METHODS OF USING SMAD7 ANTISENSE OLIGONUCLEOTIDES BASED ON BIOMARKER EXPRESSION
20200237801 ยท 2020-07-30
Inventors
- Salvatore Bellinvia (Mendrisio, CH)
- Giovanni Monteleone (Grottaferrata, IT)
- Gerald Scott BARDEN HORAN (Winchester, MA, US)
Cpc classification
A61P1/04
HUMAN NECESSITIES
A61K31/7125
HUMAN NECESSITIES
C04B35/5603
CHEMISTRY; METALLURGY
C04B35/571
CHEMISTRY; METALLURGY
C04B2235/483
CHEMISTRY; METALLURGY
C12N15/1136
CHEMISTRY; METALLURGY
C04B2235/6581
CHEMISTRY; METALLURGY
C04B2235/80
CHEMISTRY; METALLURGY
International classification
A61K31/7125
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
Abstract
Described herein are methods of treating inflammatory bowel disease (IBD) in a patient having IBD using SMAD7 antisense oligonucleotides.
Claims
1. A method for treating or managing inflammatory bowel disease (IBD) in a patient having IBD, wherein the method comprises (a) analyzing a first level of Interleukin-5 (IL-5) in the patient; (b) administering to the patient an initial dose of a SMAD7 antisense oligonucleotide (AON); (c) analyzing a second level of IL-5 in the patient after the administering step; and wherein: i. if the second level of IL-5 is the same or higher than the first level of IL-5, then: administering to the patient a subsequent dose that is equal to or greater than the initial dose, and/or administering to the patient a subsequent dose at an equal or higher frequency than the initial dose; or ii. if the second level of IL-5 is lower than the first level of IL-5, then administering to the patient a subsequent dose that is equal to or smaller than the initial dose, and/or administering to the patient a subsequent dose at an equal or lower frequency than the initial dose.
2. The method of claim 1, wherein the second level of IL-5 is about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100% higher, or more than the first level of IL-5.
3. The method of claim 1, wherein the second level of IL-5 is about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% lower than the first level of IL-5.
4. A method for treating or managing IBD in a patient having IBD, wherein the method comprises (a) administering to the patient an initial dose of a SMAD7 AON; (b) analyzing the level of IL-5 in the patient after the administering step; and wherein i. if the level of IL-5 is above normal levels of IL-5, then administering to the patient a subsequent dose that is greater than or equal to the initial dose, and/or administering to the patient a subsequent dose at an equal or higher frequency than the initial dose; or ii. if the level of IL-5 is below normal levels of IL-5, then administering to the patient a subsequent dose that is equal to or smaller than the initial dose and/or administering to the patient a subsequent dose at an equal or lower frequency than the initial dose.
5. The method of claim 4, wherein the level of IL-5 is about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100% higher, or more than the normal level of IL-5.
6. The method of claim 4, wherein the level of IL-5 is about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% lower than the normal level of IL-5.
7. A method for treating or managing inflammatory bowel disease (IBD) in a patient having IBD, wherein the method comprises (a) analyzing the base level of IL-5 in the patient; and (b) if the base level of IL-5 is above normal levels of IL-5, then administering to the patient an initial dose of a SMAD7 AON.
8. The method of claim 7, wherein the level of IL-5 is about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100% higher, or more than the base level of IL-5.
9. The method of claim 7, wherein the method further comprises: (c) analyzing the level of IL-5 in the patient after said administering step; and wherein i. if the level of IL-5 after said administering step is above normal levels of IL-5, or above or equal to the base level, then administering to the patient a subsequent dose that is greater than or equal to the initial dose and/or administering to the patient a subsequent dose at an equal or higher frequency than the initial dose, or, ii. if the level of IL-5 after said administering step is below the base level of IL-5, then administering to the patient a subsequent dose that is equal to or smaller than the initial dose and/or administering to the patient a subsequent dose at an equal or lower frequency than the initial dose.
10. The method of claim 9, wherein the level of IL-5 after said administering step is about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100% higher, or more than the normal and/or base level of IL-5.
11. The method of claim 9, wherein the level of IL-5 after said administering step is about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% lower than the normal and/or base level of IL-5.
12. The method any one of the preceding claims, wherein, if the subsequent dose is equal to or greater than the maximum tolerated dose (MTD), then terminating the treatment.
13. The method of claim 12 wherein the MTD is about 40 mg, about 60 mg, about 80 mg, about 100 mg, about 120 mg, about 140 mg, about 160 mg, about 180 mg, about 200 mg, about 220 mg, about 240 mg, about 260 mg, about 280 mg, about 300 mg, about 320 mg, about 340 mg, about 360 mg, about 380 mg, about 400 mg, or higher.
14. The method of any one of the preceding claims, wherein the initial dose is 40 mg/day or 160 mg/day or 320 mg/day, and wherein the subsequent dose is 40 mg/day or 160 mg/day or 320 mg/day.
15. The method of any one of the preceding claims, wherein administering at a lower frequency comprises administering at an alternating schedule.
16. The method of any one of the preceding claims, wherein if the patient is in clinical remission and the level of IL-5 is at normal levels, then terminating the treatment.
17. The method of any one of the preceding claims, wherein if the patient is in clinical remission and the level of IL-5 is unchanged or increased after said administration step compared to the level of IL-5 before said administration step, then terminating the treatment.
18. The method of any one of the preceding claims, wherein a decrease in the level of IL-5 is associated with clinical remission.
19. The method of any one of the preceding claims, wherein a decrease in the level of IL-5 is associated with a decrease in CDAI score relative to baseline.
20. The method of claim 19, wherein the decrease in the level of IL-5 is associated with a decrease in CDAI score of about 10 points, about 20 points, about 30 points, about 40 points, about 50 points, about 60 points, about 70 points, about 80 points, about 90 points, about 100 points, about 120 points, about 130 points, about 140 points, about 150 points, or more.
21. The method of any one of the preceding claims, wherein an increase in the level of IL-5 is associated with an increase in CDAI score relative to baseline.
22. The method of claim 21, wherein the increase in the level of IL-5 is associated with an increase in CDAI score of about 10 points, about 20 points, about 30 points, about 40 points, about 50 points, about 60 points, about 70 points, about 80 points, about 90 points, about 100 points, about 120 points, about 130 points, about 140 points, about 150 points, or more.
23. The method of any one of the preceding claims, wherein a decrease in the level of IL-5 is associated with clinical remission, clinical response, and/or a decrease in CDAI score about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11, weeks, about 12 weeks, about 13 weeks, about 14 weeks, about 15 weeks, about 16 weeks, about 17 weeks, about 18 weeks, about 19 weeks, about 20 weeks, about 21 weeks, about 22 weeks, about 23 weeks, about 24 weeks, about 25 weeks, about 26 weeks, about 27 weeks, about 28 weeks, about 29 weeks, about 30 weeks, about 31 weeks, about 32 weeks, about 33 weeks, about 34 weeks, about 35 weeks, about 36 weeks, about 37 weeks, about 38 weeks, about 39 weeks, about 40 weeks, about 41 weeks, about 42 weeks, about 43 weeks, about 44 weeks, about 45 weeks, about 46 weeks, about 47 weeks, about 48 weeks, about 49 weeks, about 50 weeks, about 51 weeks, and/or about 52 weeks or more after administering an initial dose of a SMAD7 AON.
24. The method of claim 23, wherein a decrease in the level of IL-5 is associated with clinical remission, clinical response, and/or a decrease in CDAI score about 12 weeks and/or about 52 weeks after administering an initial dose of a SMAD7 AON.
25. The method of any one of the preceding claims, wherein a decrease in the level of IL-5 is associated with a decrease in the baseline Harvey-Bradshaw Index (HBI) score.
26. The method of claim 25, wherein the decrease in HBI score is a decrease of 1 point, 2 points, 3 points, 4 points, 5 points, 6 points, 7 points, 8 points, 9 points, 10 points or more.
27. The method of claim 25, wherein the decrease in HBI score results in an HBI score of equal to or less than 7, equal to or less than 6, or equal to or less than 5.
28. The method of claim 25, wherein the decrease in HBI score is observed at any time between 1 and 52 weeks after administering an initial dose of a SMAD7 AON.
29. The method of any of the preceding claims, wherein the decrease in level of IL-5 is associated with a simple endoscopic score for Crohn's disease (SES-CD) of less than 2 after administering an initial dose of a SMAD7 AON.
30. The method of any of the preceding claims, wherein the decrease in level of IL-5 is associated with about a 5%, about a 10%, about a 20%, about a 30%, about a 40%, or about a 50% decrease in SES-CD relative to baseline after administering an initial dose of a SMAD7 AON.
31. The method of claim 29 or 30, wherein the decrease in SES-CD is observed at any time between 1 and 52 weeks after administering an initial dose of a SMAD7 AON.
32. The method of claim 29 or 30, wherein the decrease in SES-CD is observed about 12 weeks and/or about 52 weeks after administering an initial dose of a SMAD7 AON.
33. The method of any of the preceding claims, wherein the decrease in level of IL-5 is associated with corticosteroid-free clinical remission in a patient.
34. The method of claim 33, wherein corticosteroid-free remission is observed at any time between about 4 weeks and about 52 weeks after administering an initial dose of a SMAD7 AON.
35. The method of claim 33, wherein corticosteroid-free remission is observed about 52 weeks after administering an initial dose of a SMAD7 AON.
36. The method of claim 33, wherein corticosteroid-free remission is observed for 12 weeks or more after administering an initial dose of a SMAD7 AON.
37. The method of claim 33, wherein corticosteroid-free remission is observed for 26 weeks or more after administering an initial dose of a SMAD7 AON.
38. The method of any of the preceding claims wherein the decrease in level of IL-5 is associated with a decrease in abdominal pain score and/or liquid/soft stool frequency.
39. The method of claim 38, wherein the abdominal pain score and/or liquid/soft stool frequency is decreased relative to baseline.
40. The method of claim 38 or 39, wherein the decrease in abdominal pain score results in an abdominal pain score of less than or equal to 1.
41. The method of claim 38 or 39, wherein the decrease in liquid/soft stool frequency results in a liquid/soft stool frequency of less than or equal to 3 or less than or equal to 1.5.
42. The method of any of claims 38-41, wherein the decrease in abdominal pain score and/or liquid/soft stool frequency is observed at 4 weeks, 12, weeks, 52 weeks, and/or at any time after administering an initial dose of a SMAD7 AON.
43. The method of any of the preceding claims, wherein the decrease in level of IL-5 is associated with a decrease in patient-reported outcome (PRO-2) score.
44. The method of claim 43, wherein the PRO-2 score is decreased relative to a baseline PRO-2 score.
45. The method of claim 43, wherein the decrease in PRO-2 score results in a score of less than or equal to 8.
46. The method of any of claims 43-45, wherein the decrease in PRO-2 score is observed after administering an initial dose of a SMAD7 AON.
47. The method of any of the preceding claims, further comprising determining a level of one or more additional analytes in the patient having IBD.
48. The method of claim 47, wherein the one or more additional analytes is C-Reactive Protein (CRP), fecal Calprotectin (FCP), Chemokine (C-C motif) ligand 20 (CCL20), Interleukin-8 (IL-8), Interleukin-13 (IL-13), Interleukin-25 (IL-25), Regenerating Islet-Derived 3 alpha (REG3), and/or Tumor Necrosis Factor (TNF) levels.
49. The method of any of the preceding claims wherein, the patient is receiving oral aminosalicylates, oral corticosteroids, immunosuppresants, and/or acetaminophen.
50. The method of any of the preceding claims, wherein the level of IL-5 is determined by analyzing a sample from the patient.
51. The method of claim 50, wherein the sample is a blood, serum, or plasma sample.
52. The method of any of the preceding claims, wherein the level of IL-5 is determined by immunochemistry or by nucleotide analysis.
53. The method of claim 52, wherein the level of IL-5 is determined by an enzyme-linked immunosorbent assay (ELISA).
54. The method of any of the preceding claims, wherein the level of IL-5 is analyzed 4 weeks and/or 8 weeks after administering an initial dose of a SMAD7 AON.
55. The method of any of the preceding claims, wherein the level of IL-5 is analyzed prior to receiving, 1-6 hours after receiving, and 6-12 hours after receiving a dose of a SMAD7 AON.
56. The method of any of claims 1-54, wherein the level of IL-5 is analyzed prior to receiving, about 2 hours, about 4 hours, about 6 hours, about 8 hours, and about 24 hours after receiving a dose of a SMAD7 AON.
57. The method of any of the preceding claims, wherein the IBD is Crohn's Disease (CD) or ulcerative colitis (UC).
58. The method of any of the preceding claims, wherein the SMAD7 AON is administered orally to the patient having IBD.
59. The method of any of the preceding claims, wherein the SMAD7 AON targets region 108-128 of human SMAD7 (SEQ ID NO: 1).
60. The method of any of claims 1-58, wherein the SMAD7 AON targets nucleotides 403, 233, 294, 295, 296, 298, 299 or 533 of human SMAD7 (SEQ ID NO: 1).
61. The method of any of claims 1-58, wherein the SMAD7 AON comprises the nucleotide sequence of SEQ ID NO: 3 (5-GTCGCCCCTTCTCCCCGCAGC-3).
62. The method of any of claims 1-58, wherein the antisense oligonucleotide is a phosphorothioate antisense oligonucleotide against SMAD7 comprising the following sequence: 5-GTXGCCCCTTCTCCCXGCAG-3 (SEQ ID NO: 4) wherein X is a nucleotide comprising 5-methyl-2-deoxycytidine and wherein the internucleotide linkages are phosphorothioate linkages.
63. The method of any of claim 1-58 or 62, wherein the antisense oligonucleotide is a phosphorothioate antisense oligonucleotide against SMAD7 comprising the following sequence: 5-GTXGCCCCTTCTCCCXGCAGC-3 (SEQ ID NO: 6) wherein X is a nucleotide comprising 5-methyl-2-deoxycytidine and wherein the internucleotide linkages are phosphorothioate linkages.
64. A method for treating or managing IBD in a patient with IBD having above normal IL-5 levels following administration of a dose of a SMAD7 AON, said method comprising administering to said patient a further dose of said oligonucleotide that is greater than or equal to the prior dose.
65. A method for treating or managing IBD in a patient with IBD having below normal IL-5 levels following administration of a dose of SMAD7 AON, said method comprising administering to said patient a further dose of said oligonucleotide that is less than or equal to the prior dose.
66. A method of treating or managing IBD in a patient with IBD having above normal IL-5 levels, said method comprising administering to said patient a dose of a SMAD7 AON.
67. The method of claim 66, wherein the administering is repeated until any of IL-5 levels, IL-8 levels, IL-13 levels, IL-25 levels, REG3 levels, CRP levels, CCL20 levels, FCP levels, and/or TNF levels reach a normal level.
68. The method of claim 66, wherein the administering is repeated until the patient achieves a CDAI score of less than 150.
69. The method of claim 66, wherein the administering is repeated until the patient achieves clinical remission.
70. The method of claim 66, wherein administering is repeated until the patient achieves a decrease in CDAI score of about 50 points, about 60 points, about 70 points, about 80 points, about 90 points, about 100 points, about 110 points, about 120 points, about 130 points, about 140 points, about 150 points, or more.
71. The method of claim 66, wherein administering is repeated until the patient achieves a SES-CD of less than or equal to 2.
72. The method of claim 66, wherein administering is repeated until the patient achieves a 50% reduction in SES-CD.
73. The method of claim 66, wherein administering is repeated until the patient achieves corticosteroid-free remission.
74. The method of claim 73, wherein the corticosteroid-free remission lasts for at least about 8 weeks, at least about 10 weeks, at least about 12 weeks, at least about 14 weeks, at least about 16 weeks, at least about 18 weeks, at least about 20 weeks, at least about 22 weeks, at least about 24 weeks, at least about 26 weeks, at least about 28 weeks, or at least about 30 weeks.
75. The method of claim 66, wherein administering is repeated until the patient achieves a daily liquid/soft stool frequency of less than or equal to 3 or less than or equal to 1.5 and/or an abdominal pain score of less than or equal to 1.
76. The method of claim 66, wherein administering is repeated until the patient achieves a PRO-2 score of less than or equal to 8.
77. A method of monitoring the treatment or management of IBD in a patient with IBD, the method comprising analyzing IL-5 levels in the patient following each SMAD7 AON administration, wherein the absence of a decrease in IL-5 levels indicates that the treatment or management is not effective.
78. The method of claim 77, wherein IL-5 levels are analyzed one time, two times, three times, four times, about five times, about 10 times, about 15 times, about 20 times, or about 30 times after each administration of SMAD7 AON.
79. The method of claim 77, wherein the IL-5 levels are analyzed immediately after, about 1 hour after, about 3 hours after, about 6 hours after, about 12 hours after, about 1 day after, about 3 days after, about 1 week after, about 2 weeks after, and/or about 1 month after SMAD7 AON administration.
80. A method of treating or managing IBD in a patient with IBD having above normal levels of IL-5, comprising increasing the amount of a SMAD7 AON administered to the patient until IL-5 levels in the patient decrease.
81. The method of claim 80, wherein IL-5 decreases to about a normal level of IL-5 or a below normal level of IL-5.
82. A SMAD7 AON for use in a method for treating or managing IBD in a patient having IBD, wherein the method comprises analyzing the level of IL-5 in the patient to determine appropriate levels of SMAD7 AON administration.
83. The SMAD7 AON for use of claim 82, wherein the method comprises the steps of: (a) administering to the patient an initial dose of the SMAD7 AON; (b) analyzing the level of IL-5 in the patient; and (c) if the level of IL-5 is above normal levels of IL-5, then administering to the patient a subsequent dose of the SMAD7 AON that is greater than or equal to the initial dose, or, if the level of IL-5 is below normal levels of IL-5 then administering to the patient a subsequent dose of the SMAD7 AON that is equal to or smaller than the initial dose.
84. A SMAD7 AON for use in a method for treating or managing IBD in a patient having IBD, wherein the method comprises (a) analyzing the level of IL-5 in the patient; and (b) if the level of IL-5 is above normal levels of IL-5, then administering to the patient an initial dose of the SMAD7 AON.
85. A method for treating or managing inflammatory bowel disease (IBD) in a patient having IBD, wherein the method comprises (a) analyzing a first level of IL-13 in the patient; (b) administering to the patient an initial dose of a SMAD7 AON; (c) analyzing a second level of IL-13 in the patient after the administering step; and wherein: i. if the second level of IL-13 is the same or higher than the first level of IL-13, then: administering to the patient a subsequent dose that is equal to or greater than the initial dose, and/or administering to the patient a subsequent dose at an equal or higher frequency than the initial dose; or ii. if the second level of IL-13 is lower than the first level of IL-13, then administering to the patient a subsequent dose that is equal to or smaller than the initial dose, and/or administering to the patient a subsequent dose at an equal or lower frequency than the initial dose.
86. The method of claim 85, wherein the second level of IL-13 is about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100% higher, or more than the first level of IL-13.
87. The method of claim 85, wherein the second level of IL-13 is about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% lower than the first level of IL-13.
88. A method for treating or managing IBD in a patient having IBD, wherein the method comprises (a) administering to the patient an initial dose of a SMAD7 AON; (b) analyzing the level of IL-13 in the patient after the administering step; and wherein i. if the level of IL-13 is above normal levels of IL-13, then administering to the patient a subsequent dose that is greater than or equal to the initial dose, and/or administering to the patient a subsequent dose at an equal or higher frequency than the initial dose; or ii. if the level of IL-13 is below normal levels of IL-13, then administering to the patient a subsequent dose that is equal to or smaller than the initial dose and/or administering to the patient a subsequent dose at an equal or lower frequency than the initial dose.
89. The method of claim 88, wherein the level of IL-13 is about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100% higher, or more than the normal level of IL-13.
90. The method of claim 88, wherein the level of IL-13 is about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% lower than the normal level of IL-13.
91. A method for treating or managing inflammatory bowel disease (IBD) in a patient having IBD, wherein the method comprises (a) analyzing the base level of IL-13 in the patient; and (b) if the base level of IL-13 is above normal levels of IL-13, then administering to the patient an initial dose of a SMAD7 AON.
92. The method of claim 91, wherein the level of IL-13 is about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100% higher, or more than the base level of IL-13.
93. The method of claim 91, wherein the method further comprises: (c) analyzing the level of IL-13 in the patient after said administering step; and wherein i. if the level of IL-13 after said administering step is above normal levels of IL-13, or above or equal to the base level, then administering to the patient a subsequent dose that is greater than or equal to the initial dose and/or administering to the patient a subsequent dose at an equal or higher frequency than the initial dose, or, ii. if the level of IL-13 after said administering step is below the base level of IL-13, then administering to the patient a subsequent dose that is equal to or smaller than the initial dose and/or administering to the patient a subsequent dose at an equal or lower frequency than the initial dose.
94. The method of claim 93, wherein the level of IL-13 after said administering step is about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100% higher, or more than the normal and/or base level of IL-13.
95. The method of claim 93, wherein the level of IL-13 after said administering step is about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% lower than the normal and/or base level of IL-13.
96. The method of any one of claims 85-95, wherein, if the subsequent dose is equal to or greater than the maximum tolerated dose (MTD), then terminating the treatment.
97. The method of claim 96 wherein the MTD is about 40 mg, about 60 mg, about 80 mg, about 100 mg, about 120 mg, about 140 mg, about 160 mg, about 180 mg, about 200 mg, about 220 mg, about 240 mg, about 260 mg, about 280 mg, about 300 mg, about 320 mg, about 340 mg, about 360 mg, about 380 mg, about 400 mg, or higher.
98. The method of any one of claims 85-97, wherein the initial dose is 40 mg/day or 160 mg/day or 320 mg/day, and wherein the subsequent dose is 40 mg/day or 160 mg/day or 320 mg/day.
99. The method of any one of claims 85-98, wherein administering at a lower frequency comprises administering at an alternating schedule.
100. The method of any one of claims 85-99, wherein if the patient is in clinical remission and the level of IL-13 is at normal levels, then terminating the treatment.
101. The method of any one of claims 85-100, wherein if the patient is in clinical remission and the level of IL-13 is unchanged or increased after said administration step compared to the level of IL-13 before said administration step, then tcrminating the treatment.
102. The method of any one of claims 85-101, wherein a decrease in the level of IL-13 is associated with clinical remission.
103. The method of any one of claims 85-102, wherein a decrease in the level of IL-13 is associated with a decrease in CDAI score relative to baseline.
104. The method of claim 103, wherein the decrease in the level of IL-13 is associated with a decrease in CDAI score of about 10 points, about 20 points, about 30 points, about 40 points, about 50 points, about 60 points, about 70 points, about 80 points, about 90 points, about 100 points, about 120 points, about 130 points, about 140 points, about 150 points, or more.
105. The method of any one of claims 85-104, wherein an increase in the level of IL-13 is associated with an increase in CDAI score relative to baseline.
106. The method of claim 105, wherein the increase in the level of IL-13 is associated with an increase in CDAI score of about 10 points, about 20 points, about 30 points, about 40 points, about 50 points, about 60 points, about 70 points, about 80 points, about 90 points, about 100 points, about 120 points, about 130 points, about 140 points, about 150 points, or more.
107. The method of claims 85-106, wherein a decrease in the level of IL-13 is associated with clinical remission, clinical response, and/or a decrease in CDAI score about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11, weeks, about 12 weeks, about 13 weeks, about 14 weeks, about 15 weeks, about 16 weeks, about 17 weeks, about 18 weeks, about 19 weeks, about 20 weeks, about 21 weeks, about 22 weeks, about 23 weeks, about 24 weeks, about 25 weeks, about 26 weeks, about 27 weeks, about 28 weeks, about 29 weeks, about 30 weeks, about 31 weeks, about 32 weeks, about 33 weeks, about 34 weeks, about 35 weeks, about 36 weeks, about 37 weeks, about 38 weeks, about 39 weeks, about 40 weeks, about 41 weeks, about 42 weeks, about 43 weeks, about 44 weeks, about 45 weeks, about 46 weeks, about 47 weeks, about 48 weeks, about 49 weeks, about 50 weeks, about 51 weeks, and/or about 52 weeks or more after administering an initial dose of a SMAD7 AON.
108. The method of claim 107, wherein a decrease in the level of IL-13 is associated with clinical remission, clinical response, and/or a decrease in CDAI score about 12 weeks and/or about 52 weeks after administering an initial dose of a SMAD7 AON.
109. The method of any one of claims 85-108, wherein a decrease in the level of IL-13 is associated with a decrease in the baseline Harvey-Bradshaw Index (HBI) score.
110. The method of claim 109, wherein the decrease in HBI score is a decrease of 1 point, 2 points, 3 points, 4 points, 5 points, 6 points, 7 points, 8 points, 9 points, 10 points or more.
111. The method of claim 109, wherein the decrease in HBI score results in an HBI score of equal to or less than 7, equal to or less than 6, or equal to or less than 5.
112. The method of claim 109, wherein the decrease in HBI score is observed at any time between 1 and 52 weeks after administering an initial dose of a SMAD7 AON.
113. The method of any of claims 85-112, wherein the decrease in level of IL-13 is associated with a simple endoscopic score for Crohn's disease (SES-CD) of less than 2 after administering an initial dose of a SMAD7 AON.
114. The method of any of claims 85-113, wherein the decrease in level of IL-13 is associated with about a 5%, about a 10%, about a 20%, about a 30%, about a 40%, or about a 50% decrease in SES-CD relative to baseline after administering an initial dose of a SMAD7 AON.
115. The method of claim 113 or 114, wherein the decrease in SES-CD is observed at any time between 1 and 52 weeks after administering an initial dose of a SMAD7 AON.
116. The method of claim 113 or 114, wherein the decrease in SES-CD is observed about 12 weeks and/or about 52 weeks after administering an initial dose of a SMAD7 AON.
117. The method of any of claims 85-116, wherein the decrease in level of IL-13 is associated with corticosteroid-free clinical remission in a patient.
118. The method of claim 117, wherein corticosteroid-free remission is observed at any time between about 4 weeks and about 52 weeks after administering an initial dose of a SMAD7 AON.
119. The method of claim 117, wherein corticosteroid-free remission is observed about 52 weeks after administering an initial dose of a SMAD7 AON.
120. The method of claim 117, wherein corticosteroid-free remission is observed for 12 weeks or more after administering an initial dose of a SMAD7 AON.
121. The method of claim 117, wherein corticosteroid-free remission is observed for 26 weeks or more after administering an initial dose of a SMAD7 AON.
122. The method of any of claims 85-121, wherein the decrease in level of IL-13 is associated with a decrease in abdominal pain score and/or liquid/soft stool frequency.
123. The method of claim 122, wherein the abdominal pain score and/or liquid/soft stool frequency is decreased relative to baseline.
124. The method of claim 122 or 123, wherein the decrease in abdominal pain score results in an abdominal pain score of less than or equal to 1.
125. The method of claim 122 or 123, wherein the decrease in liquid/soft stool frequency results in a liquid/soft stool frequency of less than or equal to 3 or less than or equal to 1.5.
126. The method of any of claims 122-125, wherein the decrease in abdominal pain score and/or liquid/soft stool frequency is observed at 4 weeks, 12, weeks, 52 weeks, and/or at any time after administering an initial dose of a SMAD7 AON.
127. The method of any of claims 85-126, wherein the decrease in level of IL-13 is associated with a decrease in patient-reported outcome (PRO-2) score.
128. The method of claim 127, wherein the PRO-2 score is decreased relative to a baseline PRO-2 score.
129. The method of claim 127, wherein the decrease in PRO-2 score results in a score of less than or equal to 8.
130. The method of any of claims 127-129, wherein the decrease in PRO-2 score is observed after administering an initial dose of a SMAD7 AON.
131. The method of any of claims 85-130, further comprising determining a level of one or more additional analytes in the patient having IBD.
132. The method of claim 132, wherein the one or more additional analytes is CRP, FCP, CCL20, IL-8, IL-5, IL-25, REG3, and/or TNF levels.
133. The method of any of claims 85-132, wherein the patient is receiving oral aminosalicylates, oral corticosteroids, immunosuppresants, and/or acetaminophen.
134. The method of any of claims 85-133, wherein the level of IL-13 is determined by analyzing a sample from the patient.
135. The method of claim 134, wherein the sample is a blood, serum, or plasma sample.
136. The method of any of claims 85-135, wherein the level of IL-13 is determined by immunochemistry or by nucleotide analysis.
137. The method of claim 136, wherein the level of IL-13 is determined by an enzyme-linked immunosorbent assay (ELISA).
138. The method of any of claims 85-137, wherein the level of IL-13 is analyzed 4 weeks and/or 8 weeks after administering an initial dose of a SMAD7 AON.
139. The method of any of claims 85-138, wherein the level of IL-13 is analyzed prior to receiving, 1-6 hours after receiving, and 6-12 hours after receiving a dose of a SMAD7 AON.
140. The method of any of claims 85-138, wherein the level of IL-13 is analyzed prior to receiving, about 2 hours, about 4 hours, about 6 hours, about 8 hours, and about 24 hours after receiving a dose of a SMAD7 AON.
141. The method of any of claims 85-140, wherein the IBD is Crohn's Disease (CD) or ulcerative colitis (UC).
142. The method of any of claims 85-141, wherein the SMAD7 AON is administered orally to the patient having IBD.
143. The method of any of claims 85-142, wherein the SMAD7 AON targets region 108-128 of human SMAD7 (SEQ ID NO: 1).
144. The method of any of claims 85-142, wherein the SMAD7 AON targets nucleotides 403, 233, 294, 295, 296, 298, 299 or 533 of human SMAD7 (SEQ ID NO: 1).
145. The method of any of claims 85-142, wherein the SMAD7 AON comprises the nucleotide sequence of SEQ ID NO: 3 (5-GTCGCCCCTTCTCCCCGCAGC-3).
146. The method of any of claims 85-142, wherein the antisense oligonucleotide is a phosphorothioate antisense oligonucleotide against SMAD7 comprising the following sequence: 5-GTXGCCCCTTCTCCCXGCAG-3 (SEQ ID NO: 4) wherein X is a nucleotide comprising 5-methyl-2-deoxycytidine and wherein the internucleotide linkages are phosphorothioate linkages.
147. The method of any of claim 85-142 or 146, wherein the antisense oligonucleotide is a phosphorothioate antisense oligonucleotide against SMAD7 comprising the following sequence: 5-GTXGCCCCTTCTCCCXGCAGC-3 (SEQ ID NO: 6) wherein X is a nucleotide comprising 5-methyl-2-deoxycytidine and wherein the internucleotide linkages are phosphorothioate linkages.
148. A method for treating or managing IBD in a patient with IBD having above normal IL-13 levels following administration of a dose of a SMAD7 AON, said method comprising administering to said patient a further dose of said oligonucleotide that is greater than or equal to the prior dose.
149. A method for treating or managing IBD in a patient with IBD having below normal IL-13 levels following administration of a dose of SMAD7 AON, said method comprising administering to said patient a further dose of said oligonucleotide that is less than or equal to the prior dose.
150. A method of treating or managing IBD in a patient with IBD having above normal IL-13 levels, said method comprising administering to said patient a dose of a SMAD7 AON.
151. The method of claim 150, wherein the administering is repeated until any of IL-13 levels, IL-8 levels, IL-5 levels, IL-25 levels, REG3 levels, CRP levels, CCL20 levels, FCP levels, and/or TNF levels reach a normal level.
152. The method of claim 150, wherein the administering is repeated until the patient achieves a CDAI score of less than 150.
153. The method of claim 150, wherein the administering is repeated until the patient achieves clinical remission.
154. The method of claim 150, wherein administering is repeated until the patient achieves a decrease in CDAI score of about 50 points, about 60 points, about 70 points, about 80 points, about 90 points, about 100 points, about 110 points, about 120 points, about 130 points, about 140 points, about 150 points, or more.
155. The method of claim 150, wherein administering is repeated until the patient achieves a SES-CD of less than or equal to 2.
156. The method of claim 150, wherein administering is repeated until the patient achieves a 50% reduction in SES-CD.
157. The method of claim 150, wherein administering is repeated until the patient achieves corticosteroid-free remission.
158. The method of claim 157, wherein the corticosteroid-free remission lasts for at least about 8 weeks, at least about 10 weeks, at least about 12 weeks, at least about 14 weeks, at least about 16 weeks, at least about 18 weeks, at least about 20 weeks, at least about 22 weeks, at least about 24 weeks, at least about 26 weeks, at least about 28 weeks, or at least about 30 weeks.
159. The method of claim 150, wherein administering is repeated until the patient achieves a daily liquid/soft stool frequency of less than or equal to 3 or less than or equal to 1.5 and/or an abdominal pain score of less than or equal to 1.
160. The method of claim 150, wherein administering is repeated until the patient achieves a PRO-2 score of less than or equal to 8.
161. A method of monitoring the treatment or management of IBD in a patient with IBD, the method comprising analyzing IL-13 levels in the patient following each SMAD7 AON administration, wherein the absence of a decrease in IL-13 levels indicates that the treatment or management is not effective.
162. The method of claim 161, wherein IL-13 levels are analyzed one time, two times, three times, four times, about five times, about 10 times, about 15 times, about 20 times, or about 30 times after each administration of SMAD7 AON.
163. The method of claim 161, wherein the IL-13 levels are analyzed immediately after, about 1 hour after, about 3 hours after, about 6 hours after, about 12 hours after, about 1 day after, about 3 days after, about 1 week after, about 2 weeks after, and/or about 1 month after SMAD7 AON administration.
164. A method of treating or managing IBD in a patient with IBD having above normal levels of IL-13, comprising increasing the amount of a SMAD7 AON administered to the patient until IL-13 levels in the patient decrease.
165. The method of claim 164, wherein IL-13 decreases to about a normal level of IL-13 or a below normal level of IL-13.
166. A SMAD7 AON for use in a method for treating or managing IBD in a patient having IBD, wherein the method comprises analyzing the level of IL-13 in the patient to determine appropriate levels of SMAD7 AON administration.
167. The SMAD7 AON for use of claim 166, wherein the method comprises the steps of: (a) administering to the patient an initial dose of the SMAD7 AON; (b) analyzing the level of IL-13 in the patient; and (c) if the level of IL-13 is above normal levels of IL-13, then administering to the patient a subsequent dose of the SMAD7 AON that is greater than or equal to the initial dose, or, if the level of IL-13 is below normal levels of IL-13 then administering to the patient a subsequent dose of the SMAD7 AON that is equal to or smaller than the initial dose.
168. A SMAD7 AON for use in a method for treating or managing IBD in a patient having IBD, wherein the method comprises (a) analyzing the level of IL-13 in the patient; and (b) if the level of IL-13 is above normal levels of IL-13, then administering to the patient an initial dose of the SMAD7 AON.
169. A method for treating or managing inflammatory bowel disease (IBD) in a patient having IBD, wherein the method comprises (a) analyzing a first level of IL-25 in the patient; (b) administering to the patient an initial dose of a SMAD7 AON; (c) analyzing a second level of IL-25 in the patient after the administering step; and wherein: i. if the second level of IL-25 is the same or higher than the first level of IL-25, then: administering to the patient a subsequent dose that is equal to or greater than the initial dose, and/or administering to the patient a subsequent dose at an equal or higher frequency than the initial dose; or ii. if the second level of IL-25 is lower than the first level of IL-25, then administering to the patient a subsequent dose that is equal to or smaller than the initial dose, and/or administering to the patient a subsequent dose at an equal or lower frequency than the initial dose.
170. The method of claim 169, wherein the second level of IL-25 is about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100% higher, or more than the first level of IL-25.
171. The method of claim 169, wherein the second level of IL-25 is about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% lower than the first level of IL-25.
172. A method for treating or managing IBD in a patient having IBD, wherein the method comprises (a) administering to the patient an initial dose of a SMAD7 AON; (b) analyzing the level of IL-25 in the patient after the administering step; and wherein i. if the level of IL-25 is above normal levels of IL-25, then administering to the patient a subsequent dose that is greater than or equal to the initial dose, and/or administering to the patient a subsequent dose at an equal or higher frequency than the initial dose; or ii. if the level of IL-25 is below normal levels of IL-25, then administering to the patient a subsequent dose that is equal to or smaller than the initial dose and/or administering to the patient a subsequent dose at an equal or lower frequency than the initial dose.
173. The method of claim 172, wherein the level of IL-25 is about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100% higher, or more than the normal level of IL-25.
174. The method of claim 172, wherein the level of IL-25 is about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% lower than the normal level of IL-25.
175. A method for treating or managing inflammatory bowel disease (IBD) in a patient having IBD, wherein the method comprises (a) analyzing the base level of IL-25 in the patient; and (b) if the base level of IL-25 is above normal levels of IL-25, then administering to the patient an initial dose of a SMAD7 AON.
176. The method of claim 175, wherein the level of IL-25 is about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100% higher, or more than the base level of IL-25.
177. The method of claim 175, wherein the method further comprises: (c) analyzing the level of IL-25 in the patient after said administering step; and wherein i. if the level of IL-25 after said administering step is above normal levels of IL-25, or above or equal to the base level, then administering to the patient a subsequent dose that is greater than or equal to the initial dose and/or administering to the patient a subsequent dose at an equal or higher frequency than the initial dose, or, ii. if the level of IL-25 after said administering step is below the base level of IL-25, then administering to the patient a subsequent dose that is equal to or smaller than the initial dose and/or administering to the patient a subsequent dose at an equal or lower frequency than the initial dose.
178. The method of claim 175, wherein the level of IL-25 after said administering step is about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100% higher, or more than the normal and/or base level of IL-25.
179. The method of claim 175, wherein the level of IL-25 after said administering step is about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% lower than the normal and/or base level of IL-25.
180. The method of any one of claims 169-179, wherein, if the subsequent dose is equal to or greater than the maximum tolerated dose (MTD), then terminating the treatment.
181. The method of claim 180 wherein the MTD is about 40 mg, about 60 mg, about 80 mg, about 100 mg, about 120 mg, about 140 mg, about 160 mg, about 180 mg, about 200 mg, about 220 mg, about 240 mg, about 260 mg, about 280 mg, about 300 mg, about 320 mg, about 340 mg, about 360 mg, about 380 mg, about 400 mg, or higher.
182. The method of any one of claims 169-181, wherein the initial dose is 40 mg/day or 160 mg/day or 320 mg/day, and wherein the subsequent dose is 40 mg/day or 160 mg/day or 320 mg/day.
183. The method of any one of claims 169-182, wherein administering at a lower frequency comprises administering at an alternating schedule.
184. The method of any one of claims 169-183, wherein if the patient is in clinical remission and the level of IL-25 is at normal levels, then terminating the treatment.
185. The method of any one of claims 169-184, wherein if the patient is in clinical remission and the level of IL-25 is unchanged or increased after said administration step compared to the level of IL-25 before said administration step, then terminating the treatment.
186. The method of any one of claims 169-185, wherein a decrease in the level of IL-25 is associated with clinical remission.
187. The method of any one of claims 169-186, wherein a decrease in the level of IL-25 is associated with a decrease in CDAI score relative to baseline.
188. The method of claim 187, wherein the decrease in the level of IL-25 is associated with a decrease in CDAI score of about 10 points, about 20 points, about 30 points, about 40 points, about 50 points, about 60 points, about 70 points, about 80 points, about 90 points, about 100 points, about 120 points, about 130 points, about 140 points, about 150 points, or more.
189. The method of any one of claims 169-188, wherein an increase in the level of IL-25 is associated with an increase in CDAI score relative to baseline.
190. The method of claim 189, wherein the increase in the level of IL-25 is associated with an increase in CDAI score of about 10 points, about 20 points, about 30 points, about 40 points, about 50 points, about 60 points, about 70 points, about 80 points, about 90 points, about 100 points, about 120 points, about 130 points, about 140 points, about 150 points, or more.
191. The method of claims 169-190, wherein a decrease in the level of IL-25 is associated with clinical remission, clinical response, and/or a decrease in CDAI score about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11, weeks, about 12 weeks, about 13 weeks, about 14 weeks, about 15 weeks, about 16 weeks, about 17 weeks, about 18 weeks, about 19 weeks, about 20 weeks, about 21 weeks, about 22 weeks, about 23 weeks, about 24 weeks, about 25 weeks, about 26 weeks, about 27 weeks, about 28 weeks, about 29 weeks, about 30 weeks, about 31 weeks, about 32 weeks, about 33 weeks, about 34 weeks, about 35 weeks, about 36 weeks, about 37 weeks, about 38 weeks, about 39 weeks, about 40 weeks, about 41 weeks, about 42 weeks, about 43 weeks, about 44 weeks, about 45 weeks, about 46 weeks, about 47 weeks, about 48 weeks, about 49 weeks, about 50 weeks, about 51 weeks, and/or about 52 weeks or more after administering an initial dose of a SMAD7 AON.
192. The method of claim 191, wherein a decrease in the level of IL-25 is associated with clinical remission, clinical response, and/or a decrease in CDAI score about 12 weeks and/or about 52 weeks after administering an initial dose of a SMAD7 AON.
193. The method of any one of claims 169-192, wherein a decrease in the level of IL-25 is associated with a decrease in the baseline Harvey-Bradshaw Index (HBI) score.
194. The method of claim 193, wherein the decrease in HBI score is a decrease of 1 point, 2 points, 3 points, 4 points, 5 points, 6 points, 7 points, 8 points, 9 points, 10 points or more.
195. The method of claim 193, wherein the decrease in HBI score results in an HBI score of equal to or less than 7, equal to or less than 6, or equal to or less than 5.
196. The method of claim 193, wherein the decrease in HBI score is observed at any time between 1 and 52 weeks after administering an initial dose of a SMAD7 AON.
197. The method of any of claims 169-196, wherein the decrease in level of IL-25 is associated with a simple endoscopic score for Crohn's disease (SES-CD) of less than 2 after administering an initial dose of a SMAD7 AON.
198. The method of any of claims 169-197, wherein the decrease in level of IL-25 is associated with about a 5%, about a 10%, about a 20%, about a 30%, about a 40%, or about a 50% decrease in SES-CD relative to baseline after administering an initial dose of a SMAD7 AON.
199. The method of claim 197 or 198, wherein the decrease in SES-CD is observed at any time between 1 and 52 weeks after administering an initial dose of a SMAD7 AON.
200. The method of claim 197 or 198, wherein the decrease in SES-CD is observed about 12 weeks and/or about 52 weeks after administering an initial dose of a SMAD7 AON.
201. The method of any of claims 169-200, wherein the decrease in level of IL-25 is associated with corticosteroid-free clinical remission in a patient.
202. The method of claim 201, wherein corticosteroid-free remission is observed at any time between about 4 weeks and about 52 weeks after administering an initial dose of a SMAD7 AON.
203. The method of claim 201, wherein corticosteroid-free remission is observed about 52 weeks after administering an initial dose of a SMAD7 AON.
204. The method of claim 201, wherein corticosteroid-free remission is observed for 12 weeks or more after administering an initial dose of a SMAD7 AON.
205. The method of claim 201, wherein corticosteroid-free remission is observed for 26 weeks or more after administering an initial dose of a SMAD7 AON.
206. The method of any of claims 169-205, wherein the decrease in level of IL-25 is associated with a decrease in abdominal pain score and/or liquid/soft stool frequency.
207. The method of claim 206, wherein the abdominal pain score and/or liquid/soft stool frequency is decreased relative to baseline.
208. The method of claim 206 or 207, wherein the decrease in abdominal pain score results in an abdominal pain score of less than or equal to 1.
209. The method of claim 206 or 207, wherein the decrease in liquid/soft stool frequency results in a liquid/soft stool frequency of less than or equal to 3 or less than or equal to 1.5.
210. The method of any of claims 206-205, wherein the decrease in abdominal pain score and/or liquid/soft stool frequency is observed at 4 weeks, 12, weeks, 52 weeks, and/or at any time after administering an initial dose of a SMAD7 AON.
211. The method of any of claims 169-210, wherein the decrease in level of IL-25 is associated with a decrease in patient-reported outcome (PRO-2) score.
212. The method of claim 211, wherein the PRO-2 score is decreased relative to a baseline PRO-2 score.
213. The method of claim 211, wherein the decrease in PRO-2 score results in a score of less than or equal to 8.
214. The method of any of claims 211-213, wherein the decrease in PRO-2 score is observed after administering an initial dose of a SMAD7 AON.
215. The method of any of claims 169-214, further comprising determining a level of one or more additional analytes in the patient having IBD.
216. The method of claim 215, wherein the one or more additional analytes is CRP, FCP, CCL20, IL-8, IL-10, IL-5, IL-13, REG3, and/or TNF levels.
217. The method of any of claims 169-216, wherein the patient is receiving oral aminosalicylates, oral corticosteroids, immunosuppresants, and/or acetaminophen.
218. The method of any of claims 169-217, wherein the level of IL-25 is determined by analyzing a sample from the patient.
219. The method of claim 218, wherein the sample is a blood, serum, or plasma sample.
220. The method of any of claims 169-219, wherein the level of IL-25 is determined by immunochemistry or by nucleotide analysis.
221. The method of claim 220, wherein the level of IL-25 is determined by an enzyme-linked immunosorbent assay (ELISA).
222. The method of any of claims 169-221, wherein the level of IL-25 is analyzed 4 weeks and/or 8 weeks after administering an initial dose of a SMAD7 AON.
223. The method of any of claims 169-222, wherein the level of IL-25 is analyzed prior to receiving, 1-6 hours after receiving, and 6-12 hours after receiving a dose of a SMAD7 AON.
224. The method of any of claims 169-223, wherein the level of IL-25 is analyzed prior to receiving, about 2 hours, about 4 hours, about 6 hours, about 8 hours, and about 24 hours after receiving a dose of a SMAD7 AON.
225. The method of any of claims 169-224, wherein the IBD is Crohn's Disease (CD) or ulcerative colitis (UC).
226. The method of any of claims 169-225, wherein the SMAD7 AON is administered orally to the patient having IBD.
227. The method of any of claims 169-226, wherein the SMAD7 AON targets region 108-128 of human SMAD7 (SEQ ID NO: 1).
228. The method of any of claims 169-226, wherein the SMAD7 AON targets nucleotides 403, 233, 294, 295, 296, 298, 299 or 533 of human SMAD7 (SEQ ID NO: 1).
229. The method of any of claims 169-226, wherein the SMAD7 AON comprises the nucleotide sequence of SEQ ID NO: 3 (5-GTCGCCCCTTCTCCCCGCAGC-3).
230. The method of any of claims 169-226, wherein the antisense oligonucleotide is a phosphorothioate antisense oligonucleotide against SMAD7 comprising the following sequence: 5-GTXGCCCCTTCTCCCXGCAG-3 (SEQ ID NO: 4) wherein X is a nucleotide comprising 5-methyl-2-deoxycytidine and wherein the internucleotide linkages are phosphorothioate linkages.
231. The method of any of claim 169-226 or 230, wherein the antisense oligonucleotide is a phosphorothioate antisense oligonucleotide against SMAD7 comprising the following sequence: 5-GTXGCCCCTTCTCCCXGCAGC-3 (SEQ ID NO: 6) wherein X is a nucleotide comprising 5-methyl-2-deoxycytidine and wherein the internucleotide linkages are phosphorothioate linkages.
232. A method for treating or managing IBD in a patient with IBD having above normal IL-25 levels following administration of a dose of a SMAD7 AON, said method comprising administering to said patient a further dose of said oligonucleotide that is greater than or equal to the prior dose.
233. A method for treating or managing IBD in a patient with IBD having below normal IL-25 levels following administration of a dose of SMAD7 AON, said method comprising administering to said patient a further dose of said oligonucleotide that is less than or equal to the prior dose.
234. A method of treating or managing IBD in a patient with IBD having above normal IL-25 levels, said method comprising administering to said patient a dose of a SMAD7 AON.
235. The method of claim 234, wherein the administering is repeated until any of IL-25 levels, IL-8 levels, IL-5 levels, IL-13 levels, REG3 levels, CRP levels, CCL20 levels, FCP levels, and/or TNF levels reach a normal level.
236. The method of claim 234, wherein the administering is repeated until the patient achieves a CDAI score of less than 150.
237. The method of claim 234, wherein the administering is repeated until the patient achieves clinical remission.
238. The method of claim 234, wherein administering is repeated until the patient achieves a decrease in CDAI score of about 50 points, about 60 points, about 70 points, about 80 points, about 90 points, about 100 points, about 110 points, about 120 points, about 130 points, about 140 points, about 150 points, or more.
239. The method of claim 234, wherein administering is repeated until the patient achieves a SES-CD of less than or equal to 2.
240. The method of claim 234, wherein administering is repeated until the patient achieves a 50% reduction in SES-CD.
241. The method of claim 234, wherein administering is repeated until the patient achieves corticosteroid-free remission.
242. The method of claim 241, wherein the corticosteroid-free remission lasts for at least about 8 weeks, at least about 10 weeks, at least about 12 weeks, at least about 14 weeks, at least about 16 weeks, at least about 18 weeks, at least about 20 weeks, at least about 22 weeks, at least about 24 weeks, at least about 26 weeks, at least about 28 weeks, or at least about 30 weeks.
243. The method of claim 234, wherein administering is repeated until the patient achieves a daily liquid/soft stool frequency of less than or equal to 3 or less than or equal to 1.5 and/or an abdominal pain score of less than or equal to 1.
244. The method of claim 234, wherein administering is repeated until the patient achieves a PRO-2 score of less than or equal to 8.
245. A method of monitoring the treatment or management of IBD in a patient with IBD, the method comprising analyzing IL-25 levels in the patient following each SMAD7 AON administration, wherein the absence of a decrease in IL-25 levels indicates that the treatment or management is not effective.
246. The method of claim 245, wherein IL-25 levels are analyzed one time, two times, three times, four times, about five times, about 10 times, about 15 times, about 20 times, or about 30 times after each administration of SMAD7 AON.
247. The method of claim 245, wherein the IL-25 levels are analyzed immediately after, about 1 hour after, about 3 hours after, about 6 hours after, about 12 hours after, about 1 day after, about 3 days after, about 1 week after, about 2 weeks after, and/or about 1 month after SMAD7 AON administration.
248. A method of treating or managing IBD in a patient with IBD having above normal levels of IL-25, comprising increasing the amount of a SMAD7 AON administered to the patient until IL-25 levels in the patient decrease.
249. The method of claim 248, wherein IL-25 decreases to about a normal level of IL-25 or a below normal level of IL-25.
250. A SMAD7 AON for use in a method for treating or managing IBD in a patient having IBD, wherein the method comprises analyzing the level of IL-25 in the patient to determine appropriate levels of SMAD7 AON administration.
251. The SMAD7 AON for use of claim 250, wherein the method comprises the steps of: (a) administering to the patient an initial dose of the SMAD7 AON; (b) analyzing the level of IL-25 in the patient; and (c) if the level of IL-25 is above normal levels of IL-25, then administering to the patient a subsequent dose of the SMAD7 AON that is greater than or equal to the initial dose, or, if the level of IL-25 is below normal levels of IL-25 then administering to the patient a subsequent dose of the SMAD7 AON that is equal to or smaller than the initial dose.
252. A SMAD7 AON for use in a method for treating or managing IBD in a patient having IBD, wherein the method comprises (a) analyzing the level of IL-25 in the patient; and (b) if the level of IL-25 is above normal levels of IL-25, then administering to the patient an initial dose of the SMAD7 AON.
253. A method for treating or managing inflammatory bowel disease (IBD) in a patient having IBD, wherein the method comprises (a) analyzing a first level of REG3 in the patient; (b) administering to the patient an initial dose of a SMAD7 AON; (c) analyzing a second level of REG3 in the patient after the administering step; and wherein: i. if the second level of REG3 is the same or higher than the first level of REG3, then: administering to the patient a subsequent dose that is equal to or greater than the initial dose, and/or administering to the patient a subsequent dose at an equal or higher frequency than the initial dose; or ii. if the second level of REG3 is lower than the first level of REG3, then administering to the patient a subsequent dose that is equal to or smaller than the initial dose, and/or administering to the patient a subsequent dose at an equal or lower frequency than the initial dose.
254. The method of claim 253, wherein the second level of REG3 is about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100% higher, or more than the first level of REG3.
255. The method of claim 253, wherein the second level of REG3 is about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% lower than the first level of REG3.
256. A method for treating or managing IBD in a patient having IBD, wherein the method comprises (a) administering to the patient an initial dose of a SMAD7 AON; (b) analyzing the level of REG3 in the patient after the administering step; and wherein i. if the level of REG3 is above normal levels of REG3, then administering to the patient a subsequent dose that is greater than or equal to the initial dose, and/or administering to the patient a subsequent dose at an equal or higher frequency than the initial dose; or ii. if the level of REG3 is below normal levels of REG3, then administering to the patient a subsequent dose that is equal to or smaller than the initial dose and/or administering to the patient a subsequent dose at an equal or lower frequency than the initial dose.
257. The method of claim 256, wherein the level of REG3 is about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100% higher, or more than the normal level of REG3.
258. The method of claim 256, wherein the level of REG3 is about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% lower than the normal level of REG3.
259. A method for treating or managing inflammatory bowel disease (IBD) in a patient having IBD, wherein the method comprises (a) analyzing the base level of REG3 in the patient; and (b) if the base level of REG3 is above normal levels of REG3, then administering to the patient an initial dose of a SMAD7 AON.
260. The method of claim 259, wherein the level of REG3 is about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100% higher, or more than the base level of REG3.
261. The method of claim 259, wherein the method further comprises: (c) analyzing the level of REG3 in the patient after said administering step; and wherein i. if the level of REG3 after said administering step is above normal levels of REG3, or above or equal to the base level, then administering to the patient a subsequent dose that is greater than or equal to the initial dose and/or administering to the patient a subsequent dose at an equal or higher frequency than the initial dose, or, ii. if the level of REG3 after said administering step is below the base level of REG3, then administering to the patient a subsequent dose that is equal to or smaller than the initial dose and/or administering to the patient a subsequent dose at an equal or lower frequency than the initial dose.
262. The method of claim 261, wherein the level of REG3 after said administering step is about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100% higher, or more than the normal and/or base level of REG3.
263. The method of claim 261, wherein the level of REG3 after said administering step is about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% lower than the normal and/or base level of REG3.
264. The method of any one of claims 253-263, wherein, if the subsequent dose is equal to or greater than the maximum tolerated dose (MTD), then terminating the treatment.
265. The method of claim 264 wherein the MTD is about 40 mg, about 60 mg, about 80 mg, about 100 mg, about 120 mg, about 140 mg, about 160 mg, about 180 mg, about 200 mg, about 220 mg, about 240 mg, about 260 mg, about 280 mg, about 300 mg, about 320 mg, about 340 mg, about 360 mg, about 380 mg, about 400 mg, or higher.
266. The method of any one of claims 253-265, wherein the initial dose is 40 mg/day or 160 mg/day or 320 mg/day, and wherein the subsequent dose is 40 mg/day or 160 mg/day or 320 mg/day.
267. The method of any one of claims 253-266, wherein administering at a lower frequency comprises administering at an alternating schedule.
268. The method of any one of claims 253-267, wherein if the patient is in clinical remission and the level of REG3 is at normal levels, then terminating the treatment.
269. The method of any one of claims 253-268, wherein if the patient is in clinical remission and the level of REG3 is unchanged or increased after said administration step compared to the level of REG3 before said administration step, then terminating the treatment.
270. The method of any one of claims 253-269, wherein a decrease in the level of REG3 is associated with clinical remission.
271. The method of any one of claims 253-270, wherein a decrease in the level of REG3 is associated with a decrease in CDAI score relative to baseline.
272. The method of claim 271, wherein the decrease in the level of REG3 is associated with a decrease in CDAI score of about 10 points, about 20 points, about 30 points, about 40 points, about 50 points, about 60 points, about 70 points, about 80 points, about 90 points, about 100 points, about 120 points, about 130 points, about 140 points, about 150 points, or more.
273. The method of any one of claims 253-272, wherein an increase in the level of REG3 is associated with an increase in CDAI score relative to baseline.
274. The method of claim 273, wherein the increase in the level of REG3 is associated with an increase in CDAI score of about 10 points, about 20 points, about 30 points, about 40 points, about 50 points, about 60 points, about 70 points, about 80 points, about 90 points, about 100 points, about 120 points, about 130 points, about 140 points, about 150 points, or more.
275. The method of claims 253-274, wherein a decrease in the level of REG3 is associated with clinical remission, clinical response, and/or a decrease in CDAI score about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11, weeks, about 12 weeks, about 13 weeks, about 14 weeks, about 15 weeks, about 16 weeks, about 17 weeks, about 18 weeks, about 19 weeks, about 20 weeks, about 21 weeks, about 22 weeks, about 23 weeks, about 24 weeks, about 25 weeks, about 26 weeks, about 27 weeks, about 28 weeks, about 29 weeks, about 30 weeks, about 31 weeks, about 32 weeks, about 33 weeks, about 34 weeks, about 35 weeks, about 36 weeks, about 37 weeks, about 38 weeks, about 39 weeks, about 40 weeks, about 41 weeks, about 42 weeks, about 43 weeks, about 44 weeks, about 45 weeks, about 46 weeks, about 47 weeks, about 48 weeks, about 49 weeks, about 50 weeks, about 51 weeks, and/or about 52 weeks or more after administering an initial dose of a SMAD7 AON.
276. The method of claim 275, wherein a decrease in the level of REG3 is associated with clinical remission, clinical response, and/or a decrease in CDAI score about 12 weeks and/or about 52 weeks after administering an initial dose of a SMAD7 AON.
277. The method of any one of claims 253-276, wherein a decrease in the level of REG3 is associated with a decrease in the baseline Harvey-Bradshaw Index (HBI) score.
278. The method of claim 277, wherein the decrease in HBI score is a decrease of 1 point, 2 points, 3 points, 4 points, 5 points, 6 points, 7 points, 8 points, 9 points, 10 points or more.
279. The method of claim 277, wherein the decrease in HBI score results in an HBI score of equal to or less than 7, equal to or less than 6, or equal to or less than 5.
280. The method of claim 277, wherein the decrease in HBI score is observed at any time between 1 and 52 weeks after administering an initial dose of a SMAD7 AON.
281. The method of any of claims 253-280, wherein the decrease in level of REG3 is associated with a simple endoscopic score for Crohn's disease (SES-CD) of less than 2 after administering an initial dose of a SMAD7 AON.
282. The method of any of claims 253-281, wherein the decrease in level of REG3 is associated with about a 5%, about a 10%, about a 20%, about a 30%, about a 40%, or about a 50% decrease in SES-CD relative to baseline after administering an initial dose of a SMAD7 AON.
283. The method of claim 281 or 282, wherein the decrease in SES-CD is observed at any time between 1 and 52 weeks after administering an initial dose of a SMAD7 AON.
284. The method of claim 281 or 282, wherein the decrease in SES-CD is observed about 12 weeks and/or about 52 weeks after administering an initial dose of a SMAD7 AON.
285. The method of any of claims 253-284, wherein the decrease in level of REG3 is associated with corticosteroid-free clinical remission in a patient.
286. The method of claim 285, wherein corticosteroid-free remission is observed at any time between about 4 weeks and about 52 weeks after administering an initial dose of a SMAD7 AON.
287. The method of claim 285, wherein corticosteroid-free remission is observed about 52 weeks after administering an initial dose of a SMAD7 AON.
288. The method of claim 285, wherein corticosteroid-free remission is observed for 12 weeks or more after administering an initial dose of a SMAD7 AON.
289. The method of claim 285, wherein corticosteroid-free remission is observed for 26 weeks or more after administering an initial dose of a SMAD7 AON.
290. The method of any of claims 253-289, wherein the decrease in level of REG3 is associated with a decrease in abdominal pain score and/or liquid/soft stool frequency.
291. The method of claim 290, wherein the abdominal pain score and/or liquid/soft stool frequency is decreased relative to baseline.
292. The method of claim 290 or 291, wherein the decrease in abdominal pain score results in an abdominal pain score of less than or equal to 1.
293. The method of claim 290 or 291, wherein the decrease in liquid/soft stool frequency results in a liquid/soft stool frequency of less than or equal to 3 or less than or equal to 1.5.
294. The method of any of claims 253-293, wherein the decrease in abdominal pain score and/or liquid/soft stool frequency is observed at 4 weeks, 12, weeks, 52 weeks, and/or at any time after administering an initial dose of a SMAD7 AON.
295. The method of any of claims 253-294, wherein the decrease in level of REG3, is associated with a decrease in patient-reported outcome (PRO-2) score.
296. The method of claim 295, wherein the PRO-2 score is decreased relative to a baseline PRO-2 score.
297. The method of claim 295, wherein the decrease in PRO-2 score results in a score of less than or equal to 8.
298. The method of any of claims 295-297, wherein the decrease in PRO-2 score is observed after administering an initial dose of a SMAD7 AON.
299. The method of any of claims 253-298, further comprising determining a level of one or more additional analytes in the patient having IBD.
300. The method of claim 299, wherein the one or more additional analytes is CRP, FCP, CCL20, IL-8, IL-5, IL-25, IL-13, and/or TNF levels.
301. The method of any of claims 253-300, wherein the patient is receiving oral aminosalicylates, oral corticosteroids, immunosuppresants, and/or acetaminophen.
302. The method of any of claims 253-301, wherein the level of REG3 is determined by analyzing a sample from the patient.
303. The method of claim 302, wherein the sample is a blood, serum, or plasma sample.
304. The method of any of claims 253-303, wherein the level of REG3 is determined by immunochemistry or by nucleotide analysis.
305. The method of claim 304, wherein the level of REG3 is determined by an enzyme-linked immunosorbent assay (ELISA).
306. The method of any of claims 253-305, wherein the level of REG3 is analyzed 4 weeks and/or 8 weeks after administering an initial dose of a SMAD7 AON.
307. The method of any of claims 253-306, wherein the level of REG3 is analyzed prior to receiving, 1-6 hours after receiving, and 6-12 hours after receiving a dose of a SMAD7 AON.
308. The method of any of claims 253-306, wherein the level of REG3 is analyzed prior to receiving, about 2 hours, about 4 hours, about 6 hours, about 8 hours, and about 24 hours after receiving a dose of a SMAD7 AON.
309. The method of any of claims 253-308, wherein the IBD is Crohn's Disease (CD) or ulcerative colitis (UC).
310. The method of any of claims 253-309, wherein the SMAD7 AON is administered orally to the patient having IBD.
311. The method of any of claims 253-310, wherein the SMAD7 AON targets region 108-128 of human SMAD7 (SEQ ID NO: 1).
312. The method of any of claims 253-310, wherein the SMAD7 AON targets nucleotides 403, 233, 294, 295, 296, 298, 299 or 533 of human SMAD7 (SEQ ID NO: 1).
313. The method of any of claims 253-310, wherein the SMAD7 AON comprises the nucleotide sequence of SEQ ID NO: 3 (5-GTCGCCCCTTCTCCCCGCAGC-3).
314. The method of any of claims 253-310, wherein the antisense oligonucleotide is a phosphorothioate antisense oligonucleotide against SMAD7 comprising the following sequence: 5-GTXGCCCCTTCTCCCXGCAG-3 (SEQ ID NO: 4) wherein X is a nucleotide comprising 5-methyl-2-deoxycytidine and wherein the internucleotide linkages are phosphorothioate linkages.
315. The method of any of claim 253-310 or 314, wherein the antisense oligonucleotide is a phosphorothioate antisense oligonucleotide against SMAD7 comprising the following sequence: 5-GTXGCCCCTTCTCCCXGCAGC-3 (SEQ ID NO: 6) wherein X is a nucleotide comprising 5-methyl-2-deoxycytidine and wherein the internucleotide linkages are phosphorothioate linkages.
316. A method for treating or managing IBD in a patient with IBD having above normal REG3 levels following administration of a dose of a SMAD7 AON, said method comprising administering to said patient a further dose of said oligonucleotide that is greater than or equal to the prior dose.
317. A method for treating or managing IBD in a patient with IBD having below normal REG3 levels following administration of a dose of SMAD7 AON, said method comprising administering to said patient a further dose of said oligonucleotide that is less than or equal to the prior dose.
318. A method of treating or managing IBD in a patient with IBD having above normal REG3 levels, said method comprising administering to said patient a dose of a SMAD7 AON.
319. The method of claim 318, wherein the administering is repeated until any of IL-13 levels, IL-8 levels, IL-5 levels, IL-25 levels, REG3 levels, CRP levels, CCL20 levels, FCP levels, and/or TNF levels reach a normal level.
320. The method of claim 318, wherein the administering is repeated until the patient achieves a CDAI score of less than 150.
321. The method of claim 318, wherein the administering is repeated until the patient achieves clinical remission.
322. The method of claim 318, wherein administering is repeated until the patient achieves a decrease in CDAI score of about 50 points, about 60 points, about 70 points, about 80 points, about 90 points, about 100 points, about 110 points, about 120 points, about 130 points, about 140 points, about 150 points, or more.
323. The method of claim 318, wherein administering is repeated until the patient achieves a SES-CD of less than or equal to 2.
324. The method of claim 318, wherein administering is repeated until the patient achieves a 50% reduction in SES-CD.
325. The method of claim 318, wherein administering is repeated until the patient achieves corticosteroid-free remission.
326. The method of claim 325, wherein the corticosteroid-free remission lasts for at least about 8 weeks, at least about 10 weeks, at least about 12 weeks, at least about 14 weeks, at least about 16 weeks, at least about 18 weeks, at least about 20 weeks, at least about 22 weeks, at least about 24 weeks, at least about 26 weeks, at least about 28 weeks, or at least about 30 weeks.
327. The method of claim 318, wherein administering is repeated until the patient achieves a daily liquid/soft stool frequency of less than or equal to 3 or less than or equal to 1.5 and/or an abdominal pain score of less than or equal to 1.
328. The method of claim 318, wherein administering is repeated until the patient achieves a PRO-2 score of less than or equal to 8.
329. A method of monitoring the treatment or management of IBD in a patient with IBD, the method comprising analyzing REG3 levels in the patient following each SMAD7 AON administration, wherein the absence of a decrease in REG3 levels indicates that the treatment or management is not effective.
330. The method of claim 329, wherein REG3 levels are analyzed one time, two times, three times, four times, about five times, about 10 times, about 15 times, about 20 times, or about 30 times after each administration of SMAD7 AON.
331. The method of claim 329, wherein the REG3 levels are analyzed immediately after, about 1 hour after, about 3 hours after, about 6 hours after, about 12 hours after, about 1 day after, about 3 days after, about 1 week after, about 2 weeks after, and/or about 1 month after SMAD7 AON administration.
332. A method of treating or managing IBD in a patient with IBD having above normal levels of REG3, comprising increasing the amount of a SMAD7 AON administered to the patient until REG3 levels in the patient decrease.
333. The method of claim 332, wherein REG3 decreases to about a normal level of REG3 or a below normal level of REG3.
334. A SMAD7 AON for use in a method for treating or managing IBD in a patient having IBD, wherein the method comprises analyzing the level of REG3 in the patient to determine appropriate levels of SMAD7 AON administration.
335. The SMAD7 AON for use of claim 334, wherein the method comprises the steps of: (a) administering to the patient an initial dose of the SMAD7 AON; (b) analyzing the level of REG3 in the patient; and (c) if the level of REG3 is above normal levels of REG3, then administering to the patient a subsequent dose of the SMAD7 AON that is greater than or equal to the initial dose, or, if the level of REG3 is below normal levels of REG3 then administering to the patient a subsequent dose of the SMAD7 AON that is equal to or smaller than the initial dose.
336. A SMAD7 AON for use in a method for treating or managing IBD in a patient having IBD, wherein the method comprises (a) analyzing the level of REG3 in the patient; and (b) if the level of REG3 is above normal levels of REG3, then administering to the patient an initial dose of the SMAD7 AON.
337. A SMAD7 AON for use in a method for treating or managing IBD in a patient having IBD, wherein the method is described in claims 1 to 81.
338. A SMAD7 AON for use in a method for treating or managing IBD in a patient having IBD, wherein the method is described in claims 85 to 165.
339. A SMAD7 AON for use in a method for treating or managing IBD in a patient having IBD, wherein the method is described in claims 169 to 249.
340. A SMAD7 AON for use in a method for treating or managing IBD in a patient having IBD, wherein the method is described in claims 253 to 333.
Description
4. BRIEF DESCRIPTION OF THE DRAWINGS
[0487]
[0488]
[0489]
[0490]
[0491]
[0492]
5. ABBREVIATIONS AND CONVENTIONS
[0493] The abbreviation AZA, as used herein, means azathioprine.
[0494] The abbreviation BSL, as used herein, means baseline.
