METHOD FOR ISOLATING AND/OR CULTURING CAMBIUM STEM CELLS OF PANAX GINSENG
20200239835 ยท 2020-07-30
Inventors
- Dong Wu (Shenzhen, CN)
- Chensheng Dai (Shenzhen, CN)
- Lili Cheng (Shenzhen, CN)
- Huaide Chen (Shenzhen, CN)
- Minxian Liu (Shenzhen, CN)
- Lili Hou (Shenzhen, CN)
- Zhuohe Jiang (Shenzhen, CN)
- Yujia Liu (Shenzhen, CN)
- Yuanjian Ling (Shenzhen, CN)
Cpc classification
A61K2236/00
HUMAN NECESSITIES
A01H6/00
HUMAN NECESSITIES
A01H4/005
HUMAN NECESSITIES
International classification
Abstract
A method for isolating and/or culturing cambium stem cells of panax ginseng is disclosed. The method comprises a step of treating tissues containing panax ginseng cambium with a compound of formula I. The present application further relates to cambium stem cells of panax ginseng obtained according to the method and use of such cambium stem cells in preparing a product for a suspension culture of panax ginseng. The method for isolating and/or culturing cambium stem cells of panax ginseng according to the present application can effectively separate the cambium stem cells of the panax ginseng which have unlimited cytodieresis ability and strong anti-adversity ability, can provide a basis for ultra-large volume liquid culture, which can significantly reduce production costs.
Claims
1. A method for isolating and/or culturing cambium stem cells of panax ginseng comprising a step of treating tissues containing panax ginseng cambium with a compound of formula I: ##STR00003## wherein R is --D-glucopyranosyl(1-2)--D-glucopyranose or --D-glucopyranose.
2. The method according to claim 1, wherein the tissues containing panax ginseng cambium is obtained by following step: exfoliating tissues containing cambium, phloem, cortex and epidermis off from xylogen.
3. The method according to claim 1, wherein the step of treating tissues containing panax ginseng cambium with the compound comprises placing the tissues containing panax ginseng cambium into a solution containing the compound of formula I.
4. The method according to claim 2, wherein the step of treating tissues containing panax ginseng cambium with the compound comprises placing the tissues containing panax ginseng cambium into a solution containing the compound of formula I.
5. The method according to claim 4, wherein the solution containing the compound of formula I has a concentration from 1 M to 100 M.
6. The method according to claim 1, wherein the compound of formula I is a mixture of the compound of formula I with R as --D-glucopyranosyl(1-2)--D-glucopyranose (saponin a) and the compound of formula I with R as --D-glucopyranose (saponin b) with a molar ratio of 2:5.
7. The method according to claim 5, wherein the compound of formula I is a mixture of the compound of formula I with R as --D-glucopyranosyl(1-2)--D-glucopyranose (saponin a) and the compound of formula I with R as --D-glucopyranose (saponin b) with a molar ratio of 2:5.
8. The method according to claim 1, wherein further comprising performing an ultrasonic treatment on the tissues containing panax ginseng cambium after the treatment of the compound of formula I.
9. The method according to claim 7, wherein further comprising performing an ultrasonic treatment on the tissues containing panax ginseng cambium after the treatment of the compound of formula I.
10. The method according to claim 9, wherein the ultrasonic treatment has a treatment frequency from 20 kHz to 40 kHz, and a treatment time from 0.1 min to 10 min.
11. The method according to claim 1, wherein further comprising treating the tissues containing panax ginseng cambium by a sucrose solution after the treatment of the compound of formula I and/or an ultrasonic treatment.
12. The method according to claim 7, wherein further comprising treating the tissues containing panax ginseng cambium by a sucrose solution after the treatment of the compound of formula I and/or the ultrasonic treatment.
13. A product comprising cambium stem cells of panax ginseng obtained according to the method according to claim 1.
14. The product according to claim 13, wherein the tissues containing panax ginseng cambium is obtained by following step: exfoliating tissues containing cambium, phloem, cortex and epidermis off from xylogen.
