Microorganism having improved ability to produce N-acetylglucosamine as a result of modulating glycolytic flux

10724015 ยท 2020-07-28

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to a mutant microorganism in which a gene that encodes phosphofructokinase-2 is disrupted or deleted to reduce glycolytic flux to thereby improve the ability of the microorganism to produce N-acetylglucosamine, and to a method of producing N-acetylglucosamine using the mutant microorganism. The mutant microorganism according to the present invention has advantages in that it has high resistance to various chemical substances, grows rapidly, is easily cultured, and produces N-acetylglucosamine with high efficiency, indicating that it is useful for production of a large amount of N-acetylglucosamine.

Claims

1. A mutant Saccharomyces cerevisiae BY4742 that overproduces N-acetylglucosamine when cultured in the presence of galactose as a sole carbon source, said mutant Saccharomyces cerevisiae BY4742 comprising a gene encoding a mutant enzyme comprising the amino acid sequence of SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6, wherein genes pfk26 and pfk27 which encode phosphofructokinase-2 (PFK-2) are disrupted or deleted, wherein the gene pfk26 has the nucleotide sequence of SEQ ID NO: 1 and the gene pfk27 has the nucleotide sequence of SEQ ID NO: 2, and wherein expression of the genes encoding phosphofructokinase-1 (PFK-1) and/or pyruvate kinase (Pyk1p) is inhibited, but not completely inactivated, said mutant Saccharomyces cerevisiae BY4742 comprising a Cas protein and/or a vector for expression of Cas protein, and guide RNA for reducing expression of said genes encoding phosphofructokinase-1 (PFK-1) and/or pyruvate kinase (Pyk1p), wherein said guide RNA comprises gRNA of SEQ ID NO: 10 for reducing expression of the gene encoding phosphofructokinase-1 (PFK-1) and/or gRNA of SEQ ID NO: 11 for reducing expression of the gene encoding pyruvate kinase (Pyk1p).

2. The mutant Saccharomyces cerevisiae of claim 1, wherein a gene encoding HAD phosphatase YqaB represented by SEQ ID NO: 7 is introduced.

3. A method for producing N-acetylglucosamine, comprising the steps of: producing N-acetylglucosamine by culturing the mutant Saccharomyces cerevisiae of claim 1; and recovering the produced N-acetylglucosamine.

4. The method of claim 3, wherein the mutant Saccharomyces cerevisiae is cultured in the presence of galactose as a carbon source.

5. The mutant Saccharomyces cerevisiae of claim 1, wherein said Cas protein is Cas9.

6. The mutant Saccharomyces cerevisiae of claim 1, wherein said Cas protein is in a Cas protein complex.

7. The mutant Saccharomyces cerevisiae of claim 1, wherein said genes pfk26 and pfk27 are deleted.

8. The mutant Saccharomyces cerevisiae of claim 7, wherein said Cas protein is Cas9.

9. The mutant Saccharomyces cerevisiae of claim 7, wherein said Cas protein is in a Cas protein complex.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

(2) FIG. 1 shows an N-acetylglucosamine biosynthesis pathway.

(3) FIG. 2, in graphs A through D, shows the glucose consumption, ethanol production and N-acetylglucosamine production profiles of a BY4742 YM strain (graphs A and C) and a pfk26/pfk27 YM strain (graphs B and D), cultured in minimal media (blue: glucose (graphs A and B)) or galactose ((graphs C and D); red: ethanol; green: N-acetylglucosamine).

(4) FIG. 3, in graphs A and B, shows the effects of various carbon sources (graph A) and GNA1 overexpression (graph B) on N-acetylglucosamine production.

(5) FIG. 4 shows a schematic diagram of glycolysis, in which glycolytic flux is modulated by reducing expression of PFK-1 and/or Pyk1p by CRIPR/Cas9.

(6) FIG. 5 shows results indicating that N-acetylglucosamine production is increased by reducing expression of PFK-1 and/or Pyk1p by CRIPR/Cas9.

BEST MODE FOR CARRYING OUT THE INVENTION

(7) Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Generally, the nomenclature used herein and the experiment methods, which will be described below, are those well-known and commonly employed in the art.

(8) In the present invention, an experiment was performed to construct a mutant microorganism having an increased ability to produce N-acetylglucosamine, by reducing glycolytic flux in a microorganism having glycolysis and N-acetylglucosamine (GlcNAc) biosynthesis pathways.

