, intended for 3-PAM binding Cas nucleases), and one upstream of the T7 promoter (5-PAM site, intended for 5-PAM-binding Cas enzymes such as Cpf1). The 3-PAM site contained a TAGGGT SaCas9 PAM, and the 5-PAM site contained a TTTC Cpf1 PAM (
[0818] To assess the generalizability of our assay, Applicants tested the activities of three different Cpf1 orthologs: AsCpf1, LbCpf1, and FnCpf1. In general, the Cpf1 orthologs had a lower activity compared to the Cas9 nucleases, as was previously reported,34 although nanomolar detection was still observable (
[0819] Mathematical Modeling and Data Fitting
[0820] Applicants developed a simple mathematical model (described in the Experimental section) for tracking the transcription of Spinach aptamer. The model can estimate the normalized transcription rate of the fluorescent reporter from the experimental data given in
[0821] Monitoring Anti-CRISPR Inhibition of SpCas9 Using the Spinach Assay
[0822] Given the interest in discovering inhibitors of Cas nucleases,(37,38) it may be desired to have assays that can sensitively screen for such molecules with sensitive detection of Cas nuclease activity. To that end, Applicants surveyed the inhibitory effects of the DNA-mimetic anti-CRISPR protein AcrIIA4 (39) on SpCas9 using both a traditional gel-based DNA cleavage assay and the Spinach assay. Applicants verified that AcrIIA4 could inhibit SpCas9 in a dose dependent manner using a DNA cleavage assay using 100 nM of SpCas9 (
[0823] Quantifying Conditional Activation of SpCas9 with the Spinach Assay
[0824] To demonstrate further applications of this assay, Applicants designed a conditionally activated system using SpCas9. Methods to rationally control the activity of SpCas9 or catalytically inactive SpCas9 (dSpCas9) are of interest because these enzymes can be used to regulate the activity of different genes in a cell (40) or an in vitro system. Conditional activation is intended as a regulatory mechanism by which inactive SpCas9 is re-activated only in the presence of a relevant signal. Applicants designed a system in which toehold-mediated strand displacement controls the functionality of gRNA. (41, 42) Applicants used RNA as a trigger signal to uncage the gRNA, allowing the input of the conditional switch to be the output of another gene (such as an RNA transcript) to conditionally activate SpCas9 only when the certain trigger gene is active.
[0825] The gRNA was incubated with a strand complementary to the target-binding region, called the lock strand (
CONCLUSIONS
[0826] Applicants have presented a cell-free assay to characterize Cas nuclease activity using the in vitro transcription of synthetic DNA templates (genelets) that produce the RNA Spinach aptamer, a well-known fluorescent reporter. This assay is simple and can be executed in any standard plate reader. As the number of available fluorescent RNA aptamer/fluorophore pairs are increasing (such as DFHBI-1T, (43) Broccoli, (29) Corn, (44) Mango, (45) Malachite Green, (46) and Hoechst (47)), the assay could be made even more sensitive and be expanded to simultaneously track multiple Cas nuclease reactions with multiple reporters.
[0827] Since Spinach transcription amplifies the template into multiple Spinach transcripts, it is possible to detect Cas9/Cpf1 activity from a very low quantity of the target template (0.1 nM). By identifying the best target locations on the Spinach genelet for optimal activity, Applicants were able to install arbitrary PAM sites to study any conceivable Cas nuclease. The ease in the design of the genelet to suit any type of Cas nuclease makes this a versatile assay, which Applicants demonstrate by detecting the activities of five Cas nucleases from two different CRISPR-types. For SpCas9 and SaCas9, Applicants showed detection of up to low nanomolar levels of the enzyme, allowing for more biologically relevant characterizations of activity without the need for radiolabeled nucleotides. Despite the Cpf1 nucleases having lower activities than their Cas9 counterparts, Applicants were also able to profile their activity in the nanomolar range. Interestingly, Applicants revealed different activities in terms of target site preference and cleavage efficiency between the different Cpf1 orthologs. The simple mathematical model to fit the experimental results has enabled us to quantitatively compare activities of Cas9 and Cpf1 enzymes across experiments, which was particularly important in high-throughput experiments where activities of various enzyme inhibitors and enhancers were being probed. Furthermore, Applicants showed that this assay can be easily used to titrate anti-CRISPR molecules and quantitatively access their inhibitory effects on SpCas9. Due to the low concentrations of SpCas9 needed, this assay would be a useful starting point to screen for potential inhibitors. Thus, the Spinach assay provides a general, quantitative, sensitive, and moderate-throughput means to assess Cas nuclease activity in a general fashion.
