Peptide having anti-obesity and anti-diabetes efficacy and use thereof

10723777 ยท 2020-07-28

Assignee

Inventors

Cpc classification

International classification

Abstract

The present disclosure relates to peptides exhibiting an anti-obesity effect by inhibiting fat accumulation and decomposing already accumulated fats as well as an outstanding anti-diabetes effect by effectively lowering blood sugar levels. The peptides that downregulate the expression of the adipogenic markers PPAR, ACC and/or aP2, upregulate the expression of the lipolytic factors pHSL, AMPK-1, CGI-58 and/or ATGL, and reduce sizes of adipocyte and levels of cholesterol in blood are described. The excellent activity and stability of the peptides described herein provides advantages in applications such as drugs and quasi-drug products.

Claims

1. A peptide consisting of the amino acid sequence of SEQ ID NO: 4.

2. The peptide according to claim 1, wherein the peptide has anti-obesity or anti-diabetic activity.

3. The peptide according to claim 1, wherein the peptide is coupled with a protecting group selected from the group consisting of an acetyl group, a fluorenylmethoxycarbonyl group, a formyl group, a palmitoyl group, a myristyl group, a stearyl group, and a polyethylene glycol (PEG) at the N-terminal end of the peptide.

4. The peptide according to claim 1, wherein the peptide is coupled with an amino group (NH.sub.2), or an azide group (NHNH.sub.2) at the C-terminal end of the peptide.

5. The peptide according to claim 1, wherein the peptide downregulates the expression of one or more adipogenic markers selected from the group consisting of peroxisome proliferator-activated receptor gamma (PPAR), acetyl-CoA carboxylase (ACC), and adipose-specific fatty acid-binding protein 2 (aP2).

6. The peptide according to claim 1, wherein the peptide upregulates the expression of one or more lipolytic factors selected from the group consisting of phospho-hormone-sensitive lipase (pHSL), AMP-activated protein kinase 1 (AMPK-1), comparative gene identification-58 (CGI-58), and adipose triglyceride lipase (ATGL).

7. The peptide according to claim 1, wherein the peptide increases lipolysis.

8. The peptide according to claim 1, wherein the peptide inhibits adipogenesis.

9. The peptide according to claim 1, wherein the peptide lowers blood sugar levels.

10. The peptide according to claim 1, wherein the peptide reduces the size of adipocytes.

11. The peptide according to claim 1, wherein the peptide reduces the levels of cholesterol in blood.

12. A pharmaceutical composition for preventing or treating obesity, comprising the amino acid sequence of SEQ ID NO: 4 as an active ingredient.

13. The pharmaceutical composition according to claim 12, further comprising one or more peptides selected from the group consisting of the peptide consisting of the amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7.

14. A pharmaceutical composition for preventing or treating diabetes, comprising the peptide consisting of the amino acid sequence of SEQ ID NO: 4 as an active ingredient.

15. The pharmaceutical composition according to claim 14, further comprising one or more peptides selected from the group consisting of the peptide consisting of the amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7.

Description

DESCRIPTION OF DRAWINGS

(1) FIG. 1a shows accumulated fats after treatment with the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention, as analyzed by Oil Red O staining.

(2) FIG. 1b shows accumulated fats after treatment with the peptide consisting of the amino acid sequence of SEQ ID NO: 4 according to an embodiment of the present invention, as analyzed by Oil Red O staining.

(3) FIG. 2a is a graph showing the results of fat accumulation after treatment with various concentrations of the peptide complexes according to an embodiment of the present invention, as analyzed by Oil Red O staining.

(4) FIG. 2b is a photograph showing the results of fat accumulation after treatment with various concentrations of the peptide complexes according to an embodiment of the present invention, as analyzed by Oil Red O staining.

(5) FIG. 3a shows the measured results of the expression levels of the gene aP2, which is involved in adipogenesis, after treatment with the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.

(6) FIG. 3b shows the measured results of the expression levels of the gene aP2, which is involved in adipogenesis, after treatment with the peptide consisting of the amino acid sequence of SEQ ID NO: 4 according to an embodiment of the present invention.

(7) FIG. 4 shows the measured results of the expression levels of the genes PPAR, ACC, and aP2, which play an important role in adipogenesis, after treatment with various concentrations of the peptide complexes according to an embodiment of the present invention.

(8) FIG. 5a shows the measured results of the expression levels of the PPAR protein, which plays an important role in adipogenesis, and the phospho-HSL protein, which plays an important role in lipolysis, after treatment with various concentrations of the peptide complexes according to the present invention.