(9) The inhibition of fructose-1,6-biphosphatase (F16BPase) by fructose-2,6-biphosphate (F26BP) and the allosteric activity of PFK-1 are known as major mechanisms that regulate glycolysis and gluconeogenesis in various eukaryotic systems, including S. cerevisiae. These mechanisms differ from those in bacteria in which PFK-1 and F16BPase are regulated transcriptionally by various transcription factors.

(10) To produce N-acetylglucosamine (GlcNAc) from fructose-6-phosphate (6BP), genes such as GFA1, GNA1 and HAD phosphatase are required. In a previous study, the present inventors identified a GFA1 mutant having an excellent ability to produce GlcN6P, and YqaB which is haloacid dehalogenase-like (HAD) phosphatase, and the present inventors induced the overproduction of N-acetylglucosamine by overexpressing the GFA1 mutant and YqaB in S. cerevisiae.

(11) The GFA1 mutant contains amino acid mutations of Q96H and Q157R in an amino acid sequence of SEQ ID NO: 3, and may preferably have an amino acid sequence of any one of SEQ ID NOs: 4 to 6.

(12) The present inventors have constructed a mutant strain library by introducing each of HAD phosphatase-encoding genes into a strain having the GFA1 mutant introduced therein, and could screen a mutant strain that overproduces N-acetylglucosamine (GlcNAc). In addition, the sequence of HAD phosphatase introduced in the mutant strain that most efficiently overproduces N-acetylglucosamine (GlcNAc) was analyzed, and as a result, it could be seen that the sequence of HAD phosphatase is YqaB having a sequence of SEQ ID NO: 7.

(13) In a previous study, the present inventors cloned the GFA1 mutant and HAD phosphatase by use of a single-copy plasmid for screening an efficient enzyme. However, in the present invention, in order to maximize the production of N-acetylglucosamine (GlcNAc), a recombinant vector was constructed using a multicopy plasmid. As a result, it could be seen that, when the GFA1 mutant was overexpressed, the production of N-acetylglucosamine (GlcNAc) was 0.2 g/L, and when the GFA1 mutant was overexpressed together with YqaB, the production of N-acetylglucosamine (GlcNAc) increased up to 1.2 g/L (FIG. 2, graph A). The production of N-acetylglucosamine (GlcNAc) was started with glucose consumption and continued until ethanol would be completely consumed (FIG. 2, graph A).

(14) In an experiment in which PFK26 and PFK27, which encode PFK-2 isozyme, were deleted from S. cerevisiae, it was shown that formation of F26BP was completely eliminated and formation of F16BP was also reduced, suggesting that in vivo PFK-1 activity is decreased when its potent activator F26BP is absent. In the N-acetylglucosamine (GlcNAc) biosynthesis pathway, the first rate-limiting step is regulated by glutamine-fructose-6-phosphate transaminase (Gfa1p) which also uses fructose-6-phosphate (F6P) as a substrate to compete with PFK-1 (FIG. 1). From this characteristic, the present inventors have found that production of N-acetylglucosamine (GlcNAc) can be increased by reducing glycolytic flux in S. cerevisiae.

(15) Eukaryotic PFK-1 is activated by F26BP, and has a much lower K.sub.M value (K.sub.M=0.11 mM for F6P with 20 M F26BP and K.sub.M=1.65 mM without F26BP) when F26BP is present. The concentration of F26BP in S. cerevisiae is correlated with glucose 6-phosphate (G6P), and fermentable sugars rapidly increase G6P concentrations to thereby F26BP. Therefore, the present inventors assumed that, because activated PFK-1 has lower K.sub.M value than Gfa1p for F6P (K.sub.M(PFK-1)=0.11 mM with 20 M F26BP vs K.sub.M(Gfa1p)=0.39 mM), the activation of PFK-1 by F26BP upon glucose consumption can interfere with the production of N-acetylglucosamine (GlcNAc). Thus, to reduce PFK-1 activity and increase the production of N-acetylglucosamine (GlcNAc), both the PFK26 and PFK27 genes were deleted so as to eliminate the production of F26BP.