[0828] As a proof-of-concept application of the Spinach assay, Applicants demonstrated a simple conditional switch to activate SpCas9. Such conditional switches are important components in logic and dynamic regulatory modules using Cas nucleases, including oscillators and bistable systems. (48) The Cas9-based conditional switch proposed here could be a useful addition to the toolbox of conditional switches used in synthetic biology. To be practical for in vivo applications, the trigger sequence may be independent of the target. Such independence can be achieved using transduction gates that use toehold-mediated strand displacement to decouple the input signal from the target.(12,49) Given the impact Cas nucleases have had in a wide array of fields, tools to systematically characterize their activity and kinetic behavior in a variety of conditions are highly valuable. While crystallography and other such techniques can yield structural insights into the action of Cas nucleases, studying their kinetic and dynamic mechanisms require high throughput assays conducted in a well-controlled environment. In vitro cell-free methods like the one described herein are well suited for this purpose. Another advantage of the approach herein is that it continuously monitors the operation of the gene targeted by the Cas nuclease; this suggests that Applicants were also able to use our in vitro assays to quantify how small molecules or other enzymes interact with or kinetically regulate the activity of Cas9 nucleases. For example, it was recently reported that the procession of RNA polymerase could dislodge Cas9 from bound and cleaved DNA and that this effect is enhanced if Cas9 has annealed to the template strand. (50) Furthermore, this release of Cas9 allows multiple turnovers to take place. As the Spinach assay directly assesses Cas nuclease activity as a function of RNA polymerase transcription and provides a method for continuous detection, Applicants can directly study the effects of active transcription for SpCas9 as well as a variety of different Cas nucleases. Thus, the assay enables a variety of novel studies on the complex mechanics of Cas nuclease-mediated genome editing in a controlled environment.
Experimental
[0829] Cas9/Cpf1 and AcrIIA4 Protein Expression and Purification
[0830] Streptococcus pyogenes Cas9 (SpCas9), Streptococcus aureus Cas9 (SaCas9), Acidaminococcus sp. Cpf1 (AsCpf1), Lachnospiraceae bacterium ND2006 Cpf1 (LbCpf1), Francisella tularensis subsp. novicida Cpf1 (FnCpf1), and AcrIIA4 from Listeria monocytogenes were expressed in E. coli BL21 (DE3) Rosetta cells and purified as previously Described (23,33,37).
[0831] IVT DNA Oligonucleotides and gRNA Synthesis
[0832] All oligonucleotides were purchased from IDT DNA (Coralville, Iowa) and were desalted for in vitro transcription experiments. The oligonucleotides used in the conditional activation experiments were purchased from IDT with PAGE purification. Oligo annealing solutions were prepared by mixing complementary strands (10 mM final concentration) together in 1X Cas9 assay buffer (20 mM of Tris-HCl, pH=7.5; 150 mM of KCl; 1 mM of EDTA; 50 mM of MgCl.sub.2). The oligonucleotides were annealed by heating to 95 C. for five minutes followed by slow cooling to 25 C. at a rate of 0.1 C. s.sup.1 to produce a double-stranded oligonucleotide. The gRNA templates were generated by annealing a sequence-specific oligo with either a universal oligo containing the Cas-nuclease-specific tracrRNA backbone (SpCas9 and SaCas9) or a T7 oligo to yield a double-stranded T7 promoter (all Cpf1 nucleases). RNA was transcribed using HiScribe T7 Quick High Yield RNA Synthesis Kits (NEB, E2050S). To assess gRNA quality, 200 ng of purified RNA was heated to 95 C. in loading buffer (Thermo Fisher, LC6876) and 50 mM of EDTA for 10 minutes and run on a 15% TBE-Urea gel (Thermo Fisher, EC68855) for 70 minutes at 200 V. The gels were stained with Sybr Green (Thermo Fisher) and imaged by UV.