[0495] The abbreviation CD, as used herein means Cluster of Differentiation, e.g., Cluster of Differentiaion 4 (CD4).
[0496] The abbreviation CDAI, as used herein, means Crohn's Disease Activity Index.
[0497] The abbreviation CDEIS, as used herein, means Crohn's Disease Endoscopic Index of Severity.
[0498] The abbreviation hsCRP, as used herein, means high-sensitivity CRP and refers to CRP levels determined by a test that can analyze low levels of CRP. For example, hsCRP can be analyzed with a high-sensitivity test using laser nephelometry. Some hsCRP tests can analyze hsCRP with a sensitivity down to 0.04 mg/ml.
[0499] The abbreviation ES, as used herein, means Endoscopy Score.
[0500] The abbreviation FCP, as used herein, means Fecal Calprotectin, a protein also known as S100 Calcium Binding Protein A9 (S100A9)).
[0501] The abbreviation Flex-sig, as used herein, means flexible rectosigmoidoscopy.
[0502] The abbreviation HLA, as used herein, means Human Leukocyte Antigen.
[0503] The abbreviation IFN, as used herein, means interferon, e.g., IFNg.
[0504] The abbreviation IL, as used herein, means interleukin, e.g., interleukin-6 (IL6).
[0505] The abbreviation IP, as used herein, means investigational product. IP can refer, for example to a pharmaceutical composition comprising a SMAD7 AON, such as COMPOUND (I).
[0506] The abbreviation IVRS, as used herein, means Interactive Voice Response System.
[0507] The abbreviation IWRS, as used herein, means Interactive Web Response System.
[0508] The abbreviation 6-MP, as used herein, means 6-mercaptopurine.
[0509] The abbreviation MMS, as used herein, means Modified Mayo Score.
[0510] The abbreviation MTX, as used herein, means methotrexate.
[0511] The abbreviation PBO, as used herein, means placebo.
[0512] The abbreviation PBO QD, as used herein means placebo daily dose.
[0513] The abbreviation PD, as used herein, means pharmacodynamic.
[0514] The abbreviation PGA, as used herein, means Physician's Global Assessment Subscore.
[0515] The abbreviation PMS, as used herein, means Partial Mayo Score.
[0516] The abbreviation PRO-2, as used herein, stands for two-item Patient Reported Outcome (PRO-2).
[0517] The abbreviation QD, as used herein, refers to a once daily (quaque die) dose, e.g., of a SMAD7 AON, such as COMPOUND (1).
[0518] The abbreviation QOL or QoL, as used herein, means quality of life.
[0519] The abbreviation RBS, as used herein, means Rectal Bleeding Subscore.
[0520] The abbreviation SES-CD, as used herein, means Simple Endoscopic Score for Crohn's Disease.
[0521] The abbreviation SFS, as used herein, means Stool Frequency Subscore.
[0522] The abbreviation SMAD7 AON as used herein, means SMAD7 AON.
[0523] The abbreviation TMS, as used herein, means Total Mayo Score.
[0524] The abbreviation UCDAI, as used herein, means Ulcerative Colitis Disease Activity Index.
[0525] The abbreviation Wk, as used herein, means week.
6. DETAILED DESCRIPTION
[0526] The invention provides methods that are generally useful for treating and managing IBD in a patient having IBD. Patients having IBD include, but are not limited to, patients having UC and CD, including steroid-dependent and steroid-resistant forms of the latter. The method is particularly useful in terms of managing treatment in a patient being treated with an anti-SMAD7 therapy, such as a SMAD7 AON therapy. A SMAD7 AON therapy may be any therapy that includes an oligonucleotide that is capable of binding to a SMAD7 mRNA transcript and inducing degradation of the SMAD7 mRNA transcript, preventing splicing of the SMAD7 mRNA transcript, or preventing protein translation of the SMAD7 mRNA transcript.
[0527] Methods of the invention are useful for predicting and determining responsiveness of patients having IBD to treatment with SMAD7 AON. Thus, methods of the invention can be used to identify patients that are likely to respond to SMAD7 AON treatment as well as patients that are unlikely to respond to SMAD7 AON treatment. The methods described herein are also useful for determining whether a patient is or is not responsive to IBD treatment. Generally, methods of the invention can also be used to determine the level or likely level of responsiveness in a patient having IBD being treated with a SMAD7 AON. Based upon a determination of a level of responsiveness or a likely level of responsiveness, administration of the SMAD7 AON may be initiated, repeated, maintained, increased, decreased, or terminated. Responsiveness may be determined using a number of factors including, but not limited to: analysis of levels or changes in levels of biomarkers and/or other analytes (e.g., IL-10, IL-5, IL-13, IL-25, REG3, CCL20, IL8, CRP, FCP, and/or TNF), CDAI score or changes in CDAI score, or assessment of symptoms of IBD (e.g., weight loss, tissue inflammation, bloody stool).
[0528] Similarly, the methods are useful for evaluating efficacy and safety of treatment with a SMAD7 AON in a patient having IBD. For example, methods of the invention may include determining changes in levels of biomarker expression or other indicators or manifestations of disease state that can indicate that treatment with the SMAD7 AON is effective or not effective to cause partial or complete remission or amelioration of IBD. Determining levels or changes in levels of biomarker expression, disease symptoms, tissue, blood, or systemic levels of the SMAD7 AON, or indicators of general health may also indicate a worsening of disease state or unsafe drug levels. Assessment of multiple indicators before, during, between, and/or after treatment(s) may be used to monitor disease stage, progression, and severity.
[0529] The invention is based in part on the discovery of a relationship between IBD disease state and IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels. Specifically, the inventors have discovered that IL-10, FCP, IL-5, IL-1 3, TL-25, and REG3 levels are a useful biomarker for determining whether a patient is responsive to, likely to be responsive to, not responsive to, or likely not responsive to treatment of IBD using a SMAD7 AON.
[0530] Furthermore, IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels can be used to manage disease treatment using a SMAD7 AON, specifically with respect to dose amount of the SMAD7 AON. For example, levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 may be used to determine whether a patient having IBD should be given a specific dose amount, for example, a higher dose or a lower dose, of SMAD7 AON, for example in a subsequent dose, with respect to, for example, a previously administered dose, for example, an initial dose, of SMAD7 AON. Thus, administration of a SMAD7 AON may be adjusted in terms of, for example, dose amount or frequency, with respect to absolute levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 or relative levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 in a patient having IBD. For instance, administration of a SMAD7 AON may be adjusted based on absolute levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 by comparing absolute levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 measured in a sample from a patient having IBD with a normal level of IL-10, FCP, IL-5, IL-13, IL-25, or REG3, where the normal level of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 is, for instance, either a benchmark value or a median level of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 in a healthy control group matched to the patient having IBD. In some embodiments of the invention, administration of a SMAD7 AON may be adjusted based on relative levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3, for instance, based on a comparison of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels before and after SMAD7 AON administration, immediately after and later after SMAD7 AON administration, or during and after SMAD7 AON administration. In some embodiments, the SMAD7 AON may be administered multiple times between an initial detection of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels and a later detection of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels used to generate the comparison of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels in the patient sample.
[0531] In some embodiments of the invention the IBD patient being treated is a patient with above-normal IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels. In some embodiments, a patient is known to have high IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels before treatment. In some embodiments, IL-10, FCP, TL-5, IL-13, TL-25, or REG3 levels in the IBD patient are determined before treatment, after treatment, before administration of an initial dose of a SMAD7 AON, after administration of an initial dose of a SMAD7 AON, before administration of a subsequent dose of a SMAD7 AON, and/or after administration of a subsequent dose of a SMAD7 AON.
[0532] A control level of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 may be determined by determining the level of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 protein or mRNA transcript in a sample (e.g., a blood sample) obtained from the subject prior to treatment with an anti-SMAD7 therapy. The control level of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 may provide a baseline for monitoring a subject's response to treatment. A control sample may be obtained from the subject on the day the anti-SMAD7 therapy is first administered (e.g., Day 1 of a treatment regimen), for example, immediately after administration of at least one anti-SMAD7 therapy. In other embodiments, a control sample may be obtained from a subject one day prior to the start of an anti-SMAD7 therapy (e.g., Day 0 of a treatment regimen). Alternatively, a control sample may be obtained from a subject 2, 3, 4, 5, 6, 7 or more days prior to the start of an anti-SMAD7 therapy. For example, the increase or decrease in IL-10, FCP, IL-5, IL-13, IL-25, or REG3 concentration may be measured prior to treatment (e.g., in a control sample), during treatment, and/or after treatment to monitor a subject's response to therapy, e.g., an anti-SMAD7 therapy.
[0533] In some embodiments, a control level may be established for a subject based on long-term monitoring of circulating IL-10, FCP, IL-5, IL-13, IL-25, or REG3 concentration in the subject. In such instances, it is contemplated that a subject may undergo multiple rounds of treatment with an anti-SMAD7 therapy. The circulating IL-10, FCP, IL-5, IL-13, IL-25, or REG3 concentration detected following multiple rounds of treatment may be compared to a prior control level of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 for the subject to determine whether the subject has responded to therapy and/or is likely to respond to further treatment with an anti-SMAD7 therapy. In other embodiments, a control or baseline level for a subject may be established based on an average measurement of a circulating IL-10, FCP, IL-5, IL-13, IL-25, or REG3 concentration determined from multiple baseline samples obtained over time (e.g., obtained over the course of days, weeks, months, or years). Accordingly, any test or assay conducted as disclosed herein may be compared with a previous or established control level and it may not be necessary to obtain a new control sample from the subject for comparison, e.g., if the subject is receiving more than one round of treatment with an anti-SMAD7 therapy.
[0534] Normal levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 may be determined based on numerical reference values or with respect to levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 in a healthy control group.
[0535] In other embodiments of the invention, normal levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 are defined as median levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 in a healthy control group.
[0536] A healthy control group may be defined based on various criteria related to genetic background, habits, and physical attributes matched to the same set of criteria in the patient. For instance, in some embodiments, the healthy control group and the patient having IBD are matched with respect to age, gender, ethnic origin, smoking habits, dietary habits, body-mass index (BMI), recreational drug use, medical drug use, drug use related to IBD, and/or exercise habits. Other factors that can be matched between the patient and control group include, but are not limited to, clinical criteria (e.g., CDAI score, Mayo score, severity of IBD-related symptoms), metabolism, IBD patient's personal disease history, genetic factors, IBD patient's family disease history, exposure to environmental factors (e.g., pollutants, toxins, allergens), and life-style (e.g., urban, suburban, or rural place of work and/or domicile).
[0537] In some embodiments, the control group is the patient receiving a treatment with an SMAD7 AON prior to receiving an initial dose of the SMAD7 AON. In some embodiments, the patient is a treatment naive patient.
[0538] In some embodiments, prior to initial administration of an anti-SMAD7 therapy, the level of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 in a patient having IBD is analyzed and compared to a threshold level. As described herein, a threshold level may be established based on IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels in a healthy control group or a group of IBD patients. In general, a threshold level will be elevated with respect to normal IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels, for example median IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels in a healthy control group, or it may fall within the spectrum of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels in a control group, for example a control group comprised of IBD patients.
[0539] A subject's responsiveness to treatment with an anti-SMAD7 therapy can be interpreted with respect to the control level of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 in a sample obtained from the subject prior to treatment. A subject may be identified as sensitive to treatment (e.g., responsive or likely to respond) with an anti-SMAD7 therapy if there is a decrease in the concentration of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 in the sample obtained from the subject compared to the control sample. In some embodiments the sample may be obtained while the subject is receiving an anti-SMAD7 therapy treatment. In other embodiments, the sample may be obtained after the subject has stopped receiving treatment, for example, about 1 day, about 7 days (i.e., about 1 week), about 14 days (i.e., about 2 weeks), about 28 days, about 56 days, about 70 days and/or longer, after stopping treatment. In a preferred embodiment, the sample may be obtained about one day after stopping anti-SMAD7 therapy treatment.
[0540] In a contemplated embodiment of the invention, a decrease in the amount of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 in the sample coincides with a CDAI score indicating that the subject is responsive to therapy and/or has entered remission or is likely to enter remission. For example, in some embodiments, a decrease in the amount of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 in the sample compared to the control level coincides with a CDAI score of less than about 200, less than about 190, less than about 180, less than about 170, less than about 160, or less than about 150 in the subject. In a particular embodiment, a decrease in the amount of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 in the sample compared to the control level coincides with a CDAI score of less than about 150 in the subject. In some embodiments, the CDAI score that coincides with the decrease in IL-10, FCP, IL-5, IL-13, IL-25, or REG3 concentration is maintained for at least one day, at least one week, at least two weeks, or at least 10 weeks in the subject.
[0541] In some embodiments, the CDAI score that coincides with the decrease in IL-10, FCP, IL-5, IL-13, IL-25, or REG3 concentration is observable after stopping treatment with the anti-SMAD7 therapy. For example, the CDAI score that coincides with the decrease in IL-10, FCP, IL-5, IL-13, IL-25, or REG3 conccntration may be observable about 1 day, about 1 week, about 2 weeks, about 10 weeks, about 1 day and about 2 weeks, or longer after stopping treatment with an anti-SMAD7 therapy. In some embodiments, a decrease in the amount of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 in the sample coincides with a decrease in CDAI score indicating that the subject is responsive to therapy and/or has entered remission or is likely to enter remission. For example, in some embodiments of the invention, a decrease in the amount of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 in the sample compared to the control level coincides with a decrease in CDAI score of about 50, about 60, about 70, about 80, about 90, about 100, about 110, about 120, about 130, about 140, or about 150 in the subject. In particular embodiments, a decrease in the amount of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 in the sample compared to the control level coincides with a decrease in CDAI score of about 70 to about 100 in the subject. In some embodiments, the decrease in CDAI score that coincides with the decrease in the amount of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 is observable after stopping treatment with the anti-SMAD7 therapy. For example, the decrease in CDAI score that coincides with the decrease in the amount of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 may be observable about 1 day, about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 10 weeks, or longer after stopping treatment with an anti-SMAD7 therapy. In some embodiments, the decrease in CDAI score that coincides with the decrease in the amount of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 is observable about 1 day or about 2 weeks after stopping treatment with an anti-SMAD7 therapy.
[0542] In some embodiments, patients receiving an anti-SMAD7 therapy, such as a SMAD7 AON, also receive one or more additional IBD therapies, e.g., steroids. In some embodiments, patients receiving the anti-SMAD7 therapy and the one or more additional IBD therapies can taper the one or more additional IBD therapies if they respond to the anti-SMAD7 therapy and/or experience clinical remission, e.g., as indicated by decreasing CDAI scores and/or decreasing IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels. In some embodiments, patients experiencing clinical remission following the administration of an anti-SMAD7 therapy (e.g., CDAI<150 at both day 15 and day 28 following completion of a 2-week treatment regimen with a SMAD7 AON) can taper steroids.
[0543] Alternatively, a subject may be identified as resistant to treatment (e.g., non-responsive or unlikely to respond) with an anti-SMAD7 therapy if there is no change or an increase in circulating IL-10, FCP, IL-5, IL-13, IL-25, or REG3 concentration in the sample obtained from the subject, compared to the control level. In one embodiment, the sample may be obtained while the subject is receiving an anti-SMAD7 therapy treatment. In other embodiments, the sample may be obtained after the subject has stopped receiving treatment, for example, about 1 day, about 7 days (i.e., about 1 week), about 14 days (i.e., about 2 weeks), about 28 days, about 56 days, about 70 days, and/or longer after stopping treatment. In a preferred embodiment, the sample may be obtained about one day after stopping anti-SMAD7 therapy treatment.
[0544] In some embodiments, a rescue therapy (e.g., biologics such as TNF, IL-5, IL-10, IL-13, IL-25, FCP. CRP, CCL20, or REG3 inhibitors and/or immunosuppressive drugs) is administered to patients experiencing a worsening of disease during a course of treatment with an anti-SMAD7 therapy, e.g., as indicated by increasing CDAI scores (e.g., >70 CDAI score increase) and/or increasing IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels (e.g., >50% increase in IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels).
[0545] Differences in patient IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels and threshold IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels are indicative of a patient's potential responsiveness to anti-SMAD7 therapy. For example, patient IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels that are elevated relative to a threshold IL-10, FCP, IL-5, IL-13, IL-25, or REG3 level indicate that a patient may be responsive to anti-SMAD7 therapy. Threshold levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 can be established using different criteria. In some embodiments, the threshold level of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 is determined with respect to normal IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels, for example median IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels, in a control group. Control groups may be comprised of healthy/normal subjects (e.g., a healthy control group) or groups of IBD patients.
[0546] For instance, in some embodiments, a IL-10, FCP, IL-5, IL-13, IL-25, or REG3 threshold level is at least 2-fold, at least 3-fold, at least 5-fold, at least 8-fold, at least 10-fold, at least 20-fold, at least 30-fold, at least 50-fold, at least 80-fold, or at least 100-fold above normal levels. In other embodiments, the IL-10, FCP, TL-5, IL-13, IL-25, or REG3 threshold level is in the 50.sup.th percentile, 60.sup.th percentile, 70.sup.th percentile, 80.sup.th percentile or 90.sup.th percentile of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels with respect to IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels, for example median IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels, in a group of IBD patients. Additionally, in some embodiments, the threshold level of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 is at least or about 1 pg/ml, at least or about 2.5 pg/ml, at least or about 5 pg/ml, at least or about 7.5 pg/ml, at least or about 10 pg/ml, at least or about 12.5 pg/ml, at least or about 15 pg/ml, at least or about 17.5 pg/ml, at least or about 20 pg/ml, at least or about 25 pg/ml, at least or about 30 pg/ml, or at least or about 35 pg/ml.
[0547] In some embodiments, the control group may consist of the patient receiving an initial dose of a SMAD7 AON. In some embodiments, normal IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels, or IL-10, FCP, IL-5, IL-13, IL-25, or REG3 threshold levels, may be the IL-10, FCP, IL-5, IL-13, IL-25, or REG3 baseline levels that are observed in a patient prior to administration of an initial dose of SMAD7 AON. IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels can subsequently be monitored in a patient over time, following the administration of the initial dose or of subsequent doses of SMAD7 AON to the patient. IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels in the patient following one or more administrations of a SMAD7 AON can be compared to the IL-10, FCP, IL-5, IL-13, IL-25, or REG3 baseline level in the patient. Dosing regimens for the SMAD7 AON can be adjusted, depending on whether IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels in the patient increase, decrease or remain constant relative to the patient's IL-10, FCP, IL-5, IL-13, IL-25, or REG3 baseline level.
[0548] Inflammatory bowel disease or IBD, as used herein, can refer to a number of chronic inflammatory diseases including Crohn's disease (CD), gastroduodenal Crohn's disease, Crohn's (granulomatous) colitis, ulcerative colitis (UC), collagenous colitis, lymphocytic colitis, ischaemic colitis, diversion colitis, Behcet's disease, microscopic colitis, ulcerative proctitis, proctosigmoiditis, jejunoileitis, left-sided colitis, pancolitis, ileocolitis, ileitis, and indeterminate colitis. CD and UC are the two most common forms of IBD. IBD is an autoimmune disease of the digestive system. CD can be localized to any portion of the gastrointestinal tract, including the terminal ileum, and can impact all cell types of the gastrointestinal tract. UC is localized to the colon and rectum, and affects cells of the mucosa only.
[0549] Both environmental and genetic factors are believed to play a role in IBD, although the identity of such factors is not well-defined. Environmental components can comprise alterations in flora of the gut which are affected by exposure to ingested foods and medications.
[0550] IBD is associated with symptoms including abdominal pain, vomiting, diarrhea, rectal bleeding, severe cramps, muscle spasms, weight loss, malnutrition, fever, anemia, skin lesions, joint pain, eye inflammation, liver disorders, arthritis, pyoderma gangrenosum, primary sclerosing cholangitis, and non-thyroidal illness syndrome. Children suffering from UC can suffer from growth defects.
[0551] Forms of CD comprise steroid-dependent and steroid-resistant forms of CD, including active CD. Patients with IBD who suffer from a steroid-dependent form of CD are responsive to treatment with steroid therapy, but cannot terminate or curtail steroid therapy without suffering from an increase in occurrence of symptoms associated with CD. Patients with IBD who suffer from a steroid-resistant form of CD are not responsive to treatment with steroid therapy. Steroid therapeutics commonly prescribed and/or administered to patients with IBD comprise: corticosteroids, for example, prednisone, dexamethasone, hydrocortisone, methylprednisolone, prednisone, and budesonide. A human patient suffering from active CD is a patient actively suffering from symptoms of CD, for example, but not limited to, bloody stool, weight loss, and/or abdominal cramps.
[0552] Ulcerative colitis is one of the most common forms of IBD. UC typically involves dysregulation or overstimulation of the mucosal immune system. Clinical characteristics can include rectal bleeding, diarrhea, and abdominal pain, as well as extraintestinal manifestations involving the skin, liver, and other sites. Patients with UC often have a poor quality of life (QoL) and are at risk for disease flares leading to hospitalizations and/or surgeries.
[0553] The objectives in the treatment of UC patients include inducement and maintenance of remission of symptoms, as well as, healing of mucosal inflammation in order to improve patients' QoL. Treatment of UC can involve pharmacological treatment and surgery. Treatment often takes into consideration the level of clinical activity combined with the extent of disease (proctitis, left-sided disease, extensive disease, or pancolitis). Pharmacological treatment usually involves aminosalicylates and glucocorticoids as an initial approach. Various immunosuppressants, as well as biologic TNF blockers, are used in refractory or severe disease. Although these drugs can provide clinical benefit, they have important limitations. Aminosalicylates are only modestly effective. Glucocorticoids can cause unacceptable adverse events (AEs) and often do not provide a benefit as maintenance therapy. Additionally, use of immunosuppressants, such as azathioprine and 6-mercaptopurine has been restricted to maintenance therapy and is also associated with significant potential toxicities. TNF blockers, although efficacious, can predispose patients to serious infections (including opportunistic infections) and possibly malignancies. Surgery is typically indicated when pharmacological treatment fails or when an emergency requires surgical intervention.
[0554] A patient or subject as described herein, refers to any animal at risk for, suffering from or diagnosed for IBD, including, but not limited to, mammals, primates, and humans. In certain embodiments, the subject may be a non-human mammal such as, e.g., a cat, a dog, or a horse. In a preferred embodiment, the subject is a human subject. A subject may be an individual diagnosed with a high risk of developing IBD, someone who has been diagnosed with IBD, someone who previously suffered from IBD, or an individual evaluated for symptoms or indications of IBD, for example, a high CDAI index score.
[0555] A patient with IBD, as used herein, refers to a patient suffering from any of the symptoms or manifestations of IBD, a patient who may suffer from any of the symptoms or manifestations of IBD, or any patient who might benefit from a method of the invention for treating or evaluating treatment for IBD. A patient in need can comprise a patient who is diagnosed with a risk of developing IBD, a patient who has suffered from IBD in the past, or a patient who has previously been treated for IBD. In some embodiments, the patient with IBD is a Crohn's disease (CD) patient. In some embodiments, the patient with IBD is an ulcerative colitis (UC) patient.
[0556] The terms treat, treatment, treating, and the like are used herein to generally mean obtaining a desired pharmacological and/or physiological effect. The effect may be therapeutic in terms of partially or completely curing a disease and/or adverse effect attributed to the disease. The term treatment as used herein covers any treatment of a disease in a mammal, particularly a human, and includes: (a) inhibiting the disease, i.e., preventing the disease from increasing in severity or scope; (b) relieving the disease, i.e., causing partial or complete amelioration of the disease; or (c) preventing relapse of the discasc, i.e., preventing the discasc from returning to an active state following previous successful treatment of symptoms of the disease or treatment of the disease.
[0557] The terms manage, management, managing, and the like are used herein to generally mean controlling the severity or manifestation of symptoms of a disease, or the means of treating the disease. Generally, management is used to obtaining a desired pharmacological and/or physiological effect. The effect may be therapeutic in terms of partially or completely curing a disease and/or adverse effect attributed to the disease or ensuring that a particular symptom or manifestation of the disease does not occur or reoccur in a patient or does not rise to an undesirable or intolerable level in a patient. The term management as used herein covers any management of a disease in a mammal, particularly a human, and includes: (a) inhibiting the disease, i.e., preventing the disease from increasing in severity or scope; (b) relieving the disease, i.e., causing partial or complete amelioration of the disease; or (c) preventing relapse of the disease, i.e., preventing the disease from returning to an active state following previous successful treatment of symptoms of the disease or treatment of the disease. Management as used herein may also be used with reference to administration of a specific treatment for the disease, for example, a SMAD7 AON.
[0558] In some embodiments of the invention, a patient having IBD will be administered an initial dose of an anti-SMAD7 therapy, for instance, a SMAD7 AON. As used herein, initial dose refers to a dose of an anti-SMAD7 therapy administered to a patient having IBD, in a series of doses. A series of doses may include one or more doses. For instance, a series of doses may comprise a single dose of an anti-SMAD7 therapy or more than a single dose of an anti-SMAD7 therapy. An initial dose may be a dose of an anti-SMAD7 therapy administered to a patient prior to any later dose administered to the patient. For instance, an initial dose may be, but is not limited to, the first dose of an anti-SMAD7 therapy administered to a treatment-nave patient. An initial dose may also be a first dose in any treatment cycle of the anti-SMAD7 therapy. For example, an initial dose may be the first dose of a first treatment cycle, of a second treatment cycle, or of any subsequent treatment cycles. Alternatively, an initial dose may be the first dose administered to a patient after analyzing levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 and/or another biomarker or biomarkers in a patient, or may be the most recently administered dose before a determination of the levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 and/or another biomarker or biomarkers in a patient.
[0559] In some embodiments of the invention, a patient having IBD will be administered a subsequent dose of an anti-SMAD7 therapy, for instance, a SMAD7 AON. As used herein, subsequent dose refers to a dose of an anti-SMAD7 therapy administered to a patient having IBD, after administration of a prior dose, for example, an initial dose. Thus, a subsequent dose may be administered to a patient having IBD in a series of doses comprising two or more doses. Furthermore, in some instances, the amount of a subsequent dose may be calibrated with respect to an initial dose or a prior dose, such that a subsequence dose is greater, equal to, or lesser than a prior dose. Calibration of the amount of a subsequent dose may be based on levels or changes in levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 and/or another biomarker or biomarkers in a patient having IBD, for instance: levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 in a patient having IBD analyzed prior to or after a prior dose, for instance, an initial dose; or changes in IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels in a patient having IBD before and after a prior dose, for instance, an initial dose. A subsequent dose may be a dose administered to a patient having IBD after a first dose, for instance, an initial dose, of an anti-SMAD7 therapy administered to a patient having IBD. A subsequent dose may also be a dose administered after a prior dose of an anti-SMAD7 therapy administered to a patient having IBD, for instance, a dose administered after a prior dose in the same round of treatment or a different round of treatment, for instance, a previous round of treatment. A subsequent dose may be a subsequent dose with respect to any prior dose, for instance, a prior dose immediately preceding the subsequent dose or a prior dose followed by one or more doses administered prior to administration of the subsequent dose.
[0560] As used herein, Crohn's Disease Activity Index or CDAI refers to a measurement or index used to assess the progress of patients suffering from CD as described by Best et al., Gastroenterology, 70:439-44 (1976). CDAI scores of 150 or below are generally associated with inactive disease and are indicative of better prognosis than higher scores. Values above 150 are generally associated with active disease and values above 450 are associated with extremely severe disease. CDAI scores may be used to determine how well a patient is responding to therapy and may be used to identify patients in remission. In certain embodiments, a benchmark clinical response means that the subject displays a decrease in CDAI score by at least 100 points. In a clinical trial, a CDAI score of 150 or below is generally associated with remission.
[0561] As used herein, Ulcerative Colitis Disease Activity Index or UCDAI refers to a measurement or index used to assess the progress of patients suffering from UC as described by Sutherland et al., Gastroenterology, 92:1894-98 (1987). The UCDAI is a series of qualifiers about the symptoms of UC including stool frequency, rectal bleeding, the appearance of the colon lining, and a physician's rating of disease activity. Each of these qualifiers is given a number from 0 to 3, with 3 being the highest disease activity. In a clinical trial, remission is often defined as a UCDAI score of 1 or less, and improvement is a reduction of 3 or more points from the score at the beginning of the trial. UCDAI may be used in clinical trials to determine how well a patient is responding to therapy and may be used to identify patients in remission. Other commonly used indices for measuring disease severity in UC patients comprise the Truelove and Witts Index, the St. Mark's Index, the Simple Clinical Colitis Activity Index (SCCAI), the Lichtiger Index, the Ulcerative Colitis Symptom Score (UCSS), and the Mayo Clinic Score.
[0562] As used herein, SMAD7 (also known as CRCS3, FLJ16482, MADH7, MADH8, MAD (mothers against decapentaplegic, Drosophila) homolog 7, MAD homolog 8, SMAD, mothers against DPP homolog 7, mothers against DPP homolog 8) means the human protein or any of the mRNA transcripts encoded by the gene identified by Entrez GeneID No. 4092 and allelic variants thereof.
[0563] As used herein, CRP (also known as C-reactive protein, pentraxin-related; Pentraxin; and PTX1) means the human protein or any of the mRNA transcripts encoded by the gene identified by Entrez GeneID No. 1401 and allelic variants thereof.
[0564] As used herein, CD4 (also known as Cluster of Differentiation 4), means the human protein or any of the mRNA transcripts encoded by the gene identified by Entrez GeneID No. 920 and allelic variants thereof.
[0565] As used herein, CD8 (also known as Cluster of Differentiation 8), means the human protein or any of the mRNA transcripts encoded by the gene identified by Entrez GeneID No. 920A or 920B and allelic variants thereof.
[0566] As used herein, IL6 (also known as Interleukin-6; B-Cell Stimulatory Factor 2 (BSF2), Hybridoma Growth Factor (HGF), Hepatocyte Stimulating Factor (HSF), Interferon Beta-2 (IFNB2)) means the human protein or any of the mRNA transcripts encoded by the gene identified by Entrez GeneID No. 3569 and allelic variants thereof.
[0567] As used herein, IL8 (also known as Interleukin-8 (IL-8); Tumor Necrosis Factor-Induced Gene 1; NAF; Granulocyte Chemotactic Protein 1 (GCP1); LECT; LUCT; Protein 3-10C; Beta-Thromboglobulin-Like Protein; Neutrophil-Activating Peptide 1; Neutrophil-Activating Protein 1 (NAP1; NAP-1); Emoctakin; GCP-1; LYNAP; Lymphocyte Derived Neutrophil Activating Peptide; Lung Giant Cell Carcinoma-Derived Chemotactic Protein; Small Inducible Cytokine Subfamily B, Member 8; Beta Endothelial Cell-Derived Neutrophil Activating Peptide; Monocyte-Derived Neutrophil Chemotactic Factor (MDNCF); Monocyte-Derived Neutrophil-Activating Peptide (MONAP); Alveolar Macrophage Chemotactic Factor I; C-X-C Motif Chemokine 8; and Chemokine (C-X-C Motif) Ligand 8 (CXCL8)) means the human protein or any of the mRNA transcripts encoded by the gene identified by Entrez GeneID No. 3576 and allelic variants thereof.
[0568] As used herein, IL12 (also known as Interleukin-12 (IL-12); Natural Killer Cell Stimulatory Factor (NKSF1), or Cytotoxic Lymphocyte Maturation Factor 1 (p35, 35 kDA Subunit), means the human protein or any of the mRNA transcripts encoded by the gene identified by Entrez GeneID No. 3592 and allelic variants thereof.
[0569] As used herein, IL17 (also known as Interleukin-17A (IL-17A); Cytotoxic T-Lymphocyte-Associated Serine Esterase 8 or Cytotoxic T-Lymphocyte-Associated Antigen 8 (CTLA8)), means the human protein or any of the mRNA transcripts encoded by the gene identified by Entrez GeneID No. 3605 (IL17A).
[0570] As used herein, IFN (also known as Interferon gamma) means the human protein or any of the mRNA transcripts encoded by the IFN gene identified by Entrez GeneID Nos. 3458 and allelic variants thereof.
[0571] As used herein HLA-DR (also known as Human Leukocyte Antigen DR, a MHC class II cell surface receptor), means a human protein or any of the mRNA transcripts encoded by any member of the HLA-DR gene family, including HLA-DRA, HLA-DRB1, HLA-DRB3, HLA-DRB4, and HLA-DRB5, which are identified by Entrez GeneID Nos. 3122, 3123, 3125, 3126, and 3127 and allelic variants thereof.
[0572] As used herein, TNF (also known as Tumor Necrosis Factor, D1F, Tumor Necrosis Factor Ligand Superfamily Member 2 (TNFSF2), APC1 Protein, cachectin, Tumor Necrosis Factor A (TNFA), Tumor Necrosis Factor- (TNF-), and Tumor Necrosis Factor-alpha (TNF-alpha)) means the human protein or any of the mRNA transcripts encoded by the gene identified by Entrez GeneID No. 7124 and allelic variants thereof.
[0573] As used herein, FCP (also known as Fecal Calprotectin or 5100 Calcium Binding Protein A9 (S100A9)) means the human protein or any of the mRNA transcripts encoded by the gene identified by Entrez GeneID No. 6280 and allelic variants thereof.
[0574] As used herein, CCL20 (also known as Chemokine (C-C Motif) Ligand 20; CKb4; LARC; ST38; MIP3A; Exodus; Macrophage Inflammatory Protein 3 Alpha (MIP-3a, MIP-3-alpha); SCYA20; Small Inducible Cytokine Subfamily A (Cys-Cys), Member 20; Liver And Activation-Regulated Chemokine; Small-Inducible Cytokine A20; CC Chemokine LARC; ST38; Beta Chemokine Exodus-1; and C-C Motif Chemokine 20) means the human protein or any of the mRNA transcripts encoded by the gene identified by Entrez GeneID No. 6364 and allelic variants thereof.
[0575] As used herein, IL-5 (also known as interleukin 5, EDF; and TRF) means the human protein or any of the mRNA transcripts encoded by the gene identified by Entrez GeneID No. 3567 and allelic variants thereof.
[0576] As used herein, IL-13 (also known as interleukin 13, and P600) means the human protein or any of the mRNA transcripts encoded by the gene identified by Entrez GeneID No. 3596 and allelic variants thereof.
[0577] As used herein, IL-25 (also known as interleukin 25, and IL17E) means the human protein or any of the mRNA transcripts encoded by the gene identified by Entrez GeneID No. 64806 and allelic variants thereof.
[0578] As used herein, REG3 (also known as regenerating islet-derived 3 alpha, HIP; PAP; PAP1; REG3; INGAP; PAP-H; PBCGF; HIP/PAP; and REG-III) means the human protein or any of the mRNA transcripts encoded by the gene identified by Entrez GeneID No. 5068 and allelic variants thereof.
[0579] As used herein, IL-10 (also known as interleukin 10, CSIF, TGIF, GVHDS, IL-10, and IL10A) means the human protein or any of the mRNA transcripts encoded by the gene identified by Entrez GeneID No. 3586 and allelic variants thereof.
6.1 Treatment Regimen
[0580] The methods provided herein are based, in part, on the recognition that inflammatory bowel disease (IBD), such as Crohn's disease (CD) or ulcerative colitic (US), can be treated or managed in a patient having IBD by administering an anti-SMAD7 therapy, e.g., a SMAD7 antisense oligonucleotide (AON), to the patient using an administration regime comprising administering the anti-SMAD7 therapy at a first dose or an initial dose during a first treatment period or an initial treatment period and administering the anti-SMAD7 therapy at a subsequent or second dose during a second or subsequent treatment period. See, e.g., Section 6.1.1. In some embodiments, the dose of the anti-SMAD7 therapy administered during the first or initial treatment period is higher than the dose administered during the second or subsequent treatment period.
[0581] In some embodiments of the methods provided herein, the IBD patient is a CD patient. In some embodiments, the IBD patient is a UC patient.
[0582] In some embodiments, the treatment regimen further comprises administering the anti-SMAD7 therapy at a third dose during a third treatment period. In some embodiments, the dose of the anti-SMAD7 therapy administered during the first and/or second treatment period is higher than the dose administered during the third treatment period. In some embodiments, the dose of the anti-SMAD7 therapy administered during the first and/or second treatment period is lower than the dose administered during the third treatment period. In some embodiments, the dose of the anti-SMAD7 therapy administered during the first and/or second treatment period is the same as the dose administered during the third treatment period.
[0583] In some embodiments, the second and/or third treatment periods are optional. In some embodiments, the second treatment period is optional. In some embodiments, the third treatment period is optional. In some embodiments, the second and third treatment periods are optional.
[0584] In the administration regimes provided herein, the anti-SMAD7 therapy can be administered to the patient using different administration schedules (e.g., a continuous administration schedule or an alternating administration schedule). See, e.g., Section 6.1.2. In some embodiments, the anti-SMAD7 therapy is administered following a continuous administration schedule during the first treatment period (e.g., once daily) and following an alternating treatment schedule during the second treatment period (e.g., 4 weeks of treatment alternating with 4 weeks of no treatment or placebo treatment).
[0585] In some embodiments, the anti-SMAD7 therapy is administered following a continuous administration schedule during the first treatment period (e.g., once daily) and following a continuous administration schedule during the second treatment period (e.g., once daily).
[0586] In some embodiments, the anti-SMAD7 therapy is administered following a continuous administration schedule during the first treatment period (e.g., once daily), following an alternating treatment schedule during the second treatment period (e.g., 4 weeks of treatment alternating with 4 weeks of no treatment or placebo treatment), and following an alternating treatment schedule during the third treatment period (e.g., 4 weeks of treatment alternating with 4 weeks of no treatment or placebo treatment). In some embodiments, the anti-SMAD7 therapy is administered following a continuous administration schedule during the first treatment period (e.g., once daily), following a continuous administration schedule during the second treatment period (e.g., once daily), and following an alternating treatment schedule during the third treatment period (e.g., 4 weeks of treatment alternating with 4 weeks of no treatment or placebo treatment). In some embodiments, the anti-SMAD7 therapy is administered following a continuous administration schedule during the first treatment period (e.g., once daily), following an alternating treatment schedule during the second treatment period (e.g., 4 weeks of treatment alternating with 4 weeks of no treatment or placebo treatment), and following a continuous administration schedule during the third treatment period (e.g., once daily).
[0587] A patient's response to the anti-SMAD7 therapies can be monitored, e.g., during the first and/or second and/or third treatment period and the administration regimes provided herein can be adjusted, depending on the IBD patient's clinical response. See, e.g., Section 6.2., Section 6.1.1.3 and Section 6.1.1.6. For example, if an IBD patient is found to respond to the anti-SMAD7 therapy during the first and/or second treatment period the first and/or second treatment period can be shortened or ended, and the IBD patient can enter the second and/or third treatment period. In some embodiments, the dose of the anti-SMAD7 therapy can be adjusted depending on the IBD patient's clinical response during the first, second and/or third treatment period. An IBD patient's response to the anti-SMAD7 therapy can be analyzed using a number of clinical parameters, such as endoscopic outcomes (e.g., Simple Endoscopic Score for Crohn's disease; SES-CD), patient reported outcomes (Crohn's Disease Activity Index, CDAI; Two-Item Patient Reported Outcome; PRO-2 score), or biomarker levels (e.g., C-reactive protein, CRP; fecal calprotectin, FCP). See, e.g., Section 6.2.
[0588] In some embodiments, if an IBD patient is found to respond to the anti-SMAD7 therapy during the first treatment period and the IBD patient loses some or all of the response during an observation period without treatment, the patient can enter the second treatment period. In some embodiments, if an IBD patient having responded to the anti-SMAD7 therapy during the first treatment period, is found to lose some or all of the response to the anti-SMAD7 therapy during the second treatment period, the second treatment period can be shortened or ended, and the IBD patient can enter the third treatment period.
[0589] In some embodiments, if an IBD patient is found not to respond to the anti-SMAD7 therapy during the first and/or second treatment period, the dosage of the anti-SMAD7 therapy can be increased (e.g., by 50%, 2-fold, 4-fold, 6-fold, 8-fold or more) and/or the first and/or second treatment period can be repeated.
6.1.1 Administration Regimen
[0590] In one aspect, provided herein is a method for treating or managing inflammatory bowel disease (IBD) in a patient having IBD, wherein the method comprises (a) administering to the patient a SMAD7 AON (SMAD7 AON) during a first treatment period at a first dose; and (b) administering to the patient the SMAD7 AON during a second treatment period at a second dose.
[0591] In another aspect, provided herein is a method for treating or managing inflammatory bowel disease (IBD) in a patient having IBD, wherein the method comprises (a) administering to the patient a SMAD7 AON (SMAD7 AON) during a first treatment period at a first dose; (b) administering to the patient the SMAD7 AON during a second treatment period at a second dose; and (c) administering to the patient the SMAD7 AON during a third treatment period at a third dose.
[0592] The first and/or second and/or third treatment periods each can have a duration of weeks, months, or years. The length of the first and/or second and/or third treatment period can be adjusted depending, e.g., on whether an IBD patient responds to the anti-SMAD7 therapy, on how strongly the patient responds (e.g., the degree of the clinical response or the occurrence of remission), or on whether a patient, who has previously responded to the anti-SMAD7 therapy, relapses.
[0593] In one aspect, provided herein is a method for preventing inflammatory bowel disease (IBD) in a patient at risk of developing IBD, wherein the method comprises (a) administering to the patient a SMAD7 AON during a first treatment period at a first dose; and (b) administering to the patient the SMAD7 AON during a second treatment period at a second dose.
[0594] In another aspect, provided herein is a method for preventing inflammatory bowel disease (IBD) in a patient at risk of developing IBD, wherein the method comprises (a) administering to the patient a SMAD7 AON during a first treatment period at a first dose; (b) administering to the patient the SMAD7 AON during a second treatment period at a second dose; and (c) administering to the patient the SMAD7 AON during a third treatment period at a third dose.
6.1.1.1 First Treatment Period
[0595] In some embodiments, the first treatment period is between about 1 week and about 20 weeks, between about 2 weeks and about 18 weeks, between about 4 weeks and about 16 weeks, between about 6 weeks and about 14 weeks, or between about 8 weeks and about 12 weeks.
[0596] In some embodiments, the first treatment period is about 1 week, about 2 weeks, about 4 weeks, about 6 weeks, about 8 weeks, about 10 weeks, about 12 weeks, about 14 weeks, about 16 weeks, about 18 weeks, or about 20 weeks.
[0597] In some embodiments, the first treatment period is about 4 weeks, about 8 weeks, or about 12 weeks.
[0598] In some embodiments, the first treatment period is at least about 1 week, at least about 2 weeks, at least about 4 weeks, at least about 6 weeks, at least about 8 weeks, at least about 10 weeks, at least about 52 weeks, at least about 56 weeks, at least about 60 weeks, at least about 3 months, at least about 6 months, at least about 9 months, at least about 12 months, at least about 18 months, at least about 24 months.
[0599] In some embodiments, the first treatment period is about 12 weeks.
[0600] In some embodiments, the first treatment period is about 8 weeks.
[0601] In some embodiments, the first treatment period is between about 1 week and about 100 weeks, between about 10 weeks and about 90 weeks, between about 20 weeks and about 80 weeks, between about 30 weeks and about 70 weeks and between about 40 weeks and about 60 weeks.
[0602] In some embodiments, the first treatment period lasts until the IBD patient shows a response to a SMAD7 AON (e.g., decrease of SES-CD score from baseline 25% or 50%; decrease of CDAI score from baseline 100 points; decrease of PRO-2 score from baseline 8 points, decrease of average daily liquid or soft stool frequency score 1 and/or decrease of abdominal pain score 1; decrease of TMS score from baseline 30% and 3 points; decrease of ES from baseline 1; decrease of PMS score from baseline 25% and 2 points; decrease of MMS score from baseline 25% and 2 points) or until the IBD patient having IBD experiences remission (e.g., SES-CD score 2; CDAI score 150; PRO-2 score 8; average daily liquid or soft stool frequency score 1.5 and/or abdominal pain score 1; TMS score 2 points; ES=0; PMS score 2 or MMS score 2).
[0603] In some embodiments, the first treatment period lasts until the IBD patient shows a response to a SMAD7 AON (e.g., decrease of TMS score from baseline 30% and 3 points, along with decrease of RBS score 1 or absolute RBS1; decrease of endoscopic subscore from baseline 1; decrease of PMS score from baseline 25% and 2 points, along with decrease of RBS score 1 or an absolute RBS1; decrease of MMS score from baseline 25% and 2 points, along with a reduction in RBS score of 1 or an absolute RBS1) or until the IBD patient having IBD experiences remission (e.g., TMS score 2 points with no individual subscore >1; endoscopic subscore=0; PMS score 2 points with no individual subscore >1; MMS score 2 points with no individual subscore >1).
[0604] In some embodiments, the first treatment period lasts until the patient shows dose-limiting toxicity or experiences an adverse event.
6.1.1.2 Dose During First Treatment Period
[0605] In the methods provided herein, during the first treatment period, a first dose of an anti-SMAD7 therapy (e.g., a SMAD7 AON) is administered to the IBD patient.
[0606] In some embodiments, the first dose of the SMAD7 AON is between about 30 mg and about 310 mg, between about 50 mg and about 290 mg, between about 70 mg and about 270 mg, between about 70 mg and about 250 mg, between about 90 mg and about 230 mg, between about 110 mg and about 210 mg, or between 130 mg and about 190 mg, or between 150 mg and about 170 mg.
[0607] In some embodiments, the first dose of the SMAD7 AON is between about 30 mg and about 620 mg, between about 60 mg and about 580 mg, between about 100 mg and about 540 mg, between about 140 mg and about 500 mg, between about 180 mg and about 460 mg, between about 220 mg and about 420 mg, between about 260 mg and about 380 mg, or between about 300 mg and about 340 mg.
[0608] In some embodiments, the first dose of the SMAD7 AON is between about 5 mg and about 90 mg, between about 10 mg and about 70 mg, or between about 30 mg and about 50 mg.
[0609] In some embodiments, the first dose of the SMAD7 AON is about 20 mg, about 40 mg, about 60 mg, about 80 mg, about 100 mg, about 120 mg, about 140 mg, about 160 mg, about 180 mg, about 200 mg, about 220 mg, about 240 mg, about 260 mg, about 280 mg, or about 300 mg.
[0610] In some embodiments, the first dose of the SMAD7 AON is about 40 mg, about 80 mg, about 120 mg, about 160 mg, about 200 mg, about 240 mg, about 280 mg, about 320 mg, about 360 mg, about 400 mg, about 440 mg, about 480 mg, about 520 mg, about 560 mg, about 600 mg, or about 640 mg.
[0611] In some embodiments, the first dose of the SMAD7 AON is about 40 mg.
[0612] In some embodiments, the first dose of the SMAD7 AON is about 160 mg.
[0613] In some embodiments, the first dose of the SMAD7 AON is about 320 mg.
[0614] In some embodiments, the first dose of the SMAD7 AON is between about 30 mg/day and about 310 mg/day, between about 50 mg/day and about 290 mg/day, between about 70 mg/day and about 270 mg/day, between about 90 mg/day and about 250 mg/day, between about 110 mg/day and about 230 mg/day, between about 130 mg/day and about 190 mg/day, or between about 150 mg/day and about 170 mg/day.
[0615] In some embodiments, the first dose of the SMAD7 AON is between about 30 mg/day and about 620 mg/day, between about 60 mg/day and about 580 mg/day, between about 100 mg/day and about 540 mg/day, between about 140 mg/day and about 500 mg/day, between about 180 mg/day and about 460 mg/day, between about 220 mg/day and about 420 mg/day, between about 260 mg/day and about 380 mg/day, or between about 300 mg/day and about 340 mg/day.
[0616] In some embodiments, the first dose of the SMAD7 AON is between about 5 mg/day and about 90 mg/day, between about 10 mg/day and about 70 mg/day, or between about 30 mg/day and about 50 mg/day.
[0617] In some embodiments, the first dose of the SMAD7 AON is about 20 mg/day, about 40 mg/day, about 60 mg/day, about 80 mg/day, about 100 mg/day, about 120 mg/day, about 140 mg/day, about 160 mg/day, about 180 mg/day, about 200 mg/day, about 220 mg/day, about 240 mg/day, about 260 mg/day, about 280 mg/day, about 300 mg/day, or about 320 mg/day.
[0618] In some embodiments, the first dose of the SMAD7 AON is about 40 mg/day, about 80 mg/day, about 120 mg/day, about 160 mg/day, about 200 mg/day, about 240 mg/day, about 280 mg/day, about 320 mg/day, about 360 mg/day, about 400 mg/day, about 440 mg/day, about 480 mg/day, about 520 mg/day, about 560 mg/day, about 600 mg/day, or about 640 mg/day.
[0619] In some embodiments, the first dose of the SMAD7 AON is about 40 mg/day.
[0620] In some embodiments, the first dose of the SMAD7 AON is about 160 mg/day.
[0621] In some embodiments, the first dose of the SMAD7 AON is about 320 mg/day.
6.1.1.3 Transition from First to Second Treatment Period
[0622] In the methods for treating IBD provided herein, an IBD patient can transition from a first treatment period to a second treatment period.
[0623] In some embodiments, the IBD patient transitions directly from the first treatment period to the second treatment period, i.e., without an intermediate period, such as an observation period. In some embodiments, the IBD patient transitions from the first to the second treatment period through an intermediate period, such as an observation period.
[0624] In some embodiments, the transition can occur based on a time dependent schedule, e.g., without considering the IBD patients response to the anti-SMAD7 therapy. For example, in some embodiments, the first treatment period has a predetermined length (e.g., 4 weeks, 8 weeks, or 12 weeks) and at the end of the first treatment period the IBD patient transitions from the first treatment period to the second treatment period, regardless of any results from monitoring the activity of the anti-SMAD7 therapy during the first treatment period (e.g., regardless of the observation of any response to the anti-SMAD7 therapy in the IBD patient).
[0625] In some embodiments, an IBD patient transitions from the first treatment period to the second treatment period if the IBD patient, at one or more timepoints during the first treatment period or at the end of the first treatment period, shows a clinical response to the anti-SMAD7 therapy (e.g., a SMAD7 AON), or if the IBD patient goes into remission. See, e.g., Section 6.2.1, Section 6.2.2, Section 6.6 and Section 6.7. The clinical response or remission of the IBD patient can be analyzed, e.g., based on an endoscopic outcome, a clinical activity parameter, a safety or tolerability parameter, a biomarker of intestinal inflammation or tissue damage, a histological score, expression of a biomarker in an intestinal mucosal biopsy. See, e.g., Section 6.2.
[0626] The treatment regimen, e.g., during the first and/or second treatment period can be adjusted depending on the strength of the clinical response in the IBD patient (e.g., depending on the decrease in CDAI from baseline), or depending on the timepoint of at which the patient shows a clinical response. For example, the stronger an IBD patient's clinical response is at the end of the first treatment period, the more the dose of the anti-SMAD7 therapy can be reduced during the second treatment period. If the IBD patient shows a response earlier during the first treatment period, the patient can transition into the second treatment period earlier. See, e.g., Section 6.7.
[0627] In some embodiments, the IBD patient transitions from the first treatment period to the second treatment period, if the patient shows a decrease of SES-CD score from baseline 25% or 50%, a decrease of CDAI score from baseline 100 points, a decrease of PRO-2 score from baseline 8 points, a decrease of average daily liquid or soft stool frequency scores 1 and/or a decrease of an abdominal pain score 1; TMS2, PMS2, MMS2, or ES=1 or 0.
[0628] In some embodiments, baseline is the SES-CD score at a timepoint during week 0 of the first treatment period. In some embodiments, baseline is the SES-CD score at a timepoint immediately prior to the first administration of the anti-SMAD7 therapy.
[0629] In some embodiments, baseline is the CDAI score at a timepoint during week 0 of the first treatment period. In some embodiments, baseline is the CDAI score at a timepoint immediately prior to the first administration of the anti-SMAD7 therapy.
[0630] In some embodiments, baseline is the PRO-2 score at a timepoint during week 0 of the first treatment period. In some embodiments, baseline is the PRO-2 score at a timepoint immediately prior to the first administration of the anti-SMAD7 therapy.
[0631] In some embodiments, the IBD patient transitions from the first treatment period to the second treatment period, if the patient shows a SES-CD score 2, a CDAI score 150, a PRO-2 score 8, an average daily liquid or soft stool frequency score 3 or 1.5 and/or an abdominal pain score 1; a TMS2, a PMS2, an MMS2, or an ES=1 or 0.
[0632] In some embodiments, the IBD patient transitions from the first treatment period to the second treatment period, if the patient shows a decrease of TMS score from baseline 30% and 3 points, along with a decrease of RBS score 1 or absolute RBS1; a decrease of endoscopic subscore from baseline 1; a decrease of PMS score from baseline 25% and 2 points, along with a decrease of RBS score 1 or an absolute RBS1; a decrease of MMS score from baseline 25% and 2 points, along with a reduction in RBS score of 1 or an absolute RBS1.
[0633] In some embodiments, the IBD patient transitions from the first treatment period to the second treatment period, if the patient shows a TMS score 2 points with no individual subscore >1; an endoscopic subscore (ES)=0; a PMS score 2 points with no individual subscore 1; an MMS score 2 points with no individual subscore >1.
[0634] In some embodiments, baseline is the TMS score at a timepoint during week 0 of the first treatment period. In some embodiments, baseline is the TMS score at a timepoint immediately prior to the first administration of the anti-SMAD7 therapy.
[0635] In some embodiments, baseline is the endoscopic subscore at a timepoint during week 0 of the first treatment period. In some embodiments, baseline is the endoscopic subscore at a timepoint immediately prior to the first administration of the anti-SMAD7 therapy.
[0636] In some embodiments, baseline is the PMS score at a timepoint during week 0 of the first treatment period. In some embodiments, baseline is the PMS score at a timepoint immediately prior to the first administration of the anti-SMAD7 therapy.
[0637] In some embodiments, baseline is the MMS score at a timepoint during week 0 of the first treatment period. In some embodiments, baseline is the MMS score at a timepoint immediately prior to the first administration of the anti-SMAD7 therapy.
[0638] In some embodiments, the IBD patient transitions from the first treatment period to the second treatment period if the level of a biomarker, such as, e.g., SMAD7 (e.g., SMAD7 protein or SMAD7 mRNA), SMAD3 phosphorylation, HLA-DR, IL6, IL8, IL12, IL17A, CD4, CD8, IFN-, CRP, FCP, TNF, or the like, in a sample from the patient having IBD is at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% decreased from baseline (e.g., respective biomarker level at timepoint during week 0 of first treatment period).
[0639] In some embodiments, the IBD patient transitions from the first treatment period to the second treatment period if the level of a biomarker, such as, e.g., SMAD7, SMAD3 phosphorylation, HLA-DR, IL6, IL8, IL12, IL17A, IFN-, CD4, CD8, CRP, FCP, TNF, or the like, in a sample from the patient having IBD is within a standard deviation (SD) range of 2, 35, 6, or 10 of the average, median, or mean level of the biomarker in a healthy control group.
[0640] In some embodiments, the IBD patient transitions from the first treatment period to the second treatment period if the patient shows mucosal healing, as indicated, e.g., by the absence of an intestinal mucosal ulceration.
[0641] In some embodiments, if the IBD patient at the end of the first treatment period (e.g., during week 4, week 8, or week 12) does not show a response to the anti-SMAD7 therapy the IBD patient does not transition from the first treatment period to the second treatment period. In some embodiments, the non-responding IBD patient repeats the first treatment period. In some embodiments, the non-responding IBD patient repeats the first treatment period and is administered with an increased first dose of the anti-SMAD7 therapy. In some embodiments, the treatment of the IBD patient is terminated (e.g., if the IBD patient was already treated with the maximum tolerated dose of the anti-SMAD7 therapy, or if the IBD patient experienced an adverse effect). In some embodiments, the increased first dose is about 1.5-fold, about 2-fold, about 4-fold, about 8-fold, about 16-fold of the initial first dose.
[0642] In some embodiments, if the IBD patient shows a response to the anti-SMAD7 treatment or if the IBD is in remission at the end of the first treatment period, the anti-SMAD7 treatment is terminated and the IBD patient does not transition to the second treatment period.
[0643] In some embodiments, if an IBD patient shows a response to the anti-SMAD7 treatment or if the IBD patient is in remission at the end of the first treatment period, and if, during a subsequent observation period without treatment, the patient experiences loss of remission or loss of some or all of the response observed at the end of the first treatment period, the patient transitions to the second treatment period. In some embodiments, if an IBD patient shows a response to the anti-SMAD7 teatment or if the IBD patient is in remission at the end of the first treatment period, and if, during a subsequent observation period without treatment, the patient experiences loss of partial response (e.g., at 2 consecutive visits the patient has a CADI score >150 and an increase of CDAI score >50 points from the CDAI score when the patient was first a responder during the first treatment period), the patient transitions to the second treatment period. In some embodiments, if an IBD patient receives a corticosteroid treatment prior to or during the first treatment period and the patient cannot taper the corticosteroid during the subsequent observation period, the patient transitions to the second treatment period.
6.1.1.4 Second Treatment Period
[0644] In some embodiments, the second treatment period is between about 1 week and about 50 weeks, between about 2 weeks and about 48 weeks, between about 4 weeks and about 46 weeks, between about 6 weeks and about 44 weeks, between about 8 weeks and about 42 weeks, between about 10 weeks and about 40 weeks, between about 12 weeks and about 38 weeks, between about 14 weeks and about 36 weeks, between about 16 weeks and about 34 weeks, between about 18 weeks and about 32 weeks, between about 20 weeks and about 30 weeks, between about 22 week and about 28 weeks, between about 22 weeks and about 26 weeks, or between about 24 weeks and about 26 weeks.
[0645] In some embodiments, the second treatment period is about 1 week, about 2 weeks, about 4 weeks, about 6 weeks, about 8 weeks, about 10 weeks, about 12 weeks, about 14 weeks, about 16 weeks, about 18 weeks, about 20 weeks, about 22 weeks, about 24 weeks, about 26 weeks, about 28 weeks, about 30 weeks, about 32 weeks, about 34 weeks, about 36 weeks, about 38 weeks, about 40 weeks, about 42 weeks, about 44 weeks, about 46 weeks, about 48 weeks, or about 50 weeks.
[0646] In some embodiments, the second treatment period is about 24 weeks.
[0647] In some embodiments, the second treatment period is between about 1 week and about 100 weeks, between about 5 weeks and about 95 weeks, between about 10 weeks and about 90 weeks, between about 15 weeks and about 85 weeks, between about 20 weeks and about 80 weeks, between about 25 weeks and about 75 weeks, between about 30 weeks and about 70 weeks, between about 35 weeks and about 65 weeks, between about 40 weeks and about 60 weeks, between about 40 weeks and about 55 weeks, between about 45 weeks and about 55 weeks, or between about 50 weeks and about 55 weeks.
[0648] In some embodiments, the second treatment period is about 1 week, about 5 weeks, about 10 weeks, about 15 weeks, about 20 weeks, about 25 weeks, about 30 weeks, about 35 weeks, about 40 weeks, about 45 weeks, about 50 weeks, about 55 weeks, about 60 weeks, about 65 weeks, about 70 weeks, about 75 weeks, about 80 weeks, about 85 weeks, about 90 weeks, about 95 weeks, or about 100 weeks.
[0649] In some embodiments, the second treatment period is about 52 weeks.
[0650] In some embodiments, the second treatment period is about 40 weeks.
[0651] In some embodiments, the second treatment period is about 44 weeks.
[0652] In some embodiments, the second treatment period is at least about 1 week, at least about 2 weeks, at least about 4 weeks, at least about 6 weeks, at least about 8 weeks, at least about 10 weeks, at least about 3 months, at least about 6 months, at least about 9 months, at least about 12 months, at least about 18 months, at least about 24 months, at least about 30 months, at least about 3 years, at least about 4 years, at least about 5 years, at least about 6 years, at least about 7 years, at least about 8 years, at least about 9 years, or at least about 10 years.
[0653] In some embodiments, the second treatment period lasts until the patient shows dose-limiting toxicity or experiences an adverse event.
[0654] In some embodiments, the second treatment period lasts for the duration of a patient's remaining life span.
[0655] In some embodiments, the second treatment period lasts for an indefinite period of time, i.e., a period of time that is not predetermined. In some embodiments, the second treatment period lasts until the patient shows a certain response to the treatment or meets a specified, predetermined clinical milestone, e.g., as determined by results from colonoscopy or ileocolonoscopy tests, biomarker levels or other tests, such as patient reported outcomes, or quality of life measurements (e.g., achievement or maintenance for a specific time of CDAI<150, SES-CD2, PRO-2 score <8, or CRP levels <1.0 mg/L, average daily liquid or soft stool frequency score 3 or 1.5 and/or an abdominal pain score 1; TMS2, PMS2, MMS2, ES=1 or 0, and the like).
[0656] In some embodiments, the second treatment period is between about 1 week and about 400 weeks, between about 40 weeks and about 340 weeks, between about 80 weeks and about 320 weeks, between about 120 weeks and about 280 weeks, between about 160 weeks and about 240 weeks, or between about 180 weeks and about 200 weeks.
[0657] In some embodiments, the second treatment period is about 196 weeks.
[0658] In some embodiments, the second treatment period lasts until the patient having IBD shows a loss of response to the SMAD7 AON (e.g., increase of SES-CD score 50%, compared to SES-CD score at time of first response; increase of CDAI score 50 points compared to CDAI score at time of first response; increase of PRO-2 score of 8 points compared to PRO-2 score at time of first response; increase of daily liquid or soft stool frequency score of 1 point and/or of an abdominal pain score of 1 points compared to liquid or soft stool frequency and/or abdominal pain scores at time of first response).
6.1.1.5 Dosing During Second Treatment Period
[0659] In the methods provided herein, during the second treatment period, the IBD patient is administered with a second dose of an anti-SMAD7 therapy (e.g., a SMAD7 AON).
[0660] In some embodiments, the second dose of the SMAD7 AON is between about 30 mg and about 310 mg, between about 50 mg and about 290 mg, between about 70 mg and about 270 mg, between about 70 mg and about 250 mg, between about 90 mg and about 230 mg, between about 110 mg and about 210 mg, or between 130 mg and about 190 mg, or between 150 mg and about 170 mg.
[0661] In some embodiments, the second dose of the SMAD7 AON is between about 30 mg and about 620 mg, between about 60 mg and about 580 mg, between about 100 mg and about 540 mg, between about 140 mg and about 500 mg, between about 180 mg and about 460 mg, between about 220 mg and about 420 mg, between about 260 mg and about 380 mg, between about 300 mg and about 340 mg.
[0662] In some embodiments, the second dose of the SMAD7 AON is between about 5 mg and about 90 mg, between about 10 mg and about 70 mg, or between about 30 mg and about 50 mg.
[0663] In some embodiments, the second dose of the SMAD7 AON is about 20 mg, about 40 mg, about 60 mg, about 80 mg, about 100 mg, about 120 mg, about 140 mg, about 160 mg, about 180 mg, about 200 mg, about 220 mg, about 240 mg, about 260 mg, about 280 mg, or about 300 mg.
[0664] In some embodiments, the second dose of the SMAD7 AON is about 40 mg, about 80 mg, about 120 mg, about 160 mg, about 200 mg, about 240 mg, about 280 mg, about 320 mg, about 360 mg, about 400 mg, about 440 mg, about 480 mg, about 520 mg, about 560 mg, about 600 mg or about 640 mg.
[0665] In some embodiments, the second dose of the SMAD7 AON is about 40 mg.
[0666] In some embodiments, the second dose of the SMAD7 AON is about 160 mg.
[0667] In some embodiments, the second dose of the SMAD7 AON is about 320 mg.
[0668] In some embodiments, the second dose of the SMAD7 AON is between about 30 mg/day and about 310 mg/day, between about 50 mg/day and about 290 mg/day, between about 70 mg/day and about 270 mg/day, between about 90 mg/day and about 250 mg/day, between about 110 mg/day and about 230 mg/day, between about 130 mg/day and about 190 mg/day, or between about 150 mg/day and about 170 mg/day.
[0669] In some embodiments, the second dose of the SMAD7 AON is between about 30 mg/day and about 620 mg/day, between about 60 mg/day and about 580 mg/day, between about 100 mg/day and about 540 mg/day, between about 140 mg/day and about 500 mg/day, between about 180 mg/day and about 480 mg/day, between about 220 mg/day and about 420 mg/day, between about 260 mg/day and about 380 mg/day or between about 300 mg/day and about 340 mg/day.
[0670] In some embodiments, the second dose of the SMAD7 AON is between about 5 mg/day and about 90 mg/day, between about 10 mg/day and about 70 mg/day, or between about 30 mg/day and about 50 mg/day.
[0671] In some embodiments, the second dose of the SMAD7 AON is about 20 mg/day, about 40 mg/day, about 60 mg/day, about 80 mg/day, about 100 mg/day, about 120 mg/day, about 140 mg/day, about 160 mg/day, about 180 mg/day, about 200 mg/day, about 220 mg/day, about 240 mg/day, about 260 mg/day, about 280 mg/day, about 300 mg/day, or about 320 mg/day.
[0672] In some embodiments, the second dose of the SMAD7 AON is about 40 mg/day, about 80 mg/day, about 120 mg/day, about 160 mg/day, about 200 mg/day, about 240 mg/day, about 280 mg/day, about 320 mg/day, about 360 mg/day, about 400 mg/day, about 440 mg/day, about 480 mg/day, about 520 mg/day, about 560 mg/day, about 600 mg/day, or about 640 mg/day.
[0673] In some embodiments, the second dose of the SMAD7 AON is about 40 mg/day.
[0674] In some embodiments, the second dose of the SMAD7 AON is about 160 mg/day.
[0675] In some embodiments, the second dose of the SMAD7 AON is about 320 mg/day.
[0676] In some embodiments, the first and second dose of the SMAD7 AON are the same dose. In some embodiments, the first and the second dose of the SMAD7 AON are different doses.
[0677] In some embodiments, the second dose of the SMAD7 AON is lower than the first dose of the SMAD7 AON. In some embodiments, the second dose is at least about 20 mg, at least about 40 mg, at least about 60 mg, at least about 80 mg, at least about 100 mg, at least about 120 mg, at least about 140 mg, at least about 160 mg, at least about 180 mg, at least about 200 mg, at least about 220 mg, at least about 240 mg, at least about 260 mg, at least about 280 mg, or at least about 300 mg lower than the first dose.
[0678] In some embodiments, the second dose of the SMAD7 AON is lower than the first dose of the SMAD7 AON. In some embodiments, the second dose is at least about 20 mg/day, at least about 40 mg/day, at least about 60 mg/day, at least about 80 mg/day, at least about 100 mg/day, at least about 120 mg/day, at least about 140 mg/day, at least about 160 mg/day, at least about 180 mg/day, at least about 200 mg/day, at least about 220 mg/day, at least about 240 mg/day, at least about 260 mg/day, at least about 280 mg/day, or at least about 300 mg/day lower than the first dose.
[0679] In some embodiments, the second dose of the SMAD7 AON is higher than the first dose of the SMAD7 AON. In some embodiments, the second dose is at least about 20 mg, at least about 40 mg, at least about 60 mg, at least about 80 mg, at least about 100 mg, at least about 120 mg, at least about 140 mg, at least about 160 mg, at least about 180 mg, at least about 200 mg, at least about 220 mg, at least about 240 mg, at least about 260 mg, at least about 280 mg, or at least about 300 mg higher than the first dose.
[0680] In some embodiments, the second dose of the SMAD7 AON is higher than the first dose of the SMAD7 AON. In some embodiments, the second dose is at least about 20 mg/day, at least about 40 mg/day, at least about 60 mg/day, at least about 80 mg/day, at least about 100 mg/day, at least about 120 mg/day, at least about 140 mg/day, at least about 160 mg/day, at least about 180 mg/day, at least about 200 mg/day, at least about 220 mg/day, at least about 240 mg/day, at least about 260 mg/day, at least about 280 mg/day, or at least about 300 mg/day higher than the first dose.
[0681] In some embodiments, the first and second dose of the SMAD7 AON are the same dose. In some embodiments, the first and second dose are at least about 20 mg, at least about 40 mg, at least about 60 mg, at least about 80 mg, at least about 100 mg, at least about 120 mg, at least about 140 mg, at least about 160 mg, at least about 180 mg, at least about 200 mg, at least about 220 mg, at least about 240 mg, at least about 260 mg, at least about 280 mg, at least about 300 mg, or at least about 320 mg.