(9) FIG. 5b is a graph showing the measured results of the expression levels of the PPAR protein, which plays an important role in adipogenesis, after treatment with various concentrations of the peptide complexes according to the present invention.

(10) FIG. 5c is a graph showing the measured results of the expression levels of the phospho-HSL protein, which plays an important role in lipolysis, after treatment with various concentrations of the peptide complexes according to the present invention.

(11) FIG. 6a shows the measured results of the expression levels of the genes AMPK-1 and CGI58, which are involved in the decomposition of accumulated fats, after treatment with the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.

(12) FIG. 6b shows the measured results of the expression levels of the genes AMPK-1 and CGI58, which are involved in the decomposition of accumulated fats, after treatment with the peptide consisting of the amino acid sequence of SEQ ID NO: 4 according to an embodiment of the present invention.

(13) FIG. 6c shows the measured results of the expression levels of the genes AMPK-1 and CGI58, which are involved in the decomposition of accumulated fats, after treatment with the peptide complexes according to an embodiment of the present invention.

(14) FIG. 7a shows is a photograph showing the measured results of the expression levels of the ATGL protein, which is involved in the decomposition of accumulated fats, after treatment with various concentrations of the peptide complexes according to the present invention.

(15) FIG. 7b shows is a graph showing the measured results of the expression levels of the ATGL protein, which is involved in the decomposition of accumulated fats, after treatment with various concentrations of the peptide complexes according to the present invention.

(16) FIG. 8a shows the results of the expression levels of the Phospho-HSL protein, which is involved in the decomposition of accumulated fats, after treatment with the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention, as analyzed by immunostaining.

(17) FIG. 8b shows the results of the expression levels of the Phospho-HSL protein, which is involved in the decomposition of accumulated fats, after treatment with the peptide consisting of the amino acid sequence of SEQ ID NO: 4 according to an embodiment of the present invention, as analyzed by immunostaining.

(18) FIG. 8c shows the results of the expression levels of the Phospho-HSL protein, which is involved in the decomposition of accumulated fats, after treatment with the peptide complexes according to an embodiment of the present invention, as analyzed by immunostaining.

(19) FIG. 9 shows the measured results of the produced glycerol levels, after treatment with various concentrations of the peptide complexes according to the present invention.

(20) FIG. 10a shows the measured results of the decomposed adipose tissues, after treatment with various concentrations of the peptide complexes according to the present invention in an experimental model of obese mice.

(21) FIG. 10b shows the measured results of sizes and numbers of the decomposed adipose tissues, after treatment with the peptide complexes according to the present invention in an experimental model of obese mice.

(22) FIG. 11 shows the measured results of the expression levels of the Phospho-HSL protein, which is involved in the decomposition of accumulated fats, after treatment with the peptide complexes according to the present invention, as analyzed by immunostaining.

(23) FIG. 12 shows the measured results of changes in (a) body weight and (b) feed intake of obese mice, after treatment with the peptide complexes according to the present invention.

(24) FIG. 13 shows the measured results of images of obese mice, after treatment with the peptide complexes according to the present invention.

(25) FIG. 14 shows the measured results of fat distribution, after treatment with the peptide complexes according to the present invention in obese mouse models induced by feeding a high-fat feed to a C57BL/6 mouse model, which is an experimental animal model, as analyzed by micro-CT imaging.

(26) FIG. 15 shows the observed results of obtained adipocyte tissues, after treatment with the peptide complexes according to the present invention in obese mouse models induced by feeding a high-fat feed to a C57BL/6 mouse model, which is an experimental animal model.

(27) FIG. 16a shows the observed results of morphological images of the adipocytes in obtained adipocyte tissues, after treatment with the peptide complexes according to the present invention in obese mouse models induced by feeding a high-fat feed to a C57BL/6 mouse model, which is an experimental animal model.

(28) FIG. 16b shows the observed results of sizes of the adipocytes in obtained adipocyte tissues, after treatment with the peptide complexes according to the present invention in obese mouse models induced by feeding a high-fat feed to a C57BL/6 mouse model, which is an experimental animal model.

(29) FIG. 16c is a graph showing the observed results of sizes of the adipocytes in obtained adipocyte tissues, after treatment with the peptide complexes according to the present invention in obese mouse models induced by feeding a high-fat feed to a C57BL/6 mouse model, which is an experimental animal model.