[0833] Fluorescence Data Acquisition and Gel Imaging
[0834] For in vitro transcription assays, fluorescence was continuously monitored at 37 C. using an i3 Spectra Max (Molecular Devices; Spinach-DFHBI-Ex 468/Em 502 nm; black, 384 well plate with plastic lid and clear bottom; bottom read; Corning, 8794BC). For conditional Cas9 experiments, fluorescence was measured on an H1m plate reader (Biotek Instruments; Spinach-DFHBI-Ex 469/Em 501 nm; fluorescein-Ex 495/Em 520; 96 well V-bottom plates; Corning Costar 3357). The 96 well plates were sealed during measurement using Costar 3080 microplate storage mats. Gel images were acquired with a C600 (Azure Biosystems).
[0835] Plasmid Cleavage and AcrIIA4 Inhibition Assays
[0836] In a typical DNA-cleavage assay, the Cas9:gRNA complex was formed by mixing each component at a 1:1.2 (Cas9:gRNA) molar ratio and incubating at room temperature for 5-15 minutes. Cas9:gRNA (100 nM) and AcrIIA4 protein (variable concentration) were mixed together in 1 assay buffer for five minutes at room temperature prior to the addition of 5 nM (100 ng per 20 mL) of linearized plasmid and incubated at 37 C. for 30 min. A T7-promoter containing the Spinach sequence cloned into pUC57-Kan and linearized with AsiS1 was used as the plasmid substrate. Loading buffer (6, NEB) was directly added to reactions and run on a 1.4% agarose gel containing 0.01% ethidium bromide and imaged by UV. The IC.sub.50 was determined using GraphPad with fitting to the Hill equation.
[0837] Cas-Nuclease-Binding In Vitro Transcription Spinach Assay
[0838] HiScribe T7 High Yield RNA in vitro transcription kits were purchased from NEB (E2040S). The Spinach aptamer template and non-template oligonucleotides were annealed as described above. In a typical assay, a Cas9/Cpf1:gRNA complex was first formed as described above. Cas9/Cpf1 without gRNA (ApoCas9/Cpf1) was treated similarly. A typical assay was performed by mixing the following components together from 10 stocks to get the indicated final concentrations: NTPs (6.7 mM), 10 T7 reaction buffer (0.67), murine RNase inhibitor (1.3 U; NEB, M0314L), DFHBI (1 mM; Lucerna), DNA template (0.1 nM), and water to a final volume of 25 mL. ApoCas9/Cpf1 or Cas9/Cpf1:gRNA complexes (10) were added to initiate cleavage and were incubated at 37 C. for 30 minutes. Transcription was initiated by adding 2 mL of T7 RNA polymerase or was omitted to assess the background fluorescence. Reactions (27 mL) were transferred to a 384 well plate and the fluorescence was monitored at 37 C. for up to four hours. For AcrIIA4 inhibition experiments, the Cas9:gRNA complexes were incubated with AcrIIA4 for five minutes in the presence of NTPs, reaction buffer, murine RNase inhibitor, and DFHBI at room temperature. The DNA template was added followed immediately by T7 RNA polymerase and incubation at 37 C.
[0839] RNA Synthesis and Purification for Conditional Activation Experiments
[0840] The trigger RNA and gRNA used for the conditional activation experiments were synthesized from gene templates and purified using polyacrylamide gel electrophoresis (PAGE). For gRNA, the dsDNA template was ordered from IDT DNA (Coralville, Iowa) using the gblocks option. For trigger RNA, the individual template and non-template strand were ordered form IDT DNA with PAGE purification and annealed in 1NEB transcription buffer (40 mM of Tris-HCl, 6 mM of MgCl.sub.2, 2 mM of spermidine, 1 mM of dithiothreitol, pH 7.9 at 25 C.) prior to transcription. Both gene templates were designed with a T7 RNAP promoter. RNA strands were individually transcribed in vitro using the AmpliScribe T7-Flash transcription kit (# ASF3507, Epicenter, Inc.) from the corresponding DNA templates. RNA strands were gel extracted using 10% denaturing polyacrylamide gel electrophoresis (PAGE). Next, the RNA was eluted using 0.3 M of sodium acetate at pH 5.3. Finally, the RNA was precipitated using ethanol and glycogen. The samples were then resuspended in 10-15 mL of Ambion nuclease-free water. The concentration was measured by absorbance at 260 nm using a Nanodrop 2000c Spectrophotometer.