15. The product according to claim 13, wherein the step of treating tissues containing panax ginseng cambium with the compound comprises placing the tissues containing panax ginseng cambium into a solution containing the compound of formula I.
16. The product according to claim 15, wherein the solution containing the compound of formula I has a concentration from 1 M to 100 M.
17. The product according to claim 13, wherein the compound of formula I is a mixture of the compound of formula I with R as --D-glucopyranosyl(1-2)--D-glucopyranose (saponin a) and the compound of formula I with R as --D-glucopyranose (saponin b) with a molar ratio of 2:5.
18. The product according to claim 13, wherein an ultrasonic treatment is preformed on the tissues containing panax ginseng cambium after the treatment of the compound of formula I.
19. The product according to claim 13, wherein after the treatment of the compound of formula I and/or an ultrasonic treatment, the tissues containing panax ginseng cambium is further treated by a sucrose solution.
20. Use of the product according to claim 13 in preparing a product for a suspension culture of panax ginseng.
Description
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT
Embodiment 1 Method of Isolating and Culturing
[0031] (1) Cleaning and Sterilization
[0032] The healthy, unbroken panax ginseng roots are rinsed with tap water for 30 minutes, then placed in a sterilized flask on an ultra-clean bench for 1 minute with 75% ethanol, and then rinsed for 3 to 5 times with sterile distilled water. The sterilized panax ginseng roots are further sterilized with 0.5% to 10% sodium hypochlorite solution for 5 to 10 minutes, then the sterilizing agent is discarded. Then the panax ginseng roots are rinsed with sterile distilled water for 3 to 5 times. After that, the 0.5% to 10% sodium hypochlorite solution is further used to sterilize for 3 to 5 minutes, and then the sterilizing agent is discarded. Finally, the treated panax ginseng roots are rinsed with sterile distilled water for 3 to 5 times.
[0033] (2) Anti-Browning Treatment Step
[0034] The above-mentioned sterilized panax ginseng roots are paced in the anti-browning culture medium containing an antioxidant (referring Table 1 below), and a shake flask culture is carried out for about 30 minutes to 1 hour. The sterilized filter paper is then used to remove moisture from the panax ginseng roots.
TABLE-US-00001 TABLE 1 Compositions of anti-browning culture medium Composition Content WPM culture medium salt content Sucrose 1% (w/v) Polyvinyl Pyrrolidone 0.5% (w/v) Ascorbic acid 100 mg/L Citric acid 150 mg/L pH 5.8
[0035] (3) Separation
[0036] The panax ginseng roots after the sterilization and the anti-browning treatment are placed into the sterilization plate filled with the cutting fluid containing the antioxidant (ascorbic acid), and then the tissues containing the cambium, phloem, cortex and epidermis are gently cut off from the xylem with a sterile scalpel, and then exfoliated off, and the exfoliated tissues are inoculated into WPM preculture medium for 30 min.
TABLE-US-00002 TABLE 2 Compositions of cutting fluid Composition Content Polyvinyl Pyrrolidone 0.5% (w/v) Ascorbic acid 100 mg/L Citric acid 150 mg/L
[0037] (4) Saponin Treatment
[0038] The precultured exfoliated tissues are placed into an aqueous solution containing a saponin compound (a mixture of saponin a and saponin b in a molar ratio of 2:5 and having a concentration of 20 M and 50 M in the solution respectively) for 5 min. The exfoliated tissues are placed in 1 M sucrose aqueous solution, and firstly treated with ultrasonic waves at a frequency of 20 kHz and a power of 20 W for 5 min, and then subjected to a low temperature treatment for 4 hours. After that, the exfoliated tissue after the ultrasonic treatment are placed in 0.05 M sucrose aqueous solution for 5 min, and finally in 0.1 M sucrose aqueous solution for 5 min. Then the solution is aspirated with a sterile pipette and the sucrose is also removed, then the specific tissues (phloem, xylem, pith, etc.) are necrotic and only the cambium (metaphase tissue) is induced.