[0682] In some embodiments, the first and second dose of the SMAD7 AON are the same dose. In some embodiments, the first and second dose are at least about 20 mg/day, at least about 40 mg/day, at least about 60 mg/day, at least about 80 mg/day, at least about 100 mg/day, at least about 120 mg/day, at least about 140 mg/day, at least about 160 mg/day, at least about 180 mg/day, at least about 200 mg/day, at least about 220 mg/day, at least about 240 mg/day, at least about 260 mg/day, at least about 280 mg/day, at least about 300 mg/day, or at least about 320 mg/day.
6.1.1.6 End of Second Treatment Period
[0683] The second treatment period can end on a time dependent schedule, or on a schedule that is dependent on the clinical response of an IBD patient to an anti-SMAD7 therapy. For example, the length of the second treatment period can be predetermined. A second treatment period of predetermined length can end at the predetermined time, regardless of whether the IBD patient, at that predetermined timepoint or at any timepoint during the second treatment period, responds to the anti-SMAD7 therapy or whether the IBD patient shows a partial or complete loss of response.
[0684] In some embodiments, if the IBD patient shows a partial or total loss of response to the anti-SMAD7 therapy (e.g., SMAD7 AON) during the second treatment period, the patient exits the second treatment period and reenters the first treatment period. See, e.g., Section 6.2.3. A patient reentering the first treatment period can be administered with a previously used first dose of the anti-SMAD7 therapy, or with an increased dose of the anti-SMAD7 therapy.
[0685] In some embodiments, the IBD patient exits the second treatment period if the patient shows an increase of SES-CD50% or 75%, compared to the IBD patient's SES-CD at time of first response; if the patient shows an increase of CDAI score 50 points compared to CDAI score at time of first response, if the patient shows an increase of PRO-2 score of 8 points compared to PRO-2 score at time of first response, if the patient shows an increase of daily liquid or soft stool frequency score of 1 point and/or of an abdominal pain score of 1 point compared to the liquid or soft stool frequency and/or abdominal pain scores at time of first response; if the patient shows 30% or 3 points increase of TMS from baseline; if the patient shows a 25% or 2 points increase of PMS from baseline; if the patient shows a 25% or 2 points increase of MMS from baseline, or if the patient shows a 1 point increase in ES from baseline.
[0686] In some embodiments, if the IBD patient shows a response to the anti-SMAD7 treatment or if the IBD is in remission at the end of the second treatment period, the anti-SMAD7 treatment is terminated.
6.1.1.7 Transition to Third Treatment Period
[0687] In the methods for treating IBD provided herein, an IBD patient can optionally transition to a third treatment period. In some embodiments, the IBD patient transitions to the third treatment period at the end of a first treatment period. In some embodiments, the IBD patient transitions to the third treatment period at the end of a second treatment period. In some embodiments, the IBD patient transitions to the third treatment period at a time point during a first and/or a second treatment. In some embodiments, the IBD patient transitions to the third treatment period at the end of or at a time point during an observation period. In some embodiments, the observation period occurs between a first and a second time period. In some embodiments, the observation period follows a second time period. In some embodiments, the IBD patient does not transition to a third treatment period.
[0688] In some embodiments, the IBD patient transitions directly from a first or second treatment period to the third treatment period, i.e., without an intermediate period, such as an observation period. In some embodiments, the IBD patient transitions from the first or second treatment period to the third treatment period through an intermediate period, such as an observation period.
[0689] In some embodiments, the transition to the third time period can occur based on a time dependent schedule, e.g., without considering the IBD patient's response to the anti-SMAD7 therapy. For example, in some embodiments, the second treatment period can have a predetermined length (e.g., 12 weeks, 24 weeks, 36 weeks, 48 weeks, or 52 weeks) and at the end of the second treatment period the IBD patient transitions from the second treatment period to the third treatment period, regardless of any results from monitoring the activity of the anti-SMAD7 therapy during the second treatment period (e.g., regardless of the observation of any response to the anti-SMAD7 therapy in the IBD patient).
[0690] In some embodiments, an IBD patient transitions from the second treatment period to the third treatment period if the IBD patient, at one or more timepoints during the second treatment period or at the end of the second treatment period, shows a clinical response to the anti-SMAD7 therapy (e.g., a SMAD7 AON), or if the IBD patient goes into remission. See, e.g., Section 6.2.1, Section 6.2.2, Section 6.6 and Section 6.7. The remission or clinical response of the IBD patient can be analyzed, e.g., based on an endoscopic outcome, a clinical activity parameter, a safety or tolerability parameter, a biomarker of intestinal inflammation or tissue damage, a histological score, expression of a biomarker in an intestinal mucosal biopsy. See, e.g., Section 6.2.
[0691] The treatment regimen, e.g., during the first, second and/or third treatment period can be adjusted depending on the strength of the clinical response in the IBD patient (e.g., depending on the decrease in the IBD patient's CDAI from baseline), or depending on the timepoint at which the patient shows a clinical response. For example, the stronger an IBD patient's clinical response is at the end of the prior (e.g., the first or second) treatment period, the further the dose of the anti-SMAD7 therapy can be reduced during the third treatment period. In some embodiments, if the IBD patient shows a response to the anti-SMAD7 therapy before the end of the prior (first or second) treatment period, the patient can transition into the third treatment as soon as the IBD patient shows the response. See, e.g., Section 6.7.
[0692] In some embodiments, the IBD patient transitions to the third treatment period, if the patient shows a decrease of SES-CD score from baseline 25% or 50%, a decrease of CDAI score from baseline 100 points, a decrease of PRO-2 score from baseline 8 points, a decrease of daily liquid or soft stool frequency score of 1 point and/or of an abdominal pain score of 1 point compared to the liquid or soft stool frequency and/or abdominal pain scores at baseline, a 3 points or 30% increase in TMS from baseline, a 2 points or 25% increase in PMS from baseline, a 2 or 25% points increase in MMS from baseline, or a 1 point increase in ES from baseline.
[0693] In some embodiments, SES-CD, CDAI, PRO-2, daily liquid or soft stool frequency score, abdominal pain score, MMS, PMS, TMS or ES baseline is the corresponding SES-CD, CDAI, PRO-2 score, daily liquid or soft stool frequency score, abdominal pain score, MMS, PMS, TMS or ES at a timepoint during week 0 of the first treatment period. In some embodiments, SES-CD, CDAI, PRO-2, daily liquid or soft stool frequency score, abdominal pain score, MMS, PMS, TMS or ES baseline is the corresponding SES-CD, CDAI, PRO-2, daily liquid or soft stool frequency score, abdominal pain score, MMS, PMS, TMS or ES score at a timepoint immediately prior to the first administration of the anti-SMAD7 therapy.
[0694] In some embodiments, the IBD patient transitions to the third treatment period, if the patient shows a SES-CD score 2, a CDAI score 150, a PRO-2 score 8, a daily liquid or soft stool frequency 3 or 1.5 and/or an abdominal pain score 1; TMS2, PMS2, MMS2, or ES=1 or 0.
[0695] In some embodiments, the IBD patient transitions from the first treatment period to the second treatment period, if the patient shows a decrease of TMS score from baseline 30% and 3 points, along with a decrease of RBS score 1 or absolute RBS1; a decrease of endoscopic subscore from baseline 1; a decrease of PMS score from baseline 25% and 2 points, along with a decrease of RBS score 1 or an absolute RBS1; a decrease of MMS score from baseline 25% and 2 points, along with a reduction in RBS score of 1 or an absolute RBS1.
[0696] In some embodiments, the IBD patient transitions from the first treatment period to the second treatment period, if the patient shows a TMS score 2 points with no individual subscore >1; an endoscopic subscore=0; a PMS score 2 points with no individual subscore >1; an MMS score 2 points with no individual subscore >1.
[0697] In some embodiments, TMS score, PMS score, MMS score, RBS score, or endoscopic score baseline is the corresponding TMS score, PMS score, MMS score, RBS score, or endoscopic score at a timepoint during week 0 of the first treatment period. In some embodiments, TMS score, PMS score, MMS score, RBS score, or endoscopic score baseline is the corresponding TMS score, PMS score, MMS score, RBS score, or endoscopic score at a timepoint immediately prior to the first administration of the anti-SMAD7 therapy.
[0698] In some embodiments, the IBD patient transitions to the third treatment period if the level of a biomarker, such as, e.g., SMAD7, SMAD3 phosphorylation, HLA-DR, CD4, CD8, CRP, FCP, TNF, IFN-, IL8, IL-12, IL17A or IL6 or the like, in a sample from the patient having IBD is at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% decreased from baseline (e.g., respective biomarker level at timepoint during week 0 of first treatment period).
[0699] In some embodiments, the IBD patient transitions to the third treatment period if the level of a biomarker, such as, e.g., SMAD7, SMAD3 phosphorylation, HLA-DR, CD4, CD8, CRP, FCP, TNF, IFN-, IL8, IL-12, IL17A or IL6 level, or the like, in a sample from the patient having IBD is within a standard deviation (SD) range of 2a, 3a, 5a, 6a, or 1 Oa of the average, median, or mean level of the biomarker in a healthy control group.
[0700] In some embodiments, the IBD patient transitions to the third treatment period if the patient shows mucosal healing, as indicated, e.g., by the absence of an intestinal mucosal ulceration.
[0701] In some embodiments, if the IBD patient at the end of the second treatment period (e.g., during week 12, week 24, week 36, week 48, or week 52) does not show a response to the anti-SMAD7 therapy the IBD patient does not transition from the second treatment period to the third treatment period. In some embodiments, the non-responding IBD patient repeats the second treatment period. In some embodiments, the non-responding IBD patient repeats the second treatment period and is administered with an increased second dose of the anti-SMAD7 therapy. In some embodiments, the treatment of the IBD patient is terminated (e.g., if the IBD patient was already treated with the maximum tolerated dose of the anti-SMAD7 therapy, or if the IBD patient experienced an adverse effect).
[0702] In some embodiments, if the IBD patient shows a response to the anti-SMAD7 treatment or if the IBD is in remission at the end of the first or second treatment period, the anti-SMAD7 treatment is terminated and the IBD patient does not transition to the third treatment period.
[0703] In some embodiments, if an IBD patient does not show a clinical improvement (e.g., the patient does not have a CDAI<180 and a reduction of 70 points in the CDAI score as compared to the baseline) at any time point during the second treatment period, the IBD patient transitions from the second treatment period to the third treatment period.
[0704] 6.1.1.8 Third Treatment Period
[0705] In some embodiments, the third treatment period is between about 1 week and about 8 years, between about 12 weeks and about 7 years, between about 24 weeks and about 6 years, between about 36 weeks and about 5 years, or between about 52 weeks and about 4 years (i.e., about 208 weeks).
[0706] In some embodiments, the third treatment period is about 1 week, about 12 weeks, about 24 weeks, about 36 weeks, about 52 weeks, about 1.5 years, about 2 years, about 2.5 years, about 3 years, about 3.5 years, about 4 years (i.e., about 208 weeks), about 5 years, about 6 years, about 7 year weeks, or about 8 years.
[0707] In some embodiments, the third treatment period is about 26 weeks, about 52 weeks, about 78 weeks, about 104 weeks, about 130 weeks, about 156 weeks, about 182 weeks, about 196 weeks, about 208 weeks, or about 312 weeks.
[0708] In some embodiments, the third treatment period is at least about 1 week, at least about 2 weeks, at least about 4 weeks, at least about 6 weeks, at least about 8 weeks, at least about 10 weeks, at least about 52 weeks, at least about 56 weeks, at least about 60 weeks, at least about 3 months, at least about 6 months, at least about 9 months, at least about 12 months, at least about 18 months, at least about 24 months, at least about 36 months, at least 48 months, at least 60 months, or at least 72 months.
[0709] In some embodiments, the third treatment period is about 208 weeks.
[0710] In some embodiments, the third treatment period is about 196 weeks.
[0711] In some embodiments, the third treatment period is between about 1 week and about 460 week, between about 40 weeks and about 420 weeks, between about 80 weeks and about 380 weeks, between about 120 weeks and about 340 weeks, between about 160 weeks and about 300 weeks, and between about 180 weeks and about 260 weeks.
[0712] In some embodiments, the third treatment period lasts until the IBD patient shows a response to a SMAD7 AON (e.g., decrease of SES-CD score from baseline 25% or 50%; decrease of CDAI score from baseline 100 points; decrease of PRO-2 score from baseline 8 points; decrease of average daily liquid or soft stool frequency score from baseline of 1 point and/or decrease of abdominal pain score 1 point) or until the IBD patient having IBD experiences remission (e.g., SES-CD score 2; CDAI score 150; PRO-2 score 8; average daily liquid or soft stool frequency score 1.5 and/or abdominal pain score 1. TMS score 2; ES=0; PMS2 points; MMS2).
[0713] In some embodiments, the third treatment period lasts until the patient shows dose-limiting toxicity or experiences an adverse event.
[0714] In some embodiments, the third treatment period lasts until the end of the patient's remaining life span.
[0715] In some embodiments, the third treatment period lasts for an indefinite period of time, i.e., a period of time that is not predetermined. In some embodiments, the third treatment period lasts until the patient shows a certain response to the treatment or meets a specified, predetermined clinical milestone, e.g., as determined by results from colonoscopy or ileocolonoscopy tests, biomarker levels or other tests, such as patient reported outcomes, or quality of life measurements (e.g., achievement or maintenance for a specific time of CDAI<150, SES-CD2, PRO-2 score <8, or CRP levels <1.0 mg/L, average daily liquid or soft stool frequency of 3.0 or 1.5 points, and/or decrease of abdominal pain score 1 point, TMS score 2; ES=0 or 1; PMS2 points; MMS2, and the like).
6.1.1.9 Dose During Third Treatment Period
[0716] In the methods provided herein, during the third treatment period, a third dose of an anti-SMAD7 therapy (e.g., a SMAD7 AON) is administered to the IBD patient.
[0717] In some embodiments, the third dose of the SMAD7 AON is between about 30 mg and about 310 mg, between about 50 mg and about 290 mg, between about 70 mg and about 270 mg, between about 70 mg and about 250 mg, between about 90 mg and about 230 mg, between about 110 mg and about 210 mg, or between 130 mg and about 190 mg, or between 150 mg and about 170 mg.
[0718] In some embodiments, the third dose of the SMAD7 AON is between about 30 mg and about 620 mg, between about 60 mg and about 580 mg, between about 100 mg and about 540 mg, between about 140 mg and about 500 mg, between about 180 mg and about 460 mg, between about 220 mg and about 420 mg, or between 260 mg and about 380 mg, or between 300 mg and about 340 mg.
[0719] In some embodiments, the third dose of the SMAD7 AON is between about 5 mg and about 90 mg, between about 10 mg and about 70 mg, or between about 30 mg and about 50 mg.
[0720] In some embodiments, the third dose of the SMAD7 AON is about 20 mg, about 40 mg, about 60 mg, about 80 mg, about 100 mg, about 120 mg, about 140 mg, about 160 mg, about 180 mg, about 200 mg, about 220 mg, about 240 mg, about 260 mg, about 280 mg, or about 300 mg.
[0721] In some embodiments, the third dose of the SMAD7 AON is about 40 mg, about 80 mg, about 120 mg, about 160 mg, about 200 mg, about 240 mg, about 280 mg, about 320 mg, about 360 mg, about 400 mg, about 440 mg, about 480 mg, about 520 mg, about 560 mg, about 600 mg or about 640 mg.
[0722] In some embodiments, the third dose of the SMAD7 AON is about 40 mg.
[0723] In some embodiments, the third dose of the SMAD7 AON is about 80 mg.
[0724] In some embodiments, the third dose of the SMAD7 AON is about 160 mg.
[0725] In some embodiments, the third dose of the SMAD7 AON is about 320 mg.
[0726] In some embodiments, the third dose of the SMAD7 AON is between about 30 mg/day and about 310 mg/day, between about 50 mg/day and about 290 mg/day, between about 70 mg/day and about 270 mg/day, between about 90 mg/day and about 250 mg/day, between about 110 mg/day and about 230 mg/day, between about 130 mg/day and about 190 mg/day, or between about 150 mg/day and about 170 mg/day.
[0727] In some embodiments, the third dose of the SMAD7 AON is between about 30 mg/day and about 620 mg/day, between about 60 mg/day and about 580 mg/day, between about 100 mg/day and about 540 mg/day, between about 140 mg/day and about 500 mg/day, between about 180 mg/day and about 460 mg/day, between about 220 mg/day and about 420 mg/day or between about 260 mg/day and about 380 mg/day, or between about 300 mg/day and about 340 mg/day.
[0728] In some embodiments, the third dose of the SMAD7 AON is between about 5 mg/day and about 90 mg/day, between about 10 mg/day and about 70 mg/day, or between about 30 mg/day and about 50 mg/day.
[0729] In some embodiments, the third dose of the SMAD7 AON is about 20 mg/day, about 40 mg/day, about 60 mg/day, about 80 mg/day, about 100 mg/day, about 120 mg/day, about 140 mg/day, about 160 mg/day, about 180 mg/day, about 200 mg/day, about 220 mg/day, about 240 mg/day, about 260 mg/day, about 280 mg/day, about 300 mg/day, or about 320 mg/day.
[0730] In some embodiments, the third dose of the SMAD7 AON is about 40 mg/day, about 80 mg/day, about 120 mg/day, about 160 mg/day, about 200 mg/day, about 240 mg/day, about 280 mg/day, about 320 mg/day, about 360 mg/day, about 400 mg/day, about 440 mg/day, about 480 mg/day, about 520 mg/day, about 560 mg/day, about 600 mg/day, or about 640 mg/day.
[0731] In some embodiments, the third dose of the SMAD7 AON is about 40 mg/day.
[0732] In some embodiments, the third dose of the SMAD7 AON is about 80 mg/day.
[0733] In some embodiments, the third dose of the SMAD7 AON is about 160 mg/day.
[0734] In some embodiments, the third dose of the SMAD7 AON is about 320 mg/day.
[0735] In some embodiments, the first, second and third (optional) doses are the same doses (e.g., the first dose is the same as the second dose.). In some embodiments, one of the first, second and third doses is different from at least one of the two other doses (e.g., the first dose is different from the second dose). In some embodiments, each of the first, second and third doses is different from each of the other two doses.
6.1.1.10 Additional Time Periods
[0736] In some embodiments, the methods provided herein further comprise an initial screening period prior to the first treatment period, e.g., to assess or monitor the IBD disease severity or to taper or discontinue an additional IBD treatment prior to the first administration of the anti-SMAD7 therapy (e.g., a SMAD7 AON)
[0737] In some embodiments, no SMAD7 AON is administered during the screening period.
[0738] In some embodiments, the screening period is between about 1 week and about 10 weeks, between about 2 weeks and about 9 weeks, between about 3 weeks and about 8 weeks, between about 4 weeks and about 7 weeks, or between weeks and about 6 weeks. In some embodiments, the screening period is about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 9 weeks or about 10 weeks. In some embodiments, the screening period is about 5 weeks.
[0739] In some embodiments, the methods provided herein further comprise an observation period between the first and the second treatment period, e.g., to monitor the IBD patient's response to the anti-SMAD7 therapy (e.g., SMAD7 AON) after the first treatment period.
[0740] In some embodiments, the methods provided herein further comprise an observation period between the second and the third treatment period, e.g., to monitor the IBD patient's response to the anti-SMAD7 therapy (e.g., SMAD7 AON) after the second treatment period. In some embodiments, no SMAD7 AON is administered to the patient having IBD during the observation period.
[0741] In some embodiments, the observation period is between about 1 week and about 100 weeks, between about 10 weeks and about 90 weeks, between about 20 weeks and about 80 weeks, between about 30 weeks and about 70 weeks, between about 40 weeks and about 60 weeks. In some embodiments, the observation period is up to about 10 weeks, up to about 20 weeks, up to about 30 weeks, up to about 40 weeks, up to about 50 weeks, up to about 60 weeks, up to about 70 weeks, up to about 80 weeks, up to about 90 weeks or up to about 100 weeks. In some embodiments, the observation period is up to about 52 weeks.
[0742] In some embodiment, tapering of an additional IBD treatment (i.e., an IBD treatment that is already in place prior to the start of the first and/or second treatment period) occurs during at least the first week, at least the second week, at least the third week, at least the fourth week, at least the fourth week, at least the fifth week, at least the sixth week, at least the seventh week, at least the eighth week, at least the ninth week, or at least the tenth week of the observation period.
[0743] In some embodiments, the methods provided herein further comprise a follow up period after the second treatment period, e.g., to monitor the IBD patient's response to the anti-SMAD7 therapy (e.g., SMAD7 AON) after the end of the second treatment period.
[0744] In some embodiments, the methods provided herein further comprise a follow up period after the third treatment period, e.g., to monitor the IBD patient's response to the anti-SMAD7 therapy (e.g., SMAD7 AON) after the end of the third treatment period.
[0745] In some embodiments, no SMAD7 AON is administered to the patient having IBD during the follow up period.
[0746] In some embodiments, the follow up period is between about 1 week and about 10 weeks, between about 2 weeks and about 9 weeks, between about 3 weeks and about 8 weeks, or between about 4 weeks and about 7 weeks. In some embodiments, the screening period is up to about 1 week, up to about 2 weeks, up to about 3 weeks, up to about 4 weeks, up to about 5 weeks, up to about 6 weeks, up to about 7 weeks, up to about 8 weeks, up to about 9 weeks, up to about 10 weeks, up to about 3 months, up to about 6 months, up to about 9 months, up to about 12 months, up to about 18 months, up to about 24 months, up to about 30 months, up to about 36 months, up to about 42 months, up to about 48 months, up to about 54 months, or up to about 60 months. In some embodiments, the follow up period is up to about 4 weeks.
[0747] In some embodiments, the methods provided herein do not comprise and additional time period. In some embodiments, the methods provided herein are consisting of a first, second and, optionally, a third treatment period.
6.1.2 Alternating Dosing Schedules
[0748] The SMAD7 AON can be administered continuously (e.g., once daily for 12 weeks) or on an alternating dosing schedule (e.g., once daily during week 0-4, no treatment during week 5-8, once daily during week 9-12) during the first, second and/or third treatment period. Continuous administrations can be at the same dose or at different doses (e.g., increasing or decreasing doses over time). In alternating dosing schedules, drug treatment periods can alternate with no drug treatment or placebo treatment periods (drug holiday periods), or treatment periods with two or more different doses can alternate.
[0749] In the alternating dosing schedules described herein two or more periods can be alternating. In some embodiments, the alternating dosing schedule can have a first alternating period and a second alternating period. In some embodiments, the first alternating period is a drug (e.g., SMAD7 AON) treatment period and the second alternating period is a no-treatment or placebo treatment period. In some embodiments, the first alternating period is a no-treatment or placebo treatment period and the second alternating period is a drug (e.g., SMAD7 AON) treatment period. The two or more alternating periods in an alternating dosing schedule can have the same length, or the alternating periods can each individually differ in length. For example, a first alternating period can be longer or shorter than a second alternating period.
[0750] Alternating periods can have a length ranging from days, to weeks, to months, to years. In some embodiments, the alternating periods can each individually be between 1 week and 7 weeks, between 2 weeks and 6 weeks, or between 3 weeks and 5 weeks. In some embodiments, the alternating periods can each individually be between 1 week and 15 weeks, between 2 weeks and 14 weeks, between 3 weeks and 13 weeks, between 4 weeks and 12 weeks, between 5 weeks and 11 weeks, between 6 weeks and 10 weeks, or between 7 weeks and 9 weeks. In some embodiments, an alternating period can be 4 weeks. In some embodiments, an alternating period can be 8 weeks. In some embodiments, an alternating period can be at least one month, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 7 months, at least 8 months, at least 9 months, at least 10 months, at least 11 months, or at least 12 months.
[0751] In some embodiments, the alternating dosing schedule starts with a drug treatment period that is then followed by a no-treatment or placebo treatment period. In some embodiments, the alternating dosing schedule, e.g., during a second or third treatment period, starts with a no-treatment or placebo treatment period that is then followed by a drug treatment period.
[0752] In some embodiments, in an alternating dosing schedule, the SMAD7 AON treatment period occurs first (e.g., during a first alternating period) and the no-treatment or placebo treatment period occurs second (e.g., during a second alternating period). In some embodiments, in the alternating dosing schedule, the no-treatment or placebo treatment period occurs first (e.g., during a first alternating period) and the SMAD7 AON treatment period occurs second (e.g., during a second alternating period).
[0753] In some embodiments, the drug treatment period and the no-treatment or placebotreatment periods are of the same length (e.g., 4 weeks each). In some embodiments, the drug treatment period and the no-treatment period are of different lengths (e.g., drug treatment period of 2 weeks, followed by a no-treatment period of 4 weeks). In some embodiments, the drug treatment period is longer than the no-treatment or placebo treatment period. In some embodiments, the no-treatment or placebo treatment period is longer than the drug treatment period.
[0754] In some embodiments, the SMAD7 AON is administered continuously during the first treatment period and during the second treatment period. In some embodiments, the SMAD7 AON is administered continuously during the first treatment period and is administered on an alternating dosing schedule during the second treatment period. In some embodiments, the SMAD7 AON is administered on an alternating dosing schedule during the first treatment period and is administered continuously during the second treatment period. In some embodiments, the SMAD7 AON is administered on an alternating dosing schedule during the first treatment period and during the second treatment period.
[0755] In some embodiments, the SMAD7 AON is administered continuously during the first, second and (optional) third treatment periods. In some embodiments, the SMAD7 AON is administered continuously during the first and (optional) third treatment periods and is administered on an alternating dosing schedule during the second treatment period. In some embodiments, the SMAD7 AON is administered continuously during the first and second treatment periods and is administered on an alternating dosing schedule during the (optional) third treatment period. In some embodiments, the SMAD7 AON is administcrcd continuously during the second and (optional) third treatment periods and is administered on an alternating dosing schedule during the first treatment period. In some embodiments, the SMAD7 AON is administered continuously during the first treatment period and is administered on an alternating dosing schedule during the second and (optional) third treatment periods. In some embodiments, the SMAD7 AON is administered continuously during the second treatment period and is administered on an alternating dosing schedule during the first and (optional) third treatment periods. In some embodiments, the SMAD7 AON is administered continuously during the (optional) third treatment period and is administered on an alternating dosing schedule during the first and second treatment periods. In some embodiments, the SMAD7 AON is administered on an alternating dosing schedule during the first, second and (optional) third treatment periods.
[0756] In some embodiments, continuously administering the SMAD7 AON comprises administering the SMAD7 AON daily (e.g., once daily, twice daily, and the like), weekly, biweekly or monthly, e.g., during the first, second and/or third treatment period.
[0757] In some embodiments, the alternating dosing schedule comprises a) administering the SMAD7 AON for a drug administration period; b) administering no SMAD7 AON or administering a placebo during a drug holiday period; and repeating a) and, optionally, b) one or more times.
[0758] In some embodiments, the alternating dosing schedule, e.g., during a second or third treatment period, comprises a) administering no SMAD7 AON or administering a placebo during a drug holiday period; b) administering the SMAD7 AON for a drug administration period; and repeating a) and, optionally, b) one or more times.
[0759] In some embodiments, a drug administration period for use with the treatment regimen provided herein can be between about 1 week and about 7 weeks, between about 2 weeks and about 6 weeks, or between about 3 weeks and about 5 weeks. In some embodiments, the drug treatment period for use with the treatment regimen provided herein can be between about 1 week and about 15 weeks, between about 2 weeks and about 14 weeks, between about 3 weeks and about 13 weeks, between about 4 weeks and about 12 weeks, between about 5 weeks and about 11 weeks, between about 6 weeks and about 10 weeks, or between about 7 weeks and about 9 weeks. In some embodiments, the drug treatment period for use with the treatment regimen provided herein can be about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, about 12 weeks, about 13 weeks, about 14 weeks, or about 15 weeks.
[0760] In some embodiments, the drug administration period is up to 1 month, up to 2 months, up to 3 months, up to 4 months, up to 5 months, up to 6 months, up to 7 months, up to 8 months, up to 9 months, up to 10 months, up to 11 months, or up to 12 months.
[0761] In some embodiments, the drug administration period is about 1 month, about 2 months, about 3 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, or about 12 months.
[0762] In some embodiments, the drug holiday period for use with the treatment regimen provided herein can be between about 1 week and about 7 weeks, between about 2 weeks and about 6 weeks, or between about 3 weeks and about 5 weeks. In some embodiments, the drug holiday period for use with the treatment regimen provided herein can be between about 1 week and about 15 weeks, between about 2 weeks and about 14 weeks, between about 3 weeks and about 13 weeks, between about 4 weeks and about 12 weeks, between about 5 weeks and about 11 weeks, between about 6 weeks and about 10 weeks, or between about 7 weeks and about 9 weeks. In some embodiments, the drug holiday period for use with the treatment regimen provided herein can be about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, about 12 weeks, about 13 weeks, about 14 weeks, or about 15 weeks.
[0763] In some embodiments, a drug administration period for use with the treatment regimen provided herein is about 4 weeks. In some embodiments, a drug holiday period for use with the treatment regimen provided herein is about 4 weeks.
[0764] In some embodiments, the alternating dosing schedule comprises drug holiday periods of between about 1 week and about 15 weeks, between about 2 weeks and about 14 weeks, between about 3 weeks and about 13 weeks, between about 4 weeks and about 12 weeks, between about 5 weeks and about 11 weeks, between about 6 weeks and about 10 weeks, or between about 7 weeks and about 9 weeks, which are alternating with drug administration periods of between about 1 week and about 15 weeks, between about 2 weeks and about 14 weeks, between about 3 weeks and about 13 weeks, between about 4 weeks and about 12 weeks, between about 5 weeks and about 11 weeks, between about 6 weeks and about 10 weeks, or between about 7 weeks and about 9 weeks.
[0765] In some embodiments, the alternating dosing schedule comprises drug holiday periods of between about 1 week and about 7 weeks, between about 2 weeks and about 6 weeks, or between about 3 weeks and about 5 weeks, which are alternating with drug administration periods of between about 1 week and about 7 weeks, between about 2 weeks and about 6 weeks, or between about 3 weeks and about 5 weeks.
[0766] In some embodiments, the alternating dosing schedule comprises drug holiday periods of up to 1 month, up to 2 months, up to 3 months, up to 4 months, up to 5 months, up to 6 months, up to 7 months, up to 8 months, up to 9 months, up to 10 months, up to 11 months, or up to 12 months, which are alternating with drug administration periods of up to 1 month, up to 2 months, up to 3 months, up to 4 months, up to 5 months, up to 6 months, up to 7 months, up to 8 months, up to 9 months, up to 10 months, up to 11 months, or up to 12 months.
[0767] In some embodiments, the alternating dosing schedule comprises drug holiday periods of about 1 month, about 2 months, about 3 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, or about 12 months, which are alternating with drug administration periods of about 1 month, about 2 months, about 3 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, or about 12 months.
[0768] In some embodiments, an alternating dosing schedule is applied during the first, second, and/or third treatment period and comprises a) administering the SMAD7 AON at the first, second, and/or third dose for between about 1 week and about 7 weeks, between about 2 weeks and about 6 weeks, or between about 3 weeks and about 5 weeks; b) administering a placebo or no SMAD7 AON for between about 1 week and about 7 weeks, between about 2 weeks and about 6 weeks, or between about 3 weeks and about 5 weeks; and repeating a) and, optionally, b) one or more times.
[0769] In some embodiments, an alternating dosing schedule is applied during the first, second, or third treatment period and comprises a) administering a placebo or no SMAD7 AON for between about 1 week and about 7 weeks, between about 2 weeks and about 6 weeks, or between about 3 weeks and about 5 weeks; b) administering the SMAD7 AON at the first, second, or third dose for between about 1 week and about 7 weeks, between about 2 weeks and about 6 weeks, or between about 3 weeks and about 5 weeks; and repeating a) and, optionally, b) one or more times.
[0770] As discussed in Section 6.1.1.4., the total length of the second and/or third treatment periods can be at least about 1 week, at least about 2 weeks, at least about 4 weeks, at least about 6 weeks, at least about 8 weeks, at least about 10 weeks, at least about 3 months, at least about 6 months, at least about 9 months, at least about 12 months, at least about 18 months, at least about 24 months, at least about 30 months, at least about 3 years, at least about 4 years, at least about 5 years, at least about 6 years, at least about 7 years, at least about 8 years, at least about 9 years, or at least about 10 years.
[0771] In some embodiments, the total length of the second and/or third treatment period can be the length of the patient's remaining life span.
[0772] In some embodiments, the alternating dosing schedule is applied during the first, second or third treatment period and comprises a) administering the SMAD7 AON at the first, second, or third dose for between about 1 week and about 15 weeks, between about 2 weeks and about 14 weeks, between about 3 weeks and about 13 weeks, between about 4 weeks and about 12 weeks, between about 5 weeks and about 11 weeks, between about 6 weeks and about 10 weeks, or between about 7 weeks and about 9 weeks; b) administering a placebo or no SMAD7 AON for between about 1 week and about 15 weeks, between about 2 weeks and about 14 weeks, between about 3 weeks and about 13 weeks, between about 4 weeks and about 12 weeks, between about 5 weeks and about 11 weeks, between about 6 weeks and about 10 weeks, or between about 7 weeks and about 9 weeks; and repeating a) and optionally b) one or more times.
[0773] In some embodiments, the alternating dosing schedule is applied during the first, second, and/or third treatment period and comprises a) administering a placebo or no SMAD7 AON for between about 1 week and about 15 weeks, between about 2 weeks and about 14 weeks, between about 3 weeks and about 13 weeks, between about 4 weeks and about 12 weeks, between about 5 weeks and about 11 weeks, between about 6 weeks and about 10 weeks, or between about 7 weeks and about 9 weeks; b) administering the SMAD7 AON at the first, second and/or third dose for between about 1 week and about 15 weeks, between about 2 weeks and about 14 weeks, between about 3 weeks and about 13 weeks, between about 4 weeks and about 12 weeks, between about 5 weeks and about 11 weeks, between about 6 weeks and about 10 weeks, or between about 7 weeks and about 9 weeks; and repeating a) and optionally b) one or more times.
[0774] In some embodiments, the alternating dosing schedule is applied during the first, second, and/or third treatment period and comprises a) administering the SMAD7 AON at the first, second and/or third dose for about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, about 12 weeks, about 13 weeks, about 14 weeks, about 15 weeks, or about 16 weeks; b) administering a placebo or no SMAD7 AON for about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, about 12 weeks, about 13 weeks, about 14 weeks, about 15 weeks, or about 16 weeks; and repeating a) and, optionally, b) one or more times.
[0775] In some embodiments, the alternating dosing schedule is applied during the first, second, and/or third treatment period and comprises a) administering a placebo or no SMAD7 AON for about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, about 12 weeks, about 13 weeks, about 14 weeks, about 15 weeks, or about 16 weeks; b) administering the SMAD7 AON at the first, second, and/or third dose for about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, about 12 weeks, about 13 weeks, about 14 weeks, about 15 weeks, or about 16 weeks; and repeating a) and, optionally, b) one or more times.
[0776] In some embodiments, the alternating dosing schedule is applied during the first, second, and/or third treatment period and comprises a) administering a placebo or no SMAD7 AON for about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, about 12 weeks, about 13 weeks, about 14 weeks, about 15 weeks, or about 16 weeks; b) administering the SMAD7 AON at the first, second, and/or third dose for about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, about 12 weeks, about 13 weeks, about 14 weeks, about 15 weeks, or about 16 weeks; and repeating a) and, optionally, b) one or more times.
[0777] In some embodiments, the alternating dosing schedule is applied during the first, second, and/or third treatment period and comprises a) administering the SMAD7 AON at the first, second and/or third dose for at least about month, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, at least about 6 months, at least about 7 months, at least about 8 months, at least about 9 months, at least about 10 months, at least about 11 months, or at least about 12 months; b) administering a placebo or no SMAD7 AON for at least about month, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, at least about 6 months, at least about 7 months, at least about 8 months, at least about 9 months, at least about 10 months, at least about 11 months, or at least about 12 months; and repeating a) and, optionally, b) one or more times.
[0778] In some embodiments, the alternating dosing schedule is applied during the first, second, or third treatment period and comprises a) administering the SMAD7 AON at the first, second, or third dose for about 2 weeks; b) administering a placebo or no SMAD7 AON for about 2 weeks; and repeating a) and, optionally, b) 5 more times.
[0779] In some embodiments, the alternating dosing schedule is applied during the first, second, or third treatment period and comprises a) administering the SMAD7 AON at the first, second, or third dose for about 4 weeks; b) administering a placebo or no SMAD7 AON for about 4 weeks; and repeating a) and, optionally, b) 2 more times.
[0780] In some embodiments, the alternating dosing schedule is applied during the first, second, or third treatment period and comprises a) administering the SMAD7 AON at the first, second, or third dose for about 4 weeks; b) administering a placebo or no SMAD7 AON for about 4 weeks; and repeating a) and, optionally, b) 6 more times.
[0781] In some embodiments, the alternating dosing schedule is applied during the first, second, and/or third treatment period and comprises a) administering a placebo or no SMAD7 AON for about 4 weeks; b) administering the SMAD7 AON at the first, second, and/or third dose for about 4 weeks; and repeating a) and, optionally b) 2 more times.
[0782] In some embodiments, the alternating dosing schedule is applied during the first, second, and/or third treatment period and comprises a) administering a placebo or no SMAD7 AON for about 4 weeks; b) administering the SMAD7 AON at the first, second, and/or third dose for about 4 weeks; and repeating a) and, optionally, b) 6 more times.
[0783] In some embodiments, the alternating dosing schedule is applied during the first, second, or third treatment period and comprises a) administering the SMAD7 AON at the first, second, or third dose for about 4 weeks; b) administering a placebo or no SMAD7 AON for about 8 weeks; and repeating a) and, optionally, b) 4 more times.
[0784] In some embodiments, the alternating dosing schedule is applied during the first, second, or third treatment period and comprises a) administering a placebo or no SMAD7 AON for about 8 weeks; b) administering the SMAD7 AON at the first, second, or third dose for about 4 weeks; and repeating a) and, optionally b) 4 more times.
[0785] In some embodiments, the alternating dosing schedule is applied during the third treatment period and comprises a) administering the SMAD7 AON at the second dose for about 4 weeks; b) administering a placebo or no SMAD7 AON for about 4 weeks; and repeating a) and optionally b) 25 more times.
[0786] In some embodiments, the alternating dosing schedule is applied during the third treatment period and comprises a) administering a placebo or no SMAD7 AON for about 4 weeks; b) administering the SMAD7 AON at the second dose for about 4 weeks; and repeating a) and, optionally b) 25 more times.
[0787] In some embodiments, a) and, optionally, b) are repeated at least 1 time, at least 2 times, at least 4 times, at least 6 times, at least 8 times, at least 10 times, at least 12 times, at least 14 times, at least 16 times, at least 18 times, at least 20 times, at least 25 times, at least 50 times, at least 100 times, at least 150 times, at least 200 times, or at least 250 times.
[0788] In some embodiments, a) and, optionally, b) are repeated at least 1 more time, at least 2 more times, at least 3 more times, at least 4 more times, at least 5 more times, at least 6 more times, at least 7 more times, at least 8 more times, at least 9 more times, at least 10 more times, at least 11 more times, at least 12 more times, at least 13 more times, at least 14 more times, at least 15 more times, at least 16 more times, at least 17 more times, at least 18 more times, at least 19 more times, at least 20 more times, at least 21 more times, at least 22 more times, at least 23 more times, at least 24 more times, at least 25 more times, at least 26 more times, at least 27 more times, at least 28 more times, at least 29 more times, at least 30 more times, at least 31 more times, at least 32 more times, at least 33 more times, at least 34 more times, at least 35, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, or at least 100 more times.
[0789] In some embodiments, a) and, optionally, b) are repeated up to 5 more times, up to 10 more times, up to 15 more times, up to 20 more times, up to 25 more times, up to 30 more times, up to 35 more times, up to 40 more times, up to 45 more times, up to 50, up to 60, up to 70, up to 80, up to 90, or up to 100 more times.
6.1.3 Illustrative Treatment Regimens
[0790] In some embodiments, a method for use with the treatment regimens provided herein comprises (a) continuously administering to an IBD patient a SMAD7 AON for a first treatment period at a first once-daily dose; (b) continuously administering to the IBD patient the SMAD7 AON for a second treatment period at a second once-daily dose; and, optionally, (c) administering to the IBD patient the SMAD7AON for a third treatment period at a third dose. See, e.g.,
[0791] In some embodiments, a method for use with the treatment regimens provided herein comprises (a) continuously administering to an IBD patient a SMAD7 AON for a first treatment period at a first once-daily dose; (b) administering to the IBD patient the SMAD7 AON for a second treatment period at a second once-daily dose using an alternating dosing schedule, wherein the alternating dosing schedule comprises c) administering to the IBD patient a placebo or no SMAD7 AON for a first alternating period; d) administering to the IBD patient the SMAD7 AON at the second once-daily dose for a second alternating period, and (c) repeating (c) and (d) one or more times, and, optionally, f) administering to the IBD patient the SMAD7 AON for a third treatment period at a third dose (e.g., continuously, or using an alternating dosing schedule). See, e.g.,
[0792] In some embodiments, a method for use with the treatment regimens provided herein comprises (a) administering to an IBD patient the SMAD7 AON for a first treatment period at a first once-daily dose using an alternating dosing schedule, wherein the alternating dosing schedule comprises (b) administering to the IBD patient the SMAD7 AON at the first once-daily dose for a first alternating period, (c) administering to the IBD patient a placebo or no SMAD7 AON for a second alternating period, and (d) repeating (b) and (c) one or more times; (e) administering to the IBD patient the SMAD7 AON for a second treatment period at a second once-daily dose using an alternating dosing schedule, wherein the alternating dosing schedule comprises (f) administering to the IBD patient the SMAD7 AON at the second once-daily dose for a third alternating period; (g) administering to the IBD patient a placebo or no SMAD7 AON for a fourth alternating period, and (h) repeating (f) and (g) one or more times, and, optionally, (i) administering to the IBD patient the SMAD7 AON for a third treatment period at a third dose (e.g., continuously, or using an alternating dosing schedule). See, e.g.,
[0793] In some embodiments, administering to the IBD patient the SMAD7AON for a third treatment period at a third dose comprises continuously administering to the IBD patient the SMAD7 AON at a third once-daily dose.
[0794] In some embodiments, administering to the IBD patient the SMAD7AON for a third treatment period at a third dose comprises using an alternating dosing schedule, wherein the alternating dosing schedule comprises (a) administering to the IBD patient a placebo or no SMAD7 AON for a first alternating period; (b) administering to the IBD patient the SMAD7 AON at the third once-daily dose for a second alternating period, and (c) repeating (a) and (b) one or more times. In some embodiments, in the alternating dosing schedule, the SMAD7 AON treatment period occurs first (during the first alternating period) and the no-treatment or placebo treatment period occurs second (during the second alternating period). In some embodiments, in the alternating dosing schedule, the no-treatment or placebo treatment period occurs first (during the first alternating period) and the SMAD7 AON treatment period occurs second (during the second alternating period).
[0795] In some embodiments, the patient transitions directly from the first to the second treatment period, from the second to the third treatment period, and/or from the first to the optional third treatment period.
[0796] In some embodiments, the patient transitions through an intermediate period, such as an observation period from the first to the second treatment period, from the second to the third treatment period, and/or from the first to the optional third treatment period.
[0797] In some embodiments, the durations of the first, second and/or third treatment periods are not predetermined, but depends on the patient's response to treatment, e.g., as determined by results from colonoscopy, ilonooscopy, biomarker levels or others (e.g., achievement or maintenance for a specific time of CDAI<150, SES-CD2, PRO-2 score <8, CRP levels <1.0 mg/L, average daily liquid or soft stool frequency 3.0 or 1.5 points and/or decrease of abdominal pain score 1 point; TMS score 2; ES=0 or 1; PMS2 points; MMS2). In some embodiments, the transition of a patient from one to another treatment period, e.g., the transition of the patient from the first to the second treatment period, is triggered by the patient's response to treatment.
[0798] In some embodiments, in an alternative dosing schedule, the SMAD7 AON treatment period is of the same length as the alternating no-treatment or placebo treatment period. In some embodiments, the SMAD7 AON treatment period and the no-treatment or placebo treatment periods are of different lengths. In some embodiments, the SMAD7 AON treatment period is longer than the no-treatment period or the placebo treatment period. In some embodiments, the no-treatment or placebo treatment period is longer than the SMAD7 AON treatment period.
[0799] As described in Section 6.1.2, the alternating periods described herein periods can have a length ranging from days, to weeks, to months, to years. In some embodiments, the alternating periods can each individually be between 1 week and 7 weeks, between 2 weeks and 6 weeks, or between 3 weeks and 5 weeks. In some embodiments, the alternating periods can each individually be between 1 week and 15 weeks, between 2 weeks and 14 weeks, between 3 weeks and 13 weeks, between 4 weeks and 12 weeks, between 5 weeks and 11 weeks, between 6 weeks and 10 weeks, or between 7 weeks and 9 weeks. In some embodiments, an alternating period can be 4 weeks. In some embodiments, an alternating period can be 8 weeks. In some embodiments, an alternating period can be at least one month, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 7 months, at least 8 months, at least 9 months, at least 10 months, at least 11 months, or at least 12 months.
[0800] In one embodiment, a method for use with the treatment regimens provided herein comprises (a) administering to a CD patient a SMAD7 AON for a period of about 4 weeks, about 8 weeks, or about 12 weeks at a once-daily dose of about 160 mg; and (b) administering to the CD patient the SMAD7 AON for about 24 weeks at a once-daily dose of about 40 mg using an alternating dosing schedule. See, e.g.,
[0801] In one embodiment, a method for use with the treatment regimens provided herein comprises (a) administering to an IBD patient a SMAD7 AON for a period of about 12 weeks at a once-daily dose of about 160 mg; and (b) administering to the IBD patient the SMAD7 AON for about 40 weeks at a once-daily dose of about 40 mg or 160 mg using an alternating dosing schedule, wherein the alternating dosing schedule comprises c) administering to the IBD patient a placebo or no SMAD7 AON for about 4 weeks; d) administering to the IBD patient the SMAD7 AON at a once-daily dose of about 40 mg or about 160 mg; and repeating c) and d) for a period of time. See, e.g.,
[0802] In some embodiments, the alternating dosing schedule comprises five SMAD7 AON treatment periods of 4-weeks each (weeks 16-19, weeks 24-27, weeks 32-35, weeks 40-43, and weeks 48-51) that are alternating with five no-treatment or placebo-treatment periods of 4 weeks each (weeks 12-15, weeks 20-23, weeks 28-31, weeks 36-39, and weeks 44-47). See, e.g., Example 2, Table 4.
[0803] In one embodiment, a method for use with the treatment regimens provided herein comprises (a) administering to an IBD patient a SMAD7 AON for a period of about 12 weeks at a once-daily dose of about 160 mg; and (b) administering to the IBD patient the SMAD7 AON for a period of time at a once-daily dose of about 40 mg. See, e.g.,
[0804] In one embodiment, a method for use with the treatment regimens provided herein comprises (a) administering to an IBD patient a SMAD7 AON for a period of about 12 weeks at a once-daily dose of about 160 mg; and (b) administering to the IBD patient the SMAD7 AON for up to about 196 weeks at a once-daily dose of about 160 mg using an alternating dosing schedule, wherein the alternating dosing schedule comprises c) administering to the IBD patient a placebo or no SMAD7 AON for about 4 weeks; d) administering to the IBD patient the SMAD7 AON at a once-daily dose of about 160 mg for about 4 weeks; and repeating c) and d) for a period of time. See, e.g.,
[0805] In some embodiments, the alternating dosing schedule comprises up to twenty-four SMAD7 AON treatment periods of 4-weeks each (weeks 16-19, weeks 24-27, weeks 32-35, weeks 40-43, weeks 48-51, weeks 56-59, weeks 64-67, weeks 72-75, weeks 80-83, weeks 88-91, weeks 96-99, weeks 104-107, weeks 112-115, weeks 120-123, weeks 128-131, weeks 136-139, weeks 144-147, weeks 152-155, weeks 160-163, weeks 168-171, weeks, 176-179, weeks 184-187, weeks 192-195, and weeks 200-203) that are alternating with up to twenty-five no-treatment or placebo treatment periods of 4 weeks each (weeks 12-15, weeks 20-23, weeks 28-31, weeks 36-39, weeks 44-47, weeks 52-55, weeks 60-63, weeks 68-71, weeks 76-79, weeks 84-87, weeks 92-95, weeks 100-103, weeks 108-111, weeks 116-119, weeks 124-127, weeks 132-135, weeks 140-143, weeks 148-151, weeks 156-159, weeks 164-167, weeks 172-175, weeks 180-183, weeks 188-191, weeks 196-199, and weeks 204-207). See, e.g., Example 3, Tables 7-10.
[0806] In one embodiment, a method for use with the treatment regimens provided herein comprises (a) administering to an IBD patient a SMAD7 AON for a period of about 12 weeks at a once-daily dose of about 160 mg using an alternating dosing schedule, wherein the alternating dosing schedule comprises b) administering to the IBD patient the SMAD7 AON at a once-daily dose of about 160 mg for about 4 weeks; c) administering to the IBD patient a placebo or no SMAD7 AON for a period of about 4 weeks; and repeating b) once; d) administering to the IBD patient the SMAD7 AON for up to about 196 weeks at a once-daily dose of up to about 160 mg using an alternating dosing schedule, wherein the alternating dosing schedule comprises e) administering to the IBD patient a placebo or no SMAD7 AON for about 4 weeks; f) administering to the IBD patient the SMAD7 AON at a once-daily dose of about 160 mg for about 4 weeks; and repeating e) and f) for a period of time. See, e.g.,
[0807] In some embodiments, the alternating dosing schedule comprises up to twenty-six SMAD7 AON treatment periods of 4-weeks each (weeks 0-3, weeks 8-11, weeks 16-19, weeks 24-27, weeks 32-35, weeks 40-43, weeks 48-51, weeks 56-59, weeks 64-67, weeks 72-75, weeks 80-83, weeks 88-91, weeks 96-99, weeks 104-107, weeks 112-115, weeks 120-123, weeks 128-131, weeks 136-139, weeks 144-147, weeks 152-155, weeks 160-163, weeks 168-171, weeks, 176-179, weeks 184-187, weeks 192-195, and weeks 200-203) that are alternating with up to twenty-six no-treatment or placebo treatment periods of 4 weeks each (weeks, 4-7, weeks 12-15, weeks 20-23, weeks 28-31, weeks 36-39, weeks 44-47, weeks 52-55, weeks 60-63, weeks 68-71, weeks 76-79, weeks 84-87, weeks 92-95, weeks 100-103, weeks 108-111, weeks 116-119, weeks 124-127, weeks 132-135, weeks 140-143, weeks 148-151, weeks 156-159, weeks 164-167, weeks 172-175, weeks 180-183, weeks 188-191, weeks 196-199, and weeks 204-207). See, e.g., Example 3, Tables 7-10,
[0808] In some embodiments, the alternating dosing schedule comprises up to twenty-six SMAD7 no-treatment or placebo treatment periods of 4-weeks each (weeks 0-3, weeks 8-11, weeks 16-19, weeks 24-27, weeks 32-35, weeks 40-43, weeks 48-51, weeks 56-59, weeks 64-67, weeks 72-75, weeks 80-83, weeks 88-91, weeks 96-99, weeks 104-107, weeks 112-115, weeks 120-123, weeks 128-131, weeks 136-139, weeks 144-147, weeks 152-155, weeks 160-163, weeks 168-171, weeks, 176-179, weeks 184-187, weeks 192-195, and weeks 200-203) that are alternating with up to twenty-six SMAD7 AON treatment periods of 4 weeks each (weeks, 4-7, weeks 12-15, weeks 20-23, weeks 28-31, weeks 36-39, weeks 44-47, weeks 52-55, weeks 60-63, weeks 68-71, weeks 76-79, weeks 84-87, weeks 92-95, weeks 100-103, weeks 108-111, weeks 116-119, weeks 124-127, weeks 132-135, weeks 140-143, weeks 148-151, weeks 156-159, weeks 164-167, weeks 172-175, weeks 180-183, weeks 188-191, weeks 196-199, and weeks 204-207). See, e.g., Example 3, Tables 7-10,
[0809] In one embodiment, a method for use with the treatment regimens provided herein comprises (a) administering to an IBD patient a SMAD7 AON for a period of about 12 weeks at a once-daily dose of about 40 mg; and (b) administering to the IBD patient the SMAD7 AON for a period of time at a once-daily dose of about 40 mg. See, e.g.,
[0810] In one embodiment, a method for use with the treatment regimens provided herein comprises (a) administering to an IBD patient a SMAD7 AON for a period of about 12 weeks at a once-daily dose of about 40 mg using an alternating dosing schedule, wherein the alternating dosing schedule comprises b) administering to the IBD patient a placebo or no SMAD7 AON for a period of about 4 weeks; c) administering to the IBD patient the SMAD7 AON at a once-daily dose of about 40 mg for about 4 weeks; and repeating b) once; d) administering to the IBD patient the SMAD7 AON for up to about 196 weeks at a once-daily dose of up to about 40 mg using an alternating dosing schedule, wherein the alternating dosing schedule comprises e) administering to the IBD patient the SMAD7 AON at a once-daily dose of about 40 mg for about 4 weeks; f) administering to the IBD patient a placebo or no SMAD7 AON for about 4 weeks; and repeating e) and f) for a total of up to about 196 weeks. See, e.g.,
[0811] In some embodiments, the alternating dosing schedule comprises up to twenty-six drug treatment periods of 4-weeks each (weeks 4-7, weeks 12-15, weeks 20-23, weeks 28-31, weeks 36-39, weeks 44-47, weeks 52-55, weeks 60-63, weeks 68-71, weeks 76-79, weeks 84-87, weeks 92-95, weeks 100-103, weeks 108-111, weeks 116-119, weeks 124-127, weeks 132-135, weeks 140-143, weeks 148-151, weeks 156-159, weeks 164-167, weeks 172-175, weeks 180-183, weeks 188-191, weeks 196-199, and weeks 204-207) that are alternating with up to twenty-six drug holiday periods of 4 weeks each (weeks 0-3, weeks 8-11, weeks 16-19, weeks 24-27, weeks 32-35, weeks 40-43, weeks 48-51, weeks 56-59, weeks 64-67, weeks 72-75, weeks 80-83, weeks 88-91, weeks 96-99, weeks 104-107, weeks 112-115, weeks 120-123, weeks 128-131, weeks 136-139, weeks 144-147, weeks 152-155, weeks 160-163, weeks 168-171, weeks, 176-179, weeks 184-187, weeks 192-195, and weeks 200-203). See, e.g., Example 3, Tables 7-10.
[0812] In one embodiment, a method for use with the treatment regimens provided herein comprises (a) administering to an IBD patient a SMAD7 AON for a period of about 8 weeks at a once-daily dose of about 160 mg; and (b) administering to the IBD patient the SMAD7 AON for up to about 44 weeks at a once-daily dose of about 160 mg using an alternating dosing schedule, wherein the alternating dosing schedule comprises c) administering to the IBD patient the SMAD7 AON at a once-daily dose of about 160 mg for about 4 weeks; d) administering a placebo or no SMAD7 AON for about 4 weeks; and repeating c) and d) for a period of time. See, e.g.,
[0813] In some embodiments, the alternating dosing schedule comprises up to five SMAD7 AON treatment periods of 4-weeks each (weeks 12-15, weeks 20-23, weeks 28-31, weeks 36-39, and weeks 44-47) that are alternating with up to six no treatment or placebo treatment periods of 4 weeks each (weeks 8-11, weeks 16-19, weeks 24-27, weeks 32-35, weeks 40-43, and weeks 48-51). See, e.g.,
[0814] In one embodiment, a method for use with the treatment regimens provided herein comprises (a) administering to an IBD patient a SMAD7 AON for a period of about 8 weeks at a once-daily dose of about 320 mg; and (b) administering to the IBD patient the SMAD7 AON for up to about 44 weeks at a once-daily dose of about 320 mg using an alternating dosing schedule, wherein the alternating dosing schedule comprises c) administering to the IBD patient the SMAD7 AON at a once-daily dose of about 320 mg for about 4 weeks; d) administering to the IBD patient a placebo or no SMAD7 AON for about 4 weeks; and repeating c) and d) for a period of time. See, e.g.,
[0815] In some embodiments, the alternating dosing schedule comprises up to five SMAD7 AON treatment periods of 4-weeks each (weeks 12-15, weeks 20-23, weeks 28-31, weeks 36-39, and weeks 44-47) that are alternating with up to six placebo or no-treatment periods of 4 weeks each (weeks 8-11, weeks 16-19, weeks 24-27, weeks 32-35, weeks 40-43, and weeks 48-51). See, e.g.,
[0816] In any embodiments comprising an alternating dosing schedule, the alternating dosing schedule can start with either a drug administration (e.g., SMAD7 AON administration) or with the administration of a placebo or no treatment.
[0817] In some embodiments, in one or more alternating dosing schedules, the SMAD7 AON is administered first and the and the placebo or no treatment is administered second.
[0818] In some embodiments, in one or more alternating dosing schedules the placebo or no treatment is administered first and the SMAD7 AON is administered second.
[0819] Any administration schedule described herein can be preceeded by the same or by any other administration schedule described herein.
[0820] In some embodiments, the IBD patient is a CD patient. In some embodiments, the IBD patient is a UC patient
[0821] As discussed in Sections 6.1.1.4. and 6.1.1.8, in some embodiments, the total length of the second and/or third treatment period can be at least about 1 week, at least about 2 weeks, at least about 4 weeks, at least about 6 weeks, at least about 8 weeks, at least about 10 weeks, at least about 3 months, at least about 6 months, at least about 9 months, at least about 12 months, at least about 18 months, at least about 24 months, at least about 30 months, at least about 3 years, at least about 4 years, at least about 5 years, at least about 6 years, at least about 7 years, at least about 8 years, at least about 9 years, or at least about 10 years.
[0822] In some embodiments, a method for use with the treatment regimens provided herein comprises (a) administering to a CD patient a SMAD7 AON for a period of about 12 weeks at a once-daily dose of about 160 mg; and (b) administering to the CD patient the SMAD7 AON for about 24 weeks a once-daily dose of about 40 mg on an alternating dosing schedule, wherein the alternating dosing schedule comprises c) administering the SMAD7 AON at a once-daily dose of about 40 mg for about 4 weeks; d) administering a placebo or no SMAD7 AON for about 4 weeks; and repeating c) and d) 2 more times. See e.g., Example 1, Table 3.
[0823] In some embodiments, a method for use with the treatment regimens provided herein comprises (a) administering to a CD patient a SMAD7 AON for a period of between about 4 weeks and about 8 weeks (e.g., for about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, or about 8 weeks) at a once-daily dose of about 40 mg; and (b) administering to the CD patient the SMAD7 AON for about 52 weeks a once-daily dose of about 40 mg on an alternating dosing schedule, wherein the alternating dosing schedule comprises c) administering the SMAD7 AON at a once-daily dose of about 40 mg for about 4 weeks; d) administering a placebo or no SMAD7 AON for about 4 weeks; and repeating c) and d) for a total of 52 weeks.
[0824] In some embodiments, a method for use with the treatment regimens provided herein comprises (a) administering to a CD patient a SMAD7 AON for a period of between about 4 weeks and about 8 weeks (e.g., for about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, or about 8 weeks) at a once-daily dose of about 40 mg; and (b) administering to the CD patient the SMAD7 AON for about 52 weeks a once-daily dose of about 40 mg on an alternating dosing schedule, wherein the alternating dosing schedule comprises c) administering the SMAD7 AON at a once-daily dose of about 40 mg for about 4 weeks; d) administering a placebo or no SMAD7 AON for about 8 weeks; and repeating c) and d) for a total of 52 weeks.
[0825] In some embodiments, a method for use with the treatment regimens provided herein comprises (a) administering to a CD patient a SMAD7 AON for a period of between about 4 weeks and about 8 weeks (e.g., for about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, or about 8 weeks) at a once-daily dose of about 160 mg; and (b) administering to the CD patient the SMAD7 AON for about 52 weeks a once-daily dose of about 40 mg on an alternating dosing schedule, wherein the alternating dosing schedule comprises c) administering the SMAD7 AON at a once-daily dose of about 40 mg for about 4 weeks; d) administering a placebo or no SMAD7 AON for about 4 weeks; and repeating c) and d) for a total of 52 weeks.
[0826] In some embodiments, a method for use with the treatment regimens provided herein comprises (a) administering to a CD patient a SMAD7 AON for a period of between about 4 weeks and about 8 weeks (e.g., for about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, or about 8 weeks) at a once-daily dose of about 160 mg; and (b) administering to the CD patient the SMAD7 AON for about 52 weeks a once-daily dose of about 40 mg on an alternating dosing schedule, wherein the alternating dosing schedule comprises c) administering the SMAD7 AON at a once-daily dose of about 40 mg for about 4 weeks; d) administering a placebo or no SMAD7 AON for about 8 weeks; and repeating c) and d) for a total of 52 weeks.
[0827] In some embodiments, a method for use with the treatment regimens provided herein method comprises (a) administering to a CD patient a SMAD7 AON for a period of between about 4 weeks and about 12 weeks (e.g., for about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, or about 12 weeks) at a once-daily dose of about 160 mg; and (b) administering to the CD patient the SMAD7 AON for about 52 weeks a once-daily dose of about 40 mg on an alternating dosing schedule, wherein the alternating dosing schedule comprises c) administering the SMAD7 AON at a once-daily dose of about 40 mg for about 4 weeks; d) administering a placebo or no SMAD7 AON for about 4 weeks; and repeating c) and d) for a total of 52 weeks.
[0828] In some embodiments, a method for use with the treatment regimens provided herein comprises (a) administering to a CD patient a SMAD7 AON for a period of between about 4 weeks and about 12 weeks (e.g., for about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, or about 12 weeks) at a once-daily dose of about 160 mg; and (b) administering to the CD patient the SMAD7 AON for about 52 weeks a once-daily dose of about 40 mg.
[0829] In some embodiments, a method for use with the treatment regimens provided herein comprises (a) administering to a CD patient a SMAD7 AON for a period of between about 4 weeks and about 12 weeks (e.g., for about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, or about 12 weeks) at a once-daily dose of about 160 mg; and (b) administering to the CD patient the SMAD7 AON for about 52 weeks a once-daily dose of about 160 mg on an alternating dosing schedule, wherein the alternating dosing schedule comprises c) administering the SMAD7 AON at a once-daily dose of about 160 mg for about 4 weeks; d) administering a placebo or no SMAD7 AON for about 4 weeks; and repeating c) and d) for a total of 52 weeks.
[0830] In some embodiments, a method for use with the treatment regimens provided herein comprises (a) administering to a CD patient a SMAD7 AON for a period of between about 4 weeks and about 12 weeks (e.g., for about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, or about 12 weeks) at a once-daily dose of about 160 mg; and (b) administering to the CD patient the SMAD7 AON for about 52 weeks a once-daily dose of about 40 mg on an alternating dosing schedule, wherein the alternating dosing schedule comprises c) administering the SMAD7 AON at a once-daily dose of about 40 mg for about 4 weeks; d) administering a placebo or no SMAD7 AON for about 8 weeks; and repeating c) and d) for a total of 52 weeks. s.
[0831] The SMAD7 AON can be administered at any time during the day, including at night time. In some embodiments, the SMAD7 AON is administered in the morning (e.g., between about 5 am and about 11 am, e.g., at about 5 am, about 6 am, about 7 am, about 8 am, about 9 am, about 10 am, or about 11 am). In some embodiments, the SMAD7 AON is administered around noon (e.g., between about 11 am and about 1 pm, e.g., at about 12 am or about 1 pm). In some embodiments, the SMAD7 AON is administered in the afternoon (e.g., between about 1 pm and about 5 pm, e.g., at about 2 pm, about 3 pm, about 4 pm, or about 5 pm). In some embodiments, the SMAD7 AON is administered in the evening (e.g., between about 5 pm and about 10 pm, e.g., at about 6 pm, about 7 pm, about 8 pm, about 9 pm or about 10 pm). In some embodiments, the SMAD7 AON is administered at night (e.g., between about 10 pm and about 4 am, e.g., at about 11 pm, about 12 pm, about 1 am, about 2 am, about 3 am, or about 4 am).
6.1.4 Rates and Manner of Administration
[0832] In some embodiments, the SMAD7 AON is administered orally. In some embodiments, the SMAD7 AON is administered with food or drinks. In some embodiments, the SMAD7 AON is administered without food or drinks. In some embodiments, the SMAD7 AON is administered with a meal, such as breakfast, lunch, or dinner. The SMAD7 AON can be administered, e.g., shortly before, shortly after, or at the same time the meal is taken. In some embodiments, the SMAD7 AON is administered in the morning shortly before breakfast. In some embodiments, the SMAD7 AON is administered at least about 5 min, at least about 10 min, at least about 20 min, at least about 30 min, at least about 45 min, at least about 60 min, at least about 75 min, at least about 90 min, or at least about 120 min before a meal. In some embodiments, the SMAD7 AON is administered within about 5 min, within about 10 min, within about 20 min, within about 30 min, within about 45 min, within about 60 min, within about 75 min, within about 90 min, or within about 120 min after a meal.
[0833] In some embodiments, the SMAD7 AON is administered in the morning shortly before breakfast with water (e.g., a glass of water). In some embodiments, the SMAD7 AON is administered in the morning within about 30 min before breakfast.
[0834] In some embodiments, the SMAD7 AON is administered once a day, twice a day, or three times a day. In some embodiments, the SMAD7 AON is administered once a day. In some embodiments, the SMAD7 AON is administered once every 2 days, once every 3 days, once every 4 days, once every 5 days, once every 6 days, once every week, once every 10 days, once every two weeks, once every three weeks, once every month, once every 6 weeks, or once every two months.
6.1.5 Additional Treatments
[0835] In the methods provided herein, the SMAD7 AON can be administered alone, or in combination with one or more additional IBD treatments (e.g., anti-SMAD7 treatments that are not SMAD7 AON, or IBD treatments that are not anti-SMAD7 treatments).
[0836] An additional IBD treatment (e.g., a drug tablet) can be administered concurrently with the SMAD7 AON or the additional drug can be administered before or after the SMAD7 AON.
[0837] The additional IBD treatment can be administered via the same route as the SMAD7 AON (e.g., oral administration) or via a different route (e.g., per i.v.).
[0838] Additional IBD treatments that can be administered in the methods provided herein in combination with the SMAD7 AON include, without limitation, one or more of the following aminosalicylates, antibiotics, steroids, immunomodulators, or inflammatory cytokine antagonists, or combinations thereof:
[0839] Aminosalicylates
[0840] In some embodiments, the additional IBD treatment comprises an aminosalicylate.
[0841] In some embodiments, the additional IBD treatment comprises 5-aminosalicylic acid (5-ASA or mesalamine), sulfasalazine, balsalazide, or olsalazine.
[0842] In some embodiments, the additional IBD treatment comprises 2-hydroxy-4-(4-(5-(2-methyl-3-phenylprop-2-enylidene)-4-oxo-2-sulfanylidene-1,3-thiazolidin-3-yl)butanoylamino)benzoic acid, 2-methoxy-5-amino-N-hydroxybenzamide, 3-methoxysalicylamine, 4-(N-(4-cyclohexylbenzyl)-2-(N,2,4,6-tetramethylphenylsulfonamido)acetamido)-2-hydroxybenzoic acid, 5-(7-hydroxy-3-O-phosphonocholyl)aminosalicylic acid, 5-aminomethylsalicylic acid, 5-aminosalicyl-glycine, 5-aminosalicyltaurine, acetyl 4-aminosalicylic acid, acetyl-4-dimethylaminosalicylic acid, acetyl-5-aminosalicylic acid, aminosalicylic acid, dersalazine, dextran-5-aminosalicylic acid, Dolo-Menthoneurin, ipsalazide, 2-hydroxy-5-(N-((2,5-dihydroxyphenyl)methyl)amino)benzoic acid 3-phenylpropyl ester, methyl 5-aminosalicylate, N-acetyl-5-aminosalicylic acid, N-glucopyranosyl-5-aminosalicylic acid, N-methacryloyl-5-aminosalicylic acid, N,N-bis(5-aminosalicyl)cysteine, NO-mesalamine, NSC 74859, olsalazine-O-sulfate, pasiniazide, phenyl 4-aminosalicylate, diethylamine salicylate, or UR 12746.
[0843] In some embodiments, the additional IBD treatment comprises a compound related to sulfasalazine, such as homosulfasalazine, methylsulfasalazine, salazodimethoxine, salazodin, salicylazoiminopyridine, susalimod, or TL-118.