(30) FIG. 17 shows the observed results of the expression levels of the phospho-HSL protein, which is involved in lipolysis, in adipocytes of obtained adipocyte tissues, after treatment with the peptide complexes according to the present invention in obese mouse models induced by feeding a high-fat feed to a C57BL/6 mouse model, which is an experimental animal model.

(31) FIG. 18 shows the measured results of cholesterol levels in obtained blood samples, after treatment with the peptide complexes according to the present invention in obese mouse models induced by feeding a high-fat feed to a C57BL/6 mouse model, which is an experimental animal model.

(32) FIG. 19 shows the measured results of blood sugar levels in obtained blood samples, after treatment with the peptide complexes according to the present invention in obese mouse models induced by feeding a high-fat feed to a C57BL/6 mouse model, which is an experimental animal model.

(33) FIG. 20 shows the measured results of changes in blood sugar levels in obtained blood samples, after treatment with the peptide complexes according to the present invention in diabetes-induced db/db mouse models.

(34) FIG. 21 shows the measured results of changes in cholesterol levels in obtained blood samples, after treatment with the peptide complexes according to the present invention in diabetes-induced db/db mouse models.

(35) FIG. 22 shows the measured results of changes in blood sugar levels in obtained blood samples, after treatment with the peptide consisting of the amino acid sequence of SEQ ID NO: 2 in diabetes-induced db/db mouse models according to an embodiment of the present invention.

(36) FIG. 23 shows the measured results of changes in blood sugar levels in obtained blood samples, after treatment with the peptide consisting of the amino acid sequence of SEQ ID NO: 4 in diabetes-induced db/db mouse models according to an embodiment of the present invention.

(37) FIGS. 24a to 24d show the measured results of changes in blood sugar levels in obtained blood samples, after treatment with the peptide complexes according to the present invention in diabetic patients having high blood sugar levels according to an embodiment of the present invention.

BEST MODE

(38) The present invention relates to a peptide consisting of the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4.

(39) Hereinafter, the present invention will be described in more detail with reference to the following examples. However, the examples are only for illustrating the present invention, and are not to be construed to limit the scope of the present invention.