[0841] Spinach Assay Demonstrating Conditional Activation of Cas9
[0842] First, the locking strand, pre-annealed Spinach gene, and the gRNA were incubated at room temperature for 15 minutes (the locking strand was at 3.75 excess of the gRNA and 15 excess of the Spinach gene) in the presence of 1NEB transcription buffer (40 mM of Tris-HCl, 6 mM of MgCl.sub.2, 2 mM of spermidine, 1 mM of dithiothreitol, pH 7.9 at 25 C.). The mixture was then incubated at 37 C. with the trigger RNA strand (at 1.3 excess of the locking strand) and Cas9 (at a final concentration of 0.3 mM; NEB catalog # M0386T) for 10 minutes. To this mixture, NTPs (5 mM each final concentration), DFHBI (5 mM each final concentration), and MgCl.sub.2 (14 mM each final concentration) were added. The final concentrations of the nucleic acid strands in the solution were: Spinach gene0.15 mM; locking strand2.25 mM, gRNA0.6 mM; trigger RNA3 mM. For controls lacking a specific ingredient, the mixture was prepared by skipping the appropriate ingredient and making up the missing volume with water. This reaction mixture was incubated at 37 C. for 15 hours. After incubation, 2.4 mL of T7 RNAP (200 U mL.sup.1; Cellscript, Catalog # C-T7300K) was added to 37.6 mL of the Cas9 reaction mixture for a nal volume of 40 mL. Fluorescence measurements were made with 12 mL of the mixture in one well of the 94 well plate. To average out the variation between measurements in different wells, three 12 mL wells were measured per sample.
[0843] Mathematical Model and Data Fitting
[0844] Applicants developed a simple model to quantify the relative changes in transcription rate of our template variants after Cas9 incubation. Applicants denoted with e(t) the concentration of unbound (free) T7 RNAP and with e.sup.tot the total concentration of RNAP; g indicated the concentration of unbound (free) Spinach reporter template, and g.sub.tot indicated the total concentration of template.
[0845] Applicants assumed that the reactions, including template, gRNA, and Cas9, reach a steady state prior to the addition of T7 RNAP. Therefore, when transcription starts, the concentration of template that has been cleaved by Cas9 is at steady state. The goal of the model is to quantify how pre-incubation with Cas9 affects the transcription rate of the template sample.
[0846] Typically, one would model the RNA transcription velocity as
which is the Michaelis-Menten approximation. However, this is a valid approximation only when g.sup.tot>>e.sup.tot, in which case gg.sup.tot (recall that g is the free, unoccupied concentration of template). If g.sup.tot<<e.sup.tot, then Applicants can assume that ee.sup.tot, i.e., that the free concentration of RNAP is approximately equal to the total concentration of RNAP. In this case, it is sensible to assume that g.sup.tot<<e.sup.tot because the template concentration used in our experiments is 0.1 nM, and Applicants used a T7 RNAP volume of 2 mL over a reaction volume of 27 mL (7% v/v). While the concentration of T7 RNAP is not specified by the vendor (NEB HiScribe kit # E2040S), past experiments done with similar high-yield transcription kits allowed us to estimate that a 10% v/v T7 RNAP dilution yields a final concentration of 200-300 nM.(15) Thus, it is reasonable to assume that the concentration of T7 RNAP is at least two orders of magnitude larger than the concentration of template. If g<<e.sup.tot, the transcription velocity becomes
[0847] In this expression, k.sub.cat and KM were determined by the sequence and length of the promoter and the surrounding template domains; therefore, these parameters are influenced by the pre-incubation reaction with Cas9 and by the location of the PAM sequence. Further, the concentration of template g.sup.tot that is a viable substrate for T7 depends on the efficiency of Cas9 activity. Finally, during the first hours of transcription during which the enzyme activity does not fluctuate significantly, the term
does not depend on time and is constant; additionally, g.sup.tot is constant because the Cas9 incubation reaction reached steady state prior to starting transcription.