[0844] Antibiotics
[0845] In some embodiments, the additional IBD treatment comprises an antibiotic. In some embodiments, the additional IBD treatment comprises a penicillin, a cephalosporin, a polymyxin, a rifampicin, a lipiarmycin (fidaxomicin), a quinolone, a sulfonamide, a macrolide, a lincosamide, a tetracycline, a aminoglycoside, a cyclic lipopeptide, a glycylcycline, or an oxaindole.
[0846] In some embodiments, the additional IBD treatment comprises a penicillin, such as benzylpenicillin, phenoxymethylpenicillin, benzathine benzylpenicillin, benzathine phenoxymethylpenicillin, penicillin G, penicillin G procaine, penicillin V, carfecillin, ampicillin, pivampicillin, carbenicillin, amoxicillin, carindacillin, bacampicillin, pivmecillinam, azlocillin, mezlocillin, piperacillin, ticarcillin, talampicillin, sulbenicillin, hetacillin, propicillin, pheneticillin, dicloxacillin, cloxacillin, meticillin, oxacillin, flucloxacillin, biapenem, apalcillin, aspoxicillin, ciclacillin, clemizole penicillin, imipenem, lenampicillin, nafcillin, or panipenem.
[0847] In some embodiments, the additional IBD treatment comprises a cephalosporin, such as cefatrizine, cefamandole, cefuzoname, cefpimizole, cephapirin, cephaloridine, cefsulodin, cefotiam, ceforanide, ceftexzole, cefoxitin, latamoxef, flomoxef, cefmetazole, cefotetan, cefpiramide, cephaloglycin, cephalexin, cefadroxil, cefroxadine, ceferadine, cefacloror, or cefoperazone.
[0848] In some embodiments, the additional IBD treatment comprises a polymyxin, such as polysporin, neosporin, polymyxin B, polymyxin E, polymyxin S, or polymyxin T.
[0849] In some embodiments, the additional IBD treatment comprises a rifampicin, such as 18,19-dihydrorifampicin, 21-(O-phosphoryl)rifampicin, 23-(O-(beta-glucopyranosyl))rifampicin, 23-(O-ribofuranosyl)rifampicin, 25-deacetylrifampicin, 25-desacetylrifapentine, 3-formyl-21-(0-phosphoryerifamycin SV, 3-formyl-23-(O-(beta-glucopyranosyl))rifamycin SV, 3-formyl-23-(O-ribofuranosyl)rifamycin SV, CGP 43371, CGS 24565, cotrifazid, dehydrorifampicin, DMB-rifampicin, Myrin P, rifamazid, rifampicin N-oxide, rifapentine, Rifaprim, rivicycline, or Sinerdol EH.
[0850] In some embodiments, the additional IBD treatment comprises a quinolones, such as cinoxacin, nalidixic acid, oxolinic acid, piromidic acid, pipemidic acid, rosoxacin, ciprofloxacin, enoxacin, fleroxacin, lomefloxacin, nadifloxacin, norfloxacin, ofloxacin, pefloxacin, rufloxacin, balofloxacin, grepafloxacin, levofloxacin, pazufloxacin, sparfloxacin, temafloxacin, tosufloxacin, clinafloxacin, gatifloxacin, gemifloxacin, moxifloxacin, sitafloxacin, trovafloxacin, prulifloxacin, delafloxacin JNJ-Q2, or nemonoxacin.
[0851] In some embodiments, the additional IBD treatment comprises an antibacterial sulfonamide, such as sulfacetamide, sulfadiazine, sulfadimidine, sulfafurazole, sulfisomidine (sulfaisodimidine), sulfadoxine, sulfamethoxazole, sulfamoxole, sulfadimethoxine, sulfamethoxypyridazine, sulfametoxydiazine, sulfadoxine, or sulfametopyrazine.
[0852] In some embodiments, the additional IBD treatment comprises a macrolide, such as azithromycin, clarithromycin, erythromycin, telithromycin, carbomycin A, josamycin, kitasamycin, midecamycin/midecamycin acetate, oleandomycin, solithromycin, spiramycin, troleandomycin, or tylosin/tylocine.
[0853] In some embodiments, the additional IBD treatment comprises a lincosamide, such as 7-azido-7-deoxylincomycin, 7-deoxylincomycin, antibiotic Bu 2545, chloramlincomycin, Clindamycin, Linco-HAP, lincomycin sulfone, lincomycin sulfoxide, lincospectin, sparsolincomycin, Stomapin, dl-N-ethylclindamycin, mirincamycin, pirlimycin, or pirlimycin adenylate.
[0854] In some embodiments, the additional IBD treatment comprises a tetracyline antibiotic, such as tetracycline, chlortetracycline, oxytetracycline, demeclocycline, semi-synthetic, lymecycline, meclocycline, methacycline, minocycline, or rolitetracycline.
[0855] In some embodiments, the additional IBD treatment comprises an aminoglycoside antibiotic, such as genatmicin, kanamycin A, amikacin, tobramycin, dibekacin, gentamicin, sisomicin, netilmicin, neomycins B and C, neomycin E (paromomycin), or streptomycin.
[0856] In some embodiments, the additional IBD treatment comprises a cyclic lipopeptide antibiotic such as daptomycin and battacin.
[0857] In some embodiments, the additional IBD treatment comprises a glycylcycline such as tigecycline.
[0858] In some embodiments, the additional IBD treatment comprises an oxazolidinone, such as linezolid, posizolid, torezolid, tedizolid, radezolid, or cycloserine.
[0859] In some embodiments, the additional IBD treatment comprises a benzoyl peroxide, rifaximin, clofazimine, isoniazid, tinidazole, vancomycin, or metronidazole.
[0860] Steroids
[0861] In some embodiments, the additional IBD treatment comprises a steroid, e.g., a corticosteroid.
[0862] In some embodiments, the additional IBD treatment comprises a corticosteroid, such as budesonide, dexamethasone (e.g., 21-acetate), betamethasone (e.g., 17-valerate), tixocortol pivalate, triamcinolone, triamcinolone (e.g., acetonide, acetonide 21-palmitate, diacetate, or hexacetonide), mometasonc, amcinonide, desonide, fluocinonide, halcinonide, fluocortolonc, hydrocortisone, fluticasone propionate, mometasone furo tate, prednisone, prednisolone, beclomethasone (e.g., dipropionate (e.g., monohydrate)), flunisolide, or methylprednisolone (e.g., acetate or sodium succinate).
[0863] In some embodiments, the additional IBD treatment comprises a corticosteroid, such as 6-hydroxydexamethasone, 9-fluorocortisone, a clobetasol (e.g., propionate), a clobetasone, a clocortolone (e.g., pivalate), a cortisone (e.g., acetate), a dichlorisone, a diflorasone (e.g., diacetate), diflucortolone, doxibetasol, flucmolone, a flumethasone (e.g., pivalate), a fluocinolone (e.g., acetonide), fluorohydroxyandrostenedione, a fluorometholone (e.g., acetate), fluoxymesterone, flupredidene, fluprednisolone, halometasone, halopredone, hydrocortisone, a isoflupredone (e.g., acetate), meclorisone, or a paramethasone (e.g., acetate).
[0864] Immunomodulators
[0865] In some embodiments, the additional IBD treatment comprises an immunomodulator, e.g., an immunosuppressant. In some embodiments, the additional IBD treatment comprises an immunomodulator, such as purine analog (e.g., azathioprine (AZA) and 6-mercaptopurine (6-MP)), a folic acid analogs (e.g., methotrexate (MTX)), a pyrimidine analogs (e.g., fluorouracil), or a cytotoxic antibiotic (e.g., dactinomycin, mitomycin C, bleomycin, mithramycin, anthracycline, and minocycline). In some embodiments, the additional IBD treatment comprises an immunomodulator, such as tacrolimus, mitoxantrone, cyclophosphamide, mycophenolate mofetil, or rapamycin.
[0866] Inflammatory Cytokine Antagonists
[0867] In some embodiments, the additional IBD treatment comprises an inflammatory cytokine antagonist, e.g., a tumor necrosis factor (TNF) antagonist or an IL-10 antagonist. In some embodiments, the additional IBD treatment comprises an inflammatory cytokine antagonist, such as infliximab, adalimumab, certolizumab pegol, vedolizumab, golimumab, etanercept, pentoxifylline, or bupropion.
[0868] In some embodiments of the methods provided herein, the additional IBD treatment has been administered to the patient prior to the first administration of the SMAD7 AON. In some embodiments, the patient has discontinued the additional IBD treatment prior to the first administration of the SMAD7 AON, e.g., more than 1 week, more than 2 weeks, more than 4 weeks, more than 6 weeks, more than 8 weeks, more than 3 months, more than 6 months, more than 9 months, more than 1 year, more than 1.5 years, more than 2 years, more than 3 years, more than 4 years, or more than 5 years prior. In some embodiments, the additional IBD treatment is administered to the patient during the first and/or second treatment period. In some embodiments, the additional IBD treatment is tapered during the first and/or second treatment period. In some embodiments, the additional IBD treatment is completely tapered at the end of the first treatment period. In some embodiments, the additional IBD treatment is a corticosteroid, the corticosteroid was administered to the patient prior to the SMAD7 AON and the corticosteroid is tapered completely at the end of the first treatment period.
[0869] In some embodiments, the additional IBD treatment is a corticosteroid, the corticosteroid was administered to the patient prior to the SMAD7 AON and the corticosteroid is tapered completely at the end of the observation period after the first and/or second treatment period.
6.1.6 Tapering
[0870] In some embodiments, the patient having IBD is tapering off one or more additional IBD treatments (other than the anti-SMAD7 therapy; e.g., a corticosteroid) during the first treatment period and/or the second treatment period. In some embodiments, the patient having IBD receives a corticosteroid at the beginning of the first treatment period and is partially or completely tapering off the corticosteroid during the first treatment period and/or the second treatment period. In some embodiments, the patient shows corticosteroid-free clinical remission at the end of the first or the second treatment period.
[0871] In some embodiments, the patients having IBD receives a corticosteroid at the beginning of the first treatment period and is partially or completely tapering off the corticosteroid during the observation period after the first and/or second treatment period.
[0872] In some embodiments, the patient having IBD is administered with one or more additional IBD treatments during some or all of the first treatment period. In some embodiments, the IBD patient is tapering off one or more additional IBD treatments during the first treatment period. In some embodiments, the IBD patient is tapering off a corticosteroid during the first treatment period (e.g., prednisone). In some embodiments, the IBD patient tapers off an additional IBD treatment comprising a corticosteroid, an aminosalicylate, a budesonide, or an immunosuppressant. In some embodiments, the IBD patient tapers off a corticosteroid. In some embodiments, the IBD patient tapers off the additional IBD treatment during the last 1 week, the last 2 weeks, the last 3 weeks, the last 4 weeks, the last 5 weeks, the last 6 weeks, the last 7 weeks, the last 8 weeks, the last 9 weeks, or the last 10 weeks of the first treatment period. In some embodiments, the IBD patient tapers off one or more additional IBD treatments completely during the first treatment period (the one or more additional IBD treatments are no longer administered to the IBD patient at the end of the first treatment period). In some embodiments, the IBD patient tapers off one or more additional IBD treatment partially during the first treatment period (the IBD patient is administered with one or more additional IBD treatments at a lower dose at the end of the first treatment period than at the beginning of the first treatment period).
[0873] In some embodiments, the IBD patient tapers off one or more additional treatments during some or all of the second treatment period. In some embodiments, the IBD patient tapers off one or more additional treatments at least during the first week, second week, third week, fourth week, fifth week, sixth week, seventh week, eighth week, ninth week, or tenth week of the second treatment period.
[0874] In some embodiments, tapering off comprises reducing the dose (e.g., daily, weekly, monthly dose) of an additional IBD treatment every 1 day, every 2 days, every 3 days, every 4 days, every 5 days, every 6 days, every 1 week, every 10 days, every 2 weeks, or every 4 weeks.
[0875] In some embodiments, tapering off comprises reducing the dose (e.g., daily, weekly, monthly dose) of an additional IBD treatment in increments of at least about 1%, at least about 3%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, or at least about 30%, at least about 40%, or at least about 50%.
[0876] In some embodiments, tapering off comprises reducing the dose (e.g., daily, weekly, monthly dose) of an additional IBD treatment in increments of at least 1 mg, at least 2 mg, at least 3 mg, at least 4 mg, at least 5 mg, at least 6 mg, at least 7 mg, at least 8 mg, at least 9 mg, or at least 10 mg.
[0877] In some embodiments, the additional IBD treatment is a corticosteroid (e.g., prednisone) administered to the patient having IBD at a daily dose of >10 mg and tapering off comprises reducing the daily dose once a week by about 5 mg until a dose of 10 mg/day is reached and then further reducing the daily dose once a week by about 2.5 mg until discontinuation.
[0878] In some embodiments, the additional IBD treatment is a corticosteroid (e.g., prednisone) administered to the patient having IBD at a daily dose of <10 mg and tapering off comprises reducing the daily dose once a week by about 2.5 mg until discontinuation.
[0879] In some embodiments, the additional IBD treatment is a corticosteroid (e.g., budesonide) administered to the patient having IBD and tapering off comprises reducing the daily dose once every 3 weeks by about 3 mg until discontinuation.
[0880] In some embodiments, the patient having IBD, who was administered with one or more additional treatments prior to the first treatment period, achieves remission without the one or more additional IBD treatments. In some embodiments, the patient having IBD achieves corticosteroid-free remission. In some embodiments, the patient having IBD achieves corticosteroid-free remission at week 24 of the second treatment period.
6.2 Monitoring Activities
[0881] In some embodiments, the methods described herein entail monitoring the treatment, disease state, or biomarkers associated with a disease state of a patient having IBD. Monitoring treatment may be useful in terms of assessing treatment efficacy and safety, as well as evaluating the need to modulate treatment. Monitoring treatment may also be useful for evaluating whether the amount of SMAD7 AON being administered to a patient or which will be administered to a patient should be increased or decreased. Furthermore, monitoring treatment may be useful in terms of determining the amount or relative amount by which a dose of SMAD7 AON should be modulated, i.e., increased or decreased.
[0882] In some embodiments, the methods provided herein further comprise monitoring the activity of the SMAD7 AON in the patient having IBD at one or more timepoints. The one or more timepoints can be, e.g., during the initial screening period, the first treatment period, the observation period, the second treatment period, the follow up period, the third treatment period, or combinations thereof. In some embodiments, the methods comprise monitoring the activity of the SMAD7 AON at one or more timepoint during the first, second and/or third treatment periods.
[0883] The one or more timepoints for monitoring can be during any week of any one or more of the initial screening period, the first treatment period, the observation period, the second treatment period, the follow up period, and the third treatment period. Each of the one or more timepoints can be at a set time before or after a given SMAD7 AON administration or it can coincide with the time of a SMAD7 AON administration.
[0884] In some embodiments, one timepoint of the one or more timepoints is at or around the beginning of the first treatment period (e.g., during first treatment periodweek 0). In some embodiments, one timepoint of the two or more timepoints is at or around the end of the first treatment period (e.g., during first treatment periodweek 4, week 8, or week 12). In some embodiments, one timepoint of the two or more timepoints is during week 12 of the first treatment period. In some embodiments, one timepoint of the two or more timepoints is at or around the beginning of the second treatment period (e.g., during second treatment periodweek 0). In some embodiments, one timepoint is at or around the end of the second treatment period (e.g., during second treatment periodweek 4, week 8, week 12, week 16, week 20, week 24, week 28, week 32, week 36, week 40, week 44, week 48, or week 52).
[0885] In some embodiments, one timepoint of the two or more timepoints is during week 24 of the second treatment period. In some embodiments, one timepoint of the two or more timepoints is during week 52 of the second treatment period. In some embodiments, one timepoint of the one or more timepoints is at or around the beginning of the third treatment period (e.g., during the third treatment periodweek 0). In some embodiments, one timepoint of the two or more timepoints is at or around the end of the third treatment period (e.g., during the third treatment periodweek 4, week 8, week 12, week 24, week 52, week 104, or week 208). In some embodiments, one timepoint of the two or more timepoints is during week 208 of the third treatment period.
[0886] Monitoring, for example, monitoring of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels in a patient having IBD, may commence prior to, during, or after an initial dose of a SMAD7 AON. Furthermore, monitoring may continue after an initial dose. For example monitoring may be performed after administration of an initial dose. Monitoring may also be performed before, during, or after a subsequent dose of SMAD7 AON. Monitoring may be continuous or discontinuous such that monitoring may be performed at regular intervals, for example, after each dose of a SMAD7 AON is administered to a patient, before each dose of a SMAD7 AON is administered to a patient, or before and after each dose of a SMAD7 AON is administered to a patient. Monitoring may be performed multiple times in a single day (for instance, 2 times, 3 times, 4 times, about five times, or about 10 times in a single day), once a day, multiple times in a single week (for instance, 2 times, 3 times, 4 times, about five times, or about 10 times in a single week), once a week, multiple times in a single month (for instance, 2 times, 3 times, 4 times, about five times, or about 10 times in a single month), or once a month. In methods of the invention, monitoring may be performed at various times relative to an administering step. For instance, in some embodiments, monitoring may be performed immediately after, or at least 1 day, at least 3 days, at least 5 days, at least 1 week, at least 2 weeks, at least 3 weeks, at least 1 month, at least 2 months, at least 4 months, or at least 6 months after an administration step.
[0887] As described above, the invention is based in part on the discovery that levels of CCL20 can be used to evaluate and modify management and treatment with a SMAD7 AON in a patient having IBD. Thus, in embodiments of the invention, it is useful to know, determine, analyze, or compare levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 in a patient or a sample from a patient having IBD. For example, in some instances it will be useful to know a threshold value for normal or abnormal levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 in order to determine whether levels of the SMAD7 AON should be increased, decreased, or left untouched. In the methods described herein, a normal level of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 may be tied to a specific value. In some embodiments, a normal level of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 may be determined by comparison to median levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 in a healthy control group that is matched to the patient with respect to various factors, for example, age, gender, ethnic origin, smoking habits, dietary habits, body-mass index (BMI), and/or exercise habits.
[0888] Levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 and/or other analytes may be determined by obtaining a sample from the patient. According to the methods described herein, a sample may be a tissue sample (e.g., a gastrointestinal tissue sample) or a bodily fluid sample (e.g., a saliva sample, a stool, or a urine sample). A sample can be a sample obtained from a patient tissue biopsy, for example, a mucosal tissue biopsy, for example, an intestinal mucosal tissue biopsy. Furthermore, the sample may be a blood, serum, or plasma sample. A sample may be a fecal sample. A blood sample from a subject may be obtained using techniques well-known in the art. Blood samples may include peripheral blood mononuclear cells (PMBCs), RBC-depleted whole blood, or blood serum. PBMCs can be separated from whole blood samples using different density gradient (e.g., Ficoll density gradient) centrifugation procedures. For example, whole blood (e.g., anticoagulated whole blood) is layered over the separating medium and centrifuged. At the end of the centrifugation step, the following layers are visually observed from top to bottom: plasma/platelets, PBMC, separating medium and erythrocytes/granulocytes.
[0889] Methods of monitoring treatment may also include methods of monitoring other factors, including, but not limited to levels of other analytes (e.g., IL8, CRP, TNF), CDAI score, clinical remission, and presence or severity of IBD symptoms.
[0890] In embodiments of the invention where levels of an analyte (e.g., IL-10, FCP, IL-5, IL-13, IL-25, or REG3) are measured, various methods may be used to measure the analyte. For example, the level of an analyte, for example, IL-10, IL-5, IL-13, IL-25, REG3, CCL20, IL8, TNF, FCP or CRP, may be determined by immunochemistry and/or by nucleotide analysis. Methods of determining analyte concentration by immunochemistry include, but are not limited to, Western blotting, ELISA, and immunostaining methods. In some embodiments, a method of determining analyte concentration by immunochemistry is performed using an antibody that can bind to the analyte of interest, for instance, an anti-IL-10 antibody, an anti-FCP antibody, an anti-IL-5 antibody, anti-IL-13 antibody, anti-IL-25 antibody, or anti-REG3 antibody. Methods of determining analyte concentration by immunochemistry may also involve the use of buffers, blocking reagents, unconjugated primary antibodies, and primary and/or secondary antibodies conjugated to tags that allow for antibody detection, such as fluorescent probes or substrate-specific enzymes.
[0891] Methods of determining analyte concentration by nucleotide analysis include, but are not limited to, methods of analyzing analyte mRNA transcript levels such as Northern blotting and polymerase chain reaction methods, for example, quantitative polymerase chain reaction methods. Nucleotide analysis may be performed using an oligonucleotide probe that binds an analyte nucleotide sequence (e.g., a IL-10, FCP, IL-5, IL-13, IL-25, or REG3 nucleotide sequence) or a pair of oligonucleotide primers capable of amplifying an analyte nucleotide sequence via a polymerase chain reaction, for example, by a quantitative polymerase chain reaction. Oligonucleotide probes and oligonucleotide primers may be linked to a detectable tag, such as, for example, a fluorescent tag. In determining analyte concentration by nucleotide analysis, the practitioner may evaluate a particular analyte's mRNA transcript concentration in a sample. Alternatively, in determining analyte concentration by nucleotide analysis, the practitioner may establish a correlation between a particular analyte's mRNA transcript abundance and the particular analyte's protein abundance in order to extrapolate analyte protein concentration based on a measure of analyte mRNA transcript abundance.
[0892] Methods of the claimed invention include steps that may be carried out in vitro. For instance, it is contemplated that the steps of measuring IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels in the subject, determining the levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 in a sample, and/or determining CDAI score or taking measurements necessary to determine CDAI score may be carried out in vitro. For example, the level of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 in a sample may be determined by performing immunochemistry or nucleotide analysis on the sample in vitro. Alternatively, in some embodiments of the invention, the steps of determining and analyzing the IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels in a patient having IBD, determining and analyzing the IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels in a sample, and/or determining CDAI score or taking measurements necessary to determine CDAI score may be carried out in vivo.
[0893] Anti-IL8 antibodies suitable for immunochemistry are commercially available, including, but not limited to, goat anti-human IL8 from Abcam (Cat. No. ab10769), mouse anti-human IL8 from Santa Cruz (Cat. Nos. sc-73321, sc-52870, and sc-7302), mouse anti-human IL8 (3IL8-H10) from Pierce (Cat. No. M801), and a mouse anti-human IL8 from Sigma-Aldrich (Cat. No. WH0003576M5) antibody.
[0894] Anti-TNF antibodies suitable for immunochemistry are commercially available, including, but not limited to, rabbit anti-human TNF from Abcam (Cat. No. ab9635), rabbit anti-human TNF from Cell Signaling Technology (Cat. No. 3707), mouse anti-human TNF from affymetrix eBioscience (Cat. No. 14-7348-81), and rabbit anti-human TNF from Rockland Antibodies & Assays (Cat. No. 209-401-306S) antibody.
[0895] Anti-CRP antibodies suitable for immunochemistry are commercially available, such as, for example, goat anti-human CRP polyclonal antibodies from Santa Cruz Biotechnology (Catalog Numbers sc-18304 and sc-18306), a rabbit anti-human CRP polyclonal antibody from from Santa Cruz Biotechnology (Catalog Number sc-30047), a mouse anti-human CRP monoclonal antibody from Santa Cruz Biotechnology (Catalog Number sc-70883), a mouse anti-human CRP monoclonal antibody from Sigma-Aldrich (Catalog Number C1688-.2ML), a rabbit anti-human monoclonal antibody from abeam (Catalog Number ab32412), a mouse anti-human CRP monoclonal antibody from abeam (Catalog Number ab13426), and a goat anti-human CRP polyclonal antibody from Thermo Scientific (Catalog Number G0301-1B).
[0896] Anti-CCL20 antibodies suitable for immunochemistry are commercially available, for example, a mouse anti-human CCL20 monoclonal antibody from R&D Systems (Catalog Number MAB360), a goat anti-human CCL20 polyclonal antibody from Sigma Aldrich (Catalog Number SAB2501804), a mouse anti-human CCL20 monoclonal antibody from Origene (Catalog Number TA316597), a goat anti-human CCL20 polyclonal antibody from Origene (Catalog Number TA316596), a goat anti-human CCL20 polyclonal antibody from Abnova (Catalog Number PAB17268), a rabbit anti-human CCL20 polyclonal antibody from Abnova (Catalog Number PAB16925), a mouse anti-human CCL20 monoclonal antibody from Abnova (Catalog Number MAB1314), a goat anti-human CCL20 polyclonal antibody from Santa Cruz Biotechnology (Catalog Number sc-9775), and a rabbit anti-human CCL20 polyclonal antibody from Abcam (Catalog Number ab9829).
[0897] Anti-FCP antibodies suitable for immunochemistry are commercially available, for example, a mouse anti-human calprotectin monoclonal antibody from Hycult Biotech (Catalog Number HM2156).
[0898] Anti-IL-5 antibodies suitable for immunochemistry are commercially available, for example, a rabbit anti-human IL-5 antibody from Abcam (Catalog Number ab9624).
[0899] Anti-IL-13 antibodies suitable for immunochemistry are commercially available, for example, a rabbit anti-human IL-13 antibody from PeproTech (Catalog Number 500-P13).
[0900] Anti-IL-25 antibodies suitable for immunochemistry are commercially available, for example, mouse and rabbit anti-human IL-25 antibodies from Novus Biologicals (Catalog Numbers AF1147, NBP1-98493, H00056005-M03, NBP1-98494, and H00056005-B01P).
[0901] Anti-REG3 antibodies suitable for immunochemistry are commercially available, for example, rabbit anti-human REG3 antibodies from Thermo Scientific (Catalog Numbers PA5-23341, PA5-26219, and PA-28780).
[0902] Anti-IL-10 antibodies suitable for immunochemistry are commercially available, for example, a rabbit anti-human IL-10 antibody from Abcam (Catalog Number ab34843).
[0903] In some embodiments, IL-10, FCP, IL-5, IL-13, IL-25, or REG3 and/or other analyte concentration may be determined by Enzyme-linked immunosorbent assay (ELISA). Specifically, levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 and/or other analytes in a sample, especially a blood sample, for example, a blood serum sample, can be determined by ELISA. In some embodiments, levels of an analyte, for example, FCP, in a fecal sample can be determined by ELISA. Assaying analyte concentration by ELISA requires at least one antibody against the analyte protein, e.g., at least one anti-IL-10 antibody, anti-FCP antibody, anti-IL-5 antibody, anti-IL-13 antibody, anti-IL-25 antibody, or anti-REG3 antibody, and/or at least one secondary antibody, e.g., at least one labeled secondary antibody. In some embodiments, the primary antibody is labeled with, e.g., a fluorescent label. In certain embodiments, the primary antibody is not labeled and a secondary antibody capable of binding the species isotype of the primary antibody is labeled, e.g., with a fluorescent probe or enzyme capable of reacting with a specific substrate, thereby providing a detectable signal.
[0904] Performing an ELISA requires at least one capture antibody, at least one detection antibody, and/or at least one enzyme-linked or fluorescent labeled secondary antibody. For example, assaying IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels by ELISA may require an anti-IL-10 antibody, an anti-FCP antibody, an anti-IL-5 antibody, anti-IL-13 antibody, anti-IL-25 antibody, or anti-REG3 antibody as the capture antibody. The anti-IL-10 antibody, anti-FCP antibody, anti-IL-5 antibody, anti-IL-13 antibody, anti-IL-25 antibody, or anti-REG3 antibody is immobilized on a solid support such as a polystyrene microtiter plate. A sample, for example, a blood serum sample is then added and allowed to complex with the bound antibody. Unbound serum components are removed with a wash. A detection antibody, e.g., a different anti-IL-10 antibody, anti-FCP antibody, anti-IL-5 antibody, anti-IL-13 antibody, anti-IL-25 antibody, or anti-REG3 antibody, e.g., an anti-IL-10 antibody, anti-FCP antibody, anti-IL-5 antibody, anti-IL-13 antibody, anti-IL-25 antibody, or anti-REG3 antibody that binds to a different portion of the IL-10, FCP, IL-5, IL-13, IL-25, or REG3 protein than the capture antibody, is added and is allowed to bind to the captured IL-10, FCP, IL-5, IL-13, IL-25, or REG3. The detection antibody is linked to a detectable tag, such as an enzyme, either directly or indirectly, e.g., through a secondary antibody that specifically recognizes the detection antibody. Typically between each step, the plate, with bound protein, is washed with a wash buffer, e.g., a mild detergent solution. Typical ELISA protocols also include one or morc blocking steps, which involve use of a non-specifically-binding protein such as bovine serum albumin to block unwanted non-specific binding of protein reagents to the plate. After a final wash step, the plate is developed by addition of an appropriate enzyme substrate, to produce a visible signal, which indicates the amount of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 protein in the sample. The substrate can be, e.g., a chromogenic substrate or a fluorogenic substrate. ELISA methods, reagents and equipment are well-known in the art and commercially available.
[0905] In some embodiments, levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 and/or other analytes may be determined by performing a nucleotide analysis. A nucleotide analysis may include analysis of analyte nucleotide transcript levels (e.g., IL-10, FCP, IL-5, IL-13, IL-25, or REG3 mRNA transcript levels) in a sample, for example, a blood sample. Analyte transcript levels may be determined by Northern blot, for example, a quantitative Northern blot; or polymerase chain reaction, for example, a quantitative polymerase chain reaction. Reagents necessary to perform Northern blot include oligonucleotide probes, for example, oligonucleotide probes linked to a detectable label. Detectable labels may include fluorescent labels or enzymes capable of reacting with a specific substrate. Reagents necessary to perform polymerase chain reaction include oligonucleotide primers capable of specifically binding to a particular analyte mRNA transcript and amplifying the number of analyte mRNA transcripts by polymerase chain reaction. Oligonucleotide primers may be linked to a detectable label to enable, for example, quantitative polymerase chain reaction. Other reagents necessary to perform quantitative polymerase chain reaction include, but are not limited to, primers capable of amplifying a control transcript signal, for instance, a beta tubulin transcript signal. Buffers, reagents (including oligonucleotide primers and probes), techniques, and equipment necessary for performing Northern blotting and polymerase chain reactions are readily available and are well-known in the art.
[0906] The invention described herein provides methods of treating patients in part by selecting patients that show some likelihood of responsiveness to SMAD7-antisense therapy. Likeliness of responsiveness to anti-SMAD7 therapy is premised in part on determining levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 in a patient with IBD, for example, preexisting levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 (i.e., levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 in a patient prior to administration of an initial dose of a SMAD7 AON) or levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 determined after an initial dose or one or more subsequent doses of SMAD7 AON. For instance, in some embodiments of the invention, a patient will be selected for treatment or further treatment with a SMAD7 AON after detecting or analyzing absolute or relative IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels or changes in IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels. Levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 in a patient with IBD may be compared to a normal level of IL-10, FCP, IL-5, IL-13, IL-25, or REG3, for example, normal levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 as defined by median IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels in a matched control group or absolute levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3.
[0907] In some embodiments, a patient will be selected for treatment or further treatment with a SMAD7 AON if the levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 in the patient are more than 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% elevated relative to the average, median or mean levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 in a matched control group.
[0908] In some embodiments, a patient will be selected for treatment or further treatment with a SMAD7 AON if the level of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 in the patient are more than 2-fold, more than 3-fold, more than 4-fold, more than 5-fold, more than 6-fold, more than 7-fold, more than 8-fold, more than 9-fold or more than 10-fold elevated relative to the average, median or mean levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 in a matched control group.
[0909] Typically IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels will be measured in terms of a concentration, for instance, mass of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 protein, peptide, or RNA per volume of sample, for example, volume of blood or tissue. Thus selection of patients for initial or continued treatment is tied to IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels in the patient, such that, for example, high initial levels of TL-10, FCP, TL-5, IL-13, IL-25, or REG3 may indicate a potential for responsiveness to SMAD7 AON treatment. Furthermore, high levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 (i.e., above normal levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3) may indicate a need for increased doses of SMAD7 AON, whereas normal or below normal levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 may indicate a need for decreased or unchanged doses of SMAD7 AON, especially following one or more doses. Alternatively, continued levels of above normal levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 after repeated doses may indicate that the patient is not responsive to treatment.
[0910] Thus, if levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 are above normal levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3, a patient may be administered an initial and/or subsequent dose of SMAD7 AON. In some embodiments, IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels are already known to be above normal IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels prior to administration of an initial dose. In some embodiments, IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels in a patient with IBD will be determined prior to administration of an initial dose. In some embodiments, after an initial dose of SMAD7 AON, if IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels are analyzed and determined to be above normal levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3, the patient will be administered a subsequent dose of SMAD7 AON, for instance a greater dose than the initial dose or a dose equal to the initial dose. Alternatively, if IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels are analyzed and determined to be below normal levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3, the patient may be administered a subsequent dose of SMAD7 AON, for instance an equal or smaller dose than the initial dose.
[0911] In yet other embodiments, IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels may be analyzed and determined in a patient with IBD, and then an initial dose of SMAD7 AON may be administered to the patient if the IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels are above normal levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3. Furthermore, in some embodiments, after an initial dose of SMAD7 AON, levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 may be determined, and if the levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 are above normal levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 then a subsequent dose of SMAD7 AON that is greater than or equal to the initial dose may be administered to the patient. Alternatively, after an initial dose of SMAD7 AON, levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 may be determined, and if the levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 are below normal levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 then a subsequent dose of SMAD7 AON that is smaller than or equal to the initial dose may be administered to the patient.
[0912] In yet other embodiments, the invention provides methods whereby: IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels may be analyzed and determined in a patient with IBD; an initial dose of SMAD7 AON may be administered to the patient if the IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels are above normal levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3; the levels of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 are analyzed after the initial administration; and if the level of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 after the initial dose is administered is lower than the level of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 before the initial dose is administered, then the patient is administered a subsequent dose that is the same as the initial dose or smaller than the initial dose. Alternatively, if the level of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 is unchanged or increased after the initial dose is administered compared to the level of IL-10, FCP, IL-13, IL-25, or REG3 before the initial dose is administered, then the patient is administered a subsequent dose that is the same as the initial dose or greater than the initial dose or treatment is terminated.
[0913] Thus, the contemplated invention provides different methods for treating and managing IBD in a patient by accounting for multiple treatment scenarios based on analysis and determination of IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels and patient responsiveness to SMAD7 AON administration.
[0914] For instance, if after administration of a SMAD7 AON IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels in a patient are above normal IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels, treatment can continue at the same dose or at an increased dose of the SMAD7 AON.
[0915] If after administration of a SMAD7 AON IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels in a patient are below normal IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels, treatment can continue at the same dose or at a decreased dose of the SMAD7 AON.
[0916] If after an initial dose and one or more subsequent doses of a SMAD7 AON IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels continue to be above or below normal IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels, the treatment may be terminated. For example, treatment may be terminated either because the patient is in remission, because the patient is not responsive to treatment, or the patient has been administered the maximum tolerated dose.
[0917] In some instances, if IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels decrease in a patient following one or more doses of the SMAD7 AON, this may indicate that a patient is responsive to treatment. In these patients, subsequent doses of the SMAD7 AON may be administered but at the same dose or a smaller dose compared to the previous dose(s).
[0918] In some instances, if IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels are stable or increase following an initial or one or more subsequent doses of the SMAD7 AON, this may indicate that a patient is not responsive to treatment. In these patients, subsequent doses of the SMAD7 AON may be administered but at a greater dose compared to the previous dose(s). Alternatively, the treatment can be discontinued, for example, if the dose approaches the maximum tolerated dose.
[0919] In some instances, if a patient achieves clinical remission, as determined by clinical factors other than IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels, but IL-10, FCP, IL-5, IL-13, IL-25, or REG3 levels remain essentially unchanged or above normal after administration of a SMAD7 AON, then the SMAD7 AON treatments may be terminated. In such a case, IL-10, FCP, IL-5, IL-13, IL-25, or REG3, levels may not be indicative of IBD progression, but may be elevated due to other factors, e.g., another inflammatory disease.
[0920] In some embodiments, a baseline (e.g., a baseline score, level, or value) is analyzed at a timepoint during the first week (e.g., week 0) of the first treatment period. In some embodiments, the baseline is analyzed prior to the first administration of the anti-SMAD7 therapy (e.g., at least 1 week, at least 2 weeks, at least 4 weeks, at least 6 weeks, at least 2 months, at least 3 months, at least 6 months, at least 9 months, at least 1 year, at least 3 years, or at least 5 years prior). In some embodiments, the baseline is analyzed during a chronic phase of IBD (flare up), e.g., prior to the first administration of an anti-SMAD7 therapy. In some embodiments, the baseline is analyzed when the patient is on remission (e.g., while receiving a previous IBD treatment, which can be an IBD treatment other than an anti-SMAD7 therapy). In some embodiments, the baseline is an average score from several timepoints prior to treatment.
[0921] In some embodiments, monitoring the activity of the SMAD7 AON in the patient having IBD comprises determining a timepoint, e.g., during the first, second and/or third treatment periods when the patient having IBD shows a response to the SMAD7 AON (e.g., decrease of SES-CD score from baseline 25% or 50%; decrease of CDAI score from baseline 100 points; decrease of PRO-2 score from baseline 8 points; decrease of average daily liquid or soft stool frequency score from baseline of 1 point, and/or decrease of abdominal pain score from baseline 1 point, decrease of TMS score from baseline 30% and 3 points; decrease of ES subscore from baseline 1; decrease of PMS score from baseline 25% and 2 points; or decrease of MMS score from baseline 25% and 2 points).
[0922] In some embodiments, monitoring the activity of the SMAD7 AON in the patient having IBD comprises determining a timepoint, e.g., during the first, second and/or third treatment periods when the patient having IBD experiences remission (e.g., SES-CD score 2; CDAI score 150; PRO-2 score 8; abdominal pain score 1 and/or average daily liquid or soft stool frequency 1.5; TMS score 2 points; ES subscorc=0; PMS score 2 or MMS score 2).
[0923] In some embodiments, monitoring the activity of the SMAD7 AON in the patient having IBD comprises analyzing an endoscopic outcome, a clinical activity parameter, a safety or tolerability parameter, a biomarker of intestinal inflammation or tissue damage, a histological score, expression of a biomarker in an intestinal mucosal biopsy, or the systemic exposure of the SMAD7 AON in the patient having IBD.
[0924] In some embodiments, monitoring the activity of the SMAD7 AON in the patient having IBD comprises analyzing Quality Of Life (QOL) and Health Economics Assessments (HEA) (e.g., Medical Outcome Study Short Form 36-item Health Survey, Version 2 (SF-36 v2); IBD Questionnaire; Work Productivity and Activity impairment Questionnaire for CD (WPAI-CD); European Quality of Life-5 Dimensions Questionnaire (ED-5D); Harvey-Bradshaw Index (HBI)).
[0925] In some embodiments, monitoring the activity of the SMAD7 AON in the patient having IBD comprises analyzing endoscopy (e.g., colonoscopy, flexible rectosignoidoscopy) and interstinal mucosal biopsy, Total Mayo Score (TMS), Partial Mayo Score (PMS), Modified Mayo Score (MMS).
[0926] In some embodiments, analyzing the endoscopic outcome comprises analyzing the Simple Endoscopic Score for Crohn's disease (SES-CD). In some embodiments, the SES-CD is analyzed at a timepoint during week 4 or week 12 of the first treatment period. In some embodiments, analyzing the SES-CD comprises analyzing the presence and size of ulcers, the extent of ulcerated surface, the extent of affected surface, or the presence and type of narrowings in the ileum, the right colon, the transverse colon, the left colon, the rectum, or in a combination or all of the listed colon regions.
[0927] In some embodiments, the SES-CD is analyzed at a timepoint during week 4, week 8, week 12, week 16, week 20, week 24, week 28, week 32, week 36, week 40, week 44, week 48, or week 52 of the second treatment period. In some embodiments, the SES-CD is analyzed at a timepoint during week 4, week 8, week 12, week 24, week 36, week 52, week 104, week 156, week 208 of the third treatment period.
[0928] In some embodiments, analyzing the SES-CD comprises analyzing an absolute SES-CD. In some embodiments, analyzing the SES-CD comprises analyzing changes in SES-CD from baseline (e.g., SES-CD increases or decreases).
[0929] In some embodiments, SES-CD variables are defined according to Table 1.
TABLE-US-00001 TABLE 1 Exemplary Definition of SES-CD Variables SES-CD Values Variable 0 1 2 3 Size of None Aphthous ulcers Large ulcers Very large ulcers ulcers (Diameter: 0.1 (Diameter: 0.5 (Diameter: >2.0 to 0.5 cm) to 2.0 cm) cm) Ulcerated None <10% 10%-30% >30% surface Affected Unaffected <50% 50%-75% >70% surface segment Presence of None Single, can Multiple, can Cannot be narrowing be passed be passed passed
[0930] In some embodiments, the patient having IBD shows a response to the SMAD7 AON if the SES-CD is reduced 25% or 50% from baseline. In some embodiments, the patient having IBD shows a response to the SMAD7 AON if the SES-CD is reduced by 4 points relative to baseline. In some embodiments, the baseline SES-CD is the SES-CD at or around the beginning of the first treatment period, e.g., at a timepoint during week 0.
[0931] In some embodiments, the patient having IBD experiences remission if the SES-CD<2.
[0932] In some embodiments, the endoscopic outcome comprises mucosal healing. In some embodiments, mucosal healing comprises the absence of ulceration. In some embodiments, mucosal healing is analyzed at a timepoint during week 12 of the first treatment period.
[0933] In some embodiments, the patient having IBD experiences mucosal healing if the SES-CD2.
[0934] In some embodiments, analyzing the histological scores comprises analyzing an absolute histological score from intestinal mucosa of the patient having IBD. In some embodiments, analyzing the histological score comprises analyzing changes in the histological score from intestinal mucosa of the patient having IBD from baseline. In some embodiments, analyzing the histological score comprises analyzing a change in the histological score from the intestinal mucosa of the patient having IBD from baseline at a timepoint during week 12 of the first treatment period.
[0935] In some embodiments, analyzing the histological score comprises analyzing a change in the histological score from the intestinal mucosa of the patient having IBD from baseline at a timepoint during week 12 or week 24 of the second treatment period. In some embodiments, analyzing the histological score comprises analyzing a change in the histological score from the intestinal mucosa of the patient having IBD from baseline at a timepoint during week 12, week 24, week 36, week 52, week 104, week 156, week 208 of the third treatment period.
[0936] In some embodiments, analyzing the endoscopic outcome comprises analyzing the Crohn's disease endoscopic index of severity (CDEIS).
[0937] In some embodiments, analyzing the clinical activity parameter comprises analyzing the Crohn's disease activity index (CDAI; range 0-600).
[0938] The CDAI is a useful measure in clinical studies evaluating the efficacy of new therapies in CD patients with predominantly inflammatory disease. This index is based, in part, on a self-assessment questionnaire completed by the subject. Self-assessment questionnaires are known in the art. The CDAI can assess how CD affects the subject's quality of life and the effect of treatment. CDAI determination can involve processing a self assessment questionnaire with patient responses scored numerically and weighted. Scores (range 0 to 600) are then ranked according to severity of the disease. Mild active disease can be defined by a score of 150 and 219, moderate active disease can be defined by a score of 220 and 450, whereas severe disease can be defined as a CDAI score >450. Remission can be defined as a CDAI score <150. CDAI determinations can consider a number of variables, including, e.g., number of liquid or soft stools per day (e.g., each day for 7 days), abdominal pain/cramps (e.g., each day for 7 days), general well-being (e.g., each day for 7 days), number of complications, such as, e.g., arthritis or arthralgias, iritis or uveitis, erythema nodosum, pyoderma gangrenosum, or aphthous ulcers, anal fissures, fistulae, or abscess, other fistula fever higher than 37.8 C. during previous week, taking loperamide, diphenoxylate, or opiates for diarrhea, abdominal mass, hematocrit of less than 0.47 in men and less than 0.42 in women, percentage of deviation above or below standard weight.
[0939] In some embodiments, analyzing the CDAI score comprises analyzing an absolute CDAI score. In some embodiments, analyzing the CDAI score comprises analyzing changes in CDAI score from baseline (e.g., CDAI score increases or decreases).
[0940] In some embodiments, the baseline CDAI is the CDAI at or around the beginning of the first treatment period, e.g., at a timepoint during week 0.
[0941] In some embodiments, the CDAI score is analyzed at one or more timepoints during the first, second and/or third treatment periods. In some embodiments, the CDAI is analyzed at the beginning of the first treatment period (e.g., at a timepoint during week 0 of the first treatment period) and at the end of the first treatment period (e.g., at a timepoint during week 4, week 8, or week 12 of the first treatment period). In some embodiments, the CDAI is analyzed at the beginning of the second treatment period (e.g., at a timepoint during week 0 of the second treatment period) and at the end of the second treatment period (e.g., at a timepoint during week 4, week 8, week 12, week 16, week 20, week 24, week 28, week 32, week 36, week 40, week 44, week 48, or week 52 of the second treatment period).
[0942] In some embodiments, the CDAI is analyzed at the beginning of the third treatment period (e.g., at a timepoint during week 0 of the third treatment period) and at the end of the third treatment period (e.g., at a timepoint during week 24, week 52, week 104, week 156, or week 208 of the third treatment period).
[0943] In some embodiments, analyzing the CDAI comprises analyzing the time to partial loss of response.
[0944] In some embodiments, the patient having IBD shows a clinical response to the SMAD7 AON if the CDAI is reduced 100 points from baseline. In some embodiments, the patient having IBD shows a clinical improvement if the absolute CDAI score is <180 and the CDAI score is reduced 70 points from baseline.
[0945] In some embodiments, the patient having IBD experiences remission if the CDAI<150.
[0946] In some embodiments, analyzing the clinical activity parameter comprises analyzing a Patient Reported Outcome (PRO). PROs analysis involves patients quantifying their own symptoms, which can be useful in assessing IBD severity. A two-item Patient Reported Outcome (PRO-2) for CD considers two CDAI variables, e.g., liquid or soft stool frequency and abdominal pain. Methods for determining PRO-2 scores are well known in the art. For example, a total PRO-2 score can be calculated based on information provided in a patient questionnaire or diary. Daily scores of liquid or soft stool frequency and abdominal pain, can be averaged over 7 days and weighted, e.g., using multiplication factors applied also during CDAI determinations. In some embodiments, PRO-2 values of 8, 14, and 34 points can correspond to CDAI scores of 150, 220, and 450 points and PRO-2 score changes from baseline of 2, 5, and 8 points can correspond to changes in CDAI scores of 50, 70, and 100 points.
[0947] In some embodiments, analyzing the clinical activity parameter comprises analyzing a two-item patient reported outcome (PRO-2) score.
[0948] In some embodiments, analyzing the PRO-2 score comprises analyzing an absolute PRO-2 score. In some embodiments, analyzing the PRO-2 score comprises analyzing changes in PRO-2 score from baseline (e.g., PRO-2 score increases or decreases).
[0949] In some embodiments, the baseline PRO-2 score is the PRO-2 score at or around the beginning of the first treatment period, e.g., at a timepoint during week 0.
[0950] In some embodiments, the PRO-2 score is analyzed at one or more timepoints during the first, second and/or third treatment periods. In some embodiments, PRO-2 is analyzed at a timepoint during week 2, week 4, week 8, or week 12 of the first treatment period. In some embodiments, PRO-2 is analyzed at a timepoint during week 4, week 8, week 12, week 16, week 20, week 24, week 28, week 32, week 36, week 40, week 44, week 48, or week 52 of the second treatment period.
[0951] In some embodiments, PRO-2 is analyzed at a timepoint during week 24, week 52, week 104, week 156, or week 208 of the third treatment period.
[0952] In some embodiments, analyzing PRO-2 comprises analyzing an average daily liquid stool, an average daily soft stool, or an average daily abdominal pain score.
[0953] In some embodiments, analyzing PRO-2 comprises analyzing the average daily liquid or soft stool frequency at a timepoint during the first, second and/or third treatment period. In some embodiments, analyzing PRO-2 comprises analyzing the average daily liquid or soft stool frequency at a timepoint during week 2, week 4, week 8, or week 12 of the first treatment period, during week 4, week 8, week 12, week 16, week 20, or week 24 of the second treatment period, or during week 24, week 52, week 104, week 156, or week 208 of the third treatment period.
[0954] In some embodiments, analyzing PRO-2 comprises analyzing the average daily abdominal pain score at a timepoint during the first, second and/or third treatment period. In some embodiments, analyzing PRO-2 comprises analyzing the average daily abdominal pain score at a timepoint during week 2, week 4, week 8, or week 12 of the first treatment period, during week 4, week 8, week 12, week 16, week 20, or week 24 of the second treatment period, or during week 24, week 52, week 104, week 156, or week 208 of the third treatment period.
[0955] In some embodiments, the patients having IBD achieve an average daily liquid or soft stool frequency 6, 5, 4, 3, 2, or 1 at a time point during week 2, week 4, week 8, or week 12 of the first treatment period, during week 4, week 8, week 12, week 16, week 20, week 24, week 24, week 28, week 32, week 36, week 40, week 44, week 48, or week 52 of the second treatment period, or during week 24, week 52, week 104, week 156, or week 208 of the third treatment period.
[0956] In some embodiments, the patients having IBD achieve an average daily abdominal pain score 3, 2, or 1 at a time point during week 2, week 4, week 8, or week 12 of the first treatment period, during week 4, week 8, week 12, week 16, week 20, week 24, week 28, week 32, week 36, week 40, week 44, week 48, or week 52 of the second treatment period, or during week 24, week 52, week 104, week 156, or week 208 of the third treatment period.
[0957] In some embodiments, the patients having IBD achieve an average daily liquid or soft stool frequency 4, 3.5, 3.0, 2.5, or 2.0 and an abdominal pain score 2.0, 1.5, or 1.0 at a time point at a time point during week 2, week 4, week 8, or week 12 of the first treatment period, during week 4, week 8, week 12, week 16, week 20, week 24, week 28, week 32, week 36, week 40, week 44, week 48, or week 52 of the second treatment period, or during week 24, week 52, week 104, week 156, or week 208 of the third treatment period.
[0958] In some embodiments, the patients having IBD achieve an average daily liquid or soft stool frequency 3 and abdominal pain score 1 at week 4, week 12, or week 52 of the dosing regimen.
[0959] In some embodiments, the patients having IBD achieve an average daily liquid or soft stool frequency 1.5 and abdominal pain score 1 at week 4, week 12, or week 52 of the dosing regimen.
[0960] In some embodiments, the patient having IBD shows a response to the SMAD7 AON if the PRO-2 score is reduced 8 points from baseline.
[0961] In some embodiments, the patient having IBD experiences remission if the PRO-2 score 8.
[0962] In some embodiments, the patient having IBD experiences remission (e.g., SES-CD2, CDAI150, PRO-28, abdominal pain score 1 and/or average daily liquid or soft stool frequency score 1.5; TMS2.0, MMS2.0, PMS2.0, or ES=0) without prior or concurrent corticorsteroid treatment.
[0963] It can be useful for the analysis of CDAI and PRO-2 scores to have the patient having IBD record information in a diary, such as number of liquid or soft stools per day, abdominal pain/cramps, general well-being, fever higher than 37.8 C. during previous week, administration of, e.g., diphenoxylate/atropine, loperamide, or opiates for diarrhea.
[0964] In some embodiments, the QOL and HEA questionnaires comprise the Medical Outcome Study Short Form 36-item Health Survey, version 2 (SF-36 v2). SF-36 v2 is a self-administered 36-item general health status instrument often used in clinical trials and health services research. SF-36 v2 typically includes 8 multi-item scales that assess 8 health domains, such as 1) limitations in physical activities because of health problems; 2) limitations in social activities because of physical or emotional problems; 3) limitations in usual role activities because of physical health problems; 4) bodily pain; 5) general mental health (psychological distress and well-being); 6) limitations in usual role activities because of emotional problems; 7) vitality (energy and fatigue); and 8) general health perceptions. The concepts measured by the SF-36 are not specific to any age, disease, or treatment group, allowing comparison of relative burden of different diseases and the relative benefit of different treatments.
[0965] In some embodiments, the QOL and HEA questionnaires comprise the Inflammatory Bowel Disease Questionnaire (IBDQ). The IBDQ is a responsive instrument for reflecting quick change in the quality of life of patients with CD within a 2-week period. The IBDQ has evolved into a standard for measuring disease-specific quality of life in patients with CD. The IBDQ is a self-administered, 32-item questionnaire concerning 4 dimensions of quality of life (Hlavaty, 2006), including bowel function dimension (BD), emotional status dimension (ED), symptoms dimension (SysD), and social functioning dimension (SocD). Each dimension is typically scored up to 7 points for each item. The total IBDQ score ranges from 32 to 224 points, with higher scores indicating a better quality of life.
[0966] In some embodiments, the QOL and HEA questionnaires comprise the Work Productivity and Activity Impairment Questionnaire for Crohn's Disease (WPAI-CD). The WPAI-CD assesses the impact of CD on a patient's work and activity during the past 7 days. The WPAI-CD comprises 6 questions that capture information, such as employment status, hours of work missed because of CD, hours missed because of other reasons, hours actually worked, the degree to which CD has affected productivity while working from 0 (no effect) to 10 (maximum impairment), the degree to which CD affected other (non-work) regular activities (0-10). The WPAI-CD questions are used to create 4 dimensions, with scores expressed in percentage of impairment; higher scores indicate greater impairment and reduced productivity: absenteeism (work time missed in employed subjects), presenteeism (reduced productivity while at work), overall work impairment (absenteeism plus presenteeism), activity impairment (reduced productivity in daily activities). The minimally important difference (MID), i.e., the change in WPAI-CD score deemed to be clinically meaningful, is approximately 7%.
[0967] In some embodiments, the QOL and HEA questionnaires comprise the European Quality of Life-5 Dimensions Questionnaire (EQ-5D). The EQ-5D (The EuroQol Group, 1990) is a validated, 6-item, self-administered instrument designed to measure generic health status. The EQ-5D typically has two components: 1) the EQ-5D descriptive system (five items; EQ-5D Index Score) and 2) the EQ Visual Analog Scale (EQ-5D VAS). The EQ-5D Index Score includes five dimensions of health (mobility, self-care, usual activities, pain/discomfort, and anxiety/depression). Each dimension can have three levels reflecting no problems, some problems, and extreme problems. A unique EQ-5D health state is defined by combining one level from each of the five dimensions. Health states are on a scale of 0.0 (death) to 1.0 (perfect health). Because the worst possible health statc may be judged by respondents as worse than death, negative values are possible. Preference values for many countries have been established through a series of studies. The EQ-5D VAS is a vertical scale with endpoints labeled best imaginable health and worst imaginable health anchored at 100 and 0, respectively. Respondents are asked to indicate how they rate their own health state today by drawing a line from an anchor box to that point on the EQ-5D VAS which best represents their own health on that day. The EQ-5D has demonstrated good reproducibility (intra-class correlation [ICC]=0.77 for the EQ VAS score and ICC=0.89 for the EQ-5D Index score) and evidence of known-groups validity.
[0968] In some embodiments, the QOL and HEA questionnaires comprise the Harvey-Bradshaw Index (HB1). The HB1 was devised in 1980 as a simpler version of the CDAI for data collection purposes. It consists of only clinical parameters, the first three items are scored by the subject for the previous day, and the remaining 2 items are scored by the Investigator or delegate at the scheduled visit. The HBI is far simpler to use than the CDAI and does not require biochemical tests. The HBI scores range from 0 to >18, the upper range may vary based on the number of liquid or soft stool per day, and are then ranked according to severity of the disease. Remission is defined by a score of <5; mild active disease is defined by a score of >5 and <7; moderate active disease is defined by a score of >8 and <16; severe disease is defined by a score of >16. The HBI consists of 8 variables: general well-being rating (from yesterday), abdominal pain rating (from yesterday), total number of liquid or soft stools (from yesterday), abdominal mass presence (on the day of the visit), complications (check any that apply, on the day of the visit, e.g., none, arthritis, uveitis, erythema nodosum, aphthous ulcers, pyoderma gangrenosum, anal fissures, new fistula, and abscess).
[0969] In some embodiments, the QOL and HEA questionnaires comprise Healthcare Resource Utilization (HRU) assessment. The HRU assessment will be evaluated in this study to assess the impact of CD and health-related outcomes (hospitalizations, emergency department or urgent care clinic visits, and physician visits).
[0970] In some embodiments, Physician's Global Assessment (PGA) is done as part of the Mayo score. The PGA acknowledges 3 criteria: the subject's daily recollection of abdominal discomfort, general sense of wellbeing, and other observations, such as physical findings and the subject's performance status.
[0971] In some embodiments, a colonoscopy is performed if a subject has extensive colitis; or a flexible rectosigmoidoscopy is performed if a subject only has left-sided colitis. The colonoscopy and/or flexible rectosigmoidoscopy is performed at about week 1, about week 2, about week 4, about week 8, about week 12, about week 24, about week 32, about week 40, about week 52, about year 2, about year 4.
[0972] In some embodiments, Total Mayo Score (TMS) is assessed. The TMS is an instrument designed to measure disease activity of UC. The TMS typically ranges from 0 to 12 points. It consists of 4 subscores, each graded from 0 to 3 with higher scores indicating more severe disease: Stool Frequency Subscore (SFS), Rectal Bleeding Subscore (RBS), Endoscopy Subscore, Physician's Global Assessment. Clinical response is defined as a decrease from baseline in TMS of at least 3 points, and at least a 30% decrease in the TMS, with an accompanying decrease in the RBS of at least 1 point or absolute RBS of 0 or 1. Clinical remission is defined as TMS2, with no individual subscore >1. Endoscopic response is defined as a 1 point or greater decrease from baseline in the endoscopy subscore. Endoscopic remission is defined as endoscopy subscore of 0. The TMS assessment is performed at about week 4, about week 8, about week 12, about week 24, about week 32, about week 40, about week 52, about year 2, about year 4.
[0973] In some embodiments, Partial Mayo Score (PMS) is assessed. The PMS is the sum of the RBS, SFS, and PGA, and ranges from 0 to 9 points. Clinical response is defined as a decrease from baseline in PMS of at least 2 points and at least 25%, with an accompanying decrease in the RBS of at least 1 point or an absolute RBS int or absolute RBS of 0 or 1. Clinical remission is defined as TMS2, no individual subscore >1. The PMS assessment is performed at about week 4, about week 8, about week 12, about week 24, about week 32, about week 40, about week 52, about year 2, about year 4.
[0974] In some embodiments, Modified Mayo Score (MMS) is assessed. The MMS will be based on the stool frequency, rectal bleeding and endoscopy subscores of the total Mayo score, and will exclude the PGA subscore, since this is a global measure that is subjective in nature. The modified Mayo score ranges from 0 to 9 points. Clinical response is defined as a decrease from baseline in MMS of at least 2 points and at least 25%, with an accompanying decrease in the RBS of at least 1 point or an absolute RBS of 0 or 1. Based on the MMS, clinical remission is defined as a MMS of 2, with no individual subscore >1. The MMS assessment is performed at about week 4, about week 8, about week 12, about week 24, about week 32, about week 40, about week 52, about year 2, about year 4.
[0975] Rectal bleeding subscore (RBS) is one of the four measurements for Mayo Scoring System (MSS). RBS often ranges from 0 to 3, with 0 representing no blood seen, 1 representing streaks of blood with stool less than half the time, 2 representing obvious blood with stool most of the time, and 3 representing blood alone passed. The daily RBS represents the most severe bleeding of the day.
[0976] In some embodiments, the safety or tolerability parameter comprises an adverse event, a physical examination, vital signs, body weight, an electrocardiogram (EKG), a clinical laboratory safety evaluation, a stool culture, or a pregnancy test.
[0977] In some embodiments, analyzing the safety or tolerability parameter comprises assessing type, frequency or severity of an adverse event, a relationship of the adverse event to the administration of the SMAD7 AON, discontinuation of SMAD7 AON administration due to an adverse event, or clinically significant changes in vital signs, ECGs, or laboratory findings.
[0978] In some embodiments, the clinical laboratory safety evaluation comprises a hematology test, a coagulation test, a serum chemistry test, and/or a urinanalysis. In some embodiments, the hematology test comprises a red blood cell (RBC) count, a hemoglobin level, a hematocrit, mean corpuscular hemoglobin (MCH), mean corpuscular hemoglobin concentration (MCHC), mean corpuscular volume (MCV), a differential white blood cell (WBC) count, an absolute WBC count, or a platelet count. In some embodiments, the coagulation test comprises analyzing the prothrombin time (PT) or the activated partial thromboplastin time (APTT). In some embodiments, the serum chemistry test comprises analyzing total protein, albumin, calcium, phosphorous, glucose, total cholesterol, triglycerides, uric acid, total bilirubin, alkaline phosphatase, aspartate aminotransferase (AST)/serum glutamic-oxaloacetic transaminase (SGOT), alaninc aminotransferase (ALT)/scrum glutamic-pyruvic transaminasc (SGPT), sodium, potassium, chloride, carbon dioxide, blood urea nitrogen (BUN), creatinine, lactic dehydrogenase (LDH), magnesium, or complement activation (e.g., Bb, C3a and C5a).
[0979] In some embodiments, the stool culture comprises a test for Clostridium difficile (C. difficile) toxin.
[0980] In some embodiments, the urinanalysis comprises dipstick urinanalysis or microscopic urinanalysis. In some embodiments, the dipstick urinanalysis comprises analyzing specific gravity, pH, glucose, ketones, total protein, bilirubin, leukocyte esterase, nitrite, or urobilinogen. In some embodiments, microscopic urinanalysis comprises analyzing epithelial cells, RBCs, or WBCs.
[0981] In some embodiments, analyzing a biomarker of intestinal inflammation or tissue damage comprises analyzing SMAD7, SMAD3 phosphorylation, HLA-DR, CD4, CD8, CRP (e.g., measured as hsCRP), FCP, TNF, IL8, IFN-, IL-12, IL17A or IL6. Biomarker analysis can comprise the analysis of absolute biomarker levels or the analysis of changes in biomarker levels (e.g., decreases or increases from baseline, or from another reference value from the patient's medical history). Biomarker levels in the patient having IBD can be compared to corresponding biomarker levels in healthy control groups, or changes in biomarker levels can be followed in the patient having IBD over time. The biomarkers can be analyzed at any one or more timepoints during the initial screening period, the first treatment period, the second treatment period, the third treatment period, or the follow up period, or combinations thereof. In some embodiments, the CRP is analyzed in a blood sample obtained from the patient having IBD. In some embodiments, the FCP is analyzed in a fecal sample obtained from the patient having IBD.
[0982] In some embodiments, analyzing a biomarker of intestinal inflammation or tissue damage comprises analyzing FCP, CRP, CD4, CD8, HLA-DR, SMAD3 phosphorylation, SMAD7 mRNA or protein level, TNF-, IL-8, IFN-, IL-12, IL-17, IL-6, Reg-3a, IL-10, IL-25, CCL20, IL-17A, Foxp3, CCR9, IL-5, IL-13, IL4 and TGF-1.
[0983] Methods for analyzing biomarkers in a patient sample are known in the art and comprise, e.g., ELISA, Western Blot, RT-PCR, HPLC, LC-MS, fluorescence microscopy, immunocytochemistry, and the like.
[0984] In some embodiments, CRP levels (e.g., measured as hsCRP), e.g., in a blood, serum or plasma sample from a patient having IBD, indicates if the patient having IBD responds to the SMAD7 AON.
[0985] In some embodiments, other biomarkers (e.g., IL-10, CCL20, TNF-) will be analyzed from serum blood samples and intestinal mucosal biopsies. In some embodiments, intestinal microbiome and FCP will be assessed from fecal samples. In some embodiments, whole blood sample will be collected at the specified time-points to isolate PBMC for evaluating the expression of immune biomarkers (e.g., IL-17A).
[0986] In some embodiments, analyzing a biomarker of intestinal inflammation or tissue damage comprises analyzing the change in CRP from baseline at a timepoint during week 4, week 8, or week 12, of the first treatment period, during week 0, week 4, week 8, week 12, week 16, week 20, or week 24 of the second treatment period, during week 24, week 52, week 104, week 156, or week 208 of the third treatment period, or during week 20 or 52 of the observation period.
[0987] In some embodiments, analyzing expression of a biomarker in an intestinal mucosal biopsy comprises analyzing biomarkers such as cluster of differentiation 4 (CD4), cluster of differentiation 8 (CD8), a major histocompatibility complex (MHC) class I or class II (e.g., HLA-DR), SMAD3 (e.g., SMAD3 phosphorylation) or SMAD7 (e.g., SMAD7 mRNA levels or protein levels).
6.2.1 Clinical Response
[0988] Clinical responses in an IBD patient to the treatment methods and/or administration regimes provided herein can inform adjustments to the treatment methods and/or administration regimes, e.g., during the transition from the first treatment period to the second treatment period, during the transition from the second treatment period to the third treatment period, or upon exit from the second or third treatment period. See, e.g., Section 6.1.1.3, Section 6.1.1.6, Section 6.6 and Section 6.7. For example, the administration regime of an IBD patient responding to an anti-SMAD7 therapy can be adjusted by, e.g., shortening the length of the first and/or second treatment period, by allowing the IBD patient to transition from the first to the second treatment period or from the second to the third treatment period, by lowering the dose of the anti-SMAD7 therapy, or by ending the anti-SMAD7 therapy. The administration regime of an IBD patient not responding to the anti-SMAD7 therapy can be adjusted, e.g., by increasing the dose of the anti-SMAD7 therapy.
[0989] In some embodiments, the patient having IBD shows a clinical response if the patient having IBD shows 50% reduction of SES-CD from baseline (e.g., a timepoint during week 0 of first treatment period), 100 points decrease from baseline in CDAI score, 8 point decrease from baseline PRO-2 score, 3.0 or 1.5 points decrease from baseline in average daily liquid or soft stool frequency and/or 1 point decrease from baseline in abdominal pain score, decrease of TMS score from baseline 30% and 3 points, decrease of ES from baseline 1; decrease of PMS score from baseline 25% and 2 points; decrease of MMS score from baseline 25% and 2 points (e.g., at a timepoint during the first, second and/or third treatment periods).
[0990] In some embodiments, the patient having IBD shows a clinical improvement if the patient having IBD shows an absolute CDAI score <180 and a CDAI score reduction 70 points from baseline (e.g., a timepoint during week 0 of first treatment period).
[0991] In some embodiments, the patient having IBD shows a clinical response if the patient having IBD shows a decrease of TMS score 30% and 3 points from baseline (e.g., a timepoint during week 0 of first treatment period), along with a decrease of RBS score 1 or absolute RBS1; a decrease of endoscopic subscore from baseline 1; a decrease of PMS score from baseline 25% and 2 points, along with a decrease of RBS score 1 or an absolute RBS1; a decrease of MMS score from baseline 25% and 2 points, along with a reduction in RBS score of 1 or an absolute RBS1.
[0992] In some embodiments, the patient having IBD shows a clinical response if the levels of one or more biomarker of intestinal inflammation, such as an inflammatory cytokine (e.g., TNF, IFN-, IL6, IL8, or IL12, or another biomarker, such as, e.g., SMAD7, SMAD3 phosphorylation, FCP, CRP, CD4, CD8, or HLA-DR), are decreased from baseline at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% in a sample obtained from the patient having IBD at a timepoint before or during the first treatment period, during the second treatment period, and/or during the third treatment period.
[0993] In some embodiments, the patient having IBD shows a clinical response if the levels of one or more biomarkers of intestinal inflammation, such as an anti-inflammatory cytokine e.g., IL10, are decreased from baseline at least 2-fold, at least 3-fold, at least 5-fold, at least 10-fold, at least 15-fold, at least 20-fold, at least 25-fold, at least 50-fold, at least 100-fold, at least 250-fold, at least 500-fold or at least 1,000-fold in a sample obtained from the patient having IBD at a timepoint before or during the first treatment period, during the second treatment period, and/or during the third treatment period.
[0994] In some embodiments, the patient having IBD shows a clinical response the levels of one or more biomarker of intestinal inflammation, (e.g., SMAD3 phosphorylation), are increased from baseline at least 2-fold, at least 3-fold, at least 5-fold, at least 10-fold, at least 15-fold, at least 20-fold, at least 25-fold, at least 50-fold, at least 75-fold, or at least 100-fold in a sample obtained from the patient having IBD at a timepoint during the first treatment period and/or the second treatment period.