EXAMPLES

Synthesis Example 1: Peptide Synthesis

(40) 700 mg of chlorotrityl chloride resins (CTL resins, Nova biochem Cat No. 01-64-0021) was placed in a reactor and 10 ml of methylene chloride (MC) was added thereto, followed by stirring for 3 minutes. After removal of the solution, 10 ml of dimethyl formamide (DMF) was added and stirred for 3 minutes, and then the solvent was removed again. To the reactor, 10 ml of a dichloromethane solution was poured, 200 mmoles of Fmoc-Asn(Trt)-OH (Bachem, Swiss) and 400 mmoles of diisopropyl ethylamine (DIEA) were added thereto and stirred to be thoroughly dissolved, and then reaction was carried out while stirring for 1 hour. After completion of the reaction, washing was performed, and reaction was carried out with a solution of methanol and DIEA (2:1) in DCM (dichloromethane) for 10 minutes, and then washing was performed with an excess of DCM/DMF (1:1). Thereafter, the solution was removed, 10 ml of dimethyl formamide (DMF) was added and stirred for 3 minutes, and then the solvent was removed again. 10 ml of a deprotecting solution (20% piperidine/DMF) was poured into the reactor and stirred at room temperature for 10 minutes, and then the solution was removed. Thereafter, the same amount of deprotecting solution was added to maintain the reaction for 10 minutes again, and then the solution was removed. Thereafter, washing was performed twice with DMF, once with MC, and once with DMF for 3 minutes, respectively to give Asn-CTL resins. In another reactor, 200 mmoles of Fmoc-Arg(Pbf)-OH (Bachem, Swiss), 200 mmoles of HoBt, and 200 mmoles of Bop were added to 10 ml of a DMF solution and well dissolved by stirring. 400 mmoles of DIEA fraction was added over two times to the reactor, and then was stirred for at least 5 minutes until the solid was completely dissolved. The dissolved amino acid mixture solution was poured into the reactor containing the deprotected resins and allowed to react for 1 hour at room temperature while stirring it. After the reaction, the reaction solution was removed by stirring it three times, each for 5 minutes with a DMF solution. A small amount of the reacted resin was taken and used in a Kaiser test (Nihydrin Test) for examining an extent of the reaction. The same deprotection reaction as stated above was performed twice with the deprotecting solution to afford Arg-Asn-CTL resins. The resins were sufficiently washed with DMF and MC, and underwent the Kaiser test once again to perform an amino acid attachment experiments below in the same manner as described above. According to selected amino acid sequences, chain reactions were sequentially performed in the order of Fmoc-Thr(tBu)-OH, Fmoc-Lys(Boc)-OH, and Fmoc-Leu-OH. The Fmoc-protecting group was removed by reacting the reacted amino acid sequence with a deprotecting solution twice, each for 10 minutes and then well washing. Acetic anhydride, DIEA, and HoBt were added and subjected to acetylation for 1 hour. The resulting peptidyl resins were washed with DMF, MC, and methanol three times, respectively. The resins were dried under a slow flow of nitrogen gas and then were completely vacuum-dried under a P2O5 atmosphere. The resins were reacted for 2 hours at room temperature with 30 ml of a leaving solution (trifluoroacetic acid 81.5%, distilled water 5%, thioanisole 5%, phenol 5%, EDT 2.5%, and TIS 1%) while intermittently shaking. The resins were filtered and washed with a small volume of TFA solution, after which the filtrate was combined with the mother liquid. The distillation was carried out under reduced pressure so that the total volume is remained to be half, and then 50 ml of cold ether was added to induce precipitation. The precipitates were collected by centrifugation and washed twice with cold ether. The mother liquid was removed and sufficiently dried under a nitrogen atmosphere to afford 0.85 g of the unpurified peptide of NH.sub.2-Leu-Lys-Thr-Arg-Asn-COOH (SEQ ID NO: 1) (yield: 92%). The peptides of 0.78 g of NH.sub.2-Lys-Gly-Ala-Cys(Ser)-Thr-Gly-Trp-Met-Ala-COOH (SEQ ID NO: 2) (yield: 82%), 0.92 g of NH.sub.2-Ala-Cys(Ser)Thr-Leu-Pro-His-Pro-Trp-Phe-Cys(Ser)-COOH (SEQ ID NO: 3) (yield: 85%), and 0.76 g of NH.sub.2Cys(Ser)-Asp-Leu-Arg-Arg-Leu-Glu-Met-Tyr-Cys(Ser)-COOH (SEQ ID NO: 4) (yield: 88%) were synthesized. The peptides of SEQ ID NOS: 1, 2, and 4 were found to have molecular weights of 630.7 (calculated: 630.7), 924.5 (calculated: 924.1), 1236 (calculated: 1236.5), and 1301.5 (calculated: 1301.5), respectively, as measured by mass spectrometry.

(41) TABLE-US-00001 TABLE1 Analysis(Mass AminoAcid spectrometry) SEQIDNO Sequence Measured Calculated 1 LKTRN 630.7 630.7 2 KGACTGWMA 924.5 924.1(908.0) 3 KGASTGWMA 4 ACYLPHPWFC 1236 1236.5(1269.4) 5 ASYLPHPWFS 6 CDLRRLEMYC 1301.5 1301.5 7 SDLRRLEMYS

(42) On the other hand, each peptide consisting of the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 3, and SEQ ID NO: 7 was mixed in equal amount to prepare a peptide complex and its efficacy was evaluated.

Example 1: Assay for Inhibitory Activity Against Adipogenesis

(43) 1-1. Inhibition of Fat Accumulation Using Pre-Adipocyte (Oil Red O Staining)

(44) The pre-adipocytes 3T3-L1 cells were incubated until becoming confluent, and then incubated for two days after treatment with various concentrations of the peptides in a differentiation medium containing 10 g/ml insulin, 0.1 M dexamethasone, and 0.5 M IBMX. Thereafter, the medium was exchanged every two days to a medium containing 10 g/ml insulin. After differentiation was induced for 10 days, the generation of droplet in the cells was confirmed by Oil Red 0 staining.

(45) The prepared 3T3-L1 pre-adipocytes were washed with PBS, fixed with 3.7% formalin for 1 hour, were washed with 60% isopropanol, and then were dyed with Oil Red O solution at room temperature for 20 minutes. After completion of dyeing, the Oil Red O solution was removed, the cells were washed three times with distilled water, and then the dyed cells were observed under a phase contrast microscope. The results are shown in FIGS. 1a and 1b. For quantitative analysis, fats were extracted from the cells using 100% isopropanol, and the cells were transferred in an amount of 200 l/well into 96-well plates and measured for optical density at 500 nm using an ELISA reader. The results are shown in FIG. 2.

(46) As shown in FIGS. 1a and 1b, it was confirmed that the degree of fat accumulation in the cells