[0848] Instead of estimating all the parameters of our simple model, Applicants quantified how the transcription rate varied in distinct assays by normalizing their outcome in relation to a control experiment in which the template was not preincubated with Cas9. The Spinach assays provide a fluorescence signal representing the RNA concentration over time; the slope of this fluorescence signal is proportional to the transcription rate. However, the RNA concentration and transcription rate can be directly estimated only via calibration experiments mapping Spinach RNA concentrations to the corresponding fluorescence levels. (51) In contrast, the relative change in the slope can be quantified without a fluorescence calibration by simply dividing the slope of each transcription experiment by the slope of the corresponding control experiment (in which the template was not pre-incubated with Cas9). The normalized slope is
[0849] where R.sub.0, g.sup.tot,0, k.sup.0, and KM.sup.0 denote the RNA concentration and corresponding template concentration and parameters for the control sample. Because all the parameters are constant, the ratio h is also constant and can be computed directly from the fluorescence data collected during the transcription experiments. To calculate , Applicants first estimated the transcription rate for each experiment by fitting a linear equation of the form
(F=St+b)
[0850] to the fluorescence data using the MATLAB command polyfit; Applicants also computed the correlation coefficient R using MATLAB's corrcoef command. Then, Applicants computed by dividing each slope by the slope of the corresponding control experiment.
REFERENCES
[0851] 1 E. V. Koonin, K. S. Makarova and F. Zhang, Curr. Opin. Microbiol., 2017, 37, 67-78. [0852] 2 M. Jinek, K Chylinski, I. Fonfara, M. Hauer, J. A. Doudna and E. Charpentier, Science, 2012, 337, 816-821. [0853] 3 J. A. Doudna and E. Charpentier, Science, 2014, 346, 1258096. [0854] 4 J. D. Sander and J. K. Joung, Nat. Biotechnol., 2014, 32, 347-355. [0855] 5 A. C. Komor, A. H. Badran and D. R. Liu, Cell, 2017, 168, 20-36. [0856] 6 A. C. Komor, A. H. Badran and D. R. Liu, ACS Chem. Biol., 2018, 13, 383-388. [0857] 7 B. P. Kleinstiver, M. S. Prew, S. Q. Tsai, V. V. Topkar, N. T. Nguyen, Z. Zheng, A. P. Gonzales, Z. Li, R. T. Peterson, J. R. Yeh, M. J. Aryee and J. K. Joung, Nature, 2015, 523, 481-485. [0858] 8 H. K. Kim, M. Song, J. Lee, A. V. Menon, S. Jung, Y. M. Kang, J. W. Choi, E. Woo, H. C. Koh, J. W. Nam and H. Kim, Nat. Methods, 2017, 14, 153-159. [0859] 9 T. R. deBoer, N. Wauford, J. Y. Chung, M. S. Torres Perez and N. Murthy, ACS Chem. Biol., 2018, 13, 461-466. [0860] 10 A. Hendel, R. O. Bak, J. T. Clark, A. B. Kennedy, D. E. Ryan, S. Roy, I. Steinfeld, B. D. Lunstad, R. J. Kaiser, A. B. Wilkens, R. Bacchetta, A. Tsalenko, D. Dellinger, L. Bruhn and M. H. Porteus, Nat. Biotechnol., 2015, 33, 