(16) To this end, the present inventors have constructed a pfk26/pfk27 YM strain (Table 1) that overexpresses two acetylglucosamine (GlcNAc) synthesis genes (GFA1 mutant and YqaB) and that shows no PFK-2 activity, and the present inventors have examined the effect of PFK-2 disruption, which leads to PFK-1 deactivation, on the production of N-acetylglucosamine (GlcNAc). As a result, it was shown that rate of glucose consumption (BY4742 YM: 1.28 g/L/h; pfk26/pfk27 YM: 1.16 g/L/h) and the amount of ethanol produced not greatly differ from those shown by a BY4742 YM control strain and that the production of N-acetylglucosamine (GlcNAc) was slightly lowered (FIG. 2, graphs A and B). Accordingly, the present inventors assumed that glycolytic flux is still strong in the pfk26/pfk27 strain when glucose is a sole carbon source and that an additional decrease in glycolytic flux is required to improve the production of N-acetylglucosamine (GlcNAc).

(17) When S. cerevisiae was cultured using galactose as a sole carbon source, the sugar utilization rate was reduced and ethanol production was reduced, compared to when glucose was used. For this reason, the present inventors used galactose as a sole carbon source in order to reduce the ethanol flux and to increase N-acetylglucosamine production. However, it was shown that, when galactose was used as a sole carbon source, the production of N-acetylglucosamine (GlcNAc) slightly decreased compared to when glucose was used (FIG. 2, graphs A and C). Furthermore, it was shown that the slower glycolytic rate of galactose had no great effect on ethanol production. This is presumably because the anticipated activity of PFK-1 was only slightly reduced while the activity of F16BPase was elevated by reduced F26BP level when galactose was used, which can trigger a futile cycle between F6P and F16BP. The decrease in N-acetylglucosamine (GlcNAc) production when using galactose as a sole carbon source resembled the effect of PFK-2 disruption (FIG. 2, graph B).

(18) Meanwhile, in the pfk26/pfk27 strain grown with glucose as a sole carbon source, the present inventors assumed that the anticipated activity of PFK-1 was reduced but still strong while the activity of F16BPase, which is allosterically inhibited by F26BP, was activated by the disruption of PFK-2, which can also result in a futile cycle.

(19) However, when the effects of galactose as a carbon source and PFK-2 disruption were combined, N-acetylglucosamine (GlcNAc) production was significantly elevated, and also reduced rate of galactose consumption (BY4742 YM: 0.985 g/L/h; pfk26/pfk27 YM: 0.553 g/L/h) and reduced ethanol production were observed (FIG. 2, graph D). The effect of galactose as the sole carbon source in the PFK-2-disrupted strain was noticeable, presumably because enough reduction of glycolysis and activation of gluconeogenesis were achieved. In this situation, F6P can be utilized more by Gfa1p, which has a higher affinity for F6P than deactivated PFK-1, resulting in more flux toward N-acetylglucosamine (GlcNAc) and its higher production. This result suggests that N-acetylglucosamine (GlcNAc) production can be additionally improved by further reducing glycolytic flux with different methods in a PFK-2-disrupted strain.

(20) Meanwhile, the same experiment was performed using various carbon sources other than galactose. As a result, it was shown that glucose, fructose and mannose showed similar final titers of N-acetylglucosamine (GlcNAc) (FIG. 3, graph A). In view of study results indicating that PFK27 was upregulated when carbon sources such as glucose or fructose were used, but was not upregulated when galactose was used, it is thought that suppression of glycolytic gene activation when galactose was used is responsible for improved N-acetylglucosamine (GlcNAc) production.

(21) Based on study results indicating that overexpression of GNA1 originated from S. cerevisiae in bacteria increased N-acetylglucosamine (GlcNAc) production in bacteria, additional overexpression of GNA1, encoding glucosamine-6-phosphate acetyltransferase, was conducted in both a BY4742 YMG strain and a pfk26/pfk27 YMG strain. However, it was shown that the overexpression of GNA1 slightly reduced N-acetylglucosamine (GlcNAc) production compared to that in a strain in which GNA1 was not overexpressed (FIG. 3, graph B). Accordingly, the present inventors could see that GNA1 is expressed sufficiently without up-regulation in S. cerevisiae and that overexpression of the GFA1 mutant and YqaB is essential and sufficient for N-acetylglucosamine (GlcNAc) production.