[0995] In some embodiments, the patient having IBD shows a clinical response if SMAD3 phosphorylation is increased from baseline (e.g., a timepoint during week 0 of first treatment period) at least 2-fold, at least 3-fold, at least 5-fold, at least 10-fold, at least 15-fold, at least 20-fold, at least 25-fold, at least 50-fold, at least 100-fold, at least 250-fold, at least 500-fold or at least 1,000-fold in a sample obtained from the patient having IBD.
[0996] In some embodiments, the patient having IBD shows a clinical response if SMAD7 mRNA levels and/or SMAD7 protein levels are decreased at least 2-fold, at least 3-fold, at least 5-fold, at least 10-fold, at least 15-fold, at least 20-fold, at least 25-fold, at least 50-fold, at least 100-fold, at least 250-fold, at least 500-fold or at least 1,000-fold in a sample obtained from the patient at the end of the first treatment period compared to a sample obtained from the patient at the beginning of the first treatment period.
[0997] In some embodiments, the IBD patient shows a clinical response if the CRP levels (e.g., measured at hsCRP) in a blood, serum or plasma sample from the patient having IBD are <3.0 mg/L, <2.5 mg/L, <2.0 mg/L, <1.5 mg/L, <1.0 mg/L, or <0.5 mg/L.
[0998] In some embodiments, the IBD patient shows a clinical response if the TNF levels in a blood, serum or plasma sample from the patient having IBD are <30 pg/ml, <25 pg/ml, <20 pg/ml, or <15 pg/ml.
[0999] In some embodiments, the IBD patient shows a clinical response if the IL6 levels in a blood, serum or plasma sample from the patient having IBD are <600 pg/ml, <500 pg/ml, <400 pg/ml, or <300 pg/ml.
[1000] In some embodiments, the IBD patient shows a clinical response if the IL8 levels in a blood, serum, or plasma sample from the patient having IBD are <30 pg/ml, <25 pg/ml, <20 pg/ml, or <15 pg/ml.
[1001] In some embodiments, the IBD patient shows a clinical response if the IL12 levels in a blood, serum or plasma sample from the patient having IBD are <100 pg/ml, <75 pg/ml, <50 pg/ml, or <25 pg/ml.
[1002] In some embodiments, the IBD patient shows a clinical response if the IL17A levels in a blood, serum or plasma sample from the patient having IBD are <100 pg/ml, <75 pg/ml, <50 pg/ml, or <25 pg/ml.
[1003] In some embodiments, the IBD patient shows a clinical response if the FCP levels in a fecal sample from the patient having IBD are 25 g/g stool, 50 g/g stool, 75 g/g stool, 100 g/g stool, 150 g/g stool, or 200 g/g stool.
6.2.2 Clinical Remission
[1004] In some embodiments, the patient having IBD shows remission, if the patient shows a SES-CD score 2, a CDAI score 150, a PRO-2 score <8, abdominal pain score 1 and/or average daily liquid or soft stool frequency score 1.5; TMS score 2; ES=0; PMS score 2; MMS score 2 or mucosal healing, as indicated, e.g., by the absence of an intestinal mucosal ulceration, e.g., at a timepoint during the first, second and/or third treatment periods.
[1005] In some embodiments, the patient having IBD shows remission, if the patient shows a TMS score 2 points with no individual subscore 1; an endoscopic subscore=0; a PMS score 2 points with no individual subscore >1; an MMS score 2 points with no individual subscore >1, e.g., at a timepoint during the first, second and/or third treatment periods.
[1006] In some embodiments, the patient having IBD shows remission, if the level of one or more biomarkers of intestinal inflammation (e.g., TNF, IFN-, IL6, IL8 or IL12, or another biomarker, such as, e.g., FCP, CRP, SMAD3 phosphorylation, IL-17A, CD4, CD8, or HLA-DR) in a sample from the patient are within a standard deviation (SD) range of 2, 3, 5, 7, or 10, from the average, median, or mean levels of the biomarker in a healthy control group (e.g., matched by medical history, age, gender, race, or other factors).
6.2.3 Loss of Response
[1007] In some embodiments, the patient experiences a partial loss of response, or a complete loss of response, if the CDAI score is increased by 50 points and if the CDAI score is 150 at 2 or more consecutive timepoints or after the patient first showed a response to the SMAD7 AON, e.g., during the first, second or third treatment period.
6.3 Fecal Calprotectin
[1008] In the methods provided herein, the biomarker FCP can be used to monitor the activities of an anti-SMAD7 treatment, as described in Section 6.2 (e.g., to analyze if a patient shows a clinical response to a SMAD7 AON, or if a patient experiences remission). In some embodiments, FCP levels in an IBD patient sample can inform a decision regarding whether an IBD patient is transitioning from the first to the second treatment phase (e.g., if the patient shows a clinical response to a SMAD7 AON or if the patient shows remission), e.g., as described in Section 6.1.
[1009] In other methods provided herein, FCP can be used as a biomarker for patient selection.
[1010] In another aspect, provided herein is a method for treating or managing IBD in a patient having IBD. In one embodiment, the method comprises the following steps: (a) of administering to the patient an initial dose of a SMAD7 AON; (b) analyzing the level of FCP in the patient; and (c) if the level of FCP is above normal levels of FCP, then administering to the patient a subsequent dose that is greater than or equal to the initial dose. Alternatively, if in step (c), the level of FCP is below normal levels of FCP as determined in step (b), then step (c) comprises administering to the patient a subsequent dose that is equal to or smaller than the initial dose.
[1011] In another aspect, provided herein is a method for treating or managing inflammatory bowel disease (IBD) in a patient having IBD, wherein the method comprises (a) establishing a control level of FCP for the patient; (b) administering to the patient an initial dose of a SMAD7 AON; c) analyzing the level of FCP in the patient; and (d) if the level of FCP is lower than the control level, then administering to the patient a subsequent dose that is the same as the initial dose or smaller than the initial dose, or, if the level of FCP is unchanged or increased compared to the control level, then administering to the patient a subsequent dose that is the same as the initial dose or greater than the initial dose or terminating the treatment.
[1012] In some embodiments, the control level for the IBD patient is the FCP level in a sample obtained from the IBD patient prior to administration of the first anti-SMAD7 treatment during a chronic disease period, e.g., when the patient was in remission. In some embodiments, the control level for the IBD patient is the FCP level in a sample obtained from the IBD patient prior to administration of the first anti-SMAD7 treatment during an acute disease period (e.g., CD patient: CDAI>150; CDAI250 and 450; UC patient: MMS4 and 9, and ES2). In some embodiments, the control level for the IBD patient is the FCP level in a sample obtained from the IBD patient during a period when the patient is administered with an anti-SMAD7 treatment, or at the beginning of a treatment period (e.g., during week 0, baseline level). In some embodiments, the control level of the IBD patient is the FCP level in a sample obtained from the IBD patient at an earlier timepoint during an anti-SMAD7 treatment period.
[1013] In another aspect, provided herein is a method for treating or managing IBD in a patient having IBD with respect to administration of an initial dose of a SMAD7 AON. In one embodiment, the provided herein is a method for treating or managing IBD in a patient having IBD, where the method comprises the following stcps: (a) analyzing the level of FCP in the patient; and (b) if the level of FCP is above normal levels of FCP, then administering to the patient an initial dose of a SMAD7 AON. Additionally, the method can further comprise the steps of: (c) analyzing the level of FCP in the patient after said administering step, i.e., step (b); and (d) if the level of FCP is above normal levels of FCP, then administering to the patient a subsequent dose that is greater than or equal to the initial dose. Alternatively, if in step (d), the level of FCP is below normal levels of FCP, as determined in step (c), then step (d) comprises administering to the patient a subsequent dose that is equal to or smaller than the initial dose. In some instances, if the subsequent dose administered in step (d) is equal to or greater than the maximum tolerated dose (MTD), then the method comprises the step of terminating the treatment.
[1014] The level of FCP can be analyzed at any timepoint during an administration schedule in a method for treating IBD provided herein. For example, the FCP level can be analyzed before or after administering an anti-SMAD7 therapy (e.g., at least 1 day, at least 3 days, at least 5 days, at least 1 week, at least 2 weeks, at least 3 weeks, at least 1 month, at least 2 months, at least 4 months, or at least 6 months), or concurrently with administering the anti-SMAD7 therapy.
[1015] The level of FCP can be analyzed at varying time points following an administering step (b). For instance, in some embodiments, following an administering step (b), the level of FCP is analyzed at least 1 day, at least 3 days, at least 5 days, at least 1 week, at least 2 weeks, at least 3 weeks, at least 1 month, at least 2 months, at least 4 months, or at least 6 months after said administration step. In some embodiments, the level of FCP is analyzed immediately after said administration step. In yet other embodiments, the level of FCP is analyzed about 7 days, about 10 days, about 15 days, about 20 days, about 25 days, or about 28 days after said administration step.
[1016] Normal levels of FCP can be determined based on numerical reference values or with respect to levels of FCP in a healthy control group. For instance, in some embodiments, normal levels of FCP are about 20 g/g (feces), about 40 g/g, about 60 g/g, about 80 g/g, about 100 g/g, about 120 g/g, about 140 g/g, about 160 g/g, about 180 g/g, about 200 g/g, about 220 g/g, or about 240 g/g. In some embodiments, normal levels of FCP in a healthy control aged 2-9 years are between about 100 g/g and about 200 g/g, between about 110 g/g and about 190 g/g, between about 120 g/g and about 180 g/g, between about 130 g/g and about 170 g/g, or between about 140 g/g and about 160 g/g. In some embodiments, normal levels of FCP in a healthy control aged 10-59 years are about 166 g/g. In some embodiments, normal levels of FCP in a healthy control aged 10-59 years is between about 10 g/g and about 100 g/g, between about 20 g/g and about 90 g/g, between about 30 g/g and about 80 g/g, between about 40 g/g and about 70 g/g, or between about 50 g/g and about 60 g/g. In some embodiments, normal levels of FCP in a healthy control aged 10-59 years are about 51 g/g. In some embodiments, normal levels of FCP in a healthy control aged 60 years are between about 60 g/g and about 160 g/g, between about 70 g/g and about 150 g/g, between about 80 g/g and about 140 g/g, between about 90 g/g and about 130 g/g, or between about 100 g/g and about 120 g/g. In some embodiments, normal levels of FCP in a healthy control aged 60 years are about 112 g/g.
[1017] In other embodiments of the invention, normal levels of FCP are defined as median levels of FCP in a healthy control group. A healthy control group can be defined based on various criteria related to genetic background, habits, and physical attributes matched to the same set of criteria in the patient. For instance, in some embodiments, the healthy control group and the patient having IBD are matched with respect to age, gender, ethnic origin, smoking habits, dietary habits, body-mass index (BMI), and/or exercise habits.
[1018] In various embodiments of the invention, the initial dose of a SMAD7 AON administered to a patient having IBD can vary. For instance, in some embodiments, the initial dose of a SMAD7 AON administered to a patient having IBD is less than 500 mg/day, less than 400 mg/day, less than 300 mg/day, less than 200 mg/day, less than 100 mg/day, less than 90 mg/day, less than 80 mg/day, less than 70 mg/day, less than 60 mg/day, less than 50 mg/day, less than 40 mg/day, less than 30 mg/day, less than 20 mg/day, or less than 10 mg/day. Alternatively, in other embodiments, the initial dose is at least 1 mg/day, at least 5 mg/day, at least 10 mg/day, at least 20 mg/day, at least 30 mg/day, at least 40 mg/day, at least 50 mg/day, at least 60 mg/day, at least 70 mg/day, at least 80 mg/day, at least 90 mg/day, at least 100 mg/day, at least 200 mg/day, at least 300 mg/day, at least 400 mg/day, or at least 500 mg/day. In yet other embodiments, the initial dose is about 5 mg/day, about 10 mg/day, about 20 mg/day, about 30 mg/day, about 40 mg/day, about 50 mg/day, about 60 mg/day, about 70 mg/day, about 80 mg/day, about 90 mg/day, about 100 mg/day, about 200 mg/day, about 300 mg/day, about 400 mg/day, or about 500 mg/day. In some embodiments, the initial dose is 5 mg/day, 10 mg/day, 20 mg/day, 30 mg/day, 40 mg/day, 50 mg/day, 60 mg/day, 70 mg/day, 80 mg/day, 90 mg/day, 100 mg/day, 110 mg/day, 120 mg/day, 130 mg/day, 140 mg/day, 150 mg/day, 160 mg/day, 170 mg/day, 180 mg/day, 190 mg/day, or 200 mg/day.
[1019] In some embodiments of a method for treating or managing inflammatory bowel disease (IBD) provided in this section, after analyzing the level of FCP in the patient in a step (b) or (c), if the level of FCP is above normal levels of FCP, then the method can comprise the step of administering to the patient a subsequent dose that is greater than the initial dose. In some embodiments, after analyzing the level of FCP in the patient in a step (b) or (c), if the level of FCP is below normal levels of FCP, then the method can comprise the step of administering to the patient a subsequent dose that is smaller than the initial dose.
[1020] In another aspect, provided herein is a method for determining the level of a subsequent dose of SMAD7 AON with respect to an initial dose of SMAD7 AON based on levels of FCP in a patient having IBD. For instance, in embodiments of the invention described herein, if FCP levels in a patient having IBD are above normal levels following an initial administration step (a) or (b), the subsequent dose administered in a step (c) or (d) is at least about 5 mg/day, at least about 10 mg/day, at least about 20 mg/day, at least about 30 mg/day, at least about 40 mg/day, at least about 50 mg/day, at least about 60 mg/day, at least about 70 mg/day, at least about 80 mg/day, at least about 90 mg/day, at least about 100 mg/day, at least about 110 mg/day, at least about 120 mg/day, at least about 130 mg/day, at least about 140 mg/day, at least about 150 mg/day, or at least about 160 mg/day, at least about 170 mg/day, at least about 180 mg/day, at least about 190 mg/day, or at least about 200 mg/day greater than the initial dose. Alternatively, in some embodiments, if FCP levels in a patient having IBD are below normal levels following an initial administration step (a) or (b), the subsequent dose administered in a step (c) or (d) is at least about 5 mg/day, at least about 10 mg/day, at least about 20 mg/day, at least about 30 mg/day, at least about 40 mg/day, at least about 50 mg/day, at least about 60 mg/day, at least about 70 mg/day, at least about 80 mg/day, at least about 90 mg/day, or at least about 100 mg/day smaller than the initial dose. Furthermore, in some embodiments, the initial dose administered in an initial administration step (a) or (b) is between about 10 mg/day and 100 mg/day, about 5 mg/day and 200 mg/day, about 10 mg/day and 50 mg/day, about 50 mg/day and 100 mg/day, and about 100 mg/day and about 200 mg/day, and the subsequent dose administered in a step (c) or (d) is between about 30 mg/day and 200 mg/day, about 5 mg/day and 30 mg/day, about 20 mg/day and 50 mg/day, about 50 mg/day and 100 mg/day, or about 100 mg/day and 200 mg/day.
[1021] In another aspect, provided herein is a method for modulating treatment with a SMAD7 AON in a patient with IBD based on a comparison of relative levels of FCP in a patient before and after an initial administering step. The method comprises the following steps: (a) analyzing the level of FCP in the patient; and (b) if the level of FCP is above normal levels of FCP, then administering to the patient an initial dose of a SMAD7 AON; (c) analyzing the level of FCP in the patient after said administering step; and (d) if the level of FCP is lower after said administration step than the level of FCP before said administration step, then administering to the patient a subsequent dose that is the same as the initial dose or smaller than the initial dose. Alternatively, in step (d) if the level of FCP is unchanged or increased after said administration step (i.e., step (b)) compared to the level of FCP before said administration step, then step (d) comprises administering to the patient a subsequent dose that is greater than the initial dose or terminating the treatment. Alternatively, in step (d) if the patient is in clinical remission and the level of FCP is unchanged or increased after said administration step (i.e., step (b)) compared to the level of FCP before said administration step, then step (d) comprises terminating the treatment.
[1022] In some embodiments of a method provided in this section, a change in FCP levels observed after an initial administration step (of SMAD7 AON) compared to FCP levels prior to the administration step can be analyzed, for example, as a change in percent of FCP levels, to determine the amount of a subsequent dose of SMAD7 AON to be administered to a patient with IBD. For example, in some embodiments, if the level of FCP is at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% decreased after said administration step (e.g., an administration step (b)) compared to the level of FCP before said administration step, then the method comprises a step (e.g., an administration step (d)) of administering to the patient a subsequent dose that is the same as the initial dose or smaller than the initial dose.
[1023] In another aspect, provided herein is a method for determining the probability that a patient having IBD will experience clinical remission following treatment with a SMAD7 AON based on a comparison of FCP levels, for example, based on a comparison of percent change in FCP levels before and after treatment with a SMAD7 AON. For example, in some embodiments, the methods described herein further comprise the step of determining that the patient having IBD has a greater than 20%, greater than 30%, greater than 40%, greater than 50%, greater than 60%, greater than 70%, greater than 80%, greater than 90% or greater than 100% chance of experiencing clinical remission of the IBD for a time period of at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 6 weeks or at least 8 weeks, if the level of FCP after an administering step (e.g., an administering step (b)) is at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% decreased compared to the level of FCP before the administration step.
[1024] Clinical remission, as described herein, can be determined by comparison to a reference value, for example, a Crohn's Disease Activity Index (CDAI) or a Modified Mayo Score (MMS). In some embodiments of the invention, clinical remission in a patient having IBD is indicated by a CDAI score of less than 150 (CDAI<150), or a MMS2. See, e.g., Section 6.2.2.
[1025] In some embodiments of a method provided in this section, a clinical response or clinical remission can be observed at a given time point or within a given time frame with respect to administration of the SMAD7 AON (e.g., using an analysis described in Section 6.2, including, e.g., CDAI score or MMS). For example, in some embodiments, clinical remission is observed about one day, about 3 days, about one week, about two weeks, about three weeks, about four weeks, about six weeks, about eight weeks, or about ten weeks after an administration step (for example, an administration step (b)) and maintained for a period of at least 3 days, at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 6 weeks at least 8 weeks, or at least 10 weeks. Similarly, some embodiments of the invention comprise a method of determining that the patient having IBD has a chance of experiencing clinical remission of IBD, where the patient having IBD had a CDAI of between about 220 and about 400, between about 150 and about 200, between about 200 and about 250, between about 250 and about 300, between about 300 and about 350, between about 350 and about 400, between about 400 and about 450, or greater than about 450 one week prior to an anti-SMAD7 therapy administration step (for example, an administration step (b)). Some embodiments of the invention comprise a method of determining that the patient having IBD has a chance of experiencing clinical remission of IBD, where the patient having IBD had a MMS of between about 4 and about 9, between about 2 and about 4, between about 4 and about 6, between about 6 and about 8, or greater than about 8 one week prior to an anti-SMAD7 therapy administration step (for example, an administration step (b)).
[1026] In some embodiments, a method of treating or managing IBD in a patient with above normal levels of FCP, comprises administering to the patient a dose of SMAD7 AON. Furthermore, in some embodiments, a methods for treating or managing IBD in a patient who has above normal FCP levels following administration of a dose of a SMAD7 AON, comprises administered a further dose of the SMAD7 AON that is greater than or equal to the prior dose. Similarly, in some embodiments of a method of treating or managing IBD, the patient having IBD has below normal FCP levels following administration of a dose of SMAD7 AON. In the latter case, the method will comprise administering to the patient a further dose of the SMAD7 AON that is less than or equal to the prior dose. In some embodiments, administration of the SMAD7 AON to the patient is repeated until the patient shows a clinical response or remission, e.g., based on monitoring a clinical parameter described in Section 6.2, e.g., until the levels of a biomarker, e.g., SMAD7, SMAD3-phosphorylation, HLA-DR, CD4, CD8, IL-12, IL17A, IL6, IL8, CRP, TNF, FCP reach normal levels or until the patient achieves a CDAI score of less than 150, or based on any other clinical parameter described in Section 6.2.
[1027] In some embodiments of a method of treating or managing IBD in a patient having above normal levels of FCP, the amount of a SMAD7 AON administered to the patient is increased until FCP levels in the patient decrease. In such embodiments, levels of SMAD7 AON administered to the patient can be increased until the level of FCP in the patient decreases to about a normal level of FCP or a below normal level of FCP.
[1028] In some embodiments of a method of treating or managing IBD comprises monitoring the treatment or management of IBD in a patient with IBD, that comprises analyzing FCP levels in the patient following each SMAD7 AON administration. Utilizing these methods, the absence of a decrease in FCP levels indicates that the treatment or management is not effective. In such embodiments, FCP levels can be analyzed one time or multiple times, for instance, two times, three times, four times, about five times, about 10 times, about 15 times, about 20 times, or about 30 times, after each administration of SMAD7 AON. Furthermore, the timing of the measurement of FCP levels can vary with respect to the time of SMAD7 AON administration such that FCP levels can be analyzed immediately after, about 1 hour after, about 3 hours after, about 6 hours after, about 12 hours after, about 1 day after, about 3 days after, about 1 week after, about 2 weeks after, and/or about 1 month after SMAD7 AON administration.
[1029] In order to determine levels of a biomarker or analyte, for example, FCP, in a patient having IBD using the methods described herein, a sample can be obtained from the patient. Therefore, in some embodiments of a method of treating or managing IBD provided in this section, the level of FCP in the patient having IBD is determined in a sample obtained from the patient having IBD. Analytes other than or in addition to FCP, for example, but not limited to Interleukin-6 (IL6), Interleukin-8 (IL8), Interleukin-12 (IL12), Interleukin-17A (IL17A), Interferon gamma (IFN-,) Tumor Necrosis Factor alpha (TNF.), Cluster of Differentiation 4 (CD4), Cluster of Differentiation 8 (CD8), Human Leukocyte Antigen-DR (HLA-DR), and C-Reactive Protein (CRP), can also be determined in methods of the invention. Thus, in some embodiments, the method comprises determining a level, or multiple levels, of one or more additional analytes in the patient having IBD. Analytes of TNF comprise RNA, DNA, and protein products of or derived from the TNF gene, described by NCBI Reference Sequence: NG_007462.1. Analytes of CRP comprise RNA, DNA, and protein products of or derived from the CRP gene, described by NCBI Reference Sequence: NG_013007.1. Analytes of IL8 comprise RNA, DNA, and protein products of or derived from the TNF gene, described by NCBI Reference Sequence: NG_029889.1. Analytes of FCP comprise RNA, DNA, and protein products of or derived from the FCP gene, described by Entrez GeneID No. 6280. Analytes of IL6 comprise RNA, DNA, and protein products of or derived from the IL6 gene, described by Entrez GeneID No. 3569. Analytes of IL8 comprise RNA, DNA, and protein products of or derived from the IL8 gene, described by Entrez GeneID No. 3567. Analytes of IL12 comprise RNA, DNA, and protein products of or derived from the IL12 gene, described by Entrez GeneID No. 3593. Analytes of IL17A comprise RNA, DNA, and protein products of or derived from the IL17A gene described by Entrez GeneID No. 3605. Analytes of IFN comprise RNA, DNA, and protein products of or derived from the IFN gene, described by Entrez GeneID No. 3458. Analytes of CD4 comprise RNA, DNA, and protein products of or derived from the CD4 gene, described by Entrez GeneID No. 920. Analytes of CD8 comprise RNA, DNA, and protein products of or derived from the CD8 gene, described by Entrez GeneID No. 925. Analytes of HLA-DR comprise RNA, DNA, and protein products of or derived from the HLA-DR gene family (including, e.g., HLA-DRA, HLA-DRB1, HLA-DRB3, HLA-DRB4, and HLA-DRB5), described, e.g., by Entrez GeneID Nos. 3122, 3123, 3125, 3126, and 3127. Analytes of Foxp3 comprise RNA, DNA, and protein products of or derived from the Foxp3 gene, described by Entrez GeneID No. 50943.
[1030] Samples containing analytes of interest, for example, SMAD7, phosphor-SMAD3, HLA-DR, TNF, CRP, IFN-, IL6, IL8, IL12, IL17A, CD4 and/or CD8, obtained from the patient having IBD, can comprise blood, serum, or plasma samples. Samples containing FCP can comprise stool samples. Stool samples can be wet stool samples or dry stool samples. Samples can also comprise tissue samples such as, but not limited to, tissue, gastrointestinal, mucosal, submucosal, intestinal, esophageal, ileal, rectal, or lymphatic samples. Levels of analytes of interest in a sample from a patient having IBD can be determined using various assays. For example, in methods of the invention, the level of FCP and/or another analyte can be determined by immunochemistry, for example, by an enzyme-linked immunosorbent assay (ELISA), or by nucleotide analysis.
[1031] Methods provided herein comprise methods for treating and managing various forms of IBD. For example, the invention comprises methods for treating and managing TBD, where the IBD is Crohn's Disease (CD) or ulcerative colitis (UC). The contemplated invention also provides methods for treating different types of patients with IBD, including, for example, but not limited to, IBD patients that are steroid-dependent patients with active CD; and steroid-resistant patients with active CD.
[1032] It will be appreciated that the SMAD7 AON administered to the patient having IBD in methods of the invention described herein, can be administered by various administration routes. In various embodiments, the SMAD7 AON can be administered by one or several routes, including orally, topically, parenterally, e.g., by subcutaneous injection, by inhalation spray, or rectally. The term parenteral as used herein comprises subcutaneous injections, intrapancreatic administration, intravenous, intramuscular, intraperitoneal, intrasternal injection or infusion techniques. In a preferred embodiment, the SMAD7 AON may be administered orally to the patient having IBD.
[1033] The SMAD7 AON described in Section 6.11 can, for example, be used in the methods of the invention described herein.
6.4 IL6, IL12, and HLA-DR
[1034] In the methods provided herein, the biomarkers IL6, IL12, or HLA-DR can be used to monitor the activities of an anti-SMAD7 treatment, as described in Section 6.2 (e.g., to analyze if a patient shows a clinical response to a SMAD7 AON, or if a patient experiences remission). In some embodiments, IL6, IL12 or HLA-DR levels in an IBD patient sample can inform a decision regarding whether an IBD patient is transitioning from the first to the second treatment phase (e.g., if the patient shows a clinical response to a SMAD7 AON or if the patient shows remission), e.g., as described in Section 6.1.
[1035] In other methods provided herein, IL6, IL12 or HLA-DR can be used as biomarkers for patient selection.
[1036] In another aspect, provided herein is a method for treating or managing IBD in a patient having IBD. In one embodiment, the method comprises the following steps: (a) of administering to the patient an initial dose of a SMAD7 AON; (b) analyzing the level of IL6, IL12 or HLA-DR in the patient; and (c) if the level of IL 6, IL12 or HLA-DR is above normal levels of IL6, IL12 or HLA-DR then administering to the patient a subsequent dose that is greater than or equal to the initial dose. Alternatively, if in step (c), the level of IL6, IL12 or HLA-DR is below normal levels of IL6, IL12 or HLA-DR as determined in step (b), then step (c) comprises administering to the patient a subsequent dose that is equal to or smaller than the initial dose.
[1037] In another aspect, provided herein is a method for treating or managing inflammatory bowel disease (IBD) in a patient having IBD, wherein the method comprises (a) establishing a control level of IL6, IL12 or HLA-DR for the patient; (b) administering to the patient an initial dose of a SMAD7 AON; c) analyzing the level of IL6, IL12 or HLA-DR in the patient; and (d) if the level of IL6, IL12 or HLA-DR is lower than the control level, then administering to the patient a subsequent dose that is the same as the initial dose or smaller than the initial dose, or, if the level of IL6, IL12 or HLA-DR is unchanged or increased compared to the control level, then administering to the patient a subsequent dose that is the same as the initial dose or greater than the initial dose or terminating the treatment.
[1038] In some embodiments, the control level for the IBD patient is the IL6, IL12 or HLA-DR level in a sample obtained from the IBD patient prior to administration of the first anti-SMAD7 treatment during a chronic disease period, e.g., when the patient was in remission. In some embodiments, the control level for the IBD patient is the IL6, IL12 or HLA-DR level in a sample obtained from the IBD patient prior to administration of the first anti-SMAD7 treatment during an acute disease period (e.g., CDAI>150; CDAI250 and 450; or a Modified Mayo Score (MMS)). In some embodiments, the control level for the IBD patient is the IL6, IL10, IL12 or HLA-DR level in a sample obtained from the IBD patient during a period when the patient is administered with an anti-SMAD7 treatment, or at the beginning of a treatment period (e.g., during week 0, baseline level). In some embodiments, the control level of the IBD patient is the IL6, IL12 or HLA-DR in a sample obtained from the IBD patient at an earlier timepoint during an anti-SMAD7 treatment period.
[1039] In another aspect, provided herein is a method for treating or managing IBD in a patient having IBD with respect to administration of an initial dose of a SMAD7 AON. In one embodiment, the provided herein is a method for treating or managing TBD in a patient having IBD, where the method comprises the following steps: (a) analyzing the level of IL6, IL12 or HLA-DR in the patient; and (b) if the level of IL6, IL12 or HLA-DR is above normal levels of IL6, IL12 or HLA-DR then administering to the patient an initial dose of a SMAD7 AON. Additionally, the method can further comprise the steps of: (c) analyzing the level of IL6, IL12, or HLA-DR in the patient after said administering step, i.e., step (b); and (d) if the level of IL6, IL12, or HLA-DR is above normal levels of IL6, IL12 or HLA-DR then administering to the patient a subsequent dose that is greater than or equal to the initial dose. Alternatively, if in step (d), the level of IL6, IL12 or HLA-DR is below normal levels of IL6, L12 or HLA-DR, as determined in step (c), then step (d) comprises administering to the patient a subsequent dose that is equal to or smaller than the initial dose. In some instances, if the subsequent dose administered in step (d) is equal to or greater than the maximum tolerated dose (MTD), then the method comprises the step of terminating the treatment.
[1040] The level of IL6, IL12 or HLA-DR can be analyzed at any timepoint during an administration schedule in a method for treating IBD provided herein. For example, the IL6, IL12 or HLA-DR level can be analyzed before or after administering an anti-SMAD7 therapy (e.g., at least 1 day, at least 3 days, at least 5 days, at least 1 week, at least 2 weeks, at least 3 weeks, at least 1 month, at least 2 months, at least 4 months, or at least 6 months), or concurrently with administering the anti-SMAD7 therapy.
[1041] The level of IL6, IL12 or HLA-DR can be analyzed at varying time points following an administering step (b). For instance, in some embodiments, following an administering step (b), the level of IL6, IL12 or HLA-DR is analyzed at least 1 day, at least 3 days, at least 5 days, at least 1 week, at least 2 weeks, at least 3 weeks, at least 1 month, at least 2 months, at least 4 months, or at least 6 months after said administration step. In some embodiments, the level of IL6, IL12 or HLA-DR is analyzed immediately after said administration step. In yet other embodiments, the level of IL6, IL12 or HLA-DR is analyzed about 7 days, about 10 days, about 15 days, about 20 days, about 25 days, or about 28 days after said administration step.
[1042] Normal levels of IL6, IL12 or HLA-DR can be determined based on numerical reference values or with respect to levels of IL6, IL12 or HLA-DR in a healthy control group. For instance, in some embodiments, normal levels of IL6 levels in a blood, serum or plasma sample from the patient having IBD are <600 pg/ml, <500 pg/ml, <400 pg/ml, or <300 pg/ml. In some embodiments, normal levels of IL12 levels in a blood, scrum or plasma sample from the patient having IBD are <100 pg/ml, <75 pg/ml, <50 pg/ml, or <25 pg/ml.
[1043] In other embodiments of the invention, normal levels of IL6, IL12 or HLA-DR are defined as median levels of IL 6, IL12 or HLA-DR in a healthy control group. A healthy control group can be defined based on various criteria related to genetic background, habits, and physical attributes matched to the same set of criteria in the patient. For instance, in some embodiments, the healthy control group and the patient having IBD are matched with respect to age, gender, ethnic origin, smoking habits, dietary habits, body-mass index (BMI), and/or exercise habits.
[1044] In various embodiments of the invention, the initial dose of a SMAD7 AON administered to a patient having IBD can vary. For instance, in some embodiments, the initial dose of a SMAD7 AON administered to a patient having IBD is less than 500 mg/day, less than 400 mg/day, less than 300 mg/day, less than 200 mg/day, less than 100 mg/day, less than 90 mg/day, less than 80 mg/day, less than 70 mg/day, less than 60 mg/day, less than 50 mg/day, less than 40 mg/day, less than 30 mg/day, less than 20 mg/day, or less than 10 mg/day. Alternatively, in other embodiments, the initial dose is at least 1 mg/day, at least 5 mg/day, at least 10 mg/day, at least 20 mg/day, at least 30 mg/day, at least 40 mg/day, at least 50 mg/day, at least 60 mg/day, at least 70 mg/day, at least 80 mg/day, at least 90 mg/day, at least 100 mg/day, at least 200 mg/day, at least 300 mg/day, at least 400 mg/day, or at least 500 mg/day. In yet other embodiments, the initial dose is about 5 mg/day, about 10 mg/day, about 20 mg/day, about 30 mg/day, about 40 mg/day, about 50 mg/day, about 60 mg/day, about 70 mg/day, about 80 mg/day, about 90 mg/day, about 100 mg/day, about 200 mg/day, about 300 mg/day, about 400 mg/day, or about 500 mg/day. In some embodiments, the initial dose is 5 mg/day, 10 mg/day, 20 mg/day, 30 mg/day, 40 mg/day, 50 mg/day, 60 mg/day, 70 mg/day, 80 mg/day, 90 mg/day, 100 mg/day, 110 mg/day, 120 mg/day, 130 mg/day, 140 mg/day, 150 mg/day, 160 mg/day, 170 mg/day, 180 mg/day, 190 mg/day, or 200 mg/day.
[1045] In some embodiments of a method for treating or managing inflammatory bowel disease (IBD) provided in this section, after analyzing the level of IL6, IL12 or HLA-DR in the patient in a step (b) or (c), if the level of IL6, IL12 or HLA-DR is above normal levels of IL 6, IL12 or HLA-DR then the method can comprise the step of administering to the patient a subsequent dose that is greater than the initial dose. In some embodiments, after analyzing the level of IL6, IL12 or HLA-DR in the patient in a step (b) or (c), if the level of IL6, IL12 or HLA-DR is below normal levels of IL6, IL12 or HLA-DR then the method can comprise the step of administering to the patient a subsequent dose that is smaller than the initial dose.
[1046] In another aspect, provided herein is a method for determining the level of a subsequent dose of SMAD7 AON with respect to an initial dose of SMAD7 AON based on levels of IL6, IL12 or HLA-DR in a patient having IBD. For instance, in embodiments of the invention described herein, if IL6, IL12 or HLA-DR levels in a patient having IBD are above normal levels following an initial administration step (a) or (b), the subsequent dose administered in a step (c) or (d) is at least about 5 mg/day, at least about 10 mg/day, at least about 20 mg/day, at least about 30 mg/day, at least about 40 mg/day, at least about 50 mg/day, at least about 60 mg/day, at least about 70 mg/day, at least about 80 mg/day, at least about 90 mg/day, at least about 100 mg/day, at least about 110 mg/day, at least about 120 mg/day, at least about 130 mg/day, at least about 140 mg/day, at least about 150 mg/day, or at least about 160 mg/day, at least about 170 mg/day, at least about 180 mg/day, at least about 190 mg/day, or at least about 200 mg/day greater than the initial dose. Alternatively, in some embodiments, if IL6, IL12 or HLA-DR levels in a patient having IBD are below normal levels following an initial administration step (a) or (b), the subsequent dose administered in a step (c) or (d) is at least about 5 mg/day, at least about 10 mg/day, at least about 20 mg/day, at least about 30 mg/day, at least about 40 mg/day, at least about 50 mg/day, at least about 60 mg/day, at least about 70 mg/day, at least about 80 mg/day, at least about 90 mg/day, or at least about 100 mg/day smaller than the initial dose. Furthermore, in some embodiments, the initial dose administered in an initial administration step (a) or (b) is between about 10 mg/day and 100 mg/day, about 5 mg/day and 200 mg/day, about 10 mg/day and 50 mg/day, about 50 mg/day and 100 mg/day, and about 100 mg/day and about 200 mg/day, and the subsequent dose administered in a step (c) or (d) is between about 30 mg/day and 200 mg/day, about 5 mg/day and 30 mg/day, about 20 mg/day and 50 mg/day, about 50 mg/day and 100 mg/day, or about 100 mg/day and 200 mg/day.
[1047] In another aspect, provided herein is a method for modulating treatment with a SMAD7 AON in a patient with IBD based on a comparison of relative levels of IL6, IL12 or HLA-DR in a patient before and after an initial administering step. The method comprises the following steps: (a) analyzing the level of IL6, IL12 or HLA-DR in the patient; and (b) if the level of IL6, IL12 or HLA-DR is above normal levels of IL 6, IL12 or HLA-DR, then administering to the patient an initial dose of a SMAD7 AON; (c) analyzing the level of IL6, IL12 or HLA-DR in the patient after said administering step; and (d) if the level of IL6, IL12 or HLA-DR is lower after said administration step than the level of IL6, IL12, or HLA-DR before said administration step, then administering to the patient a subsequent dose that is the same as the initial dose or smaller than the initial dose. Alternatively, in step (d) if the level of IL6, IL12, or HLA-DR is unchanged or increased after said administration step (i.e., step (b)) compared to the level of IL6, IL12 or HLA-DR before said administration step, then step (d) comprises administering to the patient a subsequent dose that is greater than the initial dose or terminating the treatment. Alternatively, in step (d) if the patient is in clinical remission and the level of IL6, IL12 or HLA-DR is unchanged or increased after said administration step (i.e., step (b)) compared to the level of IL6, IL12 or HLA-DR before said administration step, then step (d) comprises terminating the treatment.
[1048] In some embodiments of a method provided in this section, a change in IL6, IL12 or HLA-DR levels observed after an initial administration step (of SMAD7 AON) compared to IL6, IL12 or HLA-DR levels prior to the administration step can be analyzed, for example, as a change in percent of IL6, IL12 or HLA-DR to determine the amount of a subsequent dose of SMAD7 AON to be administered to a patient with IBD. For example, in some embodiments, if the level of IL 6, IL12 or HLA-DR is at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% decreased after said administration step (e.g., an administration step (b)) compared to the level of IL6, IL12 or HLA-DR before said administration step, then the method comprises a step (e.g., an administration step (d)) of administering to the patient a subsequent dose that is the same as the initial dose or smaller than the initial dose.
[1049] In another aspect, provided herein is a method for determining the probability that a patient having IBD will experience clinical remission following treatment with a SMAD7 AON based on a comparison of IL6, IL12 or HLA-DR, for example, based on a comparison of percent change in IL6, IL12, or HLA-DR levels before and after treatment with a SMAD7 AON. For example, in some embodiments, the methods described herein further comprise the step of determining that the patient having IBD has a greater than 20%, greater than 30%, greater than 40%, greater than 50%, greater than 60%, greater than 70%, greater than 80%, greater than 90% or greater than 100% chance of experiencing clinical remission of the IBD for a time period of at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 6 weeks or at least 8 weeks, if the level of IL 6, IL12 or HLA-DR after an administering step (e.g., an administering step (b)) is at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% decreased compared to the level of IL6, IL12 or HLA-DR before the administration step.
[1050] Clinical remission, as described herein, can be determined by comparison to a reference value, for example, a Crohn's Disease Activity Index (CDAI) or a Modified Mayo Score (MMS). In some embodiments of the invention, clinical remission in a patient having IBD is indicated by a CDAI score of less than 150 (CDAI<150) or by an MMS of 2 or less (MMS2). See, e.g., Section 6.2.2.
[1051] In some embodiments of a method provided in this section, a clinical response or clinical remission can be observed at a given time point or within a given time frame with respect to administration of the SMAD7 AON (e.g., using an analysis described in Section 6.2, including, e.g., CDAI score). For example, in some embodiments, clinical remission is observed about one day, about 3 days, about one week, about two weeks, about three weeks, about four weeks, about six weeks, about eight weeks, or about ten weeks after an administration step (for example, an administration step (b)) and maintained for a period of at least 3 days, at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 6 weeks at least 8 weeks, or at least 10 weeks. Similarly, some embodiments of the invention comprise a method of determining that the patient having IBD has a chance of experiencing clinical remission of IBD, where the patient having IBD had a CDAI of between about 220 and about 400, about 150 and about 200, about 200 and about 250, about 250 and about 300, about 300 and about 350, about 350 and about 400, about 400 and about 450, or greater than about 450 one week prior to an anti-SMAD7 therapy administration step (for example, an administration step (b)). Some embodiments of the invention comprise a method of determining that the patient having IBD has a chance of experiencing clinical remission of IBD, where the patient having IBD had a MMS of between about 4 and about 9, between about 2 and about 4, between about 4 and about 6, between about 6 and about 8, or greater than about 8 one week prior to an anti-SMAD7 therapy administration step (for example, an administration step (b)).
[1052] In some embodiments, a method of treating or managing IBD in a patient with above normal levels of IL6, IL12 or HLA-DR, comprises administering to the patient a dose of SMAD7 AON. Furthermore, in some embodiments, a methods for treating or managing IBD in a patient who has above normal IL 6, IL12 or HLA-DR levels following administration of a dose of a SMAD7 AON, comprises administered a further dose of the SMAD7 AON that is greater than or equal to the prior dose. Similarly, in some embodiments of a method of treating or managing IBD, the patient having IBD has below normal IL6, IL12 or HLA-DR levels following administration of a dose of SMAD7 AON. In the latter case, the method will comprise administering to the patient a further dose of the SMAD7 AON that is less than or equal to the prior dose. In some embodiments, administration of the SMAD7 AON to the patient is repeated until the patient shows a clinical response or remission, e.g., based on monitoring a clinical parameter described in Section 6.2, e.g., until the levels of a biomarker, e.g., SMAD7, Foxp3, CCR9, CCL20, IL10, CD4, CD8, IFN-, IL17, IL4, IL8, CRP, TNF, FCP reach normal levels or until the patient achieves a CDAI score of less than 150, or based on any other clinical parameter described in Section 6.2.
[1053] In some embodiments of a method of treating or managing IBD in a patient having above normal levels of IL6, IL12 or HLA-DR, the amount of a SMAD7 AON administered to the patient is increased until IL6, IL12 or HLA-DR levels in the patient decrease. In such embodiments, levels of SMAD7 AON administered to the patient can be increased until the level of IL6, IL12 or HLA-DR in the patient decreases to about a normal level of IL6, IL12 or HLA-DR or a below normal level of IL6, IL12 or HLA-DR.
[1054] In some embodiments of a method of treating or managing IBD comprises monitoring the treatment or management of IBD in a patient with IBD, that comprises analyzing IL6, IL12 or HLA-DR levels in the patient following each SMAD7 AON administration. Utilizing these methods, the absence of a decrease in IL 6, IL12 or HLA-DR levels indicates that the treatment or management is not effective. In such embodiments, IL6, IL12 or HLA-DR levels can be analyzed one time or multiple times, for instance, two times, three times, four times, about five times, about 10 times, about 15 times, about 20 times, or about 30 times, after each administration of SMAD7 AON. Furthermore, the timing of the measurement of IL6, IL12 or HLA-DR levels can vary with respect to the time of SMAD7 AON administration such that IL6, IL12 or HLA-DR levels can be analyzed immediately after, about 1 hour after, about 3 hours after, about 6 hours after, about 12 hours after, about 1 day after, about 3 days after, about 1 week after, about 2 weeks after, and/or about 1 month after SMAD7 AON administration.
[1055] In order to determine levels of a biomarker or analyte, for example, IL6, IL12 or HLA-DR, in a patient having IBD using the methods described herein, a sample can be obtained from the patient. Therefore, in some embodiments of a method of treating or managing IBD provided in this section, the level of IL6, IL12 or HLA-DR in the patient having IBD is determined in a sample obtained from the patient having IBD. Analytes other than or in addition to IL6, IL12 or HLA-DR, for example, but not limited to Fecal Calprotectin (FCP), Interleukin-8 (IL8), Interleukin-17 (IL17A), Interferon gamma (IFN-,) Tumor Necrosis Factor alpha (TNF), Cluster of Differentiation 4 (CD4), Cluster of Differentiation 8 (CD8) and C-Reactive Protein (CRP), can also be determined in methods of the invention. Thus, in some embodiments, the method comprises determining a level, or multiple levels, of one or more additional analytes in the patient having IBD. Analytes of TNF comprise RNA, DNA, and protein products of or derived from the TNF gene, described by NCBI Reference Sequence: NG_007462.1. Analytes of CRP comprise RNA, DNA, and protein products of or derived from the CRP gene, described by NCBI Reference Sequence: NG_013007.1. Analytes of IL8 comprise RNA, DNA, and protein products of or derived from the TNF gene, described by NCBI Reference Sequence: NG_029889.1. Analytes of FCP comprise RNA, DNA, and protein products of or derived from the FCP gene, described by Entrez GeneID No. 6280. Analytes of IL6 comprise RNA, DNA, and protein products of or derived from the IL6 gene, described by Entrez GeneID No. 3569. Analytes of IL8 comprise RNA, DNA, and protein products of or derived from the IL8 gene, described by Entrez GeneID No. 3567. Analytes of IL12 comprise RNA, DNA, and protein products of or derived from the IL12 gene, described by Entrez GeneID No. 3593. Analytes of IL17 comprise RNA, DNA, and protein products of or derived from the IL17A gene, described by Entrez GeneID No. 3605. Analytes of IFN comprise RNA, DNA, and protein products of or derived from the IFN gene, described by Entrez GeneID No. 3458. Analytes of CD4 comprise RNA, DNA, and protein products of or derived from the CD4 gene, described by Entrez GeneID No. 920. Analytes of CD8 comprise RNA, DNA, and protein products of or derived from the CD8 gene, described by Entrez GeneID No. 925. Analytes of HLA-DR comprise RNA, DNA, and protein products of or derived from the HLA-DR gene family (including, e.g., HLA-DRA, HLA-DRB1, HLA-DRB3, HLA-DRB4, and HLA-DRB5), described, e.g., by Entrez GeneID Nos. 3122, 3123, 3125, 3126, and 3127.
[1056] Samples containing analytes of interest, for example, SMAD7, phosphor-SMAD3, HLA-DR, TNF, CRP, IFN-, IL6, IL8, IL12, IL17, CD4 and/or CD8, obtained from the patient having IBD, can comprise blood, serum, or plasma samples. Samples containing FCP can comprise stool samples. Stool samples can be wet stool samples or dry stool samples. Samples can also comprise tissue samples such as, but not limited to, tissue, gastrointestinal, mucosal, submucosal, intestinal, esophageal, ileal, rectal, or lymphatic samples. Levels of analytes of interest in a sample from a patient having IBD can be determined using various assays. For example, in methods of the invention, the level of FCP and/or another analyte can be determined by immunochemistry, for example, by an enzyme-linked immunosorbent assay (ELISA), or by nucleotide analysis.
[1057] Methods provided herein comprise methods for treating and managing various forms of IBD. For example, the invention comprises methods for treating and managing IBD, where the IBD is Crohn's Disease (CD) or ulcerative colitis (UC). The contemplated invention also provides methods for treating different types of patients with IBD, including, for example, but not limited to, IBD patients that are steroid-dependent patients with active CD; and steroid-resistant patients with active CD.
[1058] It will be appreciated that the SMAD7 AON administered to the patient having IBD in methods of the invention described herein, can be administered by various administration routes. In various embodiments, the SMAD7 AON can be administered by one or several routes, including orally, topically, parenterally, e.g., by subcutaneous injection, by inhalation spray, or rectally. The term parenteral as used herein comprises subcutaneous injections, intrapancreatic administration, intravenous, intramuscular, intraperitoneal, intrasternal injection or infusion techniques. In a preferred embodiment, the SMAD7 AON may be administered orally to the patient having IBD
[1059] The SMAD7 AONs described in Section 6.11 can, for example, be used in the methods of the invention described herein.
6.5 Phospho-SMAD3
[1060] In the methods provided herein, the biomarker phospho-SMAD3 can be used to monitor the activities of an anti-SMAD7 treatment, as described in Section 6.2 (e.g., to analyze if a patient shows a clinical response to a SMAD7 AON, or if a patient experiences remission). In some embodiments, phospho-SMAD3 levels in an IBD patient sample can inform a decision regarding whether an IBD patient is transitioning from the first to the second treatment phase (e.g., if the patient shows a clinical response to a SMAD7 AON or if the patient shows remission), e.g., as described in Section 6.1.
[1061] In other methods provided herein, phospho-SMAD3 can be used as biomarkers for patient selection.
[1062] In another aspect, provided herein is a method for treating or managing IBD in a patient having IBD. In one embodiment, the method comprises the following steps: (a) of administering to the patient an initial dose of a SMAD7 AON; (b) analyzing the level of phospho-SMAD3 in the patient; and (c) if the level of phospho-SMAD3 is below normal levels of phospho-SMAD3 then administering to the patient a subsequent dose that is greater than or equal to the initial dose. Alternatively, if in step (c), the level of phospho-SMAD3 is above normal levels of phospho-SMAD3 as determined in step (b), then step (c) comprises administering to the patient a subsequent dose that is equal to or smaller than the initial dose.
[1063] In another aspect, provided herein is a method for treating or managing inflammatory bowel disease (IBD) in a patient having IBD, wherein the method comprises (a) establishing a control level of phospho-SMAD3 for the patient; (b) administering to the patient an initial dose of a SMAD7 AON; c) analyzing the level of phospho-SMAD3 in the patient; and (d) if the level of phospho-SMAD3 is higher than the control level, then administering to the patient a subsequent dose that is the same as the initial dose or smaller than the initial dose, or, if the level of phospho-SMAD3 is unchanged or lower compared to the control level, then administering to the patient a subsequent dose that is the same as the initial dose or greater than the initial dose or terminating the treatment.
[1064] In some embodiments, the control level for the IBD patient is the phospho-SMAD3 level in a sample obtained from the IBD patient prior to administration of the first anti-SMAD7 treatment during a chronic disease period, e.g., when the patient was in remission. In some embodiments, the control level for the IBD patient is the phospho-SMAD3 level in a sample obtained from the IBD patient prior to administration of the first anti-SMAD7 treatment during an acute disease period (e.g., CDAI>150; CDAI250 and 450; MMS4 and 9). In some embodiments, the control level for the IBD patient is the phospho-SMAD3 level in a sample obtained from the IBD patient during a period when the patient is administered with an anti-SMAD7 treatment, or at the beginning of a treatment period (e.g., during week 0, baseline level). In some embodiments, the control level of the IBD patient is the phospho-SMAD3 in a sample obtained from the IBD patient at an earlier timepoint during an anti-SMAD7 treatment period.
[1065] In another aspect, provided herein is a method for treating or managing IBD in a patient having IBD with respect to administration of an initial dose of a SMAD7 AON. In one embodiment, the provided herein is a method for treating or managing IBD in a patient having IBD, where the method comprises the following steps: (a) analyzing the level of phospho-SMAD3 in the patient; and (b) if the level of phospho-SMAD3 is below normal levels of phospho-SMAD3 then administering to the patient an initial dose of a SMAD7 AON. Additionally, the method can further comprise the steps of: (c) analyzing the level of phospho-SMAD3 in the patient after said administering step, i.e., step (b); and (d) if the level of phospho-SMAD3 is below normal levels of phospho-SMAD3 then administering to the patient a subsequent dose that is greater than or equal to the initial dose. Alternatively, if in step (d), the level of phospho-SMAD3 is above normal levels of phospho-SMAD3, as determined in step (c), then step (d) comprises administering to the patient a subsequent dose that is equal to or smaller than the initial dose. In some instances, if the subsequent dose administered in step (d) is equal to or greater than the maximum tolerated dose (MTD), then the method comprises the step of terminating the treatment.
[1066] The level of phospho-SMAD3 can be analyzed at any timepoint during an administration schedule in a method for treating IBD provided herein. For example, the phospho-SMAD3 can be analyzed before or after administering an anti-SMAD7 therapy (e.g., at least 1 day, at least 3 days, at least 5 days, at least 1 week, at least 2 weeks, at least 3 weeks, at least 1 month, at least 2 months, at least 4 months, or at least 6 months), or concurrently with administering the anti-SMAD7 therapy.
[1067] The level of phospho-SMAD3 can be analyzed at varying time points following an administering step (b). For instance, in some embodiments, following an administering step (b), the level of phospho-SMAD3 is analyzed at least 1 day, at least 3 days, at least 5 days, at least 1 week, at least 2 weeks, at least 3 weeks, at least 1 month, at least 2 months, at least 4 months, or at least 6 months after said administration step. In some embodiments, the level of phospho-SMAD3 is analyzed immediately after said administration step. In yet other embodiments, the level of phospho-SMAD3 is analyzed about 7 days, about 10 days, about 15 days, about 20 days, about 25 days, or about 28 days after said administration step.
[1068] Normal levels of phospho-SMAD3 can be determined by comparison with levels of phospho-SMAD3 in a healthy control group.
[1069] In other embodiments of the invention, normal levels of phospho-SMAD3 are defined as median levels of phospho-SMAD3 in a healthy control group. A healthy control group can be defined based on various criteria related to genetic background, habits, and physical attributes matched to the same set of criteria in the patient. For instance, in some embodiments, the healthy control group and the patient having IBD are matched with respect to age, gender, ethnic origin, smoking habits, dietary habits, body-mass index (BMT), and/or exercise habits.
[1070] In various embodiments of the invention, the initial dose of a SMAD7 AON administered to a patient having IBD can vary. For instance, in some embodiments, the initial dose of a SMAD7 AON administered to a patient having IBD is less than 500 mg/day, less than 400 mg/day, less than 300 mg/day, less than 200 mg/day, less than 100 mg/day, less than 90 mg/day, less than 80 mg/day, less than 70 mg/day, less than 60 mg/day, less than 50 mg/day, less than 40 mg/day, less than 30 mg/day, less than 20 mg/day, or less than 10 mg/day. Alternatively, in other embodiments, the initial dose is at least 1 mg/day, at least 5 mg/day, at least 10 mg/day, at least 20 mg/day, at least 30 mg/day, at least 40 mg/day, at least 50 mg/day, at least 60 mg/day, at least 70 mg/day, at least 80 mg/day, at least 90 mg/day, at least 100 mg/day, at least 200 mg/day, at least 300 mg/day, at least 400 mg/day, or at least 500 mg/day. In yet other embodiments, the initial dose is about 5 mg/day, about 10 mg/day, about 20 mg/day, about 30 mg/day, about 40 mg/day, about 50 mg/day, about 60 mg/day, about 70 mg/day, about 80 mg/day, about 90 mg/day, about 100 mg/day, about 200 mg/day, about 300 mg/day, about 400 mg/day, or about 500 mg/day. In some embodiments, the initial dose is 5 mg/day, 10 mg/day, 20 mg/day, 30 mg/day, 40 mg/day, 50 mg/day, 60 mg/day, 70 mg/day, 80 mg/day, 90 mg/day, 100 mg/day, 110 mg/day, 120 mg/day, 130 mg/day, 140 mg/day, 150 mg/day, 160 mg/day, 170 mg/day, 180 mg/day, 190 mg/day, or 200 mg/day.
[1071] In some embodiments of a method for treating or managing inflammatory bowel disease (IBD) provided in this section, after analyzing the level of phospho-SMAD3 in the patient in a step (b) or (c), if the level of phospho-SMAD3 is below normal levels of phospho-SMAD3 then the method can comprise the step of administering to the patient a subsequent dose that is greater than the initial dose. In some embodiments, after analyzing the level of phospho-SMAD3 in the patient in a step (b) or (c), if the level of phospho-SMAD3 is above normal levels of phospho-SMAD3 then the method can comprise the step of administering to the patient a subsequent dose that is smaller than the initial dose.
[1072] In another aspect, provided herein is a method for determining the level of a subsequent dose of SMAD7 AON with respect to an initial dose of SMAD7 AON based on levels of phospho-SMAD3 in a patient having IBD. For instance, in embodiments of the invention described herein, phospho-SMAD3 levels in a patient having IBD are below normal levels following an initial administration step (a) or (b), the subsequent dose administered in a step (c) or (d) is at least about 5 mg/day, at least about 10 mg/day, at least about 20 mg/day, at least about 30 mg/day, at least about 40 mg/day, at least about 50 mg/day, at least about 60 mg/day, at least about 70 mg/day, at least about 80 mg/day, at least about 90 mg/day, at least about 100 mg/day, at least about 110 mg/day, at least about 120 mg/day, at least about 130 mg/day, at least about 140 mg/day, at least about 150 mg/day, or at least about 160 mg/day, at least about 170 mg/day, at least about 180 mg/day, at least about 190 mg/day, or at least about 200 mg/day greater than the initial dose. Alternatively, in some embodiments, if phospho-SMAD3 levels in a patient having IBD are above normal levels following an initial administration step (a) or (b), the subsequent dose administered in a step (c) or (d) is at least about 5 mg/day, at least about 10 mg/day, at least about 20 mg/day, at least about 30 mg/day, at least about 40 mg/day, at least about 50 mg/day, at least about 60 mg/day, at least about 70 mg/day, at least about 80 mg/day, at least about 90 mg/day, or at least about 100 mg/day smaller than the initial dose. Furthermore, in some embodiments, the initial dose administered in an initial administration step (a) or (b) is between about 10 mg/day and 100 mg/day, about 5 mg/day and 200 mg/day, about 10 mg/day and 50 mg/day, about 50 mg/day and 100 mg/day, and about 100 mg/day and about 200 mg/day, and the subsequent dose administered in a step (c) or (d) is between about 30 mg/day and 200 mg/day, about 5 mg/day and 30 mg/day, about 20 mg/day and 50 mg/day, about 50 mg/day and 100 mg/day, or about 100 mg/day and 200 mg/day.
[1073] In another aspect, provided herein is a method for modulating treatment with a SMAD7 AON in a patient with IBD based on a comparison of relative levels of phospho-SMAD3 in a patient before and after an initial administering step. The method comprises the following steps: (a) analyzing the level of phospho-SMAD3 in the patient; and (b) if the level of phospho-SMAD3 is below normal levels of phospho-SMAD3, then administering to the patient an initial dose of a SMAD7 AON; (c) analyzing the level of phospho-SMAD3 in the patient after said administering step; and (d) if the level of phospho-SMAD3 is higher after said administration step than the level of phospho-SMAD3 before said administration step, then administering to the patient a subsequent dose that is the same as the initial dose or smaller than the initial dose. Alternatively, in step (d) if the level of phospho-SMAD3 is unchanged or lower after said administration step (i.e., step (b)) compared to the level of phospho-SMAD3 before said administration step, then step (d) comprises administering to the patient a subsequent dose that is greater than the initial dose or terminating the treatment. Alternatively, in step (d) if the patient is in clinical remission and the level of phospho-SMAD3 is unchanged or decreased after said administration step (i.e., step (b)) compared to the level of phospho-SMAD3 before said administration step, then step (d) comprises terminating the treatment.
[1074] In some embodiments of a method provided in this section, a change in phospho-SMAD3 levels observed after an initial administration step (of SMAD7 AON) compared to phospho-SMAD3 levels prior to the administration step can be analyzed, for example, as a change in percent of phospho-SMAD3 to determine the amount of a subsequent dose of SMAD7 AON to be administered to a patient with IBD. For example, in some embodiments, if the level of phospho-SMAD3 is at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, or at least 10-fold increased after said administration step (e.g., an administration step (b)) compared to the level of phospho-SMAD3 before said administration step, then the method comprises a step (e.g., an administration step (d)) of administering to the patient a subsequent dose that is the same as the initial dose or smaller than the initial dose.
[1075] In another aspect, provided herein is a method for determining the probability that a patient having IBD will experience clinical remission following treatment with a SMAD7 AON based on a comparison of phospho-SMAD3, for example, based on a comparison of percent change in phospho-SMAD3 levels before and after treatment with a SMAD7 AON. For example, in some embodiments, the methods described herein further comprise the step of determining that the patient having IBD has a greater than 20%, greater than 30%, greater than 40%, greater than 50%, greater than 60%, greater than 70%, greater than 80%, greater than 90% or greater than 100% chance of experiencing clinical remission of the IBD for a time period of at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 6 weeks or at least 8 weeks, if the level of phospho-SMAD3 after an administering step (e.g., an administering step (b)) is at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, or at least 10-fold increased compared to the level of phospho-SMAD3 before the administration step.
[1076] Clinical remission, as described herein, can be determined by comparison to a reference value, for example, a Crohn's Disease Activity Index (CDAI) or Modified Mayo Score (MMS). In some embodiments of the invention, clinical remission in a patient having IBD is indicated by a CDAI score of less than 150 (CDAI<150) or an MMS2. See, e.g., Section 6.2.2.
[1077] In some embodiments of a method provided in this section, a clinical response or clinical remission can be observed at a given time point or within a given time frame with respect to administration of the SMAD7 AON (e.g., using an analysis described in Section 6.2, including, e.g., CDAI score or MMS). For example, in some embodiments, clinical remission is observed about one day, about 3 days, about one week, about two weeks, about three weeks, about four weeks, about six weeks, about eight weeks, or about ten weeks after an administration step (for example, an administration step (b)) and maintained for a period of at least 3 days, at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 6 weeks at least 8 weeks, or at least 10 weeks. Similarly, some embodiments of the invention comprise a method of determining that the patient having IBD has a chance of experiencing clinical remission of IBD, where the patient having IBD had a CDAI of between about 220 and about 400, between about 150 and about 200, between about 200 and about 250, between about 250 and about 300, between about 300 and about 350, between about 350 and about 400, between about 400 and about 450, or greater than about 450 one week prior to an anti-SMAD7 therapy administration step (for example, an administration step (b)). Some embodiments of the invention comprise a method of determining that the patient having IBD has a chance of experiencing clinical remission of IBD, where the patient having IBD had a MMS of between about 4 and about 9, between about 2 and about 4, between about 4 and about 6, between about 6 and about 8, or greater than about 8 one week prior to an anti-SMAD7 therapy administration step (for example, an administration step (b)).
[1078] In some embodiments, a method of treating or managing IBD in a patient with above normal levels of phospho-SMAD3, comprises administering to the patient a dose of SMAD7 AON. Furthermore, in some embodiments, a methods for treating or managing IBD in a patient who has above normal phospho-SMAD3 levels following administration of a dose of a SMAD7 AON, comprises administered a further dose of the SMAD7 AON that is greater than or equal to the prior dose. Similarly, in some embodiments of a method of treating or managing IBD, the patient having IBD has below normal phospho-SMAD3 levels following administration of a dose of SMAD7 AON. In the latter case, the method will comprise administering to the patient a further dose of the SMAD7 AON that is less than or equal to the prior dose. In some embodiments, administration of the SMAD7 AON to the patient is repeated until the patient shows a clinical response or remission, e.g., based on monitoring a clinical parameter described in Section 6.2, e.g., until the levels of a biomarker, e.g., SMAD7, Foxp3, CCR9, CCL20, IL4, IL10, CD4, CD8, IFN-, IL17, IL8, CRP, TNF, FCP reach normal levels or until the patient achieves a CDAI score of less than 150, or based on any other clinical parameter described in Section 6.2.
[1079] In some embodiments of a method of treating or managing IBD in a patient having below normal levels of phospho-SMAD3, the amount of a SMAD7 AON administered to the patient is increased until phospho-SMAD3 levels in the patient increase. In such embodiments, levels of SMAD7 AON administered to the patient can be increased until the level of phospho-SMAD3 in the patient increases to about a normal level of phospho-SMAD3 or a above normal level of phospho-SMAD3.
[1080] In some embodiments of a method of treating or managing IBD comprises monitoring the treatment or management of IBD in a patient with IBD, that comprises analyzing phospho-SMAD3 levels in the patient following each SMAD7 AON administration. Utilizing these methods, the absence of an increase in phospho-SMAD3 levels indicates that the treatment or management is not effective. In such embodiments, phospho-SMAD3 levels can be analyzed one time or multiple times, for instance, two times, three times, four times, about five times, about 10 times, about 15 times, about 20 times, or about 30 times, after each administration of SMAD7 AON. Furthermore, the timing of the measurement of phospho-SMAD3 levels can vary with respect to the time of SMAD7 AON administration such that phospho-SMAD3 levels can be analyzed immediately after, about 1 hour after, about 3 hours after, about 6 hours after, about 12 hours after, about 1 day after, about 3 days after, about 1 week after, about 2 weeks after, and/or about 1 month after SMAD7 AON administration.
[1081] In order to determine levels of a biomarker or analyte, for example, phospho-SMAD3, in a patient having IBD using the methods described herein, a sample can be obtained from the patient. Therefore, in some embodiments of a method of treating or managing IBD provided in this section, the level of phospho-SMAD3 in the patient having IBD is determined in a sample obtained from the patient having IBD. Analytes other than or in addition to phospho-SMAD3, for example, but not limited to Fecal Calprotectin (FCP), Interleukin-8 (IL8), Interleukin-17 (IL17), Interferon gamma (IFN-,) Tumor Necrosis Factor alpha (TNF), Cluster of Differentiation 4 (CD4), Cluster of Differentiation 8 (CD8) and C-Reactive Protein (CRP), can also be determined in methods of the invention. Thus, in some embodiments, the method comprises determining a level, or multiple levels, of one or more additional analytes in the patient having IBD. Analytes of TNF comprise RNA, DNA, and protein products of or derived from the TNF gene, described by NCBI Reference Sequence: NG_007462.1. Analytes of CRP comprise RNA, DNA, and protein products of or derived from the CRP gene, described by NCBI Reference Sequence: NG_013007.1. Analytes of IL8 comprise RNA, DNA, and protein products of or derived from the TNF gene, described by NCBI Reference Sequence: NG_029889.1. Analytes of FCP comprise RNA, DNA, and protein products of or derived from the FCP gene, described by Entrez GeneID No. 6280. Analytes of IL6 comprise RNA, DNA, and protein products of or derived from the IL6 gene, described by Entrez GeneID No. 3569. Analytes of IL8 comprise RNA, DNA, and protein products of or derived from the IL8 gene, described by Entrez GeneID No. 3567. Analytes of IL12 comprise RNA, DNA, and protein products of or derived from the IL12 gene, described by Entrez GeneID No. 3593. Analytes of IL17 comprise RNA, DNA, and protein products of or derived from the IL17A gene described by Entrez GeneID No. 3605. Analytes of CD4 comprise RNA, DNA, and protein products of or derived from the CD4 gene, described by Entrez GeneID No. 920. Analytes of CD8 comprise RNA, DNA, and protein products of or derived from the CD8 gene, described by Entrez GeneID No. 925. Analytes of HLA-DR comprise RNA, DNA, and protein products of or derived from the HLA-DR gene family (including, e.g., HLA-DRA, HLA-DRB1, HLA-DRB3, HLA-DRB4, and HLA-DRB5), described, e.g., by Entrez GeneID Nos. 3122, 3123, 3125, 3126, and 3127. Analytes of Foxp3 comprise RNA, DNA, and protein products of or derived from the Foxp3 gene, described by Entrez GeneID No. 50943.
[1082] Samples containing analytes of interest, for example, SMAD7, phospho-SMAD3, HLA-DR, TNF, CRP, IFN-, IL6, IL8, IL12, IL17A, CD4 and/or CD8, obtained from the patient having IBD, can comprise blood, serum, plasma samples, or tissue samples, such as a tissue biopsy. Samples containing FCP can comprise stool samples. Stool samples can be wet stool samples or dry stool samples. Samples can also comprise tissue samples such as, but not limited to, tissue, gastrointestinal, mucosal, submucosal, intestinal, esophageal, ileal, rectal, or lymphatic samples. Levels of analytes of interest in a sample from a patient having IBD can be determined using various assays. For example, in methods of the invention, the level of phospho-SMAD3 and/or another analyte can be determined by immunochemistry, for example, by an enzyme-linked immunosorbent assay (ELISA). Alternatively, the level os phosphor-SMAD3 in a sample, such as a tissue biopsy, can be determined in an assay coupling high-pressure liquid chromatography with mass spectrometry (HPLC-MS).
[1083] Methods provided herein comprise methods for treating and managing various forms of IBD. For example, the invention comprises methods for treating and managing IBD, where the IBD is Crohn's Disease (CD) or ulcerative colitis (UC). The contemplated invention also provides methods for treating different types of patients with IBD, including, for example, but not limited to, IBD patients that are steroid-dependent patients with active CD; and steroid-resistant patients with active CD
[1084] It will be appreciated that the SMAD7 AON administered to the patient having IBD in methods of the invention described herein, can be administered by various administration routes. In various embodiments, the SMAD7 AON can be administered by one or several routes, including orally, topically, parenterally, e.g., by subcutaneous injection, by inhalation spray, or rectally. The term parenteral as used herein comprises subcutaneous injections, intrapancreatic administration, intravenous, intramuscular, intraperitoneal, intrasternal injection or infusion techniques. In a preferred embodiment, the SMAD7 AON may be administered orally to the patient having IBD
[1085] The SMAD7 AON described in Section 6.11 can, for example, be used in the methods of the invention described herein.