[0039] (5) Culture
[0040] The tissue obtained after the above treatment is inoculated to a B5 culture medium containing 30 g/L sucrose, 0.7 g/L agarose, 3.0 mg/L 2,4-dichlorophenoxyacetic acid, 3.0 mg/L IBA and 0.5 mg/L KT, and cultured in the dark at 20 C.
[0041] After two weeks of culture, the explants with obvious cambium proliferation are taken out, and the cambium stem cells are separated and transferred to a subculture medium of MS culture medium containing 30 g/L sucrose, 3.0 mg/L 2,4-dichlorophenoxyacetic acid, and 6.0 mg/L NAA. The subculture is carried out for once every two weeks, a large number of cambium stem cells are obtained in a short period of time.
Embodiment 2 Telomerase Activity Detection
[0042] Detection Method of the Telomerase Activity
[0043] Objective: Telomerase activity in cell clusters obtained under different treatment conditions is detected, and the effects of different treatment conditions on telomerase activity are compared.
[0044] Telomerase Detection Steps:
[0045] 1. Extraction of Telomerase: 1 g vigorously growing panax ginseng cell clusters are ground into uniform powders by adding liquid nitrogen, and then transferred rapidly to 50 mL centrifugal tube. 10 ml pre-cooled lysate (Tris-HCl, pH 7.4, 50 mM; MgCl.sub.2 15 mM; KCl 1M; EGTA 0.25M; DTT 0.1M; PMSF 12 mM; PVP 7.5%; glyceride 50%; DEPC treated water for constant volume) is added for treating, then the mixture is incubated in an ice bath and oscillated for 5 min at 4 C., 16000g, and then centrifuged for 20 min. After that, the supernatant is transferred to a centrifuge tube, in which 4% (v/v) PEG6000 is added. Then the mixture is incubated in an ice bath at 100 rpm for 30 min to mix uniformly. After that, the mixtures are subpackaged in 2 ml centrifugal tubes to be centrifuged at 16000g for 15 min, and then the supernatant is removed. Lysate of original amount is added to the precipitate for resuspending and lysing again. The obtained product is incubated in an ice bath at 4 C., 100 rpm for 30 min and then centrifuged at 16000g for 2 min. After that, the supernatant is taken out, and RNase inhibitor (40 U/ul) is added in the supernatant. The extracted proteins are stored at 20 C. and waiting for use.
[0046] 2. Telomerase enzymatic reaction: Telomerase DNA fragments are synthesized by the reverse transcription of the enzymatic reaction of the extracted proteins. The enzymatic reaction liquid comprises Tris-HCl (pH 8.3) 15 M, KCl 15 M, EGTA 3 M, MgCl2 1.5 M, BSA 0.01%, dNTP 0.015 M, Triton x-100 0.01%, DTT 0.3 M, primers 0.36 M, protein extracts of proper amount in 300 L system. Among them, the upstream primer is GG: CACTATCGACTACGCGATCGG (SEQ ID NO: 1), 21 bp, and the downstream primer is ACX: GCGCTATACCCTATACCCTAAACC (SEQ ID NO: 2), 24 bp.
[0047] 3. Telomerase activity detection by TRAP method: The reaction system comprises rTaq enzyme 25 L, primer 2 L, enzymatic reaction liquid 15 L, ddH.sub.2O 8 L. The PCR procedure parameters are 95 C. 5 min, 95 C. 30 sec, 47 C. 30 sec, 72 C. 40 sec, 30 circles. The PCR products are collected by ethanol precipitation method, and 12% polyacrylamide gel electrophoresis is implemented. The obtained electrophoresis strip is dyed by the silver staining method and then the telomerase activity is judged according to the number of strips.