(22) In the present invention, it has been found that, when glycolytic flux was reduced by disrupting PFK-2 (which produces F26BP that is the most potent activator of PFK-1 in S. cerevisiae) and using galactose as a sole carbon source, ethanol production was reduced and N-acetylglucosamine (GlcNAc) production was increased up to 2 g/L. This is the highest titer of N-acetylglucosamine reported in eukaryotic system.

(23) Therefore, in one aspect, the present invention is directed to a mutant microorganism having an improved ability to produce N-acetylglucosamine in which a gene encoding phosphofructokinase-2 (PFK-2) is disrupted or deleted in a microorganism having glycolysis and N-acetylglucosamine biosynthesis pathways.

(24) In one embodiment of the present invention, the gene encoding phosphofructokinase-2 (PFK-2) may be PFK26 gene represented by SEQ ID NO: 1 and/or PFK27 gene represented by SEQ ID NO: 2.

(25) In one embodiment of the present invention, the mutant microorganism may further have introduced therein a gene encoding a mutant enzyme which comprises a mutation of Q96H and/or Q157R in a GFA1 enzyme represented by SEQ ID NO: 3, and which has an amino acid sequence of any one of SEQ ID NOs: 4 to 6.

(26) In one embodiment of the present invention, the mutant microorganism may have introduced therein a gene encoding HAD phosphatase. The gene encoding HAD phosphatase may be YqaB or YihX. In the meantime, the HAD phosphatase YqaB may be represented by SEQ ID NO: 7.

(27) In one embodiment of the present invention, as a host microorganism, any microorganism can be used without limitations as long as it has glycolysis and N-acetylglucosamine biosynthesis pathways, but any one microorganism selected from the group consisting of yeast, fungus, and aspergillus is preferably used.

(28) In another aspect, the present invention is directed to a method for producing N-acetylglucosamine, comprising the steps of: producing N-acetylglucosamine by culturing the above-described mutant microorganism; and recovering the produced N-acetylglucosamine.

(29) In one embodiment of the present invention, the mutant microorganism may be cultured in the presence of galactose as a carbon source.

(30) Meanwhile, according to the present invention, when other kind of glycolysis-regulating genes such as phosphofructokinase or pyruvate kinase is further modified in addition to disrupting or deleting the gene encoding phosphofructokinase-2 (PFK-2), the rate of glycolysis can be reduced, and the production of N-acetylglucosamine (GlcNAc) can further be increased.

(31) To this end, in the present invention, examination was performed to determine whether N-acetylglucosamine production in the mutant strain containing a deletion of PFK-2 (i.e., pfk26/pfk27) would be increased when expression of PFK1 and/or PYK1 in the mutant strain was additionally inhibited by the CRISPR/Cas system. In an example of the present invention, it could be seen that N-acetylglucosamine (GlcNAc) production in a mutant strain, in which pfk26/pfk27 were deleted and expression of PFK1 and/or PYK1 gene was additionally inhibited (reduced), was significantly increased compared to that in the control strain (pfk26/pfk27 YM) in which expression of these genes was not inhibited (reduced) (FIG. 5).

(32) Thus, in the present invention, expression of genes encoding phosphofructokinase-1 (PFK-1) and/or pyruvate kinase (PYK1P) in the mutant microorganism may additionally be reduced.

(33) In the present invention, the expression of the genes may be reduced by using CRISPR/Cas9. gRNA for reducing expression of the gene encoding phosphofructokinase-1 (PFK-1) may be represented by SEQ ID NO: 10, and gRNA for reducing expression of the gene encoding pyruvate kinase (Pyk1p) may be represented by SEQ ID NO: 11.

(34) Generally, the CRISPR/Cas system consists of a complex of the nuclease Cas protein and guide RNA. In the CRISPR/Cas9 system, a single-stranded guide RNA (sgRNA) consisting of a combination of crRNA and tracrRNA, which is guide RNA, may also form complex with the Cas9 protein.

(35) Because the guide sequence of guide RNA has a sequence complementary to a target sequence, it binds to the target gene. Furthermore, the nuclease Cas9 cleaves a site adjacent to a protospacer adjacent motif (PAM) to produce a double strand break (DSB), and the target gene is deleted by the host cell's DNA repair mechanisms that repair the cleaved site.