6.6 IBD Treatment, Management, and Prevention
[1086] The methods recited in this section are useful to treat or manage IBD in a patient or subject having IBD, including, e.g., mild, medium, or severe forms of IBD (e.g., mild, medium, or severe forms of CD or UC), e.g., as determined by a clinical activity parameter or a biomarker level. In some embodiments, the methods are useful to prevent IBD, e.g., in a patient at risk of developing IBD, e.g., as determined by the presence of certain risk factors in the patient, which are known in the art (e.g., genetic, environmental, or lifestyle factors). In some embodiments, the methods provided herein are useful to prevent the reoccurrence of IBD in a patient who has previously received an IBD treatment (e.g., an aminosalicylate treatment or a steroid treatment), which is failing, or in a treatment naive patient who is experiencing a chronic disease with few or no clinical symptoms.
[1087] In some embodiments, treating or managing IBD comprises reducing one or more clinical symptoms of IBD. In some embodiments, treating or managing IBD comprises reducing a symptom of CD, such as belly pain (including, e.g., cramping, soreness to touch, constant ache), diarrhea (including, e.g., blood in stool), loss of appetite, fever, weight loss, anemia, intestinal inflammation, or an infection (e.g., an abscess), an anal fissure, joint pain, eye problems, a skin rash, or liver disease. In some embodiments, treating or managing IBD comprises reducing one or more symptoms of UC, such as intestinal swelling, intestinal inflammation, sores in the lining of the large intestine (colon), diarrhea, belly pain, or bleeding from the rectum. In some embodiments, treating or managing IBD comprises reducing one or more IBD symptoms during a chronic phase of the disease. In some embodiments, treating or managing IBD comprises reducing one or more IBD symptoms during an acute phase of the disease (e.g., during a disease flare up). In some embodiments, treating or managing IBD comprises increasing the time to relapse in an IBD paticnt who has responded to an IBD treatment such as an anti-SMAD7 therapy (e.g., and anti-SMAD7 AON).
[1088] In some embodiments, treating or managing IBD comprises reducing the intensity of a disease flare up. In some embodiments, treating or managing IBD comprises reducing the frequency with which flare ups occur the IBD patient.
[1089] In some embodiments, treating of managing IBD comprises improving the quality of life of an IBD patient (e.g., as determined by a patient survey), e.g., by reducing pain in the IBD patient, improving appetite in the IBD patient, or improving the IBD patient's sleep (e.g., length of uninterrupted sleep).
[1090] In some embodiments, treating or managing IBD comprises, reducing an IBD biomarker level (e.g., hsCRP, FCP, inflammatory cytokine (e.g., IL6, IL8, IL12, IL17, TNF, IFN), phospho-SMAD3 or SMAD7 mRNA or SMAD7 protein levels).
[1091] In some embodiments, treating or managing IBD comprises, increasing an IBD biomarker level (e.g., SMAD3 phosphorylation).
[1092] In some embodiments FCP levels in a fecal sample from the patient having IBD are 50 g/g stool, 75 g/g stool, 100 g/g stool, 125 g/g stool, 150 g/g stool, 175 g/g stool, 200 g/g stool, 225 g/g stool, 250 g/g stool, 275 g/g stool, 300 g/g stool, 325 g/g stool, 350 g/g stool, 375 g/g stool, or 400 g/g stool at a timepoint during the first treatment period or at a timepoint during the second treatment period. FCP levels can be determined in an IBD patient's wet stool sample or dry stool sample. In some embodiments, FCP levels in a fecal sample from the patient having IBD are 200 g/g stool at the end of the first treatment period or at the end of the second treatment period. In some embodiments, FCP levels in a fecal sample from a patient aged 2-9 years are reduced to between about 100 g/g stool and about 200 g/g stool, between about 110 g/g stool and about 190 g/g stool, between about 120 g/g stool and about 180 g/g stool, between about 130 g/g stool and about 170 g/g stool, or between about 140 g/g stool and about 160 g/g stool. In some embodiments, FCP levels in a fecal sample from a patient aged 2-9 years are reduced to about 166 g/mg stool. In some embodiments, FCP levels in a fecal sample from a patient aged 10-59 years are reduced to between about 10 g/g stool and about 100 g/g stool, between about 20 g/g stool and about 90 g/g stool, between about 30 g/g stool and about 80 g/g stool, between about 40 g/g stool and about 70 g/g stool, or between about 50 g/g stool and about 60 g/g stool. In some embodiments, FCP levels in a fecal sample from a patient aged 10-59 years are reduced to about 51 g/g stool. In some embodiments, FCP levels in a fecal sample from a patient aged 60 years are reduced to between about 60 g/g stool and about 160 g/g stool, between about 70 g/g stool and about 150 g/g stool, between about 80 g/g stool and about 140 g/g stool, between about 90 g/g stool and about 130 g/g stool, or between about 100 g/g stool and about 120 g/g stool. In some embodiments, FCP levels in a fecal sample from a patient aged 60 years are reduced to about 112 g/g stool.
[1093] In some embodiments, FCP levels in fecal samples from the patient having IBD are reduced from baseline by 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% at a timepoint during the first treatment period. In some embodiments, FCP levels in fecal samples from the patient having IBD are reduced from baseline by 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% at a timepoint during the second treatment period.
[1094] In some embodiments, treating or managing IBD comprises maintaining an IBD biomarker level in a normal, or near-normal range (e.g., as determined by the respective biomarker levels in a healthy control group). In some embodiments, treating or managing IBD comprises decreasing a clinical activity score, such as an SES-CD, CDAI, UCDAI, PRO-2, abdominal pain, average daily liquid or soft stool frequency score, MMS, PMS, TMS, ES or a histological score. In some embodiments, treating or managing IBD comprises maintaining a clinical activity score, such as a SES-CD, CDAI, UCDAI, PRO-2, abdominal pain, average daily liquid or soft stool frequency score, MMS, PMS, TMS, ES score or a histological score below certain threshold levels (e.g., SES-CD2; CDAI150; PRO-2<8; abdominal pain 1; average daily liquid or soft stool frequency 1.5 or 3.0, TMS score 2; ES=0; PMS score 2; MMS score 2). In some embodiments, treating or managing IBD comprises decreasing a clinical activity score, such as an SES-CD, CDAI, UCDAI, PRO-2, abdominal pain, average daily liquid or soft stool frequency score, MMS, PMS, TMS, ES score or a histological score, by a certain number of points (e.g., a 25% or 50% reduction of SES-CD scores from baseline; reduction of CDAI score by 100 from baseline; reduction of PRO-2 from baseline by 8 points; reduction of abdominal pain 1 from baseline and/or reduction of average daily liquid or soft stool frequency 1 from baseline; decrease of TMS score from baseline 30% and 3 points; decrease of ES from baseline 1; decrease of PMS score from baseline 25% and 2 points; decrease of MMS score from baseline 25% and 2 points). In some embodiments, treating or managing IBD comprises maintaining a clinical activity score in a normal range or a near-normal range (e.g., as determined by the respective biomarker levels in a healthy control group).
[1095] In some embodiments, treating or managing IBD comprises decreasing a clinical activity score, such as a TMS, PMS, MMS score, or an RBS, endoscopic subscore. In some embodiments, treating or managing IBD comprises maintaining a clinical activity score, such as a TMS, PMS, MMS score, or an RBS, endoscopic subscore below certain threshold levels (e.g., an RBS subscore 1). In some embodiments, treating or managing IBD comprises decreasing a clinical activity score, such as a TMS, PMS, MMS score, or an RBS, endoscopic subscore, by a percentage or certain number of points from baseline (e.g., a 30% and 3 points reduction of TMS scores from baseline; a 25% and 2 points reduction of PMS scores from baseline; a 25% and 2 points reduction of MMS scores from baseline; a 1 point reduction in RBS subscore). In some embodiments, treating or managing IBD comprises maintaining a clinical activity score in a normal range or a near-normal range (e.g., as determined by the respective score levels in a healthy control group).
[1096] In some embodiments, treating or managing IBD comprises a reduction of about 4 points in SES-CD score compared to baseline at a timepoint in or around week 4 of the first treatment period. In some embodiments, the patient having IBD shows a response to the SMAD7 AON if the SES-CD score is reduced by 4 points relative to baseline.
[1097] In some embodiments, treating or managing IBD comprises an SES-CD score at a timepoint during the first treatment period or during the second treatment period of 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, or 20% compared to the SES-CD score at baseline (e.g., at a timepoint during week 0 of the first treatment period). In some embodiments, the SES-CD score at a timepoint during the first treatment period is 50% compared to the patient's SES-CD score at baseline. In some embodiments, the SES-CD score at a timepoint in or around week 4 of the first treatment period is 75% or 50% compared to baseline. In some embodiments, the SES-CD score at a timepoint in or around week 12 of the first treatment period is 75% or 50% compared to baseline.
[1098] In some embodiments, the SES-CD score is 5, 4, 3, 2, or 1 at a timepoint during the first treatment period or the second treatment period (e.g., a timepoint during the last week of the first or the second treatment period). In some embodiments, the SES-CD score is 2 at a timepoint during first treatment period or the second treatment period (e.g., during the last week of the first or the second treatment period). In some embodiments, the SES-CD score is 2 at a timepoint in or around week 12 of the first treatment period.
[1099] In some embodiments, the patient has a SES-CD score of 7 at the beginning of the first treatment period (e.g., at a timepoint during week 0).
[1100] In some embodiments, the patient has a total SES-CD score of 6 or the ileum segmental SES-CD score of 4 at the beginning of the first treatment period (e.g., at a timepoint during week 0).
[1101] In some embodiments, treating or managing IBD comprises reducing an average daily liquid or soft stool frequency score by 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% from baseline in the patient having IBD at a timepoint during the first, second and/or third treatment periods, e.g., at a timepoint during week 2, week 4, week 8, or week 12 of the first treatment period, during week 4, week 8, week 12, week 16, week 20, or week 24 of the second treatment period, or during week 24, week 52, week 104, week 156, or week 208 of the third treatment period.
[1102] In some embodiments, treating or managing IBD comprises reducing average daily abdominal pain from baseline by 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% in the patient having IBD at a timepoint during the first, second and/or third treatment periods, e.g., at a timepoint during week 2, week 4, week 8, or week 12 of the first treatment period, during week 4, week 8, week 12, week 16, week 20, or week 24 of the second treatment period, or during week 24, week 52, week 104, week 156, or week 208 of the third treatment period.
[1103] In some embodiments, treating or managing IBD comprises achieving a PRO-2 score of <14, <12, <10, <8, <6, <4, or <2 in the patient having IBD at a timepoint during the first treatment period. In some embodiments, the PRO-2 score at a timepoint during the second treatment period is <14, <12, <10, <8, <6, <4, or <2.
[1104] In some embodiments, the PRO-2 score at a timepoint during the third treatment period is <14, <12, <10, <8, <6, <4, or <2.
[1105] In some embodiments, the PRO-2 score is <8 at a timepoint during the first, second and/or third treatment periods (e.g., at a timepoint during week 2, week 4, week 8, or week 12 of the first treatment period, at a timepoint during week 4, week 8, week 12, week 16, week 20 or week 24 of the second treatment period, or at a timepoint during week 24, week 52, week 104, week 156, or week 208 of the third treatment period).
[1106] In some embodiments, the PRO-2 score is 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, or 14 points decreased from baseline at a timepoint during the first, second and/or third treatment periods.
[1107] In some embodiments, the PRO-2 is 8 points decreased from baseline at a timepoint during or at a timepoint during week 2, week 4, week 8 or week 12 of the first treatment period, during week 4, week 8, week 12, week 16, week 20, or week 24 of the second treatment period, or during week 24, week 52, week 104, week 156, or week 208 of the third treatment period.
[1108] In some embodiments, the CDAI score decreases 20 points, 30 points, 40 points, 50 points, 60 points, 70 points, 80 points, 90 points, 100 points, 110 points, 120 points, 130 points, 140 points, or 150 points from baseline during the first treatment period, during the second treatment period or during the first and second treatment period.
[1109] In some embodiments, the CDAI score decreases 20 points, 30 points, 40 points, 50 points, 60 points, 70 points, 80 points, 90 points, 100 points, 110 points, 120 points, 130 points, 140 points, or 150 points from baseline during the third treatment period, during the second and the third treatment periods, during the first and third treatment periods, or during all three treatment periods.
[1110] In some embodiments, the CDAI score is decreased 100 points from baseline at a timepoint during the first treatment period, during the second treatment period, or during the first and second treatment periods. In some embodiments, the CDAI score is 100 points decreased from baseline at a timepoint during week 2, week 4, week 8 or week 12 of the first treatment period and at a timepoint during week 4, week 8, week 12, week 16, week 20, or week 24 of the second treatment period.
[1111] In some embodiments, the CDAI score is decreased 100 points from baseline at a timepoint during the third treatment period, during the second and the third treatment periods, during the first and third treatment periods, or during all three treatment periods. In some embodiments, the CDAI score is 100 points decreased from baseline at a timepoint during week 24, week 52, week 104, week 156, or week 208 of the third treatment period.
[1112] In some embodiments, the CDAI score is <200, <190, <180, <170, <160, <150, <140, <130, <120, <110, or <100 at a timepoint during the first, second or third treatment period (e.g., at a timepoint during the last week of the first, second or third treatment period). In some embodiments, the CDAI score is <150 at a timepoint during the first, second or third treatment period.
[1113] In some embodiments, the CDAI score is <150 at a timepoint in or around week 2, week 4, week 8, or week 12 of the first treatment period, at a timepoint in or around week 4, week 8, week 12, week 16, week 20, or week 24 of the second treatment period, or at a timepoint during week 24, week 52, week 104, week 156, or week 208 of the third treatment period. In some embodiments, the CDAI score is <150 at a timepoint in or around week 4 of the first treatment period.
[1114] In some embodiments, the CDAI score is <150 at a timepoint in or around week 8 of the first treatment period. In some embodiments, the CDAI score is <150 at a timepoint in or around week 12 of the first treatment period. In some embodiments, the CDAI score is <150 at a timepoint in or around week 24 of the second treatment period. In some embodiments, the CDAI score is <150 at a timepoint in or around week 52 of the second treatment period. In some embodiments, the CDAI score is <150 at a timepoint in or around week 52 of the third treatment period. In some embodiments, the CDAI score is <150 at a timepoint in or around week 208 of the third treatment period.
[1115] In some embodiments, treating or managing IBD comprises a reduction of about 3 points in a TMS score compared to baseline at a timepoint in or around week 4 of the first treatment period. In some embodiments, the patient having IBD shows a response to the SMAD7 AON if the TMS score is reduced by 3 points relative to baseline.
[1116] In some embodiments, treating or managing IBD comprises a TMS score at a timepoint during the first treatment period or during the second treatment period of 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, or 20% compared to the TMS score at baseline (e.g., at a timepoint during week 0 of the first treatment period). In some embodiments, the TMS score at a timepoint during the first treatment period is 70% compared to the patient's TMS score at baseline. In some embodiments, the TMS score at a timepoint in or around week 4 of the first treatment period is 70% compared to baseline. In some embodiments, the TMS score at a timepoint in or around week 8 of the first treatment period is 70% compared to baseline. In some embodiments, the TMS scorc at a timepoint during the second treatment period is 70% compared to the patient's TMS score at baseline.
[1117] In some embodiments, the TMS score is 9, 8, 7, 6, 5, 4, 3, 2, or 1 at a timepoint during the first treatment period or the second treatment period (e.g., a timepoint during the last week of the first or the second treatment period). In some embodiments, the TMS score is 9 at a timepoint during first treatment period or the second treatment period (e.g., during the last week of the first or the second treatment period). In some embodiments, the TMS score is 2 at a time point in or around week 8 of the first treatment period.
[1118] In some embodiments, the patient has a TMS score of 4 at the beginning of the first treatment period (e.g., at a timepoint during week 0). In some embodiments, the patient has a TMS score of 6 at the beginning of the first treatment period (e.g., at a timepoint during week 0). In some embodiments, the patient has a TMS score of 9 at the beginning of the first treatment period (e.g., at a timepoint during week 0).
[1119] In some embodiments, treating or managing IBD comprises a reduction of about 2 points in a PMS score compared to baseline at a timepoint in or around week 4 of the first treatment period. In some embodiments, the patient having IBD shows a response to the SMAD7 AON if the PMS score is reduced by 2 points relative to baseline.
[1120] In some embodiments, treating or managing IBD comprises a PMS score at a timepoint during the first treatment period or during the second treatment period of 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, or 20% compared to the PMS score at baseline (e.g., at a timepoint during week 0 of the first treatment period). In some embodiments, the PMS score at a timepoint during the first treatment period is 75% compared to the patient's PMS score at baseline. In some embodiments, the PMS score at a timepoint in or around week 4 of the first treatment period is 75% compared to baseline. In some embodiments, the PMS score at a timepoint in or around week 8 of the first treatment period is 75% compared to baseline. In some embodiments, the PMS score at a timepoint during the second treatment period is 75% compared to the patient's PMS score at baseline.
[1121] In some embodiments, the PMS score is 7, 6, 5, 4, 3, 2, or 1 at a timepoint during the first treatment period or the second treatment period (e.g., a timepoint during the last week of the first or the second treatment period). In some embodiments, the PMS score is 7 at a timepoint during first treatment period or the second treatment period (e.g., during the last week of the first or the second treatment period). In some embodiments, the PMS score is 2 at a time point in or around week 8 of the first treatment period.
[1122] In some embodiments, the patient has a PMS score of 4 at the beginning of the first treatment period (e.g., at a timepoint during week 0). In some embodiments, the patient has a PMS score of 6 at the beginning of the first treatment period (e.g., at a timepoint during week 0).
[1123] In some embodiments, treating or managing IBD comprises a reduction of about 2 points in an MMS score compared to baseline at a timepoint in or around week 4 of the first treatment period. In some embodiments, the patient having IBD shows a response to the SMAD7 AON if the MMS score is reduced by 2 points relative to baseline.
[1124] In some embodiments, treating or managing IBD comprises an MMS score at a timepoint during the first treatment period or during the second treatment period of 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, or 20% compared to the MMS score at baseline (e.g., at a timepoint during week 0 of the first treatment period). In some embodiments, the MMS score at a timepoint during the first treatment period is 75% compared to the patient's MMS score at baseline. In some embodiments, the MMS score at a timepoint in or around week 4 of the first treatment period is 75% compared to baseline. In some embodiments, the MMS score at a timepoint in or around week 8 of the first treatment period is 75% compared to baseline. In some embodiments, the MMS score at a timepoint during the second treatment period is 75% compared to the patient's MMS score at baseline.
[1125] In some embodiments, the MMS score is 7, 6, 5, 4, 3, 2, or 1 at a timepoint during the first treatment period or the second treatment period (e.g., a timepoint during the last week of the first or the second treatment period). In some embodiments, the MMS score is 7 at a timepoint during first treatment period or the second treatment period (e.g., during the last week of the first or the second treatment period). In some embodiments, the MMS score is 2 at a time point in or around week 8 of the first treatment period.
[1126] In some embodiments, the patient has a MMS score of 4 at the beginning of the first treatment period (e.g., at a timepoint during week 0). In some embodiments, the patient has a MMS score of 6 at the beginning of the first treatment period (e.g., at a timepoint during week 0).
[1127] In some embodiments, treating or managing IBD comprises a reduction of about 1 point in an RBS subscore compared to baseline at a timepoint in or around week 4 of the first treatment period. In some embodiments, the patient having IBD shows a response to the SMAD7 AON if the RBS subscore is reduced by 1 point relative to baseline.
[1128] In some embodiments, treating or managing IBD comprises an RBS subscore at a timepoint during the first treatment period or during the second treatment period of 0 or 1 point. In some embodiments, the RBS subscore at a timepoint during the first treatment period is 0 or 1. In some embodiments, the RBS subscore at a timepoint in or around week 4 of the first treatment period is 0 or 1. In some embodiments, the RBS subscore at a timepoint in or around week 8 of the first treatment period is 0 or 1. In some embodiments, the RBS subscore at a timepoint during the second treatment period is 0 or 1.
[1129] In some embodiments, the patient has an RBS subscore of 1 at the beginning of the first treatment period (e.g., at a timepoint during week 0). In some embodiments, the patient has an RBS subscore of 2 at the beginning of the first treatment period (e.g., at a timepoint during week 0).
[1130] In some embodiments, treating or managing IBD comprises a reduction of about 1 point in an endoscopic subscore compared to baseline at a timepoint in or around week 4 of the first treatment period. In some embodiments, the patient having IBD shows a response to the SMAD7 AON if the endoscopic subscore is reduced by 1 point relative to baseline.
[1131] In some embodiments, treating or managing IBD comprises an endoscopic subscore at a timpoint during the first treatment period or during the second treatment period of 0 or 1 point. In some embodiments, the endoscopic subscore at a timepoint during the first treatment period is 0 or 1. In some embodiments, the endoscopic subscore at a timepoint in or around week 4 of the first treatment period is 0 or 1. In some embodiments, the endoscopic subscore at a timepoint in or around week 8 of the first treatment period is 0 or 1. In some embodiments, the endoscopic subscore at a timepoint during the second treatment period is 0 or 1.
[1132] In some embodiments, the patient has an endoscopic subscore of 1 at the beginning of the first treatment period (e.g., at a timepoint during week 0). In some embodiments, the patient has an endoscopic subscore of 2 at the beginning of the first treatment period (e.g., at a timepoint during week 0).
[1133] In some embodiments, treating or managing IBD comprises a reduction of at least 3 points and at least 30% in a TMS score compared to baseline, with an accompanying reduction in an RBS score of at least 1 point or absolute RBS of 0 or 1.
[1134] In some embodiments, treating or managing IBD comprises a reduction of at least 2 points and at least 25% in an MMS score compared to baseline, with an accompanying reduction in an RBS score of at least 1 point or absolute RBS of 0 or 1.
[1135] In some embodiments, treating or managing IBD comprises a reduction of at least 2 points and at least 25% in a PMS score compared to baseline, with an accompanying reduction in an RBS score of at least 1 point or absolute RBS of 0 or 1.
[1136] In some embodiments, the patient having IBD shows a response to the SMAD7 AON administration at a timepoint during the first treatment period (e.g., during week 2, week 4, week 8, or week 12) or second treatment period (e.g., during week 4, week 8, week 12, week 16, week 20, or week 24), or at a timepoint following the second treatment period (e.g., 1 week, 2 weeks, 4 weeks, 3 months, 6 months, 9 months, 12 months, 18 months, 2 years, 3 years, 4 years or 5 years after the second treatment period). In some embodiments, the response to the SMAD7 AON administration comprises a reduction of the severity or the frequency of recurrence of one or more clinical symptoms of IBD. In some embodiments, the response to the SMAD7 AON administration comprises a reduction of at least 50% in the SES-CD score compared to baseline (e.g., a timepoint during week 0 of first treatment period). In some embodiments, the response to the SMAD7 AON administration comprises a decrease from baseline of 100 points in CDAI score. In some embodiments, the response to the SMAD7 AON administration comprises a decrease from baseline of 8 point in PRO-2 score. In some embodiments, the response to the SMAD7 AON administration comprises a decrease from baseline of 1 point in average daily liquid or soft stool frequency scores. In some embodiments, the response to the SMAD7 AON administration comprises a decrease from baseline of 1.0 point in abdominal pain score. In some embodiments, the response to the SMAD7 AON administration comprises a decrease from baseline of 1 point in average daily liquid or soft stool frequency scores and a decrease from baseline of 1 point in abdominal pain score. In some embodiments, the response to the SMAD7 AON administration comprises a decrease of TMS from baseline 30% and 3 points. In some embodiments, the response to the SMAD7 AON administration comprises a decrease of ES from baseline 1. In some embodiments, the response to the SMAD7 AON administration comprises a decrease of PMS score from baseline 25% and 2 points. In some embodiments, the response to the SMAD7 AON administration comprises a decrease of MMS score from baseline 25% and 2 points.
[1137] In some embodiments, the patient having IBD shows a response to the SMAD7 AON administration at a timepoint during the third treatment period (e.g., during week 24, week 52, week 104, or week 208) or at a timepoint following the third treatment period (e.g., 1 week, 2 weeks, 4 weeks, 3 months, 6 months, 9 months, 12 months, 18 months, 2 years, 3 years, 4 years or 5 years after the third treatment period).
[1138] In some embodiments, the patient having IBD shows a time to loss of response (i.e., reoccurrence of a clinical IBD symptom) following the first, second or third treatment period of at least 2 weeks, at least 4 weeks, at least 6 weeks, at least 8 weeks, at least 2 months, at least 3 months, at least 6 months, at least 9 months, at least 12 months, at least 18 months, at least 24 months, at least 30 months, at least 36 months, at least 42 months, at least 48 months, at least 54 months or at least 60 months. In some embodiments, time to loss of response is defined, e.g., a determination at 2 consecutive timepoints of a CDAI score 150 and an increase of CDAI score 50 from the CDAI score at the time point when the patient first showed a response to the SMAD7 AON.
[1139] In some embodiments, the patient having IBD shows remission at a timepoint during the first treatment period (e.g., during week 2, week 4, week 8, or week 12) or second treatment period (e.g., during week 4, week 8, week 12, week 16, week 20, or week 24), or at a timepoint following the second treatment period (e.g., 1 week, 2 weeks, 4 weeks, 3 months, 6 months, 9 months, 12 months, 18 months, 2 years, 3 years, 4 years or 5 years after the second treatment period). In some embodiments, remission comprises a reduction of the severity or the frequency of recurrence of one or more clinical symptoms of IBD. In some embodiments, remission comprises a SES-CD score <2. In some embodiments, remission comprises a CDAI score <150. In some embodiments, remission comprises a PRO-2 score <8. In some embodiments, remission comprises mucosal healing, as indicated, e.g., by the absence of an intestinal mucosal ulceration. In some embodiments, remission comprises an abdominal pain score 1. In some embodiments, remission comprises an average daily liquid or soft stool frequency score of 1.5. In some embodiments, remission comprises an MMS, a PMS, or a TMS score 2. In some embodiments, remission comprises an ES=0.
[1140] In some embodiments, the patient having IBD shows remission at a timepoint during the third treatment period (e.g., during week 24, week 52, week 104, or week 208) or at a timepoint following the third treatment period (e.g., 1 week, 2 weeks, 4 weeks, 3 months, 6 months, 9 months, 12 months, 18 months, 2 years, 3 years, 4 years or 5 years after the second treatment period).
[1141] In some embodiments, the patient having IBD does not experience a fibrotic event (e.g., scarring) during the first treatment period. In some embodiments, the patient having IBD does not experience a fibrotic even during the second treatment period. In some embodiments, the patient having ID does not experience a fibrotic event for a period of at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 6 weeks, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 9 months, at least 12 months, at least 18 months, at least 24 months, at least 30 months, at least 36 months, at least 42 months, at least 48 months, at least 54 months, or at least 60 months after the end of the second treatment period.
[1142] In some embodiments, the patient having IBD does not experience a fibrotic even during the third treatment period. In some embodiments, the patient having ID does not experience a fibrotic event for a period of at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 6 weeks, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 9 months, at least 12 months, at least 18 months, at least 24 months, at least 30 months, at least 36 months, at least 42 months, at least 48 months, at least 54 months, or at least 60 months after the end of the third treatment period.
6.6.2 Prevention
[1143] In some embodiments, preventing IBD or preventing the reoccurrence of IBD comprises preventing the occurrence or reoccurrence of one or more clinical symptoms of IBD, either partially or completely. In some embodiments, preventing IBD or preventing the reoccurrence of IBD comprises preventing the occurrence or reoccurrence of a symptom of CD, such as belly pain (including, e.g., cramping, soreness to touch, constant ache), diarrhea (including, e.g., blood in stool), loss of appetite, fever, weight loss, anemia, intestinal inflammation, or an infection (e.g., an abscess), an anal fissure, joint pain, eye problems, a skin rash, or liver disease. In some embodiments, preventing IBD or preventing the reoccurrence of IBD comprises preventing the occurrence or the reoccurrence of one or more symptoms of UC, such as intestinal swelling, intestinal inflammation, sores in the lining of the large intestine (colon), diarrhea, belly pain, or bleeding from the rectum. In some embodiments, preventing IBD or preventing the reoccurrence of IBD comprises preventing one or more IBD symptoms during a chronic phase of the disease. In some embodiments, preventing IBD or preventing the reoccurrence of IBD comprises reducing one or more IBD symptoms during an acute phase of the disease (e.g., during a disease flare up). In some embodiments, preventing the reoccurrence of IBD comprises increasing the time to relapse in an IBD patient who has responded to an IBD treatment such as an anti-SMAD7 therapy (e.g., and anti-SMAD7 AON).
[1144] In some embodiments, preventing IBD or preventing the reoccurrence of IBD comprises preventing the occurrence or reoccurrence of a disease flare up or of a disease flare up of a certain intensity. In some embodiments, preventing IBD or preventing the reoccurrence of IBD comprises preventing the occurrence or reoccurrence of flare ups at a certain frequency (e.g., at a frequency observed in the patient having IBD directly prior to the administration of an IBD treatment regiment or at a (e.g., median, average or mean) frequency observed in a control group of untreated IBD patients).
[1145] In some embodiments, preventing IBD or preventing the reoccurrence of IBD comprises preventing a (further) deterioration in the quality of life of an IBD patient (e.g., as determined by a patient survey), e.g., by preventing the increase in pain in the IBD patient, preventing (further) loss of appetite in the IBD patient, or preventing a worsening of sleeplessness in the IBD patient.
[1146] In some embodiments, preventing IBD or preventing the reoccurrence of IBD comprises, comprises preventing the increase of an IBD biomarker level (e.g., CRP (e.g., measured as hsCRP), FCP, inflammatory cytokine (e.g., IL6, IL8, IL12, or IL17), CD4, CD8, phosphor-SMAD3, HLA-DR or SMAD7 mRNA or SMAD7 protein levels), e.g., an increase over previous IBD biomarker levels observed in the patient or an increase relative to normal or near-normal IBD biomarker levels (e.g., as determined by the respective biomarker levels in a healthy control group). In some embodiments, preventing IBD or preventing the reoccurrence of IBD comprises preventing the (further) increase of a clinical activity score, such as a SES-CD, CDAI, UCDAI, PRO-2, abdominal pain, average daily liquid or soft stool frequency score, MMS, PMS, TMS, ES or a histological score. In some embodiments, preventing IBD or preventing the reoccurrence of IBD comprises preventing a clinical activity score, such as an SES-CD, CDAI, UCDAI, PRO-2, abdominal pain, average daily liquid or soft stool frequency score, MMS, PMS, TMS, ES or a histological score, from increasing above a certain threshold levels (e.g., SES-CD=2; CDAI=150; PRO-2=8; abdominal pain=1.0; average daily liquid or soft stool frequency=1.5 or 3.0, MMS=2, PMS=2, TMS=2, ES=0 or 1). In some embodiments, preventing IBD or preventing the reoccurrence of IBD comprises preventing a clinical activity score, such as an SES-CD, CDAI, UCDAI, PRO-2, abdominal pain, average daily liquid or soft stool frequency score, MMS, PMS, TMS, ES or a histological score, from increasing by a certain number of points (e.g., a doubling of SES-CD scores; an increase in CDAI50 or >100; an increase of PRO-28; an increase in abdominal pain by 1 point and/or an increase in average daily liquid or soft stool frequency by 1 point; an increase in MMS, TMS, or PMS2; an increase in ES1). In some embodiments, preventing IBD or preventing the reoccurrence of IBD comprises preventing a clinical activity score from exceeding a normal range or a near-normal range (e.g., as determined by the respective biomarker levels in a healthy control group).
[1147] In some embodiments, preventing IBD or preventing the reoccurrence of IBD comprises preventing the (further) increase of a clinical activity score, such as a TMS, PMS, MMS score, or an RBS, endoscopic subscore. In some embodiments, preventing IBD or preventing the reoccurrence of IBD comprises preventing a clinical activity score, such as a TMS, PMS, MMS score, or an RBS, endoscopic subscore from increasing above a certain threshold levels (e.g., an RBS subscore=1). In some embodiments, preventing IBD or preventing the reoccurrence of IBD comprises preventing a clinical activity score, such as a TMS, PMS, MMS score, or an RBS, endoscopic subscore, from increasing by a percentage or certain number of points from baseline (e.g., a 30% and 3 points increase of TMS scores from baseline; a 25% and 2 points increase of PMS scores from baseline; a 25% and 2 points increase of MMS scores from baseline; a 1 point increase in RBS subscore). In some embodiments, treating or managing IBD comprises maintaining a clinical activity score in a normal range or a near-normal range (e.g., as determined by the respective score levels in a healthy control group).
6.7. Adjustment of Treatment Regimens
[1148] In some embodiments, the methods provided herein further comprise adjusting the method of treating or managing IBD at a time when the patient having IBD shows a response to the SMAD7 AON or experiences remission. See, e.g., Section 6.1.1.3 and Section 6.1.1.6.
[1149] For example, if the patient having IBD shows a response to the SMAD7 AON prior to the end of the first treatment period, the first treatment period can be ended or shortened (e.g., by any number of days, weeks, or months). In this case, the second treatment period can start early and the second treatment period can comprise administration of the SMAD7 AON at the second dose or a lower dose than the second dose (e.g., 20%, 30%, 40%, or 50% lower). In some embodiments, the dosing schedule during the second treatment period can be altered if the patient having IBD responds to the SMAD7 AON during the first treatment period. For example, an alternating dosing schedule can be altered to have longer periods without treatment.
[1150] In some embodiments, if the patient having IBD does not show a response, does not show remission, or cannot fully taper an addition IBD treatment at the end of the first treatment period, the patient does not enter the second treatment period, but instead repeats the first treatment period. In this case, the patient having IBD can be administered with an increased first dose during the repeat of the first treatment period (e.g., the first dose can be increased by 20 mg/day, or by 10%). In some embodiments, the patient having IBD can repeat the first treatment period at continuously increasing first doses of the SMAD7 AON until the patient having IBD shows a response to the SMAD7 AON, shows remission, fully tapers an additional IBD treatment. If the first dose exceeds the maximum tolerated dose, the treatment is terminated.
[1151] In some embodiments, the first dose during the repeat of the first treatment period can be increased by 40 mg/day, 80 mg/day, 120, mg/day, 160 mg/day, 240 mg/day, 320 mg/day, or 50%, 100%, 200%, 400%.
[1152] In some embodiments, an IBD patient who does not show a response or remission during the second treatment period, can transition from the second treatment period to the third treatment period. During the third treatment period, the IBD patient can be administered with an increased third dose (e.g., the third dose can be increased by 120 mg/day, from 40 mg/day to about 160 mg/day, or 4-fold, relative to the second dose). In some embodiments, the IBD patient can be administered the third dose using a continuous dosing schedule or an alternating dosing schedule (e.g., 4 weeks of SMAD7 AON treatment alternating with 4 weeks of placebo or no treatment) until the IBD patient shows a response to the SMAD7 AON, or experiences remission. If the third dose exceeds the maximum tolerated dose, the treatment is terminated.
[1153] In some embodiments, the monitoring the activity of the SMAD7 AON shows that the patient responds to an initial first dose of the SMAD7 AON during the first treatment period and shows a partial or complete loss of response at a timepoint during the second treatment period. In some such embodiments, the second treatment period is ended and the patient reenters the first treatment period, receiving the SMAD7 AON either at the initial first dose or at a dose higher than the initial first dose.
6.8 Pharmacokinetics (PK) and Pharmacodynamic (PD) Assessments
[1154] In some embodiments, a method provided herein for the treatment or prevention of IBD further comprises analyzing PK/PD characteristics of the SMAD7 AON.
[1155] In some embodiments, analyzing the PK/PD characteristics comprises analyzing biomarkers in a blood sample (e.g., CRP) or in a stool sample (e.g., FCP) from the patient having IBD.
[1156] In some embodiments, analyzing the PK/PD characteristics comprises analyzing biomarkers in an intestinal mucosal sample (e.g., TNF, microbiome) from the patient having IBD. In some embodiments, analyzing the PK/PD characteristics comprises analyzing biomarkers in mononuclear cells sample (e.g., IL-17A, Foxp3, CCR9) from the patient having IBD.
[1157] In some embodiments, analyzing the PK/PD characteristics comprises analyzing an intestinal mucosal biopsy from the patient having IBD. In some embodiments, analyzing the PK/PD characteristics comprises analyzing SMAD7 phosphorylation, e.g., in the intestinal mucosal biopsy from the patient having IBD. In some embodiments, analyzing the PK/PD characteristics comprises analyzing the expression of biomarkers, such as CD4, CD8, or HLA-DR, in the intestinal mucosal biopsy from the patient having IBD.
[1158] In some embodiments, analyzing the PK/PD characteristics of the SMAD7 AON comprises monitoring the systematic exposure of the SMAD7 AON in the patient having IBD. In some embodiments, monitoring the systematic exposure of the SMAD7 AON in the patient having IBD comprises analyzing the plasma concentration of the SMAD7 AON at a timepoint during week 4, week 8, or week 12 of the first treatment period. In some embodiments, monitoring the systematic exposure of the SMAD7 AON comprises performing a sparse PK analysis (e.g., an analysis of Area Under the Curve and other pharmacokinetic parameters on the basis of only few patient samples, see, e.g., Example 1) during the first treatment period or the second treatment period. In some embodiments, the sparse PK analysis is performed at week 4, week 8, or week 12 of the first treatment period.
[1159] In some embodiments, the sparse PK comprises drawing blood samples from the patient having IBD at two time points, a pre-dose time point and a post-dose time point. In some embodiments, the pre-dose timepoint is at least >23 hours after administration of the previous dose of the SMAD7 AON and the post-dose timepoint is 1 to 6 hours after administration of a dose of interest of the SMAD7 AON. The blood samples can be analyzed for SMAD7 AON content using methods known in the art (e.g., HPLC).
6.9 Patient Population
[1160] In some embodiments, an IBD patient to be treated with a method provided herein is a UC patient or a CD patient. In some embodiments, the patient having IBD was diagnosed with CD or UC at least 3 months prior to the initial screening period or the first treatment period. In some embodiments, the patient having IBD was diagnosed with ileitis, or ileocolitis, e.g., as determined by endoscopic, radiographic or another imaging method (e.g., magnetic resonance imaging [MRI], computed tomography [CT] scan), within 2 years prior to the screening period or to the first treatment period. In some embodiments, the patient has IBD involving the distal to mid transverse colon. In some embodiments, the patient has extensive colitis.
[1161] In some embodiments, an IBD patient to be treated with a method provided herein has active disease, characterized by a CDAI score 220 and 450 (range: 0 to 600) or by a SES-CD score 7 at the beginning of the screening period or the first treatment period.
[1162] In some embodiments, an IBD patient to be treated with a method provided herein has active disease, characterized by a CDAI score 220 and 450 (range: 0 to 600) and by a SES-CD score 4 (if the patient has ileitis only) at the beginning of the screening period or the first treatment period. In some embodiments, an IBD patient to be treated with a method provided herein has active disease, characterized by a CDAI score 220 and 450 (range: 0 to 600) and by a total SES-CD score 6 or ileum segmental SES-CD4 at the beginning of the screening period or the first treatment period. In some embodiments, an IBD patient to be treated with a method provided herein has active disease, characterized by an MMS4 and 9 and a Mayo endoscopic subscore 2.
[1163] In some embodiments, an IBD patient to be treated with a method provided herein failed or experienced intolerance to an IBD treatment other than a SMAD7 AON, e.g., an IBD treatment comprising an aminosalicylate, a budesonide, a systemic corticosteroid, an immunosuppressants (6-mercaptopurine [6-MP], azathioprinc [AZA], or methotrexate [MTX]), or biologics (e.g., infliximab, adalimumab, certolizumab, or vedolizumab).
[1164] In some embodiments, an IBD patient to be treated with a method provided herein who failed treatment with an aminosalicylate showed a sign or symptom of active disease despite a history of receiving 8 weeks of treatment with mesalamine or sulafasalazine 3 grams. In some embodiments, a patient having IBD who is intolerant to an aminosalicylate experienced a headache, nausea, vomiting, a hypersensitivity reaction (e.g., rash, eosinophilia, fever or lymphadenopathy), nephrotoxicity, hepatotoxicity, a blood disorder, oligospermia or infertility when receiving the aminosalicylate.
[1165] In some embodiments, the failure of an IBD patient to be treated with a method provided herein to respond to budenoside treatment is indicated by a sign or symptom of active IBD in the IBD patient despite a history of receiving 8 weeks of treatment with budesonide at doses 9 grams. In some embodiments, budenoside intolerance is indicated by the development of Cushing's syndrome, osteopenia/osteoporosis, hyperglycemia, insomnia or an infection in an IBD patient receiving budenoside.
[1166] In some embodiments, the failure of an IBD patient to be treated with a method provided herein to respond to treatment with a systemic corticosteroid is indicated by a sign or symptom of active IBD in the IBD patient despite a history of receiving at least one 4-week course regimen with prednisone 0.75 mg/kg mg daily orally or equivalent, or 1 week of intravenous corticosteroids; or 2 failed attempts to taper corticosteroids to 10 mg of prednisone or equivalent on 2 occasions.
[1167] In some embodiments, the failure of an IBD patient to be treated with a method provided herein to respond to treatment with an immunosuppressant is indicated by a sign or symptom of active CD in the IBD patient despite a history of 8 weeks of treatment with azathioprine (1.5 mg/kg), or 6-mercaptopurine (0.75 mg/kg), or methotrexate (12.5 mg/week). In some embodiments, intolerance to an immunosuppressant is indicated by nausea, vomiting, abdominal pain, pancreatitis, a liver function test abnormality, lymphopenia or an infection in an IBD patient receiving the systemic immunosuppressant.
[1168] In some embodiments of the methods provided herein, the failure of an IBD patient to respond to a treatment with biologics is indicated by (a) an inadequate initial response (primary non-responder) after at least 2 doses of induction therapy to: infliximab (doses of >5 mg/kg); adalimumab (doses of 160 mg followed by 80 mg); certolizumab (doses of 400 mg) at least 2 weeks apart; or vedolizumab (doses of 300 mg) at least 8 weeks apart, or (b) recurrence of signs and symptoms, such as worsening of diarrhea, abdominal pain, rectal bleeding, or initiation or increased use of antidiarrheals (secondary non-responders) after at least 2 doses of maintenance therapy to infliximab (doses of >5 mg/kg), adalimumab (doses of 40 mg), certolizumab (doses of 400 mg); or vedolizumab (doses of 300 mg). In some embodiments, intolerance to biologics is indicated by fever, chills, rash, flush, itching, hypotension, urticaria, myalgia, arthralgias; which were related to the treatment.
[1169] In some embodiments, an IBD patient to be treated with a method provided herein has received one or more additional IBD treatments prior to the SMAD7 AON treatment. In some embodiments, an IBD patient to be treated with a method provided herein has received one additional IBD treatment prior to the SMAD7 AON treatment. In some embodiments, an IBD patient to be treated with a method provided herein has received two or more additional IBD treatments prior to the SMAD7 AON treatment. In some embodiments, one of the additional IBD treatment is biologics treatment (e.g., infliximab, adalimumab, certolizumab, or vedolizumab) In some embodiments, one of the additional IBD treatment is corticosteroid treatment (e.g., prednisone, budesonide). In some embodiments, one of the additional IBD treatment is immunosuppressant treatment (e.g., AZA, 6-MP, or MTX). In some embodiments, one of the additional IBD treatment is aminosalicylate treatment (e.g., SSZ, ASA).
[1170] In some embodiments, the failure of an IBD patient to be treated with a method provided herein receives an additional IBD treatment other than the SMAD7 AON.
[1171] In some embodiments, the additional IBD treatment comprises an oral aminosalicylate. In some embodiments, the additional IBD treatment comprising the oral aminosalicylate was initiated 6 weeks prior to the beginning of the first treatment period and the oral aminosalicylate has been administered at a stable dose for 2 weeks prior to the beginning of the first treatment period and the dose of the oral aminosalicylate remains stable during the first treatment period and/or the second treatment period. In some embodiments, the patient having IBD has discontinued an aminosalicylate at least 2 weeks prior to the beginning of the first treatment period.
[1172] In some embodiments, the dose of the oral aminosalicylate remains stable through week 12. In some embodiments, the dose of the oral aminosalicylate may be changed (i.e., tapered, stopped or increased), as clinically indicated, at the discretion of the doctor after week 12.
[1173] In some embodiments, the additional IBD treatment comprises an oral corticosteroid. In some embodiments, the oral corticosteroid was administered at a stable dose for at least about 4 weeks prior to the first treatment period (e.g., prednisone 20 mg/day or equivalent, budesonide 9 mg/day) and the dose of the oral corticosteroid remains stable until the patient having IBD starts corticosteroid tapering.
[1174] In some embodiments, the oral corticosteroid was administered at a stable dose for at least about 3 weeks prior to the first treatment period (prednisone <20 mg/day or equivalent, budesonide <9 mg/day) and the dose remains stable until the subject is eligible to start corticosteroids tapering. In some embodiments, the patient having IBD has discontinued an oral corticosteroid at least 3 weeks prior to the beginning of the first treatment period. In some embodiments, the oral corticosteroid was administered at a stable dose for at least about 3 weeks prior to the first treatment period (prednisone <20 mg/day or equivalent, budesonide <9 mg/day) and the dose remains stable through week 12. In some embodiments, the dose of the oral corticosteroid may be changed (i.e., tapered, stopped or increased), as clinically indicated, at the discretion of the doctor after week 12.
[1175] In some embodiments, the additional IBD treatment comprises an immunosuppressant, such as 6-MP, AZA, or MTX. In some embodiments, the addition IBD treatment comprising the immunosuppressant was initiated 12 weeks prior to the first treatment period and the immunosuppressant was administered at a stable dose for 8 weeks prior to the first treatment period and continues to be administered at a stable dose during the first treatment period and/or the second treatment period. In some embodiments, the patient having IBD has discontinued an immunosuppressant at least 8 weeks prior to the first treatment period.
[1176] In some embodiments, the addition IBD treatment comprising the immunosuppressant was initiated 12 weeks prior to the first treatment period and the immunosuppressant was administered at a stable dose for 8 weeks prior to the first treatment period and continues to be administered at a stable dose through week 12. In some embodiments, the dose of the oral corticosteroid may be changed (i.e., tapered, stopped or increased), as clinically indicated, at the discretion of the doctor after week 12.
[1177] In some embodiments, oral aminosalicylates (such as sulfasalazine [SSZ] or 5-aminosalicylic acid [5-ASA] compounds); or immunosuppressants (such as AZA, 6-MP, or MTX) may be initiated or changed before the beginning of the first treatment period, or continued from the previous first and/or second treatment period, provided that the dose remains stable through the first 12 weeks of the third treatment period from Week 0 to Week 12. In some embodiments, after Week 12 of the third treatment, patients may taper doses or completely discontinue any of these background CD medications or may increase doses or add any new CD medications as clinically indicated, except for biologics, at the discretion of the doctor.
[1178] In some embodiments, oral corticosteroids (with no dose restriction) may be initiated or changed before the beginning of the first treatment period, or continued from the previous first and/or second treatment period, provided that the dose remains stable through the first 4 weeks of the third treatment period from Week 0 to Week 4. In some embodiments, after Week 4, patients may taper corticosteroids doses as clinically indicated, at the discretion of the doctor.
[1179] In some embodiments, an IBD patient to be treated with a method provided herein meets one or more of the following laboratory criteria: white blood cell count 3000/mm.sup.3 (3.010.sup.9/L) and <14,000/mm.sup.3 (<14.010.sup.9/L); platelet count 100,000/mm.sup.3 (10010.sup.9/L); serum creatinine 1.5 mg/dL (132.6 mon); AST (SGOT) and ALT (SGPT)2 X upper limit of normal (ULN); total bilirubin 2 mg/dL (34 mol/L) or albumin >lower limit of normal (LLN); hemoglobin 9 g/dL (5.6 mmoUL), activated partial thromboplastin time (APTT)1.5ULN.
[1180] In some embodiments, an IBD patient to be treated with a method provided herein is a male or female patient of at least 18 years of age. In some embodiments, the IBD patient is a male or female patient of between about 18 and about 45 years of age. In some embodiments, the IBD patient is a male or female patient of about 18 and about 75 years of age.
[1181] In some embodiments, an IBD patient to be treated with a method provided herein is diagnosed as a CD patient using the Vienna classification scheme, the Montreal classification scheme, or the Paris classification scheme. See, e.g., Gasche, C., et al., A simple classification of Crohn's disease: report of the Working Party for the World Congresses of Gastroenterology, Vienna 1998. Inflamm Bowel Dis. 2000 February; 6(1):8-15; Levine, A., et al. A comparison of budesonide and prednisone for the treatment of active pediatric Crohn disease. J Pediatr Gastroenterol Nutr 2003; 36(2):248-52; Levine, A., et al., Pediatric modification of the Montreal classification for inflammatory bowel disease: the Paris classification. Inflamm Bowel Dis. 2011 June; 17(6):1314-21. doi: 10.1002/ibd.21493. Epub 2010 Nov. 8; Satsangi, J., et al., The Montreal classification of inflammatory bowel disease: controversies, consensus, and implications. Gut. 2006 June; 55(6):749-53.
[1182] In some embodiments, an IBD patient to be treated with a method provided herein is treatment nave at the beginning of the first treatment period. In some embodiments, the patient having IBD has never received an anti-SMAD7 therapy prior to the first treatment period. In some embodiments, the patient having IBD has never received a SMAD7 AON prior to the first treatment period. In some embodiments, the patient having IBD has never received an IBD treatment other than an SMAD7 AON prior to the first treatment period.
[1183] In some embodiments, an IBD patient to be treated with a method provided herein has received one or more additional IBD treatments other than a SMAD7 AON prior to the first treatment period (e.g., an aminosalicylate, a corticosteroid, or an immunosuppressant). In some embodiments, the IBD patient has discontinued an additional IBD treatment prior to the first treatment period (e.g., at least 1 week, at least 2 weeks, at least 4 weeks, at last 2 months, at least 3 months, at least 6 months, at least 9 months, at least 12 months, at least 18 months, at least 2 years, at least 3 years, at least 4 years, or at least 5 years prior to the first treatment period). In some embodiments, the IBD patient continues to receive an additional TBD treatment during the first treatment period or during parts of the first treatment period. In some embodiments, the IBD patient continues to receive the additional IBD treatment during the second treatment period or during parts of the second treatment period. In some embodiments, an IBD paticnt receiving a certain additional IBD treatment is not eligible for a treatment according to the methods provided herein. In some embodiments, the IBD patient is cannot tolerate one or more additional treatment. In some embodiments, an IBD patient to be treated with a method provided herein has failed to respond to or to achieve remission with one or more additional IBD treatments. In some embodiments, the IBD patient can taper one or more additional IBD treatments during a treatment according to the methods provided herein (e.g., during the first or second treatment period). In some embodiments, the IBD patient cannot taper one or more additional IBD treatments.
[1184] In some embodiments, an IBD patient to be treated with a method provided herein at the beginning of the first treatment period is not diagnosed with ulcerative colitis (UC), indeterminate colitis, ischemic colitis, microscopic colitis, radiation colitis or diverticular disease-associated colitis. In some embodiments, the patient having IBD at the beginning of the first treatment period is not diagnosed with local manifestations of CD, such as strictures, abscesses, fistula, short bowel syndrome or other disease complications for which surgery might be indicated or could confound the evaluation of efficacy. In some embodiments, the patient having IBD has not received an intestinal resection within 6 months or any intra-abdominal surgery within 3 months prior to the first treatment period. In some embodiments, the patient having IBD has not received an ileostomy or a colostomy or does not have intestinal pathogens the beginning of the first treatment period. In some embodiments, the patient having IBD does not have a history of colorectal cancer or colorectal dysplasia. In some embodiments, the patient having IBD has not used mycophenolic acid, tacrolimus, sirolimus, cyclosporine, thalidomide or apheresis (e.g., Adacolumn) before the beginning of the first treatment period. In some embodiments, the patient having IBD has not used intravenous (IV) corticosteroids within 2 weeks of the beginning of the first treatment period. In some embodiments, the patient having IBD has not used a topical treatment with 5-aminosalicylic acid (5-ASA) or corticosteroid enemas or suppositories within 2 weeks of the beginning of the first treatment period. In some embodiments, the patient having IBD is not stool positive for any enteric pathogen or C. difficile toxin at the beginning of the first treatment period. In some embodiments, the patient having IBD has not received an antibiotic therapy for the treatment of CD within 3 weeks of the beginning of the first treatment period. In some embodiments, the patient having IBD has not used cholestyramine within 3 weeks of the beginning of the first treatment period. In some embodiments, the patient having IBD has not received a treatment with any biologic agents, including TNF blockers prior to the beginning of the first treatment period. In some embodiments, the patient having IBD has not been administered with total parenteral nutrition (TPN) within 4 weeks of the beginning of the first treatment period. In some embodiments, the patient having IBD does not have a history of one or more of a clinically significant neurological, renal, hepatic, gastrointestinal, pulmonary, metabolic, cardiovascular, psychiatric, endocrine, or hematological disorder or disease. In some embodiments, the patient having IBD is not pregnant or breastfeeding. In some embodiments, the patient having IBD does not have a history of one or more of the following cardiac conditions within 6 months of the beginning of the first treatment period: myocardial infarction, acute coronary syndrome, unstable angina, new onset atrial fibrillation, new onset atrial flutter, second- or third-degree atrioventricular block, ventricular fibrillation, ventricular tachycardia, heart failure, cardiac surgery, interventional cardiac catheterization (with or without a stent placement), interventional electrophysiology procedure, or presence of implanted defibrillator. In some embodiments, the patient having IBD does not have a known active current or history of recurrent bacterial, viral, fungal, mycobacterial or other infections (including but not limited to tuberculosis and atypical mycobacterial disease and Herpes zoster), human immunodeficiency virus (HIV), or any major episode of infection requiring hospitalization or treatment with intravenous (IV) or oral antibiotics within 4 weeks of the beginning of the first treatment period. In some embodiments, the patient having IBD does not have a history of congenital or acquired immunodeficiency (e.g., common variable immunodeficiency disease). In some embodiments, the patient having IBD does not have a history of malignancy, except for: treated (i.e., cured) basal cell or squamous cell in situ skin carcinomas, treated (i.e., cured) cervical intraepithelial neoplasia or carcinoma in situ of the cervix with no evidence of recurrence within the previous 5 years. In some embodiments, the patient having IBD has not received any investigational drug or device within 3 months of the beginning of the first treatment period. In some embodiments, the patient having IBD has not received a prior treatment with a SMAD7 AON. In some embodiments, the patient having IBD does not have a history of alcohol, drug, or chemical abuse within the 6 months prior to the beginning of the first treatment period. In some embodiments, the patient having IBD does not have a known hypersensitivity to oligonucleotides.
6.10 SMAD7 Antisense Oligonucleotides
[1185] The present disclosure is directed in part to methods of treating IBD in a patient with an anti-SMAD7 therapy comprising a SMAD7 inhibitor. SMAD7 inhibitors may include, for example, small binding molecules, e.g., natural and synthetic compounds, antibodies, aptamers, intramers, RNAi (double stranded RNA, siRNA) and SMAD7 AONs that bind, degrade, or otherwise interfere with SMAD7 stability, production, or function. SMAD7 inhibitors may also comprise truncated and/or mutated SMAD7 molecules which interfere with SMAD7 activity, binding partners, or substrates and which, thereby, inhibit SMAD7 function.
[1186] The present disclosure is also directed in part to methods of treating IBD in a patient with a SMAD7 AON. Antisense oligonucleotides are short synthetic oligonucleotide sequences complementary to the messenger RNA (mRNA), which encodes for the target protein (e.g., SMAD7). Without being bound by theory, antisense oligonucleotide sequences hybridize to the mRNA producing a double-strand hybrid that can lead to the activation of ubiquitary catalytic enzymes, such as RNase H, which degrades DNA/RNA hybrid strands, thus preventing protein translation. Without being bound by theory, an antisense oligonucleotide described in this section and useful in the methods provided herein can hybridize to its target sequence as RNA or DNA. Thus, even if a DNA sequence is provided as target, the corresponding RNA sequence (including uracil instead of thymine) is included. The antisense oligonucleotide can be either RNA or DNA.
[1187] The SMAD7 AON used in the methods provided herein can specifically target SMAD7 from any one mammalian organism. Such mammalian organisms comprise, e.g., without limitation, humans, primates (e.g., monkeys, chimpanzees, orangutans, and gorillas), cats, dogs, rabbits, farm animals (e.g., cows, horses, goats, sheep, pigs), and rodents (e.g., mice, rats, hamsters, and guinea pigs).
[1188] The SMAD7 AON can target any one region of SMAD7, including any translated region or any untranslated region. Any 8 or more, 10 or more, 12 or more, 14 or more, 16 or more, 18 or more, 20 or more, 22 or more, 24 or more, 26 or more, 28 or more or 30 or more consecutive nucleotides of SMAD7 can be targeted by the SMAD7 AON s.
[1189] In some embodiments, the SMAD7 AON can target a region in human SMAD7. In some embodiments, the SMAD7 AON can target a region of 8 or more, 10 or more, 12 or more, 14 or more, 16 or more, 18 or more, 20 or more, 22 or more, 24 or more, 26 or more, 28 or more or 30 or more consecutive nucleotides of human SMAD7. In some embodiments, the SMAD7 AON can target a region in a human SMAD7 including the nucleic acid sequence of SEQ ID NO: 1, or the corresponding RNA sequence.
[1190] SEQ ID NO:1 (Coding Sequence: CDS (288-1568) of NM 005904.3; Homo sapiens SMAD family member 7 (SMAD7), transcript variant 1, mRNA) (region 108-128 underlined):
TABLE-US-00002 ATGTTCAGGACCAAACGATCTGCGCTCGTCCGGCGTCTCTGGA GGAGCCGTGCGCCCGGCGGCGAGGACGAGGAGGAGGGCGC AGGGGGAGGTGGAGGAGGAGGCGA GGACAGCCGAGCGCATGGGGCCGGTGGCGGCGGCC CGGGCAGGGCTGGATGCTGCCTGGGCAAGGCGGTGCGAGG TGCCAAAGGTCACCACCATCCCCACCCGCCAGCCGCGGGC GCCGGCGCGGCCGGGGGCGCCGAGGCGGATCTGAAGGCGC TCACGCACTCGGTGCTCAAGAAACTGAAGGAGCGGCAGCT GGAGCTGCTGCTCCAGGCCGTGGAGTCCCGCGGCGGGACG CGCACCGCGTGCCTCCTGCTGCCCGGCCGCCTGGACTGCA GGCTGGGCCCGGGGGCGCCCGCCGGCGCGCAGCCTGCGCA GCCGCCCTCGTCCTACTCGCTCCCCCTCCTGCTGTGCAAA GTGTTCAGGTGGCCGGATCTCAGGCATTCCTCGGAAGTCA AGAGGCTGTGTTGCTGTGAATCTTACGGGAAGATCAACCC CGAGCTGGTGTGCTGCAACCCCCATCACCTTAGCCGACTC TGCGAACTAGAGTCTCCCCCCCCTCCTTACTCCAGATACC CGATGGATTTTCTCAAACCAACTGCAGACTGTCCAGATGC TGTGCCTTCCTCCGCTGAAACAGGGGGAACGAATTATCTG GCCCCTGGGGGGCTTTCAGATTCCCAACTTCTTCTGGAGC CTGGGGATCGGTCACACTGGTGCGTGGTGGCATACTGGGA GGAGAAGACGAGAGTGGGGAGGCTCTACTGTGTCCAGGAG CCCTCTCTGGATATCTTCTATGATCTACCTCAGGGGAATG GCTTTTGCCTCGGACAGCTCAATTCGGACAACAAGAGTCA GCTGGTGCAGAAGGTGCGGAGCAAAATCGGCTGCGGCATC CAGCTGACGCGGGAGGTGGATGGTGTGTGGGTGTACAACC GCAGCAGTTACCCCATCTTCATCAAGTCCGCCACACTGGA CAACCCGGACTCCAGGACGCTGTTGGTACACAAGGTGTTC CCCGGTTTCTCCATCAAGGCTTTCGACTACGAGAAGGCGT ACAGCCTGCAGCGGCCCAATGACCACGAGTTTATGCAGCA GCCGTGGACGGGCTTTACCGTGCAGATCAGCTTTGTGAAG GGCTGGGGCCAGTGCTACACCCGCCAGTTCATCAGCAGCT GCCCGTGCTGGCTAGAGGTCATCTTCAACAGCCGGTAG
[1191] In some embodiments, the SMAD7 AON targets region 108-128 of a human SMAD7. In some embodiments, the human SMAD7 has the nucleic acid sequence of SEQ ID NO:1, or the corresponding RNA sequence. In some embodiments, the human SMAD7 is a naturally occurring variant of the human SMAD7 having the nucleic acid sequence of SEQ IN NO:1.
[1192] In some embodiments, the SMAD7 AON targets nucleotides 403, 233, 294, 295, 296, 298, 299 or 533 of the human SMAD7. In some embodiments, the SMAD7 AON targets nucleotides 403, 233, 294, 295, 296, 298, 299 or 533 the nucleic acid sequence of SEQ ID NO: 1, or the corresponding RNA sequence.
[1193] In some embodiments, the SMAD7 AON comprises the nucleotide sequence of SEQ ID NO: 2 (5-GTCGCCCCTTCTCCCCGCAG-3).
[1194] In some embodiments, the SMAD7 AON comprises the nucleotide sequence of SEQ ID NO: 3 (5-GTCGCCCCTTCTCCCCGCAGC-3).
[1195] The SMAD7 AON used in the methods provided herein can comprise naturally occurring nucleobases, sugars, and covalent internucleotide (backbone) linkages, as well as non-naturally occurring portions. For example, the SMAD7 AON can comprise a mixed-backbone, e.g., including one or more phosphorothioate linkages. In some embodiments, the SMAD7 AON can have one or more cytosine residues replaced by 5-methylcytosine. In some embodiments the one or more cytosine residues form part of a CpG pair.
[1196] In some embodiments, the SMAD7 AON can comprise artificial nucleotides, such as deoxycytidine and/or 5-methyl 2-deoxycytidine, including, but not limited to, 5-methyl-2-deoxycytidine 5-monophosphate and 5-methyl-2-deoxycytidine 5-monophosphorothioate.
[1197] In some embodiments, the SMAD7 AON comprises the nucleic acid sequence of SEQ ID NO: 7 (5-GTXGCCCCTTCTCCCXGCAG-3), wherein X is 5-methyl 2-deoxycytidine.
[1198] In some embodiments, the SMAD7 AON comprises the nucleic acid sequence of SEQ ID NO: 5 (5-GTXYCCCCTTCTCCCXYCAG-3), whereby X is a nucleotide comprising a nitrogenous base selected from the group consisting of cytosine, 5-methylcytosine and 2-O-methylcytosine, and wherein Y is a nucleotide comprising a nitrogenous base selected from the group consisting of guanine, 5-methylguanine and 2-O-methylguanine, optionally provided that at least one of the nucleotides X or Y comprises a methylated nitrogenous base. In some embodiments, at least one of the internucleoside linkages of the SMAD7 AON is a phosphorothioate linkage. In some embodiments, all of the internucleoside linkages of the SMAD7 AON are phosphorothioate linkages. In some embodiments, the SMAD7 AON is a SMAD7 AON comprising a nucleotide sequence of SEQ ID NO: 5, wherein all internucleoside linkages are phosphothioate linkages.
[1199] In some embodiments, the SMAD7 AON comprises the nucleic acid sequence of SEQ ID NO: 6: (5-GTXGCCCCTTCTCCCXGCAGC-3), whereby X is 5-methyl-2-deoxycytidine. In some embodiments, at least one of the internucleoside linkages of the SMAD7 AON is a phosphorothioate linkage. In some embodiments, all of the internucleoside linkages of the SMAD7 AON are phosphorothioate linkages. In some embodiments, the SMAD7 AON is a SMAD7 AON comprising a nucleotide sequence of SEQ ID NO: 6, wherein all internucleotide linkages are phosphothioate linkages.
[1200] In some embodiments, the SMAD7 AON comprises the AON of
[1201] COMPOUND (I) is a SMAD7 AON with a phosphorothioate backbone. It can be described chemically as the fully neutralized sodium salt of a 3.fwdarw.5 linked 2-deoxyribophosphorothioate oligonucleotide 21-mer in which each of the 20 internucleotide linkages is an O,O linked phosphorothioate. The sequence of heterocyclic bases is depicted by SEQ ID NO: 6 and shown in
[1202] In some embodiments, the SMAD7 AON has the structure of COMPOUND (I). The following structure of COMPOUND (I) is drawn over four pages:
##STR00001## ##STR00002## ##STR00003## ##STR00004##
[1203] The structure of COMPOUND (I) is presented herein to show the sodium counterion (Na). A skilled artisan will understand that COMPOUND (I) may also refer to the anionic form without counterion. A skilled artisan will further understand that an anionic form of COMPOUND (I) can be protonated to form an acidic form of COMPOUND (I). In some embodiments, the phosphorothioate backbone of COMPOUND (I) can be fully or partially protonated to form an acidic form of COMPOUND (I).
[1204] In some embodiments, COMPOUND (I) is formulated as a gastro-resistant delayed release pH-dependent tablet designed to deliver the active substance in the distal GI tract (Formulation (I)).
[1205] In some embodiments, the SMAD7 AON comprises at least one internucleoside linkage, which is a phosphate linkage, e.g., a monophosphate linkage.
[1206] In some embodiments, the SMAD7 AON comprises at least one internucleoside linkage, which is a phosphorothioate linkage. In some embodiments, the SMAD7 AON comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more phosphorothioate linkages. In some embodiments, at least 5%, 10%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of internucleoside linkages in the SMAD7 AON are phosphorothioate linkages. In some embodiments, all internucleoside linkages are phosphorothioate linkages.
[1207] In some embodiments, the SMAD7 AON comprises at least one, unnatural nucleoside, e.g., 5-methyl-2-deoxycytidine-5-monophosphate and 5-methyl-2-deoxycytidine-5-monophosphorothioate. In some embodiments, the SMAD7 AON comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more deoxycytidine and/or 5-methyl 2-deoxycytidines. In some embodiments, at least 5%, 10%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of nucleotides in the SMAD7 AON comprise deoxycytidine and/or 5-methyl-2-deoxycytidine. In some embodiments, the SMAD7 AON comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more deoxycytidine and/or 5-methyl 2-deoxycytidine. In some embodiments, the SMAD7 AON comprises one or more deoxycytidines and no 5-methyl 2-deoxycytidine. In some embodiments, the SMAD7 AON comprises one or more 5-methyl 2-deoxycytidine and no deoxycytidine.
[1208] In some embodiments, the SMAD7 AON comprises methylphosphonate linkages that are be placed at the 5- and/or 3-ends of the SMAD7 AONs.
[1209] In some embodiments, the SMAD7 AON comprises pharmaceutically acceptable salts or solvates. In some embodiments, the solvates are hydrates. In some embodiments, the SMAD7 AON is a sodium salt of the SMAD7 AON including the nuclei acid sequence of COMPOUND (I) (as depicted by SEQ ID NO: 6), that optionally can comprise 1 to 20 O,O-linked phosphorothioate internucleotide linkages. In some embodiments, the SMAD7 AON comprises the free acid form, the salt form or the anionic form without a counterion of the nucleic acid sequence of COMPOUND (I), wherein each of the 20 internucleotide linkages is an O,O-linked phosphorothioate linkage. Contemplated salts of SMAD7 AON comprise those that are fully neutralized, e.g., each phosphorothioate linkage is associated with an ion such as Na.sup.t. In some embodiments the salts of the SMAD7 AON are only partially neutralized, e.g., less than all phosphorothioate linkages are associated with an ion (e.g., less than 99%, less than 95%, less than 90%, less than 85%, less than 80%, less than 85%, less than 80%, less than 75%, less than 70%, less than 65%, less than 60%, less than 55%, less than 50%, less than 45%, less than 40%, less than 35%, less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, less than 3%, or less than 1% are neutralized). In some embodiments, the phosphorothioate backbone of the nucleic acid sequence of COMPOUND (I) can be fully or partially protonated to form an acidic form of nucleic acid sequence of COMPOUND (I).