[0048] The results shows that there is no significant change in the activity of telomerase when it is treated with ginsenoside of low concentration, but the activity of telomerase decreases when the concentration of ginsenoside is too high, for example, higher than 200 M. The results show that the optimum concentration is about 10 M to 100 M. When the saponin is a mixture of the saponin a and saponin b, it is preferably a mixture of saponin a and saponin b with a molar ratio of 2:5, and the optimum concentrations of saponin a and saponin b are 20 M and 50 M, respectively.
[0049] The method for isolating and/or culturing cambium stem cells of panax ginseng according to the present application can effectively separate the cambium stem cells of the panax ginseng which have unlimited cytodieresis ability and strong anti-adversity ability, can provide a basis for ultra-large volume liquid culture, which can significantly reduce production costs. Moreover, the specific tissue can be effectively made necrosis by the ultrasonic treatment and the hypertonic treatment. The cambium stem cells can be effectively induced due to their strong anti-reverse ability, and the time of hypertonic treatment is effectively shortened, and the probability of bacteria infection is reduced. At the same time, the hormone concentration in the culture medium is controlled so that the somatocyte would not be proliferated while cambium stem cells are proliferated. Moreover, the anti-browning treatment will reduce the browning of cells during the culture.
Embodiment 3 Effect Experiments of Treatment and Hypertonic Time on Induction Rate of Cambium Stem Cells of Panax Ginseng
[0050] Taking the ultrasound frequency, treatment time and hyperosmotic treatment time as the influencing factors, orthogonal experiment analysis of stem cell induction rate is carried out to explore the best treatment method for improving the induction efficiency of the cambium stem cells of panax ginseng and reducing the bacteria infection risk. In these embodiments, the saponin compound used for treatment is a mixture of the saponin a and saponin b with a molar ratio of 2:5 and the optimum concentrations of 20 M and 50 M, respectively.
TABLE-US-00003 TABLE 3 Orthogonal experiment factor level table factors A Ultrasound B Ultrasound C Hyperosmotic level frequency (kHz) time (min) treatment time (h) 1 20 0 2 2 30 5 4 3 40 10 6
The experiment results are listed in table 4.
TABLE-US-00004 TABLE 4 Experiment solution and experiment data analysis table A B C Exper- Ultrasound Ultra- Hyperosmotic Experiment results iment frequen- sound treatment (* Stem cell Number cy (kHz) time (min) time (h) induction rate %) 1 20 0 2 25.6 2 20 5 4 95.2 3 20 10 6 89.4 4 30 0 4 63.3 5 30 5 6 87.7 6 30 10 2 58.9 7 40 0 6 51.5 8 40 5 2 35.1 9 40 10 4 32.3 K.sub.1 210.2 140.4 119.6 K.sub.2 209.9 218.0 190.8 K.sub.3 145.5 180.6 228.6 k.sub.1 70.1 46.8 39.9 k.sub.2 70.0 72.7 63.3 K.sub.3 48.5 60.2 76.2 R 21.6 25.9 36.3 Notes: * Stem cell induction rate means that just the loose stem cells are inducted, no obvious callus cells, no infection of bacteria.
[0051] It can be seen from the experimental data that appropriate increase of ultrasonic frequency and ultrasonic time can effectively shorten the hyperosmotic treatment time, however excessively high ultrasonic frequency or excessively long ultrasound time will decrease the induction rate of cambium stem cells. The preferred treatment parameters comprises: ultrasonic frequency 20 kHz, ultrasonic treatment time 5 min, saponin a with a concentration of 20 M and saponin b with a concentration of 50 M, respectively, 1 M sucrose hypertonic treatment time 4 h.
[0052] The above are only the preferred embodiments of the present application, and are not intended to limit the scope of the present application. Any modifications, equivalents, improvements, etc., which are within the spirit and scope of the present application, should be included in the protection of the present application.