(36) In the present invention, Cas protein, for example, Cas9 (CRISPR associated protein 9), binds to the RNA scaffold sequence of guide RNA to form a complex, and recognizes a PAM sequence present in the target gene sequence to guide the CRISPR/Cas system to the target gene, and the target gene is recognized by complementary binding between the guide sequence of guide RNA and the target gene. Finally, the Cas protein exhibits nuclease activity by its active domains (HNH domain and RuvC domain).

(37) It is known that, when one mutation is introduced into a specific amino acid in the two domains, which are involved in nucleotide cleavage, among various domains of Cas9, Cas9 loses its nuclease activity. For example, when the amino acids at positions 10 and 840 in the amino acid sequence of Cas9 of Streptococcus pyogenes are mutated into alanine residues (D10A and H840A mutations), the Cas9 loses its DNA cleavage ability, and this catalytically inactive form of Cas9 is usually referred to as dCas9. Furthermore, a Cas9 enzyme, in which only any one of amino acids at positions 10 and 840 is mutated into alanine (D10A or H840A mutation), is known to have nickase activity that cleaves one strand of double-strand DNA.

(38) In the present invention, Cas protein and guide RNA may be constructed such that they will be expressed by a single vector or different vectors when they are simultaneously introduced into a strain. The expressed Cas protein and guide RNA may spontaneously form a complex after their expression in the strain. The term complex may be used interchangeably with terms such as CRISPR/Cas system, CRISPR complex, Cas9-gRNA complex, CRISPR/Cas complex, Cas protein complex, etc.

EXAMPLES

(39) Hereinafter, the present invention will be described in further detail with reference to examples. It will be obvious to a person having ordinary skill in the art that these examples are illustrative purposes only and are not to be construed to limit the scope of the present invention. Thus, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.

Example 1: Construction of Plasmids and the PFK26/PFK27 Double Knockout Strains

(40) Using the method disclosed in Korean Patent Publication No. 10-2016-0002509, a mutant strain that overexpresses a GFA1 mutant and the HAD phosphatase YqaB was constructed, and a pfk26/pfk27 strain containing a deletion of PFK26 and PFK27 for a disruption of PFK-2 was also constructed. Specifically, in order to construct a high-copy plasmid for enhancing the N-acetylglucosamine biosynthesis pathway, a target gene was amplified by PCR, cleaved with restriction enzymes, and then ligated into a p423GPD or p425GPD plasmid. The YqaB gene was cloned into p423GPD having an HIS3 selectable marker, thereby constructing p423GPD-YqaB, and mutated GFA1 and GNA1 were cloned into p425GPD having a LEU2 selectable marker, thereby constructing p425GPD-MG. Overexpressions of YqaB, mutated GFA1 and GNA1 were induced by GPD, GPD and TEF promoters, respectively. The ORF (open reading frame) of PFK26 in S. cerevisiae BY4742 was replaced with an integration fragment containing a KanMX6 selectable marker flanked by 45-bp homology arms and loxP sequences via homologous recombination. The KanMX6 selectable marker was recycled using the Cre/loxP system to delete PFK27. Integration and recycling of the selectable marker on the chromosomal locus of either PFK26 or PFK27 were confirmed by sequencing. The constructed strains and plasmids are shown in Tables 1 and 2 below.

(41) TABLE-US-00001 TABLE 1 Strain Description Source BY4742 MAT his31 leu20 lys20 ura30 (Brachmann et al. 1998) pfk26/pfk27 BY4742 pfk260 pfk27::URA3 BY4742 YM BY4742 p423GPD-YqaB p425GPD- GFA1m BY4742 YMG BY4742 p423GPD-YqaB p425GPD- MG pfk26/pfk27 YM pfk26/pfk27 p423GPD-YqaB p425GPD-GFA1m pfk26/pfk27 YMG pfk26/pfk27 p423GPD-YqaB p425GPD-MG

(42) TABLE-US-00002 TABLE 2 Plasmid Description Source p423GPD Plasmid with 2 origin, GPD (Mumberg promoter, CYC1 terminator, and et al. 1995) HIS3 selectable marker p425GPD Plasmid with 2origin, GPD (Mumberg promoter, CYC1 terminator, and et al. 1995) LEU2 selectable marker p423GPD-YqaB p423GPD harboring YqaB p425GPD-GFA1m p423GPD harboring GFA1 mutant p425GPD-MG p423GPD harboring GFA1 mutant under GPD promoter and GNA1 under TEF promoter

Example 2: Culture of Strains for Production of N-Acetylglucosamine

(43) Each of the strains constructed in Example 1 was cultured using a minimal synthetic medium containing 20 g/L of a carbon source (glucose, fructose, mannose or galactose), 6.7 g/L of a yeast nitrogen base (w/o amino acid) and a CSM-HIS-LEU dropout mixture. Each strain was shake-cultured in a 250-ml flask containing 20 mL of the medium at 30 C. and 250 rpm under a microaerobic condition, and the absorbance at a wavelength of 660 nm was measured to check growth.

Example 3: Determination of Metabolite Concentration

(44) Extracellular N-acetylglucosamine production, carbon source consumption and ethanol production were determined by high-performance liquid chromatography (HPLC). The medium, in which each strain was cultured, was centrifuged, and the supernatant was analyzed by HPLC (YL instrument, Anyang, Korea). Glucose, galactose, ethanol and N-acetylglucosamine were detected using an RI detector and 10 mM H.sub.2SO.sub.4 solution as an eluent with a Shodex SUGAR SH1011 column (8.0300 mm).

(45) As a result, the pfk27/pfk27 YM strain produced almost two-fold more N-acetylglucosamine (GlcNAc) compared to the control BY4742 YM strain when cultured using galactose as a sole carbon source (GlcNAc) (FIG. 2, graphs A through D). Meanwhile, glucose, fructose and mannose showed similar final titers of N-acetylglucosamine (GlcNAc) measured 6 days after inoculation of the mutant strain (FIG. 3, graph A), and the mutant strain that further overexpressed GNA1 in addition to the GFA1 mutant and YqaB showed a decrease in the production of N-acetylglucosamine (GlcNAc) in both the glucose and galactose minimal media (FIG. 3, graph B).

(46) From the above-described results, it could be seen that, when the mutant microorganism, obtained by additionally deleting phosphofructokinase-2 from the microorganism having introduced therein the YqaB gene and the GFA1 mutant, was cultured using galactose as a sole carbon source, it showed the highest efficiency in N-acetylglucosamine (GlcNAc) production.

Example 4: Construction of a Strain in which Expression of PFK1 and/or PYK1 Gene was Inhibited Using CRISPR/Cas System, and Determination of Metabolite Concentration

(47) Examination was performed to determine whether N-acetylglucosamine production in mutant strain constructed in Example 1 in which pfk26/pfk27 were deleted (pfk26/pfk27 YM) would be increased when expression of PFK1 and/or PYK1 gene in the mutant strain was further inhibited or reduced (disrupted) using the CRISPR/Cas system (FIG. 4).

(48) To inhibit or reduce (disrupt) expression of PFK1 and/or PYK1 gene by CRISPR/Cas9, the method disclosed in the article Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas (ACS Synthetic Biology Vol. 2 No. 10 604p-617p, Fahim Farzadfard et al.) was used.

(49) Because the glycolytic gene PFK1 (SEQ ID NO: 8) and/or PYK1 (SEQ ID NO: 9) could not be completely inactivated, guide RNA sequences capable of inhibiting the expression level of the genes to certain levels, thereby increasing N-acetylglucosamine production were screened.

(50) As a result, CAATCTCAAGATTCATGCTA (SEQ ID NO: 10) was selected as a gRNA sequence that binds to the ORF of PFK1, and CAGTAGAAAACACTTTGTGA (SEQ ID NO: 11) was selected as a gRNA sequence that binds to the upstream region of PYK1. The pRPR1_gRNA_handle_RPR1t plasmid (Addgene, USA) and pTPGI_dCas9_VP64 (Addgene, USA) used in the above-described article were purchased, and the gRNA sequences thereof and dCas9 were cloned and expressed according to the manufacturer's instruction, thereby inhibiting expression of the PFK1 and/or PYK1 gene.

(51) As a result, N-acetylglucosamine (GlcNAc) production in the strains (PFK1-4 and PYK1-4), in which expression of these genes was additionally inhibited, was significantly increased compared to that in the control strain (pfk26/pfk27 YM) in which expression of these genes was not inhibited (FIG. 5).

(52) Although the present invention has been described in detail with reference to the specific features, it will be apparent to those skilled in the art that this description is only for a preferred embodiment and does not limit the scope of the present invention. Thus, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.