[1210] Exemplary SMAD7 AONs, are be described in U.S. Pat. Nos. 6,159,697, 7,807,818, and 8,648,186 and in International Patent Application Publication WO 2010/054826, each of which is incorporated herein by reference.
[1211] In some embodiment, the SMAD7 AON is an isotopically enriched SMAD7 AON, e.g., having one or more H replaced with a D.
[1212] In some embodiments, the 2-deoxyribonucleotides in the SMAD7 AON is replaced by corresponding ribonucleotides.
6.11 Pharmaceutical Compositions
[1213] The pharmaceutical compositions described in this section can be used in the methods provided herein. In some embodiments, the pharmaceutical composition comprises a SMAD7 AON described and a pharmaceutically acceptable adjuvant and/or excipient. In some embodiments, the pharmaceutical composition is an oral pharmaceutical composition. In some embodiments, the pharmaceutical composition comprises an enteric coating to topically deliver the modified SMAD7 AON to the terminal ileum and/or right colon of an IBD patient. In some embodiments, the pharmaceutical composition is a gastro-resistant granules formulation.
[1214] Contemplated SMAD7 AON s comprise oligonucleotides that act against SMAD7 and can be administered orally. Disclosed therapies can, when administered orally to a subject suffering from IBD, deliver an effective amount of an AON to the intestinal system of a patient, e.g. deliver an effective amount of an AON to the terminal ileum and/or right colon of a patient.
[1215] In some embodiments of the methods of treating IBD provided herein, the anti-SMAD7 therapy (e.g., a therapy comprising a SMAD7 AON) can be suitable for oral delivery of an AON, e.g., tablets, that comprise an enteric coating, e.g., a gastro-resistant coating, such that the compositions can deliver the antisense compound to, e.g., the terminal ileum and right colon of a patient. For example, such administration can result in a topical effect, substantially topically applying the antisense compound directly to an affected portion of the intestine of a subject. Such administration, can, in some embodiments, substantially avoid unwanted systemic absorption of the antisense compound.
[1216] For example, a tablet for oral administration can comprise granules (e.g., is at least partially formed from granules) that comprise a disclosed SMAD7 AON and pharmaceutically acceptable excipients. Such a tablet can be coated with an enteric coating. Contemplated tablets can comprise pharmaceutically acceptable excipients such as fillers, binders, disintegrants, and/or lubricants, as well as coloring agents, release agents, coating agents, sweetening, flavoring such as wintergreen, orange, xylitol, sorbitol, fructose, and maltodextrin, and perfuming agents, preservatives and/or antioxidants.
[1217] In some embodiments, contemplated pharmaceutical formulations comprise an intra-granular phase that comprises a contemplated SMAD7 AON or a pharmaceutically acceptable salt and a pharmaceutically acceptable filler. For example, COMPOUND(I) and a filler can be blended together, with optionally other excipients, and formed into granules. In some embodiments, the intragranular phase can be formed using wet granulation, e.g. a liquid (e.g., water) is added to the blended antisense compound and filler, and then the combination is dried, milled and/or sieved to produce granules. One of skill in the art would understand that other processes can be used to achieve an intragranular phase.
[1218] In some embodiments, contemplated formulations comprise an extra-granular phase, which can comprise one or more pharmaceutically acceptable excipients, and which can be blended with the intragranular phase to form a disclosed formulation.
[1219] An anti-SMAD7 therapy formulation can comprise an intragranular phase that comprises a filler. Exemplary fillers comprise, but are not limited to, cellulose, gelatin, calcium phosphate, lactose, sucrose, glucose, mannitol, sorbitol, microcrystalline cellulose, pectin, polyacrylates, dextrose, cellulose acetate, hydroxypropylmethyl cellulose, partially pregelatinized starch, calcium carbonate, and others including combinations thereof.
[1220] In some embodiments, an anti-SMAD7 therapy formulation can comprise an intragranular phase and/or an extragranular phase that comprises a binder, which can generally function to hold the ingredients of the pharmaceutical formulation together. Exemplary binders comprise, for example, the following: starches, sugars, cellulose or modified cellulose such as hydroxypropyl cellulose, lactose, pregelatinized maize starch, polyvinyl pyrrolidone, hydroxypropyl cellulose, hydroxypropylmethyl cellulose, low substituted hydroxypropyl cellulose, sodium carboxymethyl cellulose, methyl cellulose, ethyl cellulose, sugar alcohols and others, including combinations thereof.
[1221] Contemplated anti-SMAD7 therapy formulations, e.g., that comprise an intragranular phase and/or an extragranular phase, can comprise a disintegrant, such as, but not limited to, starch, cellulose, crosslinked polyvinyl pyrrolidone, sodium starch glycolate, sodium carboxymethyl cellulose, alginates, corn starch, crosmellose sodium, crosslinked carboxymethyl cellulose, low substituted hydroxypropyl cellulose, acacia, and others including combinations thereof. For example, an intragranular phase and/or an extragranular phase can comprise a disintegrant.
[1222] In some embodiments, a contemplated anti-SMAD7 therapy formulation comprises an intra-granular phase comprising a disclosed antisense compound and excipients chosen from: mannitol, microcrystalline cellulose, hydroxypropylmethyl cellulose, and sodium starch glycolate, or combinations thereof, and an extra-granular phase comprising one or more of: microcrystalline cellulose, sodium starch glycolate, and magnesium stearate, or mixtures thereof.
[1223] In some embodiments, a contemplated anti-SMAD7 therapy formulation can comprise a lubricant, e.g., an extra-granular phase can contain a lubricant. Lubricants comprise but are not limited to talc, silica, fats, stearin, magnesium stearate, calcium phosphate, silicone dioxide, calcium silicate, calcium phosphate, colloidal silicon dioxide, metallic stearates, hydrogenated vegetable oil, corn starch, sodium benzoate, polyethylene glycols, sodium acetate, calcium stearate, sodium lauryl sulfate, sodium chloride, magnesium lauryl sulfate, talc, and stearic acid.
[1224] In some embodiments, the pharmaceutical formulation comprises an enteric coating. Generally, enteric coatings create a barrier for the oral medication that controls the location at which the drug is absorbed along the digestive track. Enteric coatings can comprise a polymer that disintegrates at different rates according to pH. Enteric coatings can comprise, for example, cellulose acetate phthalate, methyl acrylate-methacrylic acid copolymers, cellulose acetate succinate, hydroxylpropylmethyl cellulose phthalate, methyl methacrylate-methacrylic acid copolymers, ethylacrylate-methacrylic acid copolymers, methacrylic acid copolymer type C, polyvinyl acetate-phthalate, and cellulose acetate phthalate.
[1225] In some embodiments, the enteric coating comprises an anionic, cationic, or neutral copolymer based on methacrylic acid, methacrylic/acrylic esters or their derivatives. In some embodiments, the enteric coating comprises an ethylacrylate-methacrylic acid copolymer. Commercially available enteric coatings comprise Opadry AMB, Acryl-EZE, Eudragit. In some embodiments, the enteric coating makes up about 5% to about 10%, about 5% to about 20%, about 8 to about 15%, about 8% to about 18%, about 10% to about 12%, or about 12% to about 16%, of a contemplated tablet by weight.
[1226] For example, an anti-SMAD7 therapy in the form of a tablet is provided that comprises or consists essentially of about 0.5% to about 70%, e.g., about 0.5% to about 10%, or about 1% to about 20%, by weight of a SMAD7 AON or a pharmaceutically acceptable salt thereof. Such a tablet can comprise for example, about 0.5% to about 60% by weight of mannitol, e.g., about 30% to about 50% by weight mannitol, e.g., about 40% by weight mannitol; and/or about 20% to about 40% by weight of microcrystalline cellulose, or about 10% to about 30% by weight of microcrystalline cellulose. For example, a contemplated tablet can comprise an intragranular phase that comprises about 30% to about 60%, e.g., about 45% to about 65% by weight, or alternatively, about 5 to about 10% by weight of Compound (I), about 30% to about 50%, or alternatively, about 5% to about 15% by weight mannitol, about 5% to about 15% microcrystalline cellulose, about 0% to about 4%, or about 1% to about 7% hydroxypropylmethyl cellulose, and about 0% to about 4%, e.g., about 2% to about 4% sodium starch glycolate by weight.
[1227] Exemplary anti-SMAD7 therapy formulations comprise dosage forms that comprise or consist essentially of about 10 mg to about 500 mg of an SMAD7 AON including the nucleic acid sequence of COMPOUND(I), for example, tablets that comprise between about 30 mg and about 310 mg, between about 50 mg and about 290 mg, between about 70 mg and about 270 mg, between about 70 mg and about 250 mg, between about 90 mg and about 230 mg, between about 110 mg and about 210 mg, or between 130 mg and about 190 mg, or between 150 mg and about 170 mg of COMPOUND (I) are contemplated herein. In some embodiments, the tablets comprise between about 5 mg and about 90 mg, between about 10 mg and about 70 mg, or between about 30 mg and about 50 mg of COMPOUND (I). In some embodiments, the tablets comprise about 20 mg, about 40 mg, about 60 mg, about 80 mg, about 100 mg, about 120 mg, about 140 mg, about 160 mg, about 180 mg, about 200 mg, about 220 mg, about 240 mg, about 260 mg, about 280 mg, or about 300 mg of COMPOUND (I).
[1228] In one embodiment, the anti-SMAD7 therapy can be a tablet for oral use comprising: about 0.5% to about 10% by weight of COMPOUND (I) or a pharmaceutically acceptable salt thereof; about 30% to about 50% by weight mannitol; and about 10% to about 30% by weight microcrystalline cellulose.
[1229] In an exemplary embodiment of the invention, a pharmaceutically acceptable tablet for oral administration is provided that comprises an intra-granular phase that can comprise about 50% by weight of COMPOUND (I) (or salt thereof), about 11.5% by weight mannitol, about 10% by weight microcrystalline cellulose, about 3% by weight hydroxypropylmethyl cellulose, and about 2.5% by weight sodium starch glycolate; and an extra-granular phase that can comprise about 20% by weight microcrystalline cellulose, about 2.5% by weight sodium starch glycolate, and about 0.5% by weight magnesium stearate. The tablet can also comprise an enteric coating.
[1230] In another exemplary embodiment, a pharmaceutically acceptable tablet for oral administration is provided that comprises or consists essentially of: an intra-granular phase that can comprise or consist essentially of about 5% to about 10%, e.g., about 8% by weight of COMPOUND (I), about 40% by weight mannitol, about 8% by weight microcrystalline cellulose, about 5% by weight hydroxypropylmethyl cellulose, and about 2% by weight sodium starch glycolate; and an extra-granular phase that can comprise about 17% by weight microcrystalline cellulose, about 2% by weight sodium starch glycolate, and about 0.4% by weight magnesium stearate.
[1231] Contemplated tablets can also comprise an enteric coating, e.g., a disclosed tablet can comprise about 10%, about 11%, about 12%, about 13%, about 14%, about 15%, about 16%, about 17%, or about 18% by weight of an enteric coating, e.g., ethylacrylate-methacrylic acid copolymers (e.g., AcyrlEZE).
[1232] For example, the anti-SMAD7 therapy can be in the form of a pharmaceutically acceptable tablet for oral use comprising an intra-granular phase and extra-granular phase, wherein for example, the intra-granular phase comprises about 5% to about 10%, by weight (for example about 8% by weight) of Compound (I) or a pharmaceutically acceptable salt thereof, about 40% by weight mannitol, about 8% by weight microcrystalline cellulose, about 5% by weight hydroxypropylmethyl cellulose, and about 2% by weight sodium starch glycolate, and, e.g., the extra-granular phase comprises about 17% by weight microcrystalline cellulose, about 2% by weight sodium starch glycolate, and about 0.4% by weight magnesium stearate, where the tablet can further comprise an enteric coating.
[1233] Contemplated formulations, e.g., tablets, in some embodiments, when orally administered to the patient can result in minimal plasma concentration of the oligonucleotide in the patient. In another embodiment, contemplated formulations, when orally administered to a patient, topically deliver to the terminal ileum and/or right colon of a patient, e.g., to an affected or diseased intestinal site of a patient.
7. EXAMPLES
Example 1: A Randomized, Double-Blind, Multicenter Study to Explore the Effect of Compound (I) on Endoscopic and Clinical Outcomes in Subjects with Active Crohn's Disease
[1234] Study Objectives
[1235] The primary objective of the study is to explore the effect of the SMAD7 AON Compound (I) (160 mg QD (QD=once daily)) on endoscopic outcomes, as measured by the SES-CD in subjects with active CD.
[1236] The secondary objectives of the study are to evaluate the effect of COMPOUND (I) (40 mg QD and 160 mg QD) on clinical activity, as measured by the CDAI in subjects with active CD and to evaluate the safety and tolerability of COMPOUND (I) (40 mg QD and 160 mg QD) in subjects with active CD.
[1237] The exploratory objectives of the study are: [1238] to explore the effect of COMPOUND (I) (40 mg QD and 160 mg QD) on clinical activity, as measured by the PRO-2 in subjects with active CD; [1239] to explore the effect of COMPOUND (I) (40 mg QD and 160 mg QD) on biomarkers of intestinal inflammation and tissue damage, such as but not limited to hsCRP, and FCP in subjects with active CD; [1240] to explore the effects of COMPOUND (I) (160 mg QD) on histological scores in intestinal mucosal biopsies from subjects with active CD; to explore the PD effects of COMPOUND (I) (160 mg QD) on the expression of biomarkers such as, but not limited to CD4, CD8 and HLA-DR, in intestinal mucosal biopsies from subjects with active CD; and [1241] to evaluate the systemic exposure of COMPOUND (I) (160 mg QD) in subjects with active CD.
[1242] Drug Identification
[1243] COMPOUND (I) is an AS ODN with a phosphorothioate backbone. It may be described chemically as the fully neutralized sodium salt of a 3.fwdarw.5 linked 2-deoxyribophosphorothioate oligonucleotide 21-mer in which each of the 20 internucleotide linkages is an O,O linked phosphorothioate. The sequence of heterocyclic bases of COMPOUND (I) (as depicted by SEQ ID NO: 6) is shown in
[1244] Study Design
[1245] A schematic diagram illustrating the study design is shown in
[1246] This is a randomized, double-blind, multicenter study to explore the effect of oral COMPOUND (I) on endoscopic and clinical outcomes in subjects with active CD, defined as a CDAI score 220 and 450 and a SES-CD score 7 (or SES-CD>4 if subject has ileitis only).
[1247] Approximately 51 subjects will be randomized in a 1:1:1 ratio to receive 1 of 3 treatment regimens in a 12-week Induction Phase: [1248] COMPOUND (I) 160 mg QD for 12 weeks [1249] COMPOUND (I) 160 mg QD for 8 weeks followed by 4 weeks of placebo [1250] COMPOUND (I) 160 mg QD for 4 weeks followed by 8 weeks of placebo
[1251] Treatment assignment at baseline will be stratified via an IVRS/IWRS based on previous exposure to TNF blockers (yes/no) and disease location (disease restricted to the terminal ileum and/or up to the mid transverse colon only, or disease involving at least 1 ulcerated segment distal to mid transverse colon). The number of subjects with previous exposure to TNF blockers (yes/no) is targeted to be approximately 40%. The number of subjects with disease involving distal to mid transverse colon is targeted to comprise approximately 50% of the study population.
[1252] Eligible subjects will enter the Induction Phase at the Baseline Visit (Week 0/Induction Visit 1). Subjects will be assigned randomly to receive IP as described above.
[1253] At Induction Week 12, subjects (responders) who achieve clinical remission, defined as a CDAI score <150, or clinical response, defined as a decrease from baseline of 100 points in CDAI score, at any of the following Induction Visits (Weeks 4, 8 and/or Week 12) will enter the Observation Phase. The Observation Phase will have a duration of up to 52 weeks. Subjects who are unable to achieve clinical remission or clinical response (nonresponders) at the following Induction Visits (Weeks 4, 8 and Week 12), will be discontinued from the study. Subjects who enter the Observation Phase and were receiving corticosteroids at baseline will start tapering corticosteroids at the end of the Induction Phase (Induction Week 12).
[1254] Subjects who enter the Observation Phase will be evaluated by CDAI score every 4 weeks. Subjects will not receive IP during the Observation Phase. Subjects who experience a partial loss of response or are unable to taper corticosteroids during the Observation Phase will enter the Extension Phase. Partial loss of response is defined as 2 consecutive visits with both a CDAI score 150 and an increase of CDAI score 50 points from the CDAI score at the visit when the subject was first a responder during the Induction Phase. Partial loss of response must be confirmed 2 to 4 weeks post initial identification of partial loss of response. Subjects who do not experience a partial loss of response until Observation Week 52 will have an end-of-study visit.
[1255] Subjects who enter the Extension Phase will receive COMPOUND (T) 40 mg QD on a 4-week, alternating dosing schedule (4 weeks of treatment with COMPOUND (I), followed by 4 weeks without COMPOUND (I) treatment) for 24 weeks.
[1256] Subjects who complete the Extension Week 24 visit will have two options: [1257] Subjects may proceed to a Long-Term Extension Study (see, e.g., Example 3), if the subjects meet all the inclusion/exclusion criteria of the Long-Term Extension Study. [1258] Subjects can receive a Follow-up Visit if they chose to not enter the Long-Term Extension Study.
[1259] Subjects who complete the Extension Phase, as well as subjects who prematurely discontinue from the study, for any reason, will enter the Follow-up Phase, the 4-week period after the last study visit.
[1260] The study will consist of 5 phases: [1261] Screening Phaseup to 4 weeks [1262] Induction Phase12 weeks [1263] Observation Phaseup to 52 weeks [1264] Extension Phase24 weeks [1265] Follow-up Phase4 weeks
[1266] Study Endpoints
[1267] The primary endpoint of this study is the change from baseline in the SES-CD score at Induction Week 12.
[1268] The secondary endpoints of the study are: [1269] the proportion of subjects achieving a clinical remission, defined as a CDAI score <150 at Induction Week 4; and [1270] the evaluation of safety and tolerability of COMPOUND (I), assessed by the type, frequency and severity of adverse events, and its relationship to IP, discontinuation due to adverse events, and clinically significant changes in vital signs, ECGs, and/or laboratory findings.
[1271] Exploratory endpoints of this study include exploratory efficacy endpoints, exploratory pharmacodynamic (PD)/biomarker endpoints, and exploratory pharmacokinetics (PK) endpoints.
[1272] The exploratory efficacy endpoints are: [1273] the proportion of subjects with endoscopic response, defined as a reduction of at least 50% in the SES-CD score, compared to baseline, at Induction Week 12; [1274] the proportion of subjects with endoscopic remission, defined as a SES-CD score 2 at
[1275] Induction Week 12; [1276] the proportion of subjects with mucosal healing, defined as the absence of intestinal mucosal ulcerations at Induction Week 12; [1277] the proportion of subjects who are in clinical remission, defined as a CDAI score <150 at Induction Weeks 2, 8, 12 and Extension Weeks 4, 8, 12, 16, 20, 24; [1278] the proportion of subjects who are in clinical response, defined as a decrease from baseline of 100 points in CDAI score at Induction Weeks 2, 4, 8, 12 and Extension Weeks 4, 8, 12, 16, 20, 24; [1279] time to partial loss of response, defined as 2 consecutive visits with both a CDAI score 150 and an increase of CDAI score 50 points from the CDAI score at the visit when the subject was first a responder during the Induction Phase; [1280] the proportion of subjects who have a PRO-2 score <8 at Induction Weeks 2, 4, 8, 12 and Extension Weeks 4, 8, 12, 16, 20, 24; [1281] the proportion of subjects who have a decrease from baseline of 8 points in the PRO-2 score at Weeks 2, 4, 8, 12 and Extension Weeks 4, 8, 12, 16, 20, 24; [1282] the proportion of subjects who achieve corticosteroid-free clinical remission at extension Week 24 among subjects receiving oral corticosteroids at baseline; [1283] the change from baseline in the CDAI score at Induction Weeks 2, 4, 8, 12 and Extension
[1284] Weeks 0, 4, 8, 12, 16, 20, 24; [1285] the change from baseline in the PRO-2 score at Induction Weeks 2, 4, 8, 12 and Extension Weeks 0, 4, 8, 12, 16, 20, 24; the change from baseline in the average daily liquid or soft stool frequency score at Induction Weeks 2, 4, 8, 12 and Extension Weeks 0, 4, 8, 12, 16, 20, 24; [1286] the change from baseline in the average daily abdominal pain score at Induction Weeks 2, 4, 8, 12 and Extension Weeks 0, 4, 8, 12, 16, 20, 24; [1287] the change from baseline in histologic scores from the intestinal mucosa at Induction Week 12; and [1288] the proportion of subjects in clinical response and clinical remission at Observation Week 52.
[1289] The exploratory PD/biomarker endpoints are: [1290] the change from baseline in hsCRP at Induction Weeks 4, 8, 12, Observations Week 20, 52 and Extension Weeks 0, 4, 8, 12, 16, 20, 24; [1291] the change from baseline in FCP at Induction Weeks 4, 8, 12, Observation Phase (every 8 weeks for the duration of the Observation Phase), and Extension Weeks 0, 4, 8, 12, 16, 20, 24; and [1292] the change from baseline in PD markers, such as, but not limited to, CD4, CD8 and HLA-DR in intestinal mucosa at Induction Week 12.
[1293] The exploratory PK endpoint is the plasma concentration of COMPOUND (I) at Induction Weeks 4, 8 and 12.
[1294] Study Population
[1295] The study population will consist of female and male subjects 18 years of age and older with active CD. Subjects must have a diagnosis of CD with a duration of at least 3 months prior to screening and a CDAI score 220 and 450 and SES-CD score 7 (or SES-CD>4 if subject has ileitis only) at screening. Subjects must have experienced treatment failure or intolerance to either aminosalicylates, budesonide, systemic corticosteroids, immunosuppressants or TNF blockers. Enrollment of subjects with prior exposure to TNF blockers will be limited to approximately 40% of the total subjects enrolled. The number of subjects with disease involving distal to mid transverse colon is targeted to comprise approximately 50% of the study population.
[1296] Study Duration
[1297] The overall study duration will be up to 97 weeks, with different phases as follows: up to 5 weeks in the Screening Phase, 12 weeks in the Induction Phase, up to 52 weeks in the Observation Phase, 24 Weeks in the Extension Phase, and 4 weeks in the Follow-up Phase.
[1298] End of Trial
[1299] The End of Trial is defined as either the date of the last visit of the last subject to complete the study, or the date of receipt of the last data point from the last subject that is required for primary, secondary and/or exploratory analysis, as pre-specified in the protocol and/or the SAP, whichever is the later date.
[1300] Safety Assessments
[1301] Serum and Urine Pregnancy Tests for Females of Childbearing Potential:
[1302] A serum pregnancy test with a sensitivity of 25 mIU/mL will be required for FCBP at screening. A urine pregnancy test will be performed on all FCBP at the Baseline Visit, at Observation Week 52 if subjects do not experience a partial loss of response by 52 weeks of observation/or Extension Week 24/or the Early Termination Visit, and at the Follow-up Visit. A urine pregnancy test kit will be provided by the central laboratory. Pregnancy tests should be performed if the FCBP has missed a menstrual period or the contraception method has changed.
[1303] Vital Signs, Height, and Weight:
[1304] Vital signs, including temperature, pulse, and seated blood pressure will be taken during visits. Height will be measured and recorded at screening; weight (to be done in street clothes, no shoes) will also be measured and recorded at different timepoints, including during screening. Body mass index (BMI) will be calculated at screening.
[1305] Complete and Limited Physical Examinations:
[1306] Complete physical examinations will include evaluation of the skin, nasal cavities, eyes, ears, respiratory, cardiovascular, abdominal, neurological, lymphatic, and musculoskeletal systems. Limited physical examinations will include evaluation of the skin, respiratory, cardiovascular, lymphatic, and musculoskeletal systems. Results of the complete and limited physical examinations will be recorded only in the source documents.
[1307] Clinically significant abnormal findings (with the exception of the disease under study [CD]) identified prior to first dose of IP will be recorded on the electronic case report form (eCRF) as medical history; clinically significant findings after the first dose of IP will be recorded as AEs.
[1308] Gynecological and urogenital examinations will not be performed unless for cause.
[1309] Stool Culture/Microbiology:
[1310] Stool culture of enteric pathogens and assessment of Clostridium difficile (C. difficile) toxin will be performed at screening. Subjects who are initially positive for C. difficile may re-screen for the study after they have successfully completed therapy and had 2 months of consecutive negative tests for C. difficile.
[1311] Twelve-Lead Electrocardiogram:
[1312] The 12-lead ECG will be performed after the subject has been supine for approximately 3 minutes. Sites are to utilize their own local ECG machines for the study and the automated ECG readings will be further interpreted by the Investigator by clinically correlating them with the subject's condition. The Investigator's clinical interpretation will be recorded in the eCRF as: normal; abnormal, not clinically significant; or abnormal, clinically significant. Abnormal, clinically significant results should be recorded in the Medical History eCRF if found prior to first dose of IP or in the AE eCRF if found after the first dose of IP.
[1313] Clinical Laboratory Evaluations:
[1314] A central laboratory will be used for this study. Clinical laboratory evaluations will include: [1315] Hematology: complete blood count (red blood cell [RBC] count, hemoglobin, hematocrit, white blood cell [WBC] count and differential, absolute WBC counts, platelet count) [1316] Coagulation: prothrombin time (PT), activated partial thromboplastin time (APTT) [1317] Serum chemistries: total protein, albumin, calcium, phosphorous, glucose, total cholesterol, triglycerides, uric acid, total bilirubin, alkaline phosphatase, aspartate aminotransferase (AST)/serum glutamic-oxaloacetic transaminase (SGOT), alanine aminotransferase (ALT)/serum glutamic-pyruvic transaminase (SGPT), sodium, potassium, chloride, carbon dioxide, blood urea nitrogen (BUN), creatinine, lactic dehydrogenase (LDH), magnesium, complement activation (Bb, C3a and C5a) [1318] Urinalysis: dipstick urinalysis (specific gravity, pH, glucose, ketones, protein, blood, bilirubin, leukocyte esterase, nitrite, and urobilinogen) [1319] Microscopic urinalysis (epithelial cells, RBC, WBC, and casts) will be performed only if the dipstick urinalysis is abnormal
[1320] Clinical laboratory evaluations are not required to be fasting. However, the site will record whether a clinical laboratory evaluation was fasting or nonfasting on the laboratory requisition form.
[1321] Adverse Events
[1322] Worsening of a subject's CD, including CD flare, should be considered as worsening of disease under study, and should not be captured as an AE. Worsening or exacerbation of CD, including CD flare, meeting the definition of an SAE should be reported as an SAE.
[1323] Efficacy Assessments
[1324] Subject Diary for Crohn's Disease Activity
[1325] During Screening Visit 1, an electronic subject diary will be given to each subject for CD activity in order to record the following information: [1326] Number of liquid or soft stools per day [1327] Abdominal pain/cramps [1328] General well-being [1329] Fever higher than 37.8 C. during previous week [1330] Taking diphenoxylate/atropine, loperamide, or opiates for diarrhea
[1331] The information extracted will be used for calculation of the CDAI and PRO-2, taking into account the data recorded over the last 7 days prior to each study visit.
[1332] Crohn's Disease Activity Index
[1333] The CDAI is the most commonly used measure in clinical studies evaluating the efficacy of new therapies in CD patients with predominantly inflammatory disease. This index is primarily based on a self-assessment questionnaire completed by the subject. It will assess how CD affects the subject's quality of life and the effect of treatment. The CDAI consists of a questionnaire with responses scored numerically and weighted. Scores (range 0 to 600) are then ranked according to severity of the disease. Mild active disease is defined by a score of 150 and 219, moderate active disease is defined by a score of 220 and 450 whereas severe disease is defined as a CDAI score >450. Remission is defined as a CDAI score <150.
[1334] The CDAI consists of 8 variables: [1335] Number of liquid or soft stools per day (each day for 7 days) [1336] Abdominal pain/cramps (each day for 7 days) [1337] General well-being (each day for 7 days) [1338] Number of complications: [1339] Arthritis or arthralgias [1340] Iritis or uveitis [1341] Erythema nodosum, pyoderma gangrenosum, or aphthous ulcers [1342] Anal fissures, fistulae, or abscess [1343] Other fistula [1344] Fever higher than 37.8 C. during previous week [1345] Taking loperamide, diphenoxylate, or opiates for diarrhea [1346] Abdominal mass [1347] Hematocrit of less than 0.47 in men and less than 0.42 in women [1348] Percentage of deviation above or below standard weight.
[1349] Patient Reported Outcomes
[1350] The Patient Reported Outcomes (PROs), defined by patients to quantify symptoms, has been proposed as an important aspect of assessing activity of IBD. PRO-2 for CD consists of 2 items from CDAI: liquid or soft stool frequency and abdominal pain. The total PRO-2 score is calculated similarly to the CDAI, the daily scores of liquid or soft stool frequency and abdominal pain, averaged over 7 days, weighted with the original CDAI multiplication factors. Values corresponding to CDAI scores of 150, 220, and 450 points are 8, 14, and 34 points, and the corresponding values for change from baseline in CDAI scores of 50, 70, and 100 points, are 2, 5, and 8 points for the PRO-2.
[1351] Ileocolonoscopy
[1352] All subjects are required to have ileocolonoscopies performed during the Screening Phase and Induction Week 12. The screening ileocolonoscopy is required to be performed at least 14 days before the Baseline Visit since it may interfere with the CDAI and PRO-2 assessments.
[1353] Intestinal mucosal biopsies will be performed when the ileocolonoscopies are done. Approximately two biopsies will be collected from the involved areas (no ulcer edges).
[1354] Conventional histological assessment will also be performed and measured by using a microscopic tissue grading score. During the procedure, biopsies will be collected from the inflamed mucosa (not from ulcers).
[1355] Simple Endoscopic Score for CD
[1356] The SES-CD is a validated endoscopic index that closely correlates with the Crohn's disease endoscopic index of severity (CDEIS) and is often considered the standard for endoscopic evaluation in subjects with CD. The two score indexes closely correlate; however, SES-CD is considered more suitable for clinical trials due to its simplicity and has been widely adopted for this purpose. Endoscopic response has been defined as a reduction of at least 50% in the SES-CD score from baseline, endoscopic remission defined as a SES-CD2 and mucosal healing defined as as the absence of ulceration.
[1357] Pharmacodynamic/Biological Markers
[1358] High sensitivity C-reactive protein (hsCRP) will be analyzed in blood samples and additional serum biomarkers may be analyzed as well. Fecal calprotectin (FCP) will be assessed in the fecal samples. The expression of biomarkers such as, but not limited to CD4, CD8 and HLA-DR, in intestinal mucosal biopsies will also be analyzed.
[1359] Pharmacokinetics
[1360] A sparse PK substudy has been incorporated into the study to monitor systematic exposures of COMPOUND (I).
[1361] Sparse Pharmacokinetics Blood Draw:
[1362] For all subjects enrolled, 2 blood draws will be obtained for sparse PK sampling at Weeks 4, 8, and 12 for a total of 6 blood specimens from a subject. The blood draws will occur at 2 time windows: 1) predose (at least >23 hours after the previous dose); and 2) 1 to 6 hours post-dose.
[1363] On all PK visits, subjects must bring their IP to the study center and IP must be administered to subjects at the study center after the collection of the predose PK blood sample.
[1364] The last dosing date and time prior to PK blood draw of each visit will be recorded. When the subject is providing a predose blood draw on the day of a PK substudy visit, the subject must be reminded to provide the date and time of his/her last dose from the day before the visit. Actual PK blood sample collection times and associated dosing times (e.g., the dosing times prior to PK sampling times) will be recorded.
[1365] Dosing
[1366] Subjects will be instructed to take the IP in the morning, 30 minutes before breakfast, with a glass of water.
[1367] Study completion for an individual subject is defined as reaching Extension Week 24, or reaching Observation Week 52 if subject does not experience a partial loss of response by 52 weeks of observation and completing the Follow-up Phase. Subjects not meeting this definition will be considered early terminators.
[1368] Study Population
[1369] Number of Subjects and Sites:
[1370] Approximately 48 subjects will be enrolled in this study.
[1371] Inclusion Criteria
[1372] Subjects must satisfy the following criteria to be enrolled in the study: [1373] Is a male or female who is 18 years at the time of signing the ICF. [1374] Understand and voluntarily sign an ICF prior to conducting any study related assessments/procedures. [1375] Able to adhere to the study visit schedule and other protocol requirements. [1376] Diagnosis of CD with a duration of at least 3 months prior to screening. [1377] Diagnosis of ileitis, ileocolitis or colitis as determined by endoscopic, radiographic or any other imaging modality (e.g., MRI, CT scan) evaluation performed within 2 years prior to screening. Subjects with colitis restricted to the left colon will not be allowed in the trial. [1378] Active disease, defined as CDAI score 220 and 450 (range: 0 to 600) at screening. [1379] SES-CD score 7 at screening. Subjects with ileitis only will require SES-CD>4. [1380] Must have failed or experienced intolerance to at least one of the following: aminosalicylates, budesonide, systemic corticosteroids or immunosuppressants (e.g., 6-MP, AZA, or MTX) or TNF blockers (e.g., infliximab, adalimimab or certolizumab). [1381] Subjects receiving oral aminosalicylates may continue their use during the study, provided that treatment was initiated at least 6 weeks prior to the Baseline Visit, and has been given at a stable dose for at least 2 weeks prior to the Baseline Visit. The dose of oral aminosalicylates must remain stable through the duration of the study or early termination from the study. If oral aminosalicylates have been recently discontinued, treatment must have been stopped at least 2 weeks prior to the Baseline Visit. [1382] Subjects receiving oral corticosteroids may continue their use during the Induction Phase, provided that the dose (prednisone 20 mg/day or equivalent, budesonide 9 mg/day) has been stable for 3 weeks prior to the Baseline Visit. If oral corticosteroids were recently discontinued, discontinuation must have been completed at least 4 weeks prior to screening. Corticosteroid doses should remain stable until the subject is eligible to start corticosteroids tapering. [1383] Subjects receiving immunosuppressants, such as 6-MP, AZA or MTX may continue their use during the study, provided that treatment was initiated 12 weeks prior to the Baseline Visit. The dose of immunosuppressants must be at a stable dose for 8 weeks prior to the Baseline Visit and must remain stable through the duration of the study or early termination from the study. Subjects who discontinued immunosuppressants should have stopped them at least 8 weeks prior the Baseline Visit. [1384] Must meet the following laboratory criteria: [1385] White blood cell count 3000/mm.sup.3 (3.010.sup.9/L) and <14,000/mm.sup.3 (<14.010.sup.9/L) [1386] Platelet count 100,000/mm.sup.3 (10010.sup.9/L) [1387] Serum creatinine 1.5 mg/dL (132.6 mol/L) [1388] AST (SGOT) and ALT (SGPT)2upper limit of normal (ULN) [1389] Total bilirubin 2 mg/dL (34 mon) or albumin lower limit of normal (LLN) [1390] Hemoglobin 9 g/dL (5.6 mmoUL) [1391] Activated partial thromboplastin time (APTT)1.5ULN [1392] Females of childbearing potential (FCBP) must have a negative pregnancy test at Screening and the Baseline Visit.
[1393] Exclusion Criteria
[1394] The presence of any of the following will exclude a subject from enrollment: [1395] Diagnosis of Crohn's colitis restricted to the left colon, UC, indeterminate colitis, ischemic colitis, microscopic colitis, radiation colitis or diverticular disease-associated colitis. [1396] Local manifestations of CD such as strictures, abscesses, fistula, short bowel syndrome or other disease complications for which surgery might be indicated or could confound the evaluation of efficacy. [1397] The female subject's chosen form of contraception must be effective by the time the female subject is randomized into the study (for example, hormonal contraception should be initiated at least 28 days before randomization). [1398] Intestinal resection within 6 months or any intra-abdominal surgery within 3 months prior to screening. [1399] Subjects with an ileostomy or a colostomy. [1400] Stool positive for any enteric pathogen or C. difficile toxin at screening. [1401] History of colorectal cancer or colorectal dysplasia. [1402] Prior use of mycophenolic acid, tacrolimus, sirolimus, cyclosporine, thalidomide or apheresis (e.g., Adacolumn) for the treatment of CD. In addition, prior use of any of these treatment modalities for an indication other than CD within 8 weeks of screeing is also excluded. [1403] Use of IV corticosteroids within 2 weeks of the Baseline Visit. [1404] Use of topical treatment with 5-ASA or corticosteroid enemas or suppositories within 2 weeks of the Baseline Visit. [1405] Use of antibiotic therapy for the treatment of CD within 3 weeks of screening. [1406] Use of cholestyramine within 3 weeks of screening. [1407] Prior treatment with more than 2 TNF blockers (e.g., infliximab, adalimumab, or certolizumab) any biologic agents, including TNF blockers. [1408] Prior treatment with any integrin antagonists (e.g., natalizumab or vedolizumab) [1409] Use of TNF blockers within 12 months of screening. [1410] Administration of total parenteral nutrition (TPN) within 4 weeks of screening. [1411] History of any clinically significant neurological, renal, hepatic, gastrointestinal, pulmonary, metabolic, cardiovascular, psychiatric, endocrine, hematological disorder or disease, or any other medical condition that, in the Investigator's opinion, would prevent the subject from participation in the study. [1412] Any condition, including the presence of laboratory abnormalities, which places the subject at unacceptable risk if he/she was to participate in the study or confounds the ability to interpret data from the study. [1413] Pregnant or breastfeeding. [1414] History of any of the following cardiac conditions within 6 months of screening: myocardial infarction, acute coronary syndrome, unstable angina, new onset atrial fibrillation, new onset atrial flutter, second- or third-degree atrioventricular block, ventricular fibrillation, ventricular tachycardia, heart failure, cardiac surgery, interventional cardiac catheterization (with or without a stent placement), interventional electrophysiology procedure, or presence of implanted defibrillator. [1415] Known active current or history of recurrent bacterial, viral, fungal, mycobacterial or other infections (including but not limited to tuberculosis and atypical mycobacterial disease and Herpes zoster), human immunodeficiency virus (HIV), or any major episode of infection requiring hospitalization or treatment with intravenous (IV) or oral antibiotics within 4 weeks of screening. [1416] History of congenital or acquired immunodeficiency (e.g., common variable immunodeficiency disease). [1417] History of malignancy, except for: [1418] Treated (i.e., cured) basal cell or squamous cell in situ skin carcinomas [1419] Treated (i.e., cured) cervical intraepithelial neoplasia or carcinoma in situ of the cervix with no evidence of recurrence within the previous 5 years [1420] Subjects who have received any investigational drug or device within 1 month of screening. [1421] Prior treatment with COMPOUND (I), or participation in a clinical study involving COMPOUND (I). [1422] History of alcohol, drug, or chemical abuse within the 6 months prior to screening. [1423] Known hypersensitivity to oligonucleotides or any ingredient in the IP.
[1424] Description of Study Treatments
[1425] Description of Investigational Products: COMPOUND (I) will be provided as 40-mg film coated tablets. Placebo will be provided as identically appearing tablets.
[1426] Treatment Administration and Schedule: Subjects will receive 1 bottle each visit. Four tablets will be taken by subject once daily in the Induction Phase and 1 tablet will be taken per day in the Extension Phase. Subjects will be instructed to take the IP in the morning, 30 minutes before breakfast, with a glass of water, they will also be instructed to refer to the label for storage instructions. Treatment and administration schedules are described below in Table 2 and Table 3.
TABLE-US-00003 TABLE 2 Dosing Schedule for Induction Phase Treatment Induction Induction Induction Treatment Group Week 0 Week 4 Week 8 COMPOUND (I) 160 mg QD 160 mg QD 160 mg QD 160 mg QD for 12 Weeks COMPOUND (I) 160 mg QD 160 mg QD Placebo 160 mg QD for 8 Weeks COMPOUND (I) 160 mg QD Placebo Placebo 160 mg QD for 4 Weeks
TABLE-US-00004 TABLE 3 Dosing Schedule for Extension Phase Treatment Treatment Extension Extension Extension Extension Extension Extension Group Week 0 Week 4 Week 8 Week 12 Week 16 Week 20 COMPOUND (I) 40 mg QD No IP 40 mg QD No IP 40 mg QD No IP 40 mg QD
[1427] Method of Treatment Assignment
[1428] Approximately 48 subjects will be randomized in a 1:1:1 ratio to receive 1 of 3 treatment regimens in a 12-week Induction Phase: [1429] COMPOUND (I) 160 mg QD for 12 weeks [1430] COMPOUND (I) 160 mg QD for 8 weeks followed by 4 weeks of placebo [1431] COMPOUND (I) 160 mg QD for 4 weeks followed by 8 weeks of placebo
[1432] Treatment assignment at baseline will be stratified via an IVRS/IWRS based on disease location (disease restricted to the terminal ileum and/or up to the mid transverse colon only, or disease involving at least 1 ulcerated segment distal to mid transverse colon). The number of subjects with disease involving distal to mid transverse colon is targeted to comprise approximately 50% of the study population.
[1433] Eligible subjects will enter the Induction Phase at the Baseline Visit (Week 0/Induction Visit 1). Subjects will be assigned randomly to receive IP as described above.
[1434] At Induction Week 12, subjects (responders) who achieve clinical remission, defined as a CDAI score <150, or clinical response, defined as a decrease from baseline of 100 points in CDAI score, at any of the following Induction Visits (Weeks 4, 8 and/or Week 12) will enter the Observation Phase. The Observation Phase will have a duration of up to 52 weeks. Subjects who are unable to achieve clinical remission or clinical response (nonresponders) at the following Induction Visits (Weeks 4, 8 and Week 12), will be discontinued from the study.
[1435] Subjects who enter the Observation Phase will be evaluated by CDAI score every 4 weeks. Subjects will not receive IP during the Observation Phase. Subjects who experience a partial loss of response or are unable to taper corticosteroids during the Observation Phase will enter the Extension Phase. Partial loss of response is defined as 2 consecutive visits with both a CDAI score 150 and an increase of CDAI score 50 points from the CDAI score at the visit when the subject was first a responder during the Induction Phase. Partial loss of response must be confirmed 2 to 4 weeks post initial identification of partial loss of response. Subjects who do not experience a partial loss of response until Observation Week 52 will have an end-of-study visit.
[1436] Subjects who enter the Extension Phase will receive COMPOUND (I) 40 mg QD on a 4-week, alternating dosing schedule (4 weeks of treatment with COMPOUND (1), followed by 4 weeks without COMPOUND (I) treatment) for 24 weeks.
[1437] Permitted Concomitant Medications and Procedures
[1438] The following concomitant medications are permitted during the study: [1439] Oral aminosalicylates (sulfasalazine [SSZ] or 5-ASA compounds) are allowed during the study, provided that treatment was initiated at least 6 weeks prior to the Baseline Visit, and has been given at a stable dose for at least 2 weeks prior to the Baseline Visit. The dose of oral aminosalicylates must remain stable through the duration of the study or early termination from the study. If oral aminosalicylates have been recently discontinued, treatment must have been stopped at least 2 weeks prior to the Baseline Visit. [1440] Oral corticosteroids are allowed during the Induction Phase, provided that the dose (prednisone 20 mg/day or equivalent, budesonide 9 mg/day) has been stable for 4 weeks prior to the Baseline Visit. If oral corticosteroids were recently discontinued, discontinuation must have been completed at least 4 weeks prior to screening. Corticosteroid doses should remain stable until the subject is eligible to start corticosteroids tapering. [1441] Immunosuppressants, such as AZA, 6-MP or MTX are allowed during the study, provided that treatment was initiated 12 weeks prior to the Baseline Visit. The dose of immunosuppressants must be at a stable dose for 8 weeks prior to the Baseline Visit and must remain stable through the duration of the study or early termination from the study. Subjects who discontinued immunosuppressants should have stopped them at least 8 weeks prior to the Baseline Visit. [1442] Acetaminophen and low-dose aspirin for cardiovascular prophylaxis are allowed. The dose of concomitant medications noted above may not be increased above the baseline dose during the study. No new CD therapy can be prescribed once the subject has been randomized to the study.
[1443] Subjects who enter the Observation Phase and were receiving corticosteroids at baseline will start tapering corticosteroids at the end of the Induction Phase (Induction Week 12). Subjects who are unable to taper corticosteroids during the Observation Phase may start tapering during the Extension Phase at the Investigator's discretion. The tapering schedule is as follows: [1444] For prednisone doses >10 mg (or equivalent) daily dose, each week the daily dose is to be tapered by 5 mg until a dose of 10 mg/day is reached, after that each week the daily dose is to be tapered by 2.5 mg until discontinuation. [1445] For prednisone doses 10 mg (or equivalent), each week the daily dose is to be tapered by 2.5 mg until discontinuation. [1446] Subjects receiving budesonide should have their daily dose tapered by 3 mg every weeks.
[1447] Prohibited Concomitant Medications and Procedures
[1448] The following concomitant medications are prohibited: [1449] Uses of any biologic agents, including TNF blockers through the duration of the study. [1450] Use of mycophenolic acid, tacrolimus, sirolimus, cyclosporine, thalidomide or apheresis (e.g., Adacolumn) through the duration of the study. [1451] Use of topical treatment with 5-ASA or corticosteroid enemas or suppositories within 2 weeks of the Baseline Visit and through the duration of the study. [1452] Use of IV corticosteroids within 2 weeks of the Baseline Visit and through the duration of the study. [1453] Administration of TPN within 4 weeks of screening and through the duration of the study. [1454] Chronic use of nonsteroidal anti-inflammatory drugs (NSAIDs). [1455] Use of antibiotic therapy for the treatment of CD within 3 weeks of screening and through the duration of the study. [1456] Use of cholestyramine within 3 weeks of screening and through the duration of the study.
[1457] Required Concomitant Medications and Procedures
[1458] There are no required concomitant medications.
[1459] Required procedures include ileocolonoscopy and intestinal mucosal biopsy.
[1460] Adverse Events
[1461] Monitoring, Recording and Reporting of Adverse Events:
[1462] An adverse event (AE) is any noxious, unintended, or untoward medical occurrence that may appear or worsen in a subject during the course of a study. It may be a new intercurrent illness, a worsening concomitant illness, an injury, or any concomitant impairment of the subject's health, including laboratory test values, regardless of etiology. Any worsening (i.e., any clinically significant adverse change in the frequency or intensity of a pre-existing condition) should be considered an AE.
[1463] Abuse, withdrawal, sensitivity or toxicity to an investigational product should be reported as an AE.
[1464] All subjects will be monitored for AEs during the study. Assessments may include monitoring of any or all of the following parameters: the subject's clinical symptoms, laboratory, pathological, radiological or surgical findings, physical examination findings, or findings from other tests and/or procedures.
[1465] Evaluation of Adverse Events:
[1466] A qualified Investigator will evaluate all adverse events as to:
[1467] Seriousness: A serious adverse event (SAE) is any AE occurring at any dose that: [1468] Results in death; [1469] Is life-threatening (i.e., in the opinion of the Investigator, the subject is at immediate risk of death from the AE); [1470] Requires inpatient hospitalization or prolongation of existing hospitalization (hospitalization is defined as an inpatient admission, regardless of length of stay); [1471] Results in persistent or significant disability/incapacity (a substantial disruption of the subject's ability to conduct normal life functions); [1472] Results in congenital anomaly/birth defect; [1473] Constitutes an important medical event.
[1474] Important medical events are defined as those occurrences that may not be immediately life threatening or result in death, hospitalization, or disability, but may jeopardize the subject or require medical or surgical intervention to prevent one of the other outcomes listed above. Medical and scientific judgment should be exercised in deciding whether such an AE should be considered serious.
[1475] Events not considered to be SAEs are hospitalizations for: [1476] A standard procedure for protocol therapy administration. However, hospitalization or prolonged hospitalization for a complication of therapy administration will be reported as an SAE. [1477] Routine treatment or monitoring of the studied indication not associated with any deterioration in condition. [1478] The administration of blood or platelet transfusion as routine treatment of studied indication. However, hospitalization or prolonged hospitalization for a complication of such transfusion remains a reportable SAE. [1479] A procedure for protocol/disease-related investigations (e.g., surgery, scans, endoscopy, sampling for laboratory tests, bone marrow sampling). However, hospitalization or prolonged hospitalization for a complication of such procedures remains a reportable SAE. [1480] Hospitalization or prolongation of hospitalization for technical, practical, or social reasons, in absence of an AE.
Example 2: A Randomized, Double-Blind, Placebo-Controlled, Multicenter Study to Investigate the Efficacy and Safety of COMPOUND (I) for the Treatment of Subjects with Active Crohn's Disease
[1481] Study Objectives
[1482] The primary objective of the study is to evaluate the efficacy of COMPOUND (I) compared with placebo on clinical activity, as measured by the CDAI in subjects with active CD.
[1483] The secondary objectives of the study are: [1484] To evaluate the efficacy of COMPOUND (I) compared with placebo on endoscopic outcomes, as measured by the SES-CD in subjects with active CD; [1485] To evaluate the efficacy of COMPOUND (I) compared with placebo on corticosteroid-free clinical remission in subjects with active CD; [1486] To evaluate the long-term efficacy of COMPOUND (I) compared with placebo on clinical activity and endoscopic outcomes in subjects with active CD; [1487] To evaluate the safety and tolerability of COMPOUND (I) in subjects with active CD.
[1488] The exploratory objectives are: [1489] To evaluate additional measures of short-term and long-term efficacy of COMPOUND (I) compared with placebo on clinical activity and endoscopic outcomes in subjects with active CD; [1490] To evaluate the change in biomarkers such as hsCRP and FCP in response to COMPOUND (I), compared with placebo, in subjects with active CD; [1491] To evaluate the change in quality of life and health economic outcomes in response to COMPOUND (I), compared with placebo, in subjects with active CD; [1492] To evaluate the systemic exposure of COMPOUND (I) in subjects with active CD.
[1493] Drug Identification
[1494] Drug tested is COMPOUND (I) as in Example 1.
[1495] Study Design
[1496] A schematic diagram illustrating the study design is shown in
[1497] This is a randomized, double-blind, placebo-controlled, multicenter study to evaluate the efficacy and safety of 3 treatment regimens of oral COMPOUND (I) versus placebo in subjects with active CD (defined by a CDAI score 220 and =450 and a total SES-CD6 at screening, or the ileum segmental SES-CD4 at screening). Approximately 1064 subjects will be randomized in a 1:1:1:1 ratio (266 subjects per COMPOUND (I) arm [total 798] and 266 subjects in the placebo arm) to receive 1 of 3 double-blind, oral COMPOUND (1) treatment regimens, or identically appearing placebo once daily (QD) for 52 weeks.
[1498] Treatment assignment at baseline (Week 0/Visit 2) will be stratified via an Interactive Web Response System (IWRS) based on concomitant use of corticosteroids (yes/no); concomitant use of immunosuppressants (e.g., azathioprine [AZA], 6-mercaptopurine [6-MP], or methotrexate [MIX]) (yes/no), and previous exposure to biologics (e.g., infliximab, adalimumab, certolizumab or vedolizumab) (yes/no). The total number of subjects with previous exposure to biologics is targeted to comprise approximately 35% of the study population.
[1499] Subjects will receive double-blind, oral COMPOUND (I) or identically appearing placebo (QD) as follows (see Table 5): [1500] COMPOUND (I) 160 mg QD for 12 weeks; followed by placebo QD for 4 weeks; followed by alternating COMPOUND (I) 160 mg QD for 4 weeks and placebo QD for 4 weeks, until the Week 52 Visit; [1501] COMPOUND (I) 160 mg QD for 12 weeks; followed by placebo QD for 4 weeks; followed by alternating COMPOUND (I) 40 mg QD for 4 weeks and placebo QD for 4 weeks, until the Week 52 Visit; [1502] COMPOUND (I) 160 mg QD for 12 weeks; followed by continuous COMPOUND (I) 40 mg QD, until the Week 52 Visit; [1503] Placebo QD until the Week 52 Visit.
TABLE-US-00005 TABLE 5 IP Dispensing Schedule: Double-blind Treatment Period Week 0 Week 12 Week 16 Week 20 Week 24 Week 28 Week 32 Week 36 Week 40 Week 44 Week 48 through through through through through through through through through through through Week 11 Week 15 Week 19 Week 23 Week 27 Week 31 Week 35 Week 39 Week 43 Week 47 Week 51 COMP(I) Placebo COMP(I) Placebo COMP(I) Placebo COMP(I) Placebo COMP(I) Placebo COMP(I) 160 mg QD 160 mg QD 160 mg QD 160 mg QD 160 mg QD 160 mg QD QD QD QD QD QD Placebo COMP(I)40 Placebo COMP(I) Placebo COMP (I) Placebo COMP(I) Placebo COMP(I) QD mg QD QD 40 mg QD 40 mg QD 40 mg QD 40 mg QD QD QD QD COMP(I) COMP(I)40 COMP(I) COMP(I) COMP(I)40 COMP (I) COMP(I) COMP(I) COMP(I) COMP(I) 40 mg mg QD 40 mg 40 mg mg QD 40 mg 40 mg 40 mg 40 mg 40 mg QD QD QD QD QD QD QD QD Placebo Placebo Placebo Placebo Placebo Placebo Placebo Placebo Placebo Placebo Placebo QD QD QD QD QD QD QD QD QD QD QD COMP(I) = COMPOUND (I)
[1504] After the Week 12 Visit and thereafter, until the Week 52 Visit, subjects who meet the criteria for early escape, will be eligible to enter the Long-term Active-treatment Study (Example 3), or may discontinue from the study. The criteria for early escape are defined as a CDAI180 and failure to achieve or maintain a reduction of at least 70 points in the CDAI score, as compared to baseline for 2 consecutive study visits, at least 14 days apart.
[1505] Subjects who complete the study described in this Example at the Week 52 Visit will have the option to enter the Example 3 Long-term Active-treatment Study.
[1506] Study Endpoints
[1507] The primary endpoint of the study is the proportion of subjects achieving clinical remission defined as a CDAI score <150 at Week 4.
[1508] The secondary endpoints of the study are: [1509] The proportion of subjects with mucosal healing defined as SES-CD2 at Week 12 and Week 52; [1510] The proportion of subjects with a reduction of at least 50% from baseline in SES-CD at Week 12 and Week 52; [1511] The proportion of subjects achieving clinical remission defined as a CDAI score <150 at Week 12 and Week 52; [1512] The proportion of subjects who achieve corticosteroid-free clinical remission at Week 52 among subjects receiving oral corticosteroids at baseline; [1513] The proportion of subjects with an average daily liquid or soft stool frequency 3 and abdominal pain score 1 at Week 4, Week 12 and Week 52; [1514] The proportion of subjects with an average daily liquid or soft stool frequency 1.5 and abdominal pain score 1 point at Week 4, Week 12, and Week 52; [1515] Type, frequency, severity, seriousness, and relationship of AEs to IP; [1516] Number of subjects who discontinue IP due to any AE; [1517] Clinically significant changes in vital signs, ECG and/or laboratory findings.
[1518] The Exploratory endpoints of this study include exploratory efficacy endpoints, exploratory pharmacodynamic (PD)/biomarker endpoints, exploratory pharmacokinetics (PK) endpoints, exploratory quality of life endpoints, and exploratory health economics endpoints.
[1519] The exploratory efficacy endpoints are: [1520] The proportion of subjects with a reduction of at least 50% in the SES-CD compared with baseline at both Week 12 and Week 52; [1521] The proportion of subjects with mucosal healing defined as SES-CD2 at Week 12 and Week 52; [1522] The proportion of subjects who are in clinical remission, defined as a CDAI score <150 at each time point through Week 52; [1523] The proportion of subjects who have a clinical response defined as a decrease from baseline in CDAI100 points at each time point through Week 52; [1524] The proportion of subjects who have corticosteroid-free clinical remission for at least 12 consecutive weeks among subjects receiving oral corticosteroids at baseline at each time point starting at Week 24; [1525] The proportion of subjects who have corticosteroid-free clinical remission for at least 26 consecutive weeks, among subjects receiving oral corticosteroids at baseline at each time point starting at Week 40; [1526] The change from baseline in the average daily abdominal pain score at each time point through Week 52; [1527] The change from baseline in the average daily liquid or soft stool frequency at each time point through Week 52; [1528] The proportion of subjects with a patient reported outcome (PRO-2) score <8 at each time point through Week 52; [1529] The proportion of subjects with a reduction of 8 from baseline in PRO-2 at each time point through Week 52; [1530] The proportion of subjects with an average daily liquid or soft stool frequency 3 and abdominal pain score 1 at each time point through Week 52; [1531] The proportion of subjects with an average daily liquid or soft stool frequency 1.5 and abdominal pain score 1 at each time point through Week 52; [1532] The change from baseline in the CDAI score at each time point through Week 52; [1533] The change from baseline in the SES-CD at each time point through Week 52; [1534] The change from baseline in the PRO-2 score at each time point through Week 52; [1535] The change from baseline in the Harvey-Bradshaw Index (HBI) score at each time point through Week 52.
[1536] The exploratory PD/biomarker endpoints are: [1537] The change from baseline in hsCRP at each time point through Week 52; [1538] The change from baseline in the FCP at each time point through Week 52.
[1539] The exploratory PK endpoint is the plasma concentration of COMPOUND (I) at Week 4 and Week 8.
[1540] The exploratory quality of life endpoints are: [1541] The change in Short Form 36 Item Health Survey, version 2 (SF-36v2) score compared with baseline at each time point through Week 52; [1542] The change in the Inflammatory Bowel Disease Questionnaire (IBDQ) compared with baseline at each time point through Week 52; [1543] The change in the Work Productivity and Activity Impairment QuestionnaireCrohn's Disease (WPAI-CD) compared with baseline at each time point through Week 52; [1544] The change in the European Quality of Life-5 Dimensions Questionnaire (EQ-5D) compared with baseline at each time point through Week 52.
[1545] The exploratory health economics endpoint is the change in the Healthcare Resource Utilization (HRU) compared with baseline at each time point through Week 52.
[1546] Study Duration
[1547] Subjects will participate for a maximum of 60 weeks in this study: up to 4 weeks in the Screening Period; 52 weeks in the Double-blind Treatment Period; and 4 weeks in the Follow-up Period.
[1548] End of Study
[1549] The End of Study is defined as either the date of the last visit of the last subject to complete the post-treatment follow-up, or the date of receipt of the last data point from the last subject that is required for primary, secondary and/or exploratory analysis, as prespecified in the protocol, whichever is the later date.
[1550] Study Population
[1551] Number of Subjects:
[1552] Approximately 1064 subjects with active CD will be enrolled in this study. The total number of subjects with previous exposure to biologics is targeted to comprise approximately 35% of the study population.
[1553] Inclusion Criteria:
[1554] Subjects must satisfy the following criteria to be enrolled in the study: [1555] Subject is a male or female 18 years at the time of signing the informed consent form (ICF); [1556] Subject must understand and voluntarily sign an ICF prior to conducting any study-related assessments/procedures; [1557] Subject is willing and able to adhere to the study visit schedule and other protocol requirements; [1558] Subject must have a diagnosis of CD with a duration of at least 3 months prior to the Screening Visit; [1559] Subject must have a diagnosis of ileitis, ileocolitis or colitis, as determined by endoscopic, radiographic or any other imaging modality (e.g., magnetic resonance imaging [MRI], computed tomography [CT] scan); [1560] Subject must have active CD disease, defined as a CDAI score 220 and 450 at screening; [1561] Subject must have 7-day average stool frequency 3.5 or abdominal pain 1.5 at screening. [1562] Subject must have a total SES-CD6 at screening, or the ileum segmental SES-CD4 at screening; [1563] Subjects must have failed or experienced intolerance to at least one of the following: aminosalicylates; budesonide; systemic corticosteroids; immunosuppressants (e.g., AZA, 6-MP, or MTX); or biologics for the treatment of CD; [1564] Subjects who have at increased risk of colorectal cancer (defined as having an 8-year history of pan-colitis or 12-year history of left-sided colitis) should have undergone a colonoscopy with pan-colonic surveillance biopsies, within 2 years of the Screening Visit. The biopsies must be negative for dysplasia; [1565] Subject must meet the following laboratory criteria [1566] White blood cell count 3000/mm.sup.3 (3.010.sup.9/L) [1567] Platelet count 100,000/mm.sup.3 (10010.sup.9/L) [1568] Serum creatinine 1.5 mg/dL (132.6 mol/L) [1569] Aspartate aminotransferase (AST)/serum glutamic oxaloacetic transaminase (SGOT), alanine aminotransferase (ALT)/serum glutamic pyruvic transaminase (SGPT)2.5upper limit of normal (ULN) [1570] Total bilirubin 2 mg/dL (34 mol/L), unless the subject has a confirmed diagnosis of Gilbert's Disease [1571] Hemoglobin 8 g/dL (4.97 mmol/L) [1572] Activated partial thromboplastin time (APTT)1.5ULN [1573] Females of childbearing potential (FCBP) must have a negative pregnancy test at the Screening and Baseline Visits. [1574] Male subjects (including those who have had a vasectomy) when engaging in sexual activity with females who are able to become pregnant must use barrier contraception while on IP and for at least 28 days after the last dose.
[1575] Exclusion Criteria:
[1576] The presence of any of the following will exclude a subject from enrollment: [1577] Subject has a diagnosis of ulcerative colitis (UC), indeterminate colitis, ischemic colitis, microscopic colitis, radiation colitis or diverticular disease-associated colitis; [1578] Subject has local manifestations of CD such as strictures, abscesses, short bowel syndrome; or other disease complications for which surgery might be indicated or could confound the evaluation of efficacy; [1579] Subject had any intestinal resection within 6 months or any intra-abdominal surgery within 3 months prior to the Screening Visit; [1580] Subject has an ileostomy or a colostomy; [1581] Subject had prior treatment with mycophenolic acid, tacrolimus, sirolimus, cyclosporine, thalidomide or apheresis (e.g., Adacolunm) within 8 weeks prior to the Screening Visit; [1582] Use of intravenous (IV) corticosteroids within 2 weeks prior to the Screening Visit; [1583] Use of topical treatment such as 5-aminosalicylic acid (5-ASA) or corticosteroid enemas or suppositories within 2 weeks prior to Screening Visit; [1584] Subject has changed or discontinued the allowed dose of oral aminosalicylates within 2 weeks prior to the Screening Visit; [1585] Use of cholestyramine within 3 weeks prior to Screeing Visi; [1586] Subject has changed or discontinued the allowed dose of oral corticosteroids (prednisone 20 mg/day or equivalent, budesonide 9 mg/day) within 3 weeks prior to the Screening Visit; [1587] Subject has initiated immunosuppressants (e.g., AZA, 6-MP, or MTX) within 12 weeks prior to the Screening Visit and has changed or discontinued the allowed dose of immunosuppressants within 8 weeks prior to the Screening Visit; [1588] Subject has received topical treatments, such as, 5-aminosalicylic acid (5-ASA) or corticosteroid enemas or suppositories within 2 weeks prior to the Screening Visit; [1589] Subject received cholestyramine within 3 weeks prior to the Screening Visit; [1590] Subject has changed or discontinued antibiotics used for the treatment of CD (e.g., ciprofloxacin, metronidazole) within 2 weeks prior to the Screening Visit; [1591] Subject had prior treatment with more than 3 biologics for the treatment of CD; [1592] Subject had treatment with a biologic within 8 weeks prior to the Screening Visit; [1593] Subject had prior treatment with natalizumab; [1594] Subject has received total parenteral nutrition within 4 weeks prior to the Screening Visit; [1595] Subject has evidence of enteric infection or C. difficile toxin at the Screening Visit; [1596] Subject has a history of any clinically significant neurological, renal, hepatic, gastrointestinal, pulmonary, metabolic, cardiovascular, psychiatric, endocrine, hematological disorder or disease, or any other medical condition that, in the investigator's opinion, would prevent the subject from participating in the study; [1597] Subject has any condition, including the presence of laboratory abnormalities, which places the subject at unacceptable risk if he/she was to participate in the study or confounds the ability to interpret data from the study; [1598] Subject is pregnant or breastfeeding; [1599] Subject has a history of any of the following cardiac conditions within 6 months prior to the Screening Visit and at any time during the Screening Period, up through the first dose of IP: myocardial infarction, acute coronary syndrome, unstable angina, new onset atrial fibrillation, new onset atrial flutter, second- or third-degree atrioventricular block, ventricular fibrillation, ventricular tachycardia, heart failure, cardiac surgery, interventional cardiac catheterization (with or without a stent placement), interventional electrophysiology procedure, or presence of implanted defibrillator; [1600] Subject has a known active current or history of clinically significant recurrent bacterial, viral, fungal, mycobacterial or other infections (including but not limited to tuberculosis and atypical mycobacterial disease and herpes zoster), human immunodeficiency virus (HIV), or anymajor episode of infection requiring hospitalization or treatment with IV or oral antibiotics within 4 weeks prior to the Screening Visit and at any time during the Screening Period, up through the first dose of IP; [1601] Subject has a history of congenital or acquired immunodeficiency (e.g., common variable immunodeficiency disease); [1602] Subject has a history of colorectal cancer or colorectal dysplasia (with the exception of adenomatous colonic polyps that have been completely resected); [1603] Subject has a history of malignancy, except for: [1604] Treated (i.e., cured) basal cell or squamous cell in situ skin carcinomas; [1605] Treated (i.e., cured) cervical intraepithelial neoplasia or carcinoma in situ of the cervix with no evidence of recurrence within the previous 5 years prior to the Screening Visit; [1606] Subject has received any investigational drug or device within 1 month prior to the Screening Visit; [1607] Subject has a history of alcohol, drug, or chemical abuse within the 6 months prior to the Screening Visit; [1608] Subject has a known hypersensitivity to oligonucleotides or any ingredient in the IP; [1609] Subject has received prior treatment with COMPOUND (I), or participated in a clinical study involving COMPOUND (I). [1610] Acetaminophen and low-dose aspirin for cardiovascular prophylaxis are allowed.
[1611] Corticosteroid Tapering Procedure
[1612] Subjects are eligible to start corticosteroid tapering beginning at the Week 12 Visit, at the discretion of the investigator, according to the following schedule: [1613] For prednisone doses >10 mg (or equivalent), each week the daily dose is to be tapered by 5 mg until a dose of 10 mg/day is reached, after that each week the daily dose is to be tapered by 2.5 mg until discontinuation. [1614] For prednisone doses <10 mg (or equivalent), each week the daily dose is to be tapered by 2.5 mg until discontinuation. [1615] Subjects receiving budesonide should have their daily dose tapered by 3 mg every 3 weeks.
[1616] Description of Study Treatments
[1617] Description of Investigational Product(s):
[1618] COMPOUND (I) will be provided as 40-mg film coated tablets. Placebo will be provided as identically appearing tablets.
[1619] Treatment Administration and Schedule:
[1620] Subjects will receive COMPOUND (I) (160 mg QD) or placebo during the first 12 weeks of the study, followed by one of 3 dose regimens of COMPOUND (I) (40 mg QD or 160 mg QD) or placebo QD, until the end of the study (Week 52 Visit). All subjects will receive 4 tablets daily during the Double-blind Treatment Period. Matched placebo tablets will also be provided. Subjects will be instructed to take the IP in the morning, 30 minutes before breakfast, with a glass of water. Treatment and administration schedule are described in Table 5.
[1621] Subjects will receive double-blind, oral COMPOUND (I) or identically appearing placebo daily (QD) as follows (Table 4):
[1622] COMPOUND (I) 160 mg QD for 12 weeks; followed by placebo QD for 4 weeks; followed by alternating COMPOUND (I) 160 mg QD for 4 weeks and placebo QD for 4 weeks, until the Week 52 Visit; [1623] COMPOUND (I) 160 mg QD for 12 weeks; followed by placebo QD for 4 weeks; followed by alternating COMPOUND (I) 40 mg QD for 4 weeks and placebo QD for 4 weeks, until the Week 52 Visit; [1624] COMPOUND (I) 160 mg QD for 12 weeks; followed by continuous COMPOUND (I) 40 mg QD, until the Week 52 Visit; [1625] Placebo QD until the Week 52 Visit.
[1626] Concomitant Medications and Procedures
[1627] Permitted concomitant medications during the study include: [1628] Oral aminosalicylates (SSZ or 5-ASA compounds), provided that treatment has been given at a stable dose for at least 2 weeks prior to the Screening Visit. The dose of oral aminosalicylates must remain stable through the duration of the study or early termination from the study. If oral aminosalicylates have been recently discontinued, treatment must have been stopped at least 2 weeks prior to the Screening Visit. [1629] Oral corticosteroids, provided that the dose (prednisone <20 mg/day or equivalent, budesonide <9 mg/day) has been stable for 3 weeks prior to the Screening Visit, and the dose must remain stable until the subject is eligible to start corticosteroids tapering. If oral corticosteroids have been recently discontinued, discontinuation must have been completed at least 3 weeks prior to the Screening Visit. [1630] Immunosuppressants, such as AZA, 6-MP, or MTX, provided that treatment was initiated >12 weeks prior to the Screening Visit, must be at a stable dose for >8 weeks prior to the Screening Visit and remain stable for the duration of the study. [1631] Acetaminophen and low-dose aspirin for cardiovascular prophylaxis are allowed.
[1632] The following concomitant medications are prohibited during the Double-blind Treatment Period of the study, Baseline Visit (Week 0/Visit 2) through the 52 Visit, or the ET Visit for subjects who discontinue prematurely during the study: [1633] Uses of any biologics are prohibited during the study and must be discontinued at least 8 weeks prior to the Screening Visit. [1634] Use of cholestyramine is prohibited during the study and must be discontinued at least 3 weeks prior to the Screening Visit. [1635] Use of antibiotics for the treatment of CD is prohibited during the study and must be discontinued at least 3 weeks prior to the Screening Visit. [1636] Use of mycophenolic acid, tacrolimus, sirolimus, cyclosporine, thalidomide or apheresis (e.g., Adacolumn) is prohibited during the study and must be discontinued at least 8 weeks prior to the Screening Visit. [1637] Use of topical treatments with 5-ASA or corticosteroid enemas or suppositories is prohibited during the study and must be discontinued at least 2 weeks prior to the Screening Visit. [1638] Use of IV corticosteroids is prohibited during the study and must be discontinued at least 2 weeks prior to the Screening Visit. [1639] Administration of total parenteral nutrition (TPN) is prohibited and must be discontinued at least 4 weeks prior to the Screening Visit. [1640] Chronic use of nonsteroidal anti-inflammatory drugs (NSAIDs) is prohibited.
[1641] There are no required concomitant medications. Required procedures include ileocolonoscopy.
[1642] Adverse Events
[1643] Monitoring, Recording and Reporting of Adverse Events:
[1644] An adverse event (AE) is any noxious, unintended, or untoward medical occurrence that may appear or worsen in a subject during the course of a study. It may be a new intercurrent illness, a worsening concomitant illness, an injury, or any concomitant impairment of the subject's health, including laboratory test values, regardless of etiology. Any worsening (i.e., any clinically significant adverse change in the frequency or intensity of a pre-existing condition) should be considered an AE.
[1645] Abuse, withdrawal, sensitivity or toxicity to an investigational product should be reported as an AE.
[1646] All subjects will be monitored for AEs during the study. Assessments may include monitoring of any or all of the following parameters: the subject's clinical symptoms, laboratory, pathological, radiological or surgical findings, physical examination findings, or findings from other tests and/or procedures.
[1647] Evaluation of Adverse Events:
[1648] A qualified Investigator will evaluate all adverse events as to: [1649] Seriousness: A serious adverse event (SAE) is any AE occurring at any dose that: [1650] Results in death; [1651] Is life-threatening (i.e., in the opinion of the Investigator, the subject is at immediate risk of death from the AE); [1652] Requires inpatient hospitalization or prolongation of existing hospitalization (hospitalization is defined as an inpatient admission, regardless of length of stay); [1653] Results in persistent or significant disability/incapacity (a substantial disruption of the subject's ability to conduct normal life functions); [1654] Results in congenital anomaly/birth defect; [1655] Constitutes an important medical event.
[1656] Events not considered to be SAEs are hospitalizations for: [1657] A standard procedure for protocol therapy administration. However, hospitalization or prolonged hospitalization for a complication of therapy administration will be reported as an SAE. [1658] Routine treatment or monitoring of the studied indication not associated with any deterioration in condition. [1659] A procedure for protocol/disease-related investigations (e.g., surgery, scans, endoscopy, sampling for laboratory tests, bone marrow sampling). However, hospitalization or prolonged hospitalization for a complication of such procedures remains a reportable SAE. [1660] Hospitalization or prolongation of hospitalization for technical, practical, or social reasons, in absence of an AE. [1661] A procedure that is planned (i.e., planned prior to start of treatment on study); must be documented in the source document and the eCRF. Hospitalization or prolonged hospitalization for a complication remains a reportable SAE. [1662] An elective treatment of or an elective procedure for a pre-existing condition, unrelated to the studied indication that has not worsened from baseline. [1663] Emergency outpatient treatment or observation that does not result in admission, unless fulfilling other seriousness criteria above.
Example 3: A Long-Term Active Treatment Extension Study of Compound (I) in Subjects with Crohn's Disease
[1664] Study Objectives
[1665] The primary objective of the study is to evaluate the long-term safety of oral COMPOUND (I) in subjects with CD.
[1666] The exploratory objectives of the study are: [1667] To explore the long-term clinical efficacy of COMPOUND (I) over time in subjects with CD who participated in a previous COMPOUND (I) study (see, e.g., Example 2); [1668] To evaluate the long-term benefit of COMPOUND (I) on health-related quality of life (HRQOL) outcome measures in subjects with CD who participated in a previous COMPOUND (I) study (see, e.g., Example 2); [1669] To evaluate the long-term changes in biomarkers such as hsCRP and FCP in response to COMPOUND (I) in subjects with CD who participated in a previous COMPOUND (I) study (see, e.g., Example 2).
[1670] Drug Identification
[1671] Drug tested is COMPOUND (I), as described in Example 1.
[1672] Study Design
[1673] A schematic diagram illustrating the study design is shown in
[1674] This is a double-blinded, long-term active treatment study to evaluate the long-term safety, tolerability and exploratory efficacy of COMPOUND (I) in subjects with CD who previously participated in a COMPOUND (I) study (see, e.g., Example 2).
[1675] Subjects from the Example 2 Study who completed the study at Week 52, or who met the early escape criteria and were discontinued after Week 12 through Week 52, may be eligible to enter this study. Subjects who discontinued the Example 2 Study are not eligible for this study.
[1676] The study will consist of 3 study periods: [1677] Screening Periodup to 4 weeks (i.e., 1 day to 28 days depending on when long-term active treatment is available for the subject); [1678] Long-term Active Treatment Period208 Weeks (Week 0 to Week 208); [1679] Follow-up Period4 weeks (i.e., no IP taken).
[1680] Subjects who complete this study through Week 208 will have a 4-week Follow-up Visit. Subjects who prematurely discontinue treatment from this study prior to Week 208 will have an Early Termination (ET) Visit and a 4-week Follow-up Visit. The ET Visit should be scheduled as soon as possible after the last dose of IP. If the ET Visit occurs 28 days after the last dose of IP, then the Follow-up Visit is not required.
[1681] Once the subject is eligible and registered, the assigned treatment is based on clinical improvement criteria to determine the subject's course of treatment for the entire 208 weeks in this study.
[1682] The clinical improvement criteria are defined as a subject who has a CDAI<180, OR a reduction 70 points in the CDAI score as compared to baseline, in the previously participated COMPOUND (I) study, as compared to baseline for 2 consecutive study visits, at least 14 days apart. The baseline value is the measurement taken at the beginning of the prior COMPOUND (I) study (e.g., Example 2), and is the composite score made up of a 8 factors (Crohn's Disease Activity Index), and then compared to the last measured value (e.g., week 52 for Example 2) of the COMPOUND (I) study.
[1683] Previously-treated COMPOUND (I) subjects in the Example 2 Study who did meet the clinical improvement criteria at Week 52:
[1684] Will continue to receive their same blinded treatment, which will be: [1685] a. PBO QD for 4 weeks/COMPOUND (I) 40 mg QD for 4 weeks, or [1686] b. COMPOUND (1) 40 mg QD, or [1687] c. PBO QD for 4 weeks/COMPOUND (I) 160 mg QD for 4 weeks.
[1688] Previously-treated COMPOUND (I) subjects treated in a prior COMPOUND (I) study who meet the clinical improvement criteria at Week 12 will receive blinded treatment with PBO QD for 4 weeks/COMPOUND (I) 160 mg for 4 weeks.
[1689] Previously-treated placebo subjects who did meet the clinical improvement criteria at Week 52 in the Example 2 Study or at Week 12 in another prior COMPOUND (I) study will receive blinded treatment with COMPOUND (I) 160 mg QD for 4 weeks/PBO QD for 4 weeks.
[1690] Previously-treated COMPOUND (I) or placebo subjects who did not meet the clinical improvement criteria after Week 12 through Week 52 in the Example 2 study, or at Week 12 in another prior COMPOUND (I) study, will receive blinded treatment with: [1691] a. COMPOUND (I) 160 mg QD for 4 weeks/PBO QD for 4 weeks, if the subject previously received COMPOUND (I) treatment, or [1692] b. COMPOUND (1) 160 mg QD for 12 weeks, followed by PBO QD for 4 weeks COMPOUND (I) 160 mg QD for 4 weeks, if the subject previously received placebo.
[1693] Study Endpoints
[1694] The primary endpoint of the study is the evaluation of safety and tolerability of COMPOUND (I), assessed by the type, frequency and severity of adverse events, and its relationship to investigational product (IP), discontinuation due to adverse events, and clinically significant changes in electrocardiograms (ECGs), vital signs, and/or laboratory findings.
[1695] The Exploratory endpoints of this study include exploratory efficacy endpoints as follows: [1696] The change in the CDAI compared to baseline over time through Week 12; [1697] The change in the HBI compared to baseline over time through Week 208; [1698] The change in the EQ-5D score compared to baseline over time through Week 208; [1699] The change in the EQ-5D score compared to baseline over time through Week 208; [1700] The change in the HRU compared to baseline over time through Week 208; [1701] The change in the hsCRP concentration compared to baseline over time through Week 208; [1702] The change in the FCP concentration compared to baseline over time through Week 52.
[1703] Study Duration
[1704] Subjects may participate for a maximum of 216 weeks with 3 different study periods: up to 4 weeks in the Screening Period; 208 weeks in the Long-term Active Treatment Period; and 4 weeks in the Follow-up Period.
[1705] End of Study
[1706] The End of Study is defined as either the date of the last visit of the last subject to complete the post-treatment follow-up, or the date of receipt of the last data point from the last subject that is required for primary and/or exploratory analysis, as prespecified in the protocol, whichever is the later date. There are no secondary objectives or end points in this study.
[1707] Study Population
[1708] Number of Subjects:
[1709] The number of subjects planned to enroll into this long-term active treatment study will be based on the number of eligible subjects who enter from previously conducted COMPOUND (I) studies, such as the Example 2 study, which include subject participation worldwide.
[1710] Inclusion Criteria:
[1711] Subjects must satisfy the following criteria to be enrolled in the study: [1712] Subject is a male or female 18 years at the time of signing the informed consent form (ICF); [1713] Subject must understand and voluntarily sign an ICF prior to conducting any study-related assessments/procedures; [1714] Subject is willing and able to adhere to the study visit schedule and other protocol requirements; [1715] Subject must have completed through Week 12 from the previous COMPOUND (I) study AND either: [1716] Completed participation through the last study treatment visit at Week 52 in the Example 2 study, or at Week 12 in another COMPOUND (I) study; OR [1717] Met the early escape criteria and were discontinued after Week 12 in the Example 2 Study.
[1718] Exclusion Criteria:
[1719] The presence of any of the following will exclude a subject from enrollment: [1720] Subject had experienced a SAE related to the IP while participating in the previous COMPOUND (1) study; [1721] Subject has any continuing serious medical condition, laboratory abnormality, or psychiatric illness that occurred while participating in the previous COMPOUND (I) study; [1722] Subject has or had a flare or worsening of CD that, in the opinion of the Investigator, would not be in the best interest for the subject to participate in this long-term active treatment study; [1723] Subject has initiated biologic agents, such as TNF- blockers or integrin antagonists; [1724] Subject has been diagnosed with colorectal cancer or colorectal dysplasia while participating in the previous COMPOUND (I) study (with the exception ofadenomatous colonic polyps that have been completely resected); [1725] Subject has a newly diagnosed malignancy while participating in the previous COMPOUND (I) study. Subject is pregnant or breastfeeding; [1726] Subject has been newly diagnosed with substance abuse; [1727] Subject has developed a known hypersensitivity to oligonucleotides, COMPOUND (I) or any ingredient in the IP.
[1728] Corticosteroid Tapering Procedure
[1729] Subjects are eligible to start corticosteroid tapering beginning at the Week 4 Visit, at the discretion of the investigator, according to the following schedule: [1730] For prednisone doses >10 mg (or equivalent) daily dose, each week the daily dose is to be tapered by 5 mg until a dose of 10 mg/day is reached. Afterwards, each week the daily dose is to be tapered by 2.5 mg until discontinuation. [1731] For prednisone doses 10 mg (or equivalent), each week the daily dose is to be tapered by 2.5 mg until discontinuation. [1732] Subjects receiving budesonide should have their daily dose tapered by 3 mg every 3 weeks.
[1733] Description of Study Treatments
[1734] Description of Investigational Product(s) [Same as Ex. 2]:
[1735] COMPOUND (I) will be provided as 40-mg film coated tablets. Placebo will be provided as identically appearing tablets.
[1736] Treatment Administration and Schedule:
[1737] Beginning at Week 0 through Week 12, subjects will receive blinded-active COMPOUND (I) (160 mg QD or 40 mg QD) treatment as one of the following numbered treatment groups (see
[1743] Beginning at Week 12 through Week 208, subjects from the above-numbered treatment groups will continue to receive blinded-active COMPOUND (I) treatment for 196 weeks as the following: [1744] 1) alternating PBO QD for 4 weeks with 160 mg QD for 4 weeks, through Week 208; [1745] 2) alternating PBO QD for 4 weeks with 160 mg QD for 4 weeks, through Week 208; [1746] 3) alternating 160 mg QD for 4 weeks with PBO QD for 4 weeks, through Week 208; [1747] 4) continuous 40 mg QD, through Week 208; [1748] 5) alternating 40 mg QD for 4 weeks with PBO QD for 4 weeks, through Week 208.
[1749] Subjects will receive 1 blister card when IP is administered. Four tablets are taken once daily during the 208-week Long-term Active Treatment Period. Subjects will be instructed to take the IP in the morning, 30 minutes before breakfast, with a glass of water, and they will also be instructed to refer to the label for storage instructions.
[1750] Treatment and administration schedules are described below beginning in Table 8.
TABLE-US-00006 TABLE 8 Dosing Schedule for the Treatment Period at Year 1 Long-term Active Treatment Period Treatment (All Treatment is Blinded) Group from (Year 1) Example 2 Weeks Weeks Weeks Weeks Weeks Weeks Weeks Weeks Weeks Weeks Weeks Weeks Weeks Weeks Study 0-3 4-7 8-11 12-15 16-19 20-23 24-27 28-31 32-35 36-39 40-43 44-47 48-51 52-55 Placebo 160 160 160 PBO 160 PBO 160 PBO 160 PBO 160 PBO 160 PBO (with no mg mg mg QD mg QD mg QD mg QD mg QD mg QD improvement) QD QD QD QD QD QD QD QD COMP(I) 160 PBO 160 PBO 160 PBO 160 PBO 160 PBO 160 PBO 160 PBO 40 mg or mg QD mg QD mg QD mg QD mg QD mg QD mg QD 160 mg on/off, QD QD QD QD QD QD QD or 40 mg daily, or 160 mg QD for 12 weeks (with no improvement), or PBO (with improvement) COMP(I) PBO 160 PBO 160 PBO 160 PBO 160 PBO 160 PBO 160 PBO 160 160 mg on/off QD mg QD mg QD mg QD mg QD mg QD mg QD mg or 160 mg QD QD QD QD QD QD QD QD for 12 weeks (with improvement) COMP(I) 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 mg daily mg mg mg mg mg mg mg mg mg mg mg mg mg mg (with QD QD QD QD QD QD QD QD QD QD QD QD QD QD improvement) COMP(I) PBO 40 PBO 40 PBO 40 PBO 40 PBO 40 PBO 40 PBO 40 40 mg on/off QD mg QD mg QD mg QD mg QD mg QD mg QD mg (with QD QD QD QD QD QD QD improvement)
TABLE-US-00007 TABLE 9 Dosing Schedule for the Treatment Period at Year 2 Long-term Active Treatment Period (All Treatment is Blinded) Treatment Group (Year 2) from Example 2 Weeks Weeks Weeks Weeks Weeks Weeks Weeks Weeks Weeks Weeks Weeks Weeks Weeks Study 56-59 60-63 64-67 68-71 72-75 76-79 80-83 84-87 88-91 92-95 96-99 100-103 104-107 Placebo 160 PBO 160 PBO 160 PBO 160 PBO 160 PBO 160 PBO 160 (with no mg QD mg QD mg QD mg QD mg QD mg QD mg improvement) QD QD QD QD QD QD QD COMP (I) 160 PBO 160 PBO 160 PBO 160 PBO 160 PBO 160 PBO 160 40 mg or mg QD mg QD mg QD mg QD mg QD mg QD mg 160 mg on/off, QD QD QD QD QD QD QD or 40 mg daily, or 160 mg QD for 12 weeks (with no improvement), or PBO (with improvement) COMP(I) PBO 160 PBO 160 PBO 160 PBO 160 PBO 160 PBO 160 PBO 160 mg on/off QD mg QD mg QD mg QD mg QD mg QD mg QD or 160 mg QD QD QD QD QD QD QD for 12 weeks (with improvement) COMP(I) 40 40 40 40 40 40 40 40 40 40 40 40 40 40 mg daily mg mg mg mg mg mg mg mg mg mg mg mg mg (with QD QD QD QD QD QD QD QD QD QD QD QD QD improvement) COMP (I) PBO 40 PBO 40 PBO 40 PBO 40 PBO 40 PBO 40 PBO 40 mg on/off QD mg QD mg QD mg QD mg QD mg QD mg QD (with QD QD QD QD QD QD improvement)
TABLE-US-00008 TABLE 10 Dosing Schedule for the Treatment Period at Year 3 Long-term Active Treatment Period (All Treatment is Blinded) Treatment Group (Year 3) from Example 2 Weeks Weeks Weeks116- Weeks Weeks Weeks Weeks Weeks Weeks Weeks Weeks Weeks Weeks Study 108-111 112-115 119 120-123 124-127 128-131 132-135 136-139 140-143 144-147 148-151 152-155 156-159 Placebo PBO 160 PBO 160 PBO 160 PBO 160 PBO 160 PBO 160 PBO (with no QD mg QD mg QD mg QD mg QD mg QD mg QD improvement) QD QD QD QD QD QD COMP(I) PBO 160 PBO 160 PBO 160 PBO 160 PBO 160 PBO 160 PBO 40 mg or 160 QD mg QD mg QD mg QD mg QD mg QD mg QD mg on/off, or QD QD QD QD QD QD 40 mg daily, or 160 mg QD for 12 weeks (with no improvement), or PBO (with improvement) COMP(I) 160 PBO 160 PBO 160 PBO 160 PBO 160 mg PBO 160 mg PBO 160 160 mg on/off mg QD mg QD mg QD mg QD QD QD QD QD mg or 160 mg QD QD QD QD QD QD for 12 weeks (with improvement) COMP(I) 40 40 40 40 mg 40 40 40 40 40 40 40 40 40 40 mg daily mg mg mg QD mg mg mg mg mg mg mg mg mg (with QD QD QD QD QD QD QD QD QD QD QD QD improvement) COMP(I) 40 PBO 40 PBO 40 PBO 40 PBO 40 PBO 40 PBO 40 40 mg on/off mg QD mg QD mg QD mg QD mg QD mg QD mg (with QD QD QD QD QD QD QD improvement)
TABLE-US-00009 TABLE 11 Dosing Schedule for the Treatment Period at Year 4 Long-term Active Treatment Period (All Treatment is Blinded) Treatment Group (Year 4) from Example 2 Weeks Weeks Weeks Weeks Weeks Weeks Weeks Weeks Weeks Weeks Weeks Weeks Weeks Study 160-133 164-167 168-171 172-175 176-179 180-183 184-187 188-191 192-195 196-199 200-203 204-207 208-211 Placebo 160 PBO 160 PBO 160 PBO 160 PBO 160 PBO 160 PBO No IP (with no mg QD mg QD mg QD mg QD mg QD mg QD improvement) QD QD QD QD QD QD COMP(I) 160 PBO 160 PBO 160 PBO 160 PBO 160 PBO 160 PBO No IP 40 mg or mg QD mg QD mg QD mg QD mg QD mg QD 160 mg on/off, QD QD QD QD QD QD or 40 mg daily, or 160 mg QD for 12 weeks (with no improvement), or PBO (with improvement) COMP(I) PBO 160 PBO 160 PBO 160 PBO 160 PBO 160 PBO 160 No IP 160 mg on/off QD mg QD mg QD mg QD mg QD mg QD mg or 160 mg QD QD QD QD QD QD QD for 12 weeks (with improvement) COMP(I) 40 40 40 40 40 40 40 40 40 40 40 40 No IP 40 mg daily mg mg mg mg mg mg mg mg mg mg mg mg (with QD QD QD QD QD QD QD QD QD QD QD QD improvement) COMP(I) PBO 40 PBO 40 PBO 40 PBO 40 PBO 40 PBO 40 No IP 40 mg on/off QD mg QD mg QD mg QD mg QD mg QD mg (with QD QD QD QD QD QD improvement)
[1751] The treatment described in each box is the treatment dispensed at a particular week visit. For example, if the subject was previously on placebo (with no improvement) in the previous COMPOUND (I) study, the subject would receive the IP in this study as: [1752] blinded COMPOUND (I) 160 mg QD for a 4-week supply at the Week 0 Visit; [1753] blinded COMPOUND (I) 160 mg QD for a 4-week supply at the Week 4 Visit; [1754] blinded PBO QD for a 4-week supply at Week 52 Visit; [1755] blinded COMPOUND (I) 160 mg QD for a 4-week supply at Week 104 Visit; [1756] blinded PBO QD for a 4-week supply at Week 156 Visit; and [1757] no IP at the Week 208 Visit.
[1758] Method of Treatment Assignment:
[1759] Eligible subjects will receive COMPOUND (I) treatment for 4-week intervals during this 208-week Long-term Active Treatment Study as either: 1) four 40-mg tablets; 2) one 40-mg tablet and three placebo tablets; or 3) four placebo tablets.
[1760] Concomitant Medications and Procedures
[1761] Permitted concomitant medications during the study include: [1762] Oral aminosalicylates (such as sulfasalazine [SSZ] or 5-aminosalicylic acid [5-ASA] compounds); or immunosuppressants (such as AZA, 6-MP, or MTX) may be initiated or changed during screening or continued from a previous COMPOUND (0 study, provided that the dose remains stable through the first 12 weeks of this study from Week 0 to Week 12. After Week 12, subjects may taper doses or completely discontinue any of these background CD medications or may increase doses or add any new CD medications as clinically indicated, except for biologics, at the discretion of the Investigator. [1763] Oral corticosteroids (with no dose restriction) may be initiated or changed during screening, or continued from a previous COMPOUND (I) study, provided that the dose remains stable through the first 4 weeks of this study from Week 0 to Week 4. After Week 4, subjects may taper corticosteroids doses as clinically indicated, at the discretion of the Investigator. [1764] The dose of the CD concomitant medications noted above should not be changed from the stable dose beginning at Enrollment Visit 2 (Week 0) through Week 12. However, corticosteroids may be changed beginning at Week 4. No new CD therapy can be prescribed once the subject has been enrolled at Visit 2/Week 0 into the study, until Week 12.
[1765] The following concomitant medications are prohibited during the Screening Period and from the Enrollment Visit (i.e., Week 0/Visit 2) through the last study treatment visit (i.e., Week 208/Visit 54), or the ET Visit for subjects who discontinue prematurely during the study: [1766] Use of any biologic agents, including TNF- blockers or integrin antagonists. If biologic agents are initiated, the subject must be discontinued from the study.
[1767] There are no required concomitant medications and procedures in this study.
[1768] Adverse Events
[1769] Monitoring, Recording and Reporting of Adverse Events:
[1770] An adverse event (AE) is any noxious, unintended, or untoward medical occurrence that may appear or worsen in a subject during the course of a study. It may be a new intercurrent illness, a worsening concomitant illness, an injury, or any concomitant impairment of the subject's health, including laboratory test values, regardless of etiology. Any worsening (i.e., any clinically significant adverse change in the frequency or intensity of a pre-existing condition) should be considered an AE.
[1771] Abuse, withdrawal, sensitivity or toxicity to an investigational product should be reported as an AE.
[1772] All subjects will be monitored for AEs during the study. Assessments may include monitoring of any or all of the following parameters: the subject's clinical symptoms, laboratory, pathological, radiological or surgical findings, physical examination findings, or findings from other tests and/or procedures.
[1773] Evaluation of Adverse Events:
[1774] A qualified Investigator will evaluate all adverse events as to: [1775] Seriousness: A serious adverse event (SAE) is any AE occurring at any dose that: [1776] Results in death; [1777] Is life-threatening (i.e., in the opinion of the Investigator, the subject is at immediate risk of death from the AE); [1778] Requires inpatient hospitalization or prolongation of existing hospitalization (hospitalization is defined as an inpatient admission, regardless of length of stay); [1779] Results in persistent or significant disability/incapacity (a substantial disruption of the subject's ability to conduct normal life functions); [1780] Results in congenital anomaly/birth defect; [1781] Constitutes an important medical event.
[1782] Important medical events are defined as those occurrences that may not be immediately life threatening or result in death, hospitalization, or disability, but may jeopardize the subject or require medical or surgical intervention to prevent one of the other outcomes listed above. Medical and scientific judgment should be exercised in deciding whether such an AE should be considered serious.
[1783] Events not considered to be SAEs are hospitalizations for: [1784] A standard procedure for protocol therapy administration. However, hospitalization or prolonged hospitalization for a complication of therapy administration will be reported as an SAE. [1785] Routine treatment or monitoring of the studied indication not associated with any deterioration in condition. [1786] A procedure for protocol/disease-related investigations (e.g., surgery, scans, endoscopy, sampling for laboratory tests, bone marrow sampling). However, hospitalization or prolonged hospitalization for a complication of such procedures remains a reportable SAE. [1787] Hospitalization or prolongation of hospitalization for technical, practical, or social reasons, in absence of an AE. [1788] A procedure that is planned (i.e., planned prior to start of treatment on study); must be documented in the source document and the eCRF. Hospitalization or prolonged hospitalization for a complication remains a reportable SAE. [1789] An elective treatment of or an elective procedure for a pre-existing condition, unrelated to the studied indication that has not worsened from baseline. [1790] Emergency outpatient treatment or observation that does not result in admission, unless fulfilling other seriousness criteria above.
Example 4: Open-Label, Multicenter Study to Explore the Pharmacodynamic Effects of Compound (I) in Subjects with Active Crohn's Disease
[1791] Study Objectives
[1792] The primary objective of the study is to explore the mechanism of action of COMPOUND (I) 160 mg once daily (QD) in subjects with active Crohn's disease (CD).
[1793] The secondary objectives are: [1794] To explore the effect of COMPOUND (I) 160 mg QD on inflammatory cytokines, and gene expression in the intestinal mucosa [1795] To evaluate the safety and tolerability of COMPOUND (1) 160 mg QD in subjects with active CD
[1796] The exploratory objectives are: [1797] To explore the effect of COMPOUND (I) 160 mg QD on clinical activity in subjects with active CD [1798] To explore the effect of COMPOUND (T) 160 mg QD on endoscopic outcomes in subjects with active CD [1799] To explore the effect of COMPOUND (I) 160 mg QD on the expression of immune biomarkers on circulating mononuclear cells [1800] To explore the association of pharmacodynamic (PD) markers with clinical and endoscopic outcomes in subjects with active CD receiving COMPOUND (1) 160 mg QDTo explore the effect of COMPOUND (I) 160 mg QD on biomarkers of intestinal inflammation and tissue damage such as high sensitivity C-reactive protein (hsCRP), regenerating islet-derived 3-alpha (Reg-3a), and fecal calprotectin (FCP), in subjects with active CD
[1801] Study Endpoints
[1802] The study endpoints are listed in Table 12.
TABLE-US-00010 TABLE 12 Study Endpoints Endpoint Name Description Timeframe Primary PD Change from baseline of SMAD7 Week 12 expression in the intestinal mucosa at Week 12, from biopsy samples taken during ileocolonoscopy Secondary PD Change from baseline in the Week 12 messenger RNA (mRNA) expression of inflammatory cytokines such as, but not limited to, interleukin (IL)-10, IL-25, chemokine (C-C motif) ligand 20 (CCL20) and tumor necrosis factor alpha (TNF-) in the intestinal mucosa at Week 12, from biopsy samples during ileocolonoscopy Safety The evaluation of safety and Through tolerability of COMPOUND (I), Week 52 assessed by the type, frequency and 4 weeks and severity of adverse events, postdose and its relationship to investigational product (IP), discontinuation due to adverse events, and clinically significant changes in electrocardiograms (ECGs), vital signs, and/or laboratory findings Exploratory Efficacy The proportion of subjects Weeks 4, 8, achieving clinical remission, 12 defined as a Crohn's Disease Activity Index (CDAI) score <150, at Weeks 4, 8, and 12 Efficacy The proportion of subjects Weeks 4, 8, achieving a clinical response, 12 defined as a decrease from baseline of 100 points in CDAI score, at Weeks 4, 8, and 12 Efficacy Change from baseline in the Weeks 4, 8, CDAI score at Weeks 4, 8, and 12 12 Efficacy Change from baseline in the Weeks 4, 8, two-item patient reported 12 outcome (PRO-2) score at Weeks 4, 8, and 12 Efficacy Change from baseline in the Through Harvey-Bradshaw Index (HBI) Week 52 score through Week 52 and 4 and 4 weeks weeks postdose postdose Efficacy Change from baseline in the Week 12 Simple Endoscopic Score for Crohn's Disease (SES-CD) at Week 12 PD Change from baseline in Weeks 4, 8, percentages of circulating 12 mononuclear cells expressing markers such as, but not limited to, 1L-17A, Foxp3 and CCR9 at Weeks 4, 8, and 12, as measured by flow cytometry PD Change from baseline in high Weeks 4, 8, sensitivity C-reactive protein 12, 24, 52 (hsCRP) at Weeks 4, 8, 12, and 4 weeks 24, 52 and 4 weeks postdose postdose PD Change from baseline in fecal Weeks 4, 8, calprotectin (FCP) at Weeks 4, 12, 24, 52 8, 12, 24, 52 and 4 weeks and 4 weeks postdose postdose PD Change from baseline in serum Weeks 4, 8. biomarkers such as, but not 12, 24, 52 limited to, regenerating islet- and 4 weeks derived 3-alpha (Reg-3a) and postdose CCL20, at Weeks 4, 8, 12, 24, 52 and 4 weeks postdose PD Change from baseline in Week 12 microbiome from feces and intestinal mucosa at Week 12 PD/ The correlation between Weeks 4, 8, Efficacy biomarkers and endoscopic 12, 24, 52 outcomes through Week 12, and and 4 weeks clinical outcomes at Weeks 4, postdose 8, 12, 52 and 4 weeks postdose
[1803] Study Design
[1804] A schematic diagram illustrating the study design is shown in
[1805] This is an open-label, multicenter study to explore the effect of COMPOUND (I) on PD outcomes for 12 weeks in subjects with active CD, defined as having a Crohn's Disease Activity Index (CDAI) score 220 and 450 and a Simple Endoscopic Score for Crohn's Disease (SES-CD) 7 (or SES-CD4 if the subject has ileitis only).
[1806] Subjects will be screened to provide 16 enrolled subjects who complete 12 weeks of COMPOUND (I) 160 mg QD treatment as open-label therapy. Subjects who discontinue the study prior to the Week 12 Visit will be replaced.
[1807] Eligible subjects will be enrolled and enter the Treatment Period at the Baseline Visit (Week 0/Visit 2), and will be assigned to receive IP as COMPOUND (I) 160 mg QD for 12 weeks.
[1808] This study also offers subjects with the option to continue with maintenance treatment at the discretion of the Investigator, beginning with alternating no IP for 4 weeks, followed by COMPOUND (I) 160 mg QD for 4 weeks, up to Week 52 during the Maintenance Period.
[1809] The study will consist of 4 periods: [1810] Screening Periodup to 4 weeks [1811] Induction Period12 weeks (Week 0 to Week 12) [1812] Maintenance Period40 weeks (Week 12 to Week 52) [1813] Follow-up Period4 weeks (ie, no IP taken)
[1814] Subjects who prematurely discontinue treatment from this study prior to Week 52 will have an Early Termination Visit and also enter the 4-week Follow-up Period.
[1815] The number of subjects with previous exposure to TNF- blockers is targeted to be approximately 40% (i.e., approximately 6 subjects).
[1816] Study Duration
[1817] The overall study duration will be up to 60 weeks with 4 different periods: up to 4 weeks in the Screening Period; 12 weeks in the Induction Period; 40 weeks in the Maintenance Period; and 4 weeks in the Follow-up Period.
[1818] Study Population
[1819] Number of Subjects: Approximately 16 subjects with active CD who complete 12 weeks of treatment will be enrolled from Europe.
[1820] Inclusion Criteria: Subjects must satisfy the following criteria to be screened and enrolled in the study: [1821] Subject is a male or female 18 years of age at the time of signing the informed consent form (ICF). [1822] Subject must understand and voluntarily sign an ICF prior to any study-related assessments/procedures being conducted. [1823] Subject is willing and able to adhere to the study visit schedule and other protocol requirements. [1824] Subject must have a diagnosis of CD with a duration of at least 3 months prior to Screening Visit 1. [1825] Subject must have a diagnosis of ileitis, ileocolitis or colitis, as determined by endoscopic, radiographic or any other imaging modality (e.g., magnetic resonance imaging [MRI], or computed tomography [CT] scan). [1826] Subject must have active disease, defined as a CDAI score 220 and 450 at screening. [1827] Subject must have a SES-CD7 at screening; subjects with ileitis only must have a SES-CD4 at screening. [1828] Subject must have failed or experienced intolerance to at least one of the following: aminosalicylates; budesonide; systemic corticosteroids; immunosuppressants (eg, azathioprine [AZA], 6-mercaptopurine [6-MP], or methotrexate [MTX]); or TNF- blockers (eg, infliximab or adalimumab). [1829] Subject must meet the following laboratory criteria: [1830] (One laboratory test repeat is allowed during the Screening Period after consultation with the medical monitor.) [1831] White blood cell (WBC) count 3000/mm3 (3.010.sup.9/L) [1832] Platelet count 100,000/mm3 (10010.sup.9/L) [1833] Serum creatinine 1.5 mg/dL (132.6 mol/L) [1834] Aspartate aminotransferase (AST)/serum glutamic oxaloacetic transaminase (SGOT), alanine aminotransferase (ALT)/serum glutamic pyruvic transaminase (SGPT)2.5upper limit of normal (ULN) [1835] Total bilirubin 2 mg/dL (34 mol/L), unless the subject has a confirmed diagnosis of Gilbert's disease [1836] Hemoglobin 8 g/dL (4.98 mmol/L) [1837] Activated partial thromboplastin time (APTT)1.5ULN
[1838] Exclusion Criteria:
[1839] The presence of any of the following will exclude a subject from screening and enrollment: [1840] Subject has CD involvement of the upper gastrointestinal tract. [1841] Subject has a diagnosis of UC, indeterminate colitis, ischemic colitis, microscopic colitis, radiation colitis or diverticular disease-associated colitis. [1842] Subject has local manifestations of CD such as strictures, abscesses, short bowel syndrome or other disease complications for which surgery might be indicated or could confound the evaluation of efficacy. [1843] Subject had an intestinal resection within 6 months or any intra-abdominal surgery within 3 months prior to Screening Visit 1. [1844] Subject has an ileostomy or a colostomy. [1845] Subject had prior treatment with mycophenolic acid, tacrolimus, sirolimus, cyclosporine, thalidomide or apheresis (e.g., Adacolumn) within 8 weeks prior to Screening Visit 1. [1846] Subject has received intravenous (IV) corticosteroids within 2 weeks prior to Screening Visit 1. [1847] Subject has initiated, discontinued or changed the dose of oral aminosalicylates within 2 weeks prior to Screening Visit 1. [1848] Subject has initiated, changed or discontinued the allowed dose of oral corticosteroids (prednisone 20 mg/day or equivalent, budesonide 9 mg/day) within 3 weeks prior to Screening Visit 1. [1849] Subject has initiated immunosuppressants (e.g., AZA, 6-MP, or MTX) within 12 weeks prior to Screening Visit 1. [1850] Subject has discontinued or changed the allowed dose of immunosuppressants (eg, AZA, 6-MP, or MTX) within 8 weeks prior to Screening Visit 1. [1851] Subject has received topical GI treatments, such as, 5-aminosalicylic acid (5-ASA) or corticosteroid enemas or suppositories within 2 weeks prior to Screening Visit 1. [1852] Subject has received cholestyramine within 3 weeks prior to Screening Visit 1. [1853] Subject has received antibiotics for the treatment of CD within 3 weeks prior to Screening Visit 1. [1854] Subject had prior treatment with more than 2 TNF- blockers (eg, infliximab or adalimumab). [1855] Subject had treatment with a TNF- blocker within 8 weeks prior to the Screening Visit 1. [1856] Subject had prior treatment with any integrin antagonists (cg, natalizumab or vedolizumab). [1857] Subject has received total parenteral nutrition (TPN) within 4 weeks prior to the Screening Visit 1. [1858] Subject is stool positive for any enteric pathogen or Clostridium difficile (C. difficile) toxin at Screening Visit 1. [1859] Subject has a history of any clinically significant neurological, renal, hepatic, gastrointestinal, pulmonary, metabolic, cardiovascular, psychiatric, endocrine, hematological disorder or disease, or any other medical condition that, in the Investigator's opinion, would prevent the subject from participating in the study. [1860] Subject has any condition, including the presence of laboratory abnormalities, which would place the subject at unacceptable risk if he/she were to participate in the study or would confound the ability to interpret data from the study. [1861] Subject is pregnant or breastfeeding. [1862] Subject has a history of any of the following cardiac conditions within 6 months prior to Screening Visit 1 and at any time during the Screening Period, up through the first dose of IP: myocardial infarction, acute coronary syndrome, unstable angina, new onset atrial fibrillation, new onset atrial flutter, second- or third-degree atrioventricular block, ventricular fibrillation, ventricular tachycardia, heart failure, cardiac surgery, interventional cardiac catheterization (with or without a stent placement), interventional electrophysiology procedure, or presence of implanted defibrillator. [1863] Subject has a known active current or history of recurrent bacterial, viral, fungal, mycobacterial or other infections (including but not limited to tuberculosis and atypical mycobacterial disease and herpes zoster), human immunodeficiency virus (HIV), or any major episode of infection requiring hospitalization or treatment with W or oral antibiotics within 4 weeks prior to Screening Visit 1 and at any time during the Screening Period, up through the first dose of IP. [1864] Subject has a history of congenital or acquired immunodeficiency (eg, common variable immunodeficiency disease). [1865] Subject has a history of colorectal cancer or colorectal dysplasia. [1866] Subject has a history of malignancy, except for: [1867] Treated (i.e., cured) basal cell or squamous cell in situ skin carcinomas [1868] Treated (i.e., cured) cervical intraepithelial neoplasia or carcinoma in situ of the cervix with no evidence of recurrence within the previous 5 years [1869] Subject has received any investigational drug or device within 1 month prior to Screening Visit 1. [1870] Subject has a history of alcohol, drug, or chemical abuse within the 6 months prior to Screening Visit 1. [1871] Subject has a known hypersensitivity to oligonucleotides or any ingredient in the IP. [1872] Subject has received prior treatment with COMPOUND (I), or participation in a clinical study involving COMPOUND (I).
[1873] Biomarkers
[1874] High sensitivity C-reactive protein will be analyzed in blood samples. Fecal calprotectin will be assessed in the fecal samples. The schedule and frequency of these collections are presented, e.g., in
[1875] Description of Study Treatments
[1876] Description of Investigational Product(s):
[1877] COMPOUND (I) will be provided as 40-mg film coated tablets.
[1878] Treatment Administration and Schedule:
[1879] Subjects will receive 1 bottle when IP is administered. Four tablets will be taken by subjects QD during the 12-week Induction Period and QD on the months when IP is taken during 40-week Maintenance Period. That is, subjects will be taking the IP as four 40-mg tablets for 160 mg QD dosing. All IP will be provided as open-label treatment during the entire study. Subjects will be instructed to take the IP in the morning, 30 minutes before breakfast, with a glass of water, and they will also be instructed to refer to the label for storage instructions. Treatment and administration schedules are described below in Table 13.
TABLE-US-00011 TABLE 13 Dosing Schedule for the Treatment Periods Treatment Group. Induction Period Maintenance Period Weeks Weeks Weeks Weeks Weeks Weeks Weeks Weeks Weeks Weeks 0-3 4-7 8-11 12-15 16-23 24-31 32-40 40-47 48-51 52-55 COMP(I) 160 160 160 No IP 160 No IP 160 No IP 160 No IP 160 mg mg mg mg mg mg mg QD QD QD QD QD QD QD
[1880] Concomitant Medication Procedures
[1881] The following concomitant medications are permitted during the study: [1882] Oral aminosalicylates (sulfasalazine [SSZ] or 5-ASA compounds) are allowed during the study, provided that the dose has been stable for at least 2 weeks prior to Screening Visit 1. [1883] The dose of oral aminosalicylates must remain stable through Week 12, and should remain stable through the Early Termination Visit if early termination occurs prior to Week 12. [1884] If oral aminosalicylates have been recently discontinued, treatment must have been stopped at least 2 weeks prior to Screening Visit 1. [1885] The dose of oral aminosalicylates can be changed (ie, tapered, stopped or increased), as clinically indicated, at the discretion of the Investigator after Week 12. [1886] Oral corticosteroids are allowed during the Induction Period, provided that the dose (prednisone <20 mg/day or equivalent, budesonide <9 mg/day) has been stable for 3 weeks prior to Screening Visit 1. [1887] The dose of oral corticosteroids must remain stable through Week 12, and should remain stable through the Early Termination Visit if early termination occurs prior to Week 12. [1888] If oral corticosteroids were recently discontinued, treatment must have been stopped at least 3 weeks prior to Screening Visit 1. [1889] The dose of oral corticosteroids can be changed (ie, tapered, stopped or increased), as clinically indicated, at the discretion of the Investigator after Week 12. Immunosuppressants, such as AZA, 6-MP or MTX are allowed during the study, provided that treatment was initiated >12 weeks prior to Screening Visit 1. [1890] The dose of immunosuppressants must be at a stable dose for >8 weeks prior to Screening Visit 1 and must remain stable through Week 12, and should remain stable through the Early Termination Visit if early termination occurs prior to Week 12. [1891] If immunosuppressants were recently discontinued, treatment must have been stopped at least 8 weeks prior to Screening Visit 1. [1892] The dose of immunosuppressants can be changed (ie, tapered, stopped or increased), as clinically indicated, at the discretion of the Investigator after Week 12. [1893] Note: The dose of concomitant medications noted above may not be changed from the baseline dose through Week 12 during the study. No new CD therapy can be prescribed once the subject has been enrolled in the study through Week 12.
[1894] The following concomitant medications are prohibited: [1895] Uses of any biologic agents, including TNF- blockers within 8 weeks prior to Screening Visit 1 and through the entire duration of the study. [1896] Use of mycophenolic acid, tacrolimus, sirolimus, cyclosporine, thalidomide or apheresis (cg, Adacolumn) within 8 weeks prior to Screening Visit 1 and through Week 12 of the study. [1897] Use of topical treatment with 5-ASA or corticosteroid enemas or suppositories within 2 weeks prior to Screening Visit 1 and through Week 12 of the study. [1898] Use of IV corticosteroids within 2 weeks prior to Screening Visit 1 and through Week 12 of the study. [1899] Administration of TPN within 4 weeks prior to Screening Visit 1 and through Week 12 of the study. [1900] Chronic use of nonsteroidal antiinflammatory drugs (NSAIDs) through the entire duration of the study. However, low-dose aspirin for cardiovascular prophylaxis is allowed. [1901] Use of antibiotic therapy for the treatment of CD within 3 weeks prior to Screening Visit 1 and through Week 12 of the study. [1902] Use of cholestyramine within 3 weeks prior to Screening Visit 1 and through Week 12 of the study.
[1903] Adverse Events
[1904] Adverse Events are defined and reported as described in Example 3.
Example 5: Open-Label, Multicenter Study to Explore the Efficacy and Safety of Compound (I) in Subjects with Active Ulcerative Colitis
[1905] Study Objectives
[1906] The primary objective of the study is to explore the effect of COMPOUND (I) on clinical activity, as measured by the MMS in subjects with active UC.
[1907] The secondary objectives are: [1908] To explore the effect of COMPOUND (I) on endoscopic outcome, as measured by the Mayo endoscopic subscore, in subjects with active UC [1909] To evaluate the safety and tolerability of COMPOUND (I) in subjects with active UC
[1910] The exploratory objectives are: [1911] To evaluate the change in biomarkers such as hsCRP and FCP in response to COMPOUND (1) in subjects with active UC [1912] To explore the effects of COMPOUND (1) on histological scores in intestinal mucosal biopsies from subjects with active UC [1913] To explore the PD effects of COMPOUND (I) on gene expression in the intestinal mucosal in subjects with active UC [1914] To explore the association of the PD parameters with the efficacy of COMPOUND (I) in subjects with active UC [1915] To measure the systemic exposure of COMPOUND (I) in subjects with active UC
[1916] Study Endpoints
[1917] The study endpoints are listed in Table 14.
TABLE-US-00012 TABLE 14 Study Endpoints Endpoint Name Description Timeframe Primary Efficacy The proportion of subjects Week 8 achieving clinical remission in the MMS, defined as a MMS of 2, with no individual subscore >1 Secondary Efficacy The proportion of subjects Week 8 achieving a MMS of 2, with rectal bleeding subscore of 0 and stool frequency subscore and Mayo endoscopic subscore 1 Efficacy The proportion of subjects Week 8 achieving a Mayo endoscopic subscore 1 Efficacy The proportion of subjects Week 8 achieving a Mayo endoscopic subscore by individual segment (rectum, sigmoid, descending colon, transverse colon, ascending colon/cecum) 1 Efficacy The proportion of subjects Week 8 achieving clinical response in the MMS, defined as a decrease from baseline of at least 2 points and at least 25%, along with a reduction in the RBS of at least 1 point or an absolute RBS 1 Efficacy The proportion of subjects Week 8 achieving endoscopic response, defined as a decrease from baseline of at least 1 point in the Mayo endoscopic subscore Efficacy The proportion of subjects Week 8 achieving clinical remission in the TMS, defined as a TMS of 2, with no individual subscore >1 Efficacy The proportion of subjects Week 8 achieving clinical response in the TMS, defined as a decrease from baseline in the TMS of at least 3 points and at least 30%, along with a reduction in the RBS of at least 1 point or an absolute RBS of 1 Safety The evaluation of safety and Through tolerability of COMPOUND (I), Week 52 assessed by the type, frequency and severity of adverse events, and its relationship to IP, discontinuation due to adverse events, and clinically significant changes in vital signs, ECGs, and/or laboratory findings Exploratory Efficacy The proportion of subjects Week 8 achieving endoscopic remission, Week 32 defined as a Mayo endoscopic subscore of 0 Efficacy The proportion of subjects Week 8 achieving endoscopic remission Week 32 by segment (rectum, sigmoid, descending colon, transverse colon, ascending colon/cecum), defined as a Mayo endoscopic subscore of 0 Efficacy The proportion of subjects Week 8 achieving clinical remission in the PMS, defined as a PMS of 2, with no individual subscore >1 Efficacy The proportion of subjects Week 8 achieving clinical response in the PMS, defined as a decrease from baseline in the PMS at least 2 points and at least 25%, along with a reduction in the RBS of at least 1 point or an absolute RBS of 1 point Efficacy The proportion of subjects Week 52 who achieve corticosteroid- free clinical remission in the PMS, among subjects receiving oral corticosteroids at baseline Efficacy The proportion of subjects Week 52 who are corticosteroid free, among subjects receiving oral corticosteroid at baseline Efficacy The proportion of subjects Week 8 achieving a RBS 1 Efficacy The proportion of subjects Through who are in clinical remission Week 52 per the PMS at each time point Efficacy The proportion of subjects Through who are in clinical response Week 52 per the PMS at each time point Efficacy The change from baseline in MMS Week 8 Week 32 Efficacy The change from baseline in TMS Week 8 Week 32 Efficacy The change from baseline in Week 8 Mayo endoscopic subscore Week 32 Efficacy The proportion of subjects Week 32 achieving a MMS of 2, with RBS of 0 and stool frequency and endoscopy subscore 1 Efficacy The proportion of subjects Week 32 achieving clinical response in the MMS Exploratory Efficacy The proportion of subjects Week 32 achieving clinical remission in the TMS Efficacy The proportion of subjects Week 32 achieving clinical response in the TMS Efficacy The change from baseline in Through PMS at each time point Week 52 Efficacy The change from baseline in Week 8 histologic scores from the Week 32 intestinal mucosal Biomarkers The change from baseline in Through hsCRP at each time point Week 52 Biomarkers The change from baseline in Through FCP at each time point Week 52 Pharmacodynamic The change from baseline in Week 8 gene expression of PD markers Week 32 such as, but not limited to, TNF-, IL-5, IL-13, and IL-17 in intestinal mucosa Pharmacokinetics The plasma concentration of Week 4 COMPOUND (I) Week 12 ECG = electrocardiogram; FCP = fecal calprotectin; hsCRP = high sensitivity C-reactive protein; IL = interleukin; IP = investigational product; MMS = modified Mayo score; PD = pharmacodynamic; PMS = partial Mayo score; RBS = rectal bleeding subscore; TMS = total Mayo score; TNF- = tumor necrosis factor .
[1918] Study Design
[1919] A schematic diagram illustrating the study design is shown in
[1920] This is an open-label, multicenter study to explore the efficacy and safety of oral COMPOUND (I) in subjects with active UC, defined as a MMS4 and 9 and a Mayo endoscopic subscore 2.
[1921] Approximately 40 subjects will be enrolled to receive open-label, oral COMPOUND (1) 160 mg for duration of 52 week treatment. Enrollment of subjects with previous exposure to TNF- blockers will be limited to approximately 15 subjects. The number of subjects with extensive colitis is targeted to comprise approximately 50% of the entire study population.
[1922] Eligible subjects will have the Baseline Visit (Week 0/Visit 2) and receive the following treatments: [1923] Induction PhaseCOMPOUND (I) 160 mg once daily (QD) for 8 weeks; [1924] Extension PhaseCOMPOUND (I) 160 mg on alternating dosing schedule (160 mg QD) for 4 weeks. Subjects who do not achieve at least a 20% decrease in PMS from baseline at Week 12 will be discontinued from the study
[1925] Based on ongoing safety and efficacy assessments performed during the study, the study may continue with the COMPOUND (I) 160 mg QD dose, a QD dose of COMPOUND (I) up to 320 mg may be added, or the study may be terminated.
[1926] If the COMPOUND (I) 160 mg QD dose group is discontinued and a new dose group is added, an additional 40 subjects will be enrolled in the new dose group. Subjects enrolled subsequent to the decision to adjust the dose of COMPOUND (I), will receive the following treatments: [1927] Induction PhaseCOMPOUND (I), up to 320 mg QD, for 8 weeks; [1928] Extension PhaseCOMPOUND (I), up to 320 mg QD, followed by 4 weeks without COMPOUND (I) treatment for an additional 44 weeks. Subjects who do not achieve at least a 20% decrease in the PMS from baseline at Week 12 will be discontinued from the study.
[1929] Actively enrolled subjects will not be affected by the dose adjustment.
[1930] Subjects receiving corticosteroids at baseline will start tapering their corticosteroids at Week 8 (the end of the Induction Phase) if they achieve clinical response, defined as a decrease from baseline of at least 2 points and at least 25%, along with a reduction in the RBS of at least 1 point or an absolute RBS1 in the MMS. The endoscopy subscore assessed by the investigator will be used for the calculation of the Week 8 MMS.
[1931] The study will consist of 4 phases: [1932] Screening Phaseup to 4 weeks [1933] Induction Phase8 weeks [1934] Extension Phase44 weeks [1935] Observational Follow-up Phase4 weeks
[1936] Subjects who complete the Extension Phase, and those subjects who prematurely discontinue from the study for any reason, will enter the post-treatment Observational Follow-up Phase, the 4-week period after the last dose of IP.
[1937] Study Duration
[1938] the overall study duration will be up to 60 weeks, with different phases as follows: up to 4 weeks in the Screening Phase; 8 weeks in the Induction Phase; 44 weeks in Extension Phase, and 4 weeks in the post-treatment Observational Follow-up Phase.
[1939] Study Population
[1940] Number of Subjects:
[1941] Approximately 40 subjects will be enrolled worldwide. The total number of subjects may increase to up to 80 if a new dose group is explored.
[1942] Inclusion Criteria:
[1943] Subjects must satisfy the following criteria to be enrolled in the study: [1944] Subject is a male or female 18 years of age at the time of signing the ICF. [1945] Subject is able to understand and voluntarily sign an ICF prior to conducting any study-related assessments/procedures. [1946] Subject is willing and able to adhere to the study visit schedule and other protocol requirements. [1947] Subject must have a diagnosis of UC with a duration of at least 3 months prior to screening. [1948] Subject must have moderate to severe UC, defined as MMS4 to 9 at screening. [1949] Subject must have a Mayo endoscopic subscore 2 at screening. [1950] Subject must have failed or experienced intolerance to at least one of the following: aminosalicylates; budesonide; systemic corticosteroids; immunosuppressants (eg, 6-mercaptopurine [6-MP], azathioprine [AZA], or methotrexate [MTX]) or TNF- blockers (e.g., infliximab, adalimumab, or golimumab). [1951] Subject must meet the following laboratory criteria: [1952] a. White blood cell count 3000/mm.sup.3 (3.010.sup.9/L) [1953] b. Platelet count 100,000/mm.sup.3 (10010.sup.9/L) [1954] c. Serum creatinine 1.5 mg/dL (132.6 mol/L) [1955] d. Aspartate transaminase (AST/serum glutamic oxaloacetic transaminase [SGOT]) and alanine transaminase (ALT/serum pyruvic transaminase [SGPT])2.5upper limit of normal (ULN) [1956] e. Total bilirubin 2 mg/dL (34 mol/L) unless there is a confirmed diagnosis of Gilbert's disease [1957] f. Hemoglobin 9 g/dL (5.6 mmol/L) [1958] g. Activated partial thromboplastin time (APTT) 1.5ULN
[1959] Exclusion Criteria:
[1960] The presence of any of the following will exclude a subject from enrollment. [1961] Subject has a diagnosis of CD, indeterminate colitis, ischemic colitis, microscopic colitis, radiation colitis or diverticular disease-associated colitis. [1962] Subject has ulcerative colitis restricted to distal 15 cm or less (eg, ulcerative proctitis). [1963] Subject had surgery as a treatment for UC or who, in the opinion of the Investigator, is likely to require surgery for UC during the study. [1964] Subject has clinical signs suggestive of fulminant colitis or toxic megacolon. [1965] Subject is stool positive for any enteric pathogen or Clostridium difficile (C. difficile) toxin at screening. [1966] Subject has history of colorectal cancer or colorectal dysplasia. [1967] Prior treatment with more than 2 TNF- blockers (eg, infliximab, adalimumab, or golimumab). [1968] Prior treatment with any integrin antagonists (eg, natalizumab or vedolizumab). [1969] Use of TNF- blockers within 8 weeks of the screening. [1970] Subject had prior treatment with mycophenolic acid, tacrolimus, sirolimus, cyclosporine, thalidomide or apheresis (eg, Adacolumn) for the treatment of UC. In addition, prior use of any of these treatment modalities for an indication other than UC within 8 weeks of screening is also excluded. [1971] Subject has received intravenous (IV) corticosteroids within 2 weeks of screening. [1972] Subject has received topical treatment with 5-ASA or corticosteroid enemas or suppositories within 2 weeks of screening. [1973] Subject has received total parenteral nutrition (TPN) within 4 weeks of screening. [1974] Subject has a history of any clinically significant neurological, renal, hepatic, gastrointestinal, pulmonary, metabolic, cardiovascular, psychiatric, endocrine, hematological disorder or disease, or any other medical condition that, in the investigator's opinion, would prevent the subject from participation in the study. [1975] Subject has any condition, including the presence of laboratory abnormalities, which places the subject at unacceptable risk if he/she was to participate in the study or confounds the ability to interpret data from the study. [1976] Subject is pregnant or breastfeeding. [1977] Subject has a history of any of the following cardiac conditions within 6 months of screening: myocardial infarction, acute coronary syndrome, unstable angina, new onset atrial fibrillation, new onset atrial flutter, second- or third-degree atrioventricular block, ventricular fibrillation, ventricular tachycardia, heart failure, cardiac surgery, interventional cardiac catheterization (with or without a stent placement), interventional electrophysiology procedure, or presence of implanted defibrillator. [1978] Subject has a known active current or history of recurrent bacterial, viral, fungal, mycobacterial or other infections (including but not limited to tuberculosis and atypical mycobacterial disease and Herpes zoster), human immunodeficiency virus (HIV), or any major episode of infection requiring hospitalization or treatment with W or oral antibiotics within 4 weeks of screening. [1979] Subject has a history of congenital or acquired immunodeficiency (eg, common variable immunodeficiency disease). [1980] Subject has a history of malignancy, except for: [1981] a. Treated (i.e., cured) basal cell or squamous cell in situ skin carcinomas [1982] b. Treated (i.e., cured) cervical intraepithelial neoplasia or carcinoma in situ of the cervix with no evidence of recurrence within the previous 5 years [1983] Subject has received investigational drug or device within 1 month of screening. [1984] Subject has a history of alcohol, drug, or chemical abuse within the 6 months prior to screening. [1985] Subject has a known hypersensitivity to oligonucleotides or any ingredient in the IP. [1986] Subject has prior treatment with COMPOUND (I) or participated in a clinical study involving COMPOUND (I).
[1987] Description of Investigational Product
[1988] COMPOUND (I) is 21 nucleotides (21-mer) in length. COMPOUND (I) is an AS ODN (21-mer) with a phosphorothioate backbone. COMPOUND (I) will be provided as 40-mg film coated tablets.
[1989] Treatment Administration Schedule
[1990] Subjects will receive 1 bottle at each visit. Four tablets will be taken by the subject once daily for the COMPOUND (I) 160 mg QD dose group. Up to eight tablets may be taken by the subject once daily for the new dose group. Subjects will be instructed to take the IP in the morning, 30 minutes before breakfast, with a glass of water. Subjects will also be instructed to refer to the label for storage instructions. The IP treatment and administration schedules are described below in Table 15 and Table 16.
TABLE-US-00013 TABLE 15 Dosing Schedule for COMPOUND (I) 160 mg Dose Group Treatment Treatment WK s WKs WK WKs WKs WKs WKs WKs WKs WKs WKs WK s WK s WKs Group 0-3 4-7 8 12-15 16-19 20-23 24-27 28-31 32-35 36-39 40-43 44-47 48-51 52-55 COMP(I) 160 160 160 No 160 No 160 No 160 No 160 No 160 No 160 mg mg mg mg IP mg IP mg IP mg IP mg IP mg IP QD QD QD QD QD QD QD QD QD IP = investigational product; QD = once daily; WK = week.
TABLE-US-00014 TABLE 16 Dosing Schedule for a New Dose Group up to 320 mg QD Treatment Treatment WKs WKs WKs WKs WKs WKs WKs WKs WKs WKs WKs WKs WKs WKs Group 0-3 4-7 8-11 12-15 16-19 20-23 24-27 28-31 32-35 36-39 40-43 44-47 48-51 52-55 COMP(I) QD QD QD No QD No QD No QD No QD No QD No QD dose dose dose dose IP dose IP dose IP dose IP dose IP dose IP up to up to up to up to up to up to up to up to up to 320 mg 320 mg 320 mg 320 mg 320 mg 320 mg 320 mg 320 mg 320 mg D
[1991] Concomitant Medications
[1992] The following concomitant medications are permitted during the study: [1993] Oral aminosalicylates (sulfasalazine [SSZ] or 5-ASA compounds) are allowed during the study, provided that treatment was initiated at least 6 weeks prior to screening, and has been given at a stable dose for at least 2 weeks prior to screening. The dose of oral aminosalicylates must remain stable through the duration of the study or early termination from the study. If oral aminosalicylates have been recently discontinued, treatment must have been stopped at least 2 weeks prior to screening. [1994] Oral corticosteroids are allowed during the Induction Phase, provided that the dose (prednisone 20 mg/day or equivalent, budesonide 9 mg/day) has been stable for 3 weeks prior to screening. If oral corticosteroids were recently discontinued, discontinuation must have been completed at least 3 weeks prior to screening. Corticosteroid doses should remain stable until the subject is eligible to start corticosteroids tapering at week 8. The tapering schedule is as follows: [1995] For prednisone doses >10 mg (or equivalent) daily dose, each week the daily dose is to be tapered by 5 mg until a dose of 10 mg/day is reached, after that each week the daily dose is to be tapered by 2.5 mg until discontinuation. [1996] For prednisone doses 10 mg (or equivalent), each week the daily dose is to be tapered by 2.5 mg until discontinuation. [1997] Subjects receiving budesonide should have their daily dose tapered by 3 mg every 3 weeks. [1998] Immunosuppressants, such as AZA, 6-MP or MTX are allowed during the study, provided that treatment was initiated 12 weeks prior to screening. The dose of immunosuppressants must be at a stable dose for 8 weeks prior to screening and must remain stable through the duration of the study or early termination from the study. Subjects who discontinued immunosuppressants should have stopped them at least 8 weeks prior to screening. [1999] Acetaminophen and low-dose aspirin for cardiovascular prophylaxis are allowed.
[2000] Note: The dose of concomitant medications noted above may not be increased above the baseline dose during the study. No new UC therapy can be prescribed once the subject has been enrolled into the study.
[2001] The following concomitant medications are prohibited: [2002] Use of any biologic agents, including TNF- blockers within 8 weeks prior to screening and through the duration of the study. [2003] Use of mycophenolic acid, tacrolimus, sirolimus, cyclosporine, thalidomide or apheresis (e.g., Adacolumn) within 8 weeks prior to screening and through the duration of the study. [2004] Use of topical treatment, such as 5-ASA or corticosteroid enemas or suppositories are prohibited during the study and must be discontinued 2 weeks prior to screening. [2005] Use of IV corticosteroids are prohibited during the study and must be discontinued 2 weeks prior to screening. [2006] Administration of TPN within 4 weeks of screening and through the duration of the study. [2007] Chronic use of nonsteroidal anti-inflammatory drugs NSAIDs.
[2008] Adverse Events
[2009] Adverse Events are defined and reported as described in Example 3.
[2010] Stopping Criteria
[2011] Criteria for stopping treatments of an individual subject: [2012] Subjects with an International Normalized Ratio (INR) or a prothrombin time (PTT greater than the upper limit of normal (ULN), which is confirmed on repeat testing; [2013] Subjects with clinically significant hemodynamic alterations or signs of systemic inflammatory response associated with elevated complement activation products.
[2014] Criteria for terminating instant study: [2015] When 3 or more subjects have been withdrawn from the study for abnormalities in coagulation laboratory parameters or complement activation factors; [2016] Sponsor (safery and clinical) determination of lack of appropriate benefit risk balance in patients with ulcerative colitis.
TABLE-US-00015 TABLE4 SEQUENCELISTING ID SEQUENCE SEQIDNO:1 ATGTTCAGGACCAAACGATCTGCGCTCGTCCGGCGTCTCTGGA GGAGCCGTGCGCCCGGCGGCGAGGACGAGGAGGAGGGCGC AGGGGGAGGTGGAGGAGGAGGCGA
GACAGCCGAGCGCATGGGGCCGGTGGCGGCGGCC CGGGCAGGGCTGGATGCTGCCTGGGCAAGGCGGTGCGAGG TGCCAAAGGTCACCACCATCCCCACCCGCCAGCCGCGGGC GCCGGCGCGGCCGGGGGCGCCGAGGCGGATCTGAAGGCGC TCACGCACTCGGTGCTCAAGAAACTGAAGGAGCGGCAGCT GGAGCTGCTGCTCCAGGCCGTGGAGTCCCGCGGCGGGACG CGCACCGCGTGCCTCCTGCTGCCCGGCCGCCTGGACTGCA GGCTGGGCCCGGGGGCGCCCGCCGGCGCGCAGCCTGCGCA GCCGCCCTCGTCCTACTCGCTCCCCCTCCTGCTGTGCAAA GTGTTCAGGTGGCCGGATCTCAGGCATTCCTCGGAAGTCA AGAGGCTGTGTTGCTGTGAATCTTACGGGAAGATCAACCC CGAGCTGGTGTGCTGCAACCCCCATCACCTTAGCCGACTC TGCGAACTAGAGTCTCCCCCCCCTCCTTACTCCAGATACC CGATGGATTTTCTCAAACCAACTGCAGACTGTCCAGATGC TGTGCCTTCCTCCGCTGAAACAGGGGGAACGAATTATCTG GCCCCTGGGGGGCTTTCAGATTCCCAACTTCTTCTGGAGC CTGGGGATCGGTCACACTGGTGCGTGGTGGCATACTGGGA GGAGAAGACGAGAGTGGGGAGGCTCTACTGTGTCCAGGAG CCCTCTCTGGATATCTTCTATGATCTACCTCAGGGGAATG GCTTTTGCCTCGGACAGCTCAATTCGGACAACAAGAGTCA GCTGGTGCAGAAGGTGCGGAGCAAAATCGGCTGCGGCATC CAGCTGACGCGGGAGGTGGATGGTGTGTGGGTGTACAACC GCAGCAGTTACCCCATCTTCATCAAGTCCGCCACACTGGA CAACCCGGACTCCAGGACGCTGTTGGTACACAAGGTGTTC CCCGGTTTCTCCATCAAGGCTTTCGACTACGAGAAGGCGT ACAGCCTGCAGCGGCCCAATGACCACGAGTTTATGCAGCA GCCGTGGACGGGCTTTACCGTGCAGATCAGCTTTGTGAAG GGCTGGGGCCAGTGCTACACCCGCCAGTTCATCAGCAGCT GCCCGTGCTGGCTAGAGGTCATCTTCAACAGCCGGTAG SEQIDNO:2 5-GTCGCCCCTTCTCCCCGCAG-3 SEQIDNO:3 5-GTCGCCCCTTCTCCCCGCAGC-3 SEQIDNO:7 5-GTXGCCCCTTCTCCCXGCAG-3, whereinXis5-methyl2-deoxycytidine. SEQIDNO:5 5-GTXYCCCCTTCTCCCXYCAG-3, wherebyXisanucleotidecomprisinga nitrogenousbaseselectedfromthegroup consistingofcytosine,5-methylcytosine and2-O-methylcytosine,andwhereinYis anucleotidecomprisinganitrogenousbase selectedfromthegroupconsistingof guanine,5-methylguanineand2-O-methyl- guanine,optionallyprovidedthatatleast oneofthenucleotidesXorYcomprisesa methylatednitrogenousbase. Insomeembodiments,atleastoneofthe internucleosidelinkagesoftheSMAD7AONis aphosphorothioatelinkage. Insomeembodiments,alloftheinter- nucleosidelinkagesoftheSMAD7AONare phosphorothioatelinkages. SEQIDNO:6 5-GTXGCCCCTTCTCCCXGCAGC-3, wherebyXisanucleotidecomprising 5-methyl-2-deoxycytidine. Insomeembodiments,atleastoneofthe internucleosidelinkagesoftheSMAD7AON isaphosphorothioatelinkage. Insomeembodiments,alloftheinter- nucleosidelinkagesoftheSMAD7AONare phosphorothioatelinkages.
INCORPORATION BY REFERENCE
[2017] The entire disclosure of each of the patent documents and scientific articles cited herein is incorporated by reference for all purposes.
EQUIVALENTS
[2018] The invention can be embodied in other specific forms with departing from the essential characteristics thereof. The foregoing embodiments therefore are to be considered illustrative rather than limiting on the invention described herein. The scope of the invention is indicated by the appended claims rather than by the foregoing description, and all changes that come within the meaning and range of equivalency of the claims are intended to be embraced therein.