985-989. [0861] 11 D. E. Ryan, D. Taussig, I. Steinfeld, S. M. Phadnis, B. D. Lunstad, M. Singh, X. Vuong, K. D. Okochi, R. McCaffrey, M. Olesiak, S. Roy, C. W. Yung, B. Curry, J. R. Sampson, L. Bruhn and D. J. Dellinger, Nucleic Acids Res., 2017, DOI:10.1093/nar/gkx1199. [0862] 12 N. Srinivas, J. Parkin, G. Seelig, E. Winfree and D. Soloveichik, Science, 2017, 358. [0863] 13 D. Y. Zhang, A. J. Turber eld, B. Yurke and E. Winfree, Science, 2007, 318, 1121-1125. [0864] 14 L. Qian and E. Winfree, Science, 2011, 332, 1196-1201. [0865] 15 E. Franco, E. Friedrichs, J. Kim, R. Jungmann, R. Murray, E. Winfree and F. C. Simmel, Proc. Natl. Acad. Sci. U.S.A, 2011, 108, E784-E793. [0866] 16 C. C. Samaniego and E. Franco, Melbourne, VIC, Australia 2017. [0867] 17 A. T. Raper, A. A. Stephenson and Z. Suo, J. Am. Chem. Soc., 2018, 140, 2971-2984. [0868] 18 C. D. Richardson, G. J. Ray, M. A. DeWitt, G. L. Curie and J. E. Corn, Nat. Biotechnol., 2016, 34, 339-344. [0869] 19 M. A. Moreno-Mateos, J. P. Fernandez, R. Rouet, C. E. Vejnar, M. A. Lane, E. Mis, M. K. Khokha, J. A. Doudna and A. J. Giraldez, Nat. Commun., 2017, 8, 2024. [0870] 20 K. Zhang, R. Deng, Y. Li, L. Zhang and J. Li, Chem. Sci., 2016, 7, 4951-4957. [0871] 21 M. Huang, X. Zhou, H. Wang and D. Xing, Anal. Chem., 2018, 90, 2193-2200. [0872] 22 C. C. Bell, G. W. Magor, K. R. Gillinder and A. C. Perkins, BMC Genomics, 2014, 15, 1002. [0873] 23 V. Pattanayak, S. Lin, J. P. Guilinger, E. Ma, J. A. Doudna and D. R. Liu, Nat. Biotechnol., 2013, 31, 839-843. [0874] 24 R. Marshall, C. S. Maxwell, S. P. Collins, T. Jacobsen, M. L. Luo, M. B. Begemann, B. N. Gray, E. January, A. Singer, Y. He, C. L. Beisel and V. Noireaux, Mol. Cell, 2018, 69, 146-157. [0875] 25 W. Liu, H. Yu, X. Zhou and D. Xing, Anal. Chem., 2016, 88, 8369-8374. [0876] 26 K. J. Seamon, Y. K. Light, E. A. Saada, J. S. Schoeniger and B. Harmon, Anal. Chem., 2018, 90, 6913-6921. [0877] 27 V. Mekler, L. Minakhin, E. Semenova, K. Kuznedelov and K. Severinov, Nucleic Acids Res., 2016, 44, 2837-2845. [0878] 28 J. S. Paige, K. Y. Wu and S. R. Jaffrey, Science, 2011, 333, 642-646. [0879] 29 G. S. Filonov, J. D. Moon, N. Svensen and S. R. Jaffrey, J. Am. Chem. Soc., 2014, 136, 16299-16308. [0880] 30 K. Hofer, L. V. Langejurgen and A. Jaschke, J. Am. Chem. Soc., 2013, 135, 13692-13694. [0881] 31 H. Huang, N. B. Suslov, N. S. Li, S. A. Shelke, M. E. Evans, Y. Koldobskaya, P. A. Rice and J. A. Piccirilli, Nat. Chem. Biol., 2014, 10, 686-691. [0882] 32 A. E. Friedland, R. Baral, P. Singhal, K. Loveluck, S. Shen, M. Sanchez, E. Marco, G. M. Gotta, M. L. Maeder, E. M. Kennedy, A. V. Kornepati, A. Sousa, M. A. Collins, H. Jayaram, B. R. Cullen and D. Bumcrot, Genome Biol., 2015, 16, 257. [0883] 33 B. Zetsche, J. S. Gootenberg, O. O. Abudayyeh, I. M. Slaymaker, K S. Makarova, P. Essletzbichler, S. E. Volz, J. Joung, J. van der Oost, A. Regev, E. V. Koonin and F. Zhang, Cell, 2015, 163, 759-771. [0884] 34 D. Kim, J. Kim, J. K. Hur, K. W. Been, S. H. Yoon and J. S. Kim, Nat. Biotechnol., 2016, 34, 863-868. [0885] 35 J. S. Gootenberg, O. O. Abudayyeh, M. J. Kellner, J. Joung, J. J. Collins and F. Zhang, Science, 2018, 360, 439-444. [0886] 36 J. S. Chen, E. Ma, L. B. Harrington, M. Da Costa, X. Tian, J. M. Palefsky and J. A. Doudna, Science, 2018, 360, 436-439. [0887] 37 L. B. Harrington, K W. Doxzen, E. Ma, J. J. Liu, G. J. Knott, A. Edraki, B. Garcia, N. Amrani, J. S. Chen, J. C. Cofsky, P. J. Kranzusch, E. J. Sontheimer, A. R. Davidson, K. L. Maxwell and J. A. Doudna, Cell, 2017, 170, 1224-1233. [0888] 38 J. Shin, F. Jiang, J. J. Liu, N. L. Bray, B. J. Rauch, S. H. Baik, E. Nogales, J. Bondy-Denomy, J. E. Corn and J. A. Doudna, Sci. Adv., 2017, 3, e1701620. [0889] 39 H. Yang and D. J. Patel, Mol. Cell, 2017, 67, 117-127. [0890] 40 M. Deaner and H. S. Alper, Metab. Eng., 2017, 40, 14-22. [0891] 41 B. Yurke and A. P. Mills, Genet. Program Evolvable Mach., 2003, vol. 4, pp. 111-122. [0892] 42 P. K. Jain, V. Ramanan, A. G. Schepers, N. S. Dalvie, A. Panda, H. E. Fleming and S. N. Bhatia, Angew. Chem., Int. Ed. Engl., 2016, 55, 12440-12444. [0893] 43 W. Song, R. L. Stack, N. Svensen and S. R. Jaffrey, J. Am. Chem. Soc., 2014, 136, 1198-1201. [0894] 44 W. Song, G. S. Filonov, H. Kim, M. Hirsch, X. Li, J. D. Moon and S. R. Jaffrey, Nat. Chem. Biol., 2017, 13, 1187-1194. [0895] 45 E. V. Dolgosheina, S. C. Jeng, S. S. Panchapakesan, R. Cojocaru, P. S. Chen, P. D. Wilson, N. Hawkins, P. A. Wiggins and P. J. Unrau, ACS Chem. Biol., 2014, 9, 2412-2420. [0896] 46 D. M. Kolpashchikov, J. Am. Chem. Soc., 2005, 127, 12442-12443. [0897] 47 S. Sando, A. Narita, M. Hayami and Y. Aoyama, Chem. Commun., 2008, 3858-3860, DOI: 10.1039/b808449a. [0898] 48 C. C. Samaniego, H. K. K. Subramanian and E. Franco, H. I. Mauna Lani, USA 2017. [0899] 49 D. Y. Zhang and E. Winfree, J. Am. Chem. Soc., 2009, 131, 17303-17314. [0900] 50 R. Clarke, R. Heler, M. S. MacDougall, N. C. Yeo, A. Chavez, M. Regan, L. Hanakahi, G. M. Church, L. A. Marraffini and B. J. Merrill, Mol. Cell, 2018, 71, 42-55. [0901] 51 J. Lloyd, C. H. Tran, K Wadhwani, C. Cuba Samaniego, H. K. K. Subramanian and E. Franco, ACS Synth. Biol., 2018, 7, 30-37.
[0902] Various modifications and variations of the described methods, pharmaceutical compositions, and kits of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific embodiments, it will be understood that it is capable of further modifications and that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are obvious to those skilled in the art are intended to be within the scope of the invention. This application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure come within known customary practice within the art to which the invention pertains and may be applied to the essential features herein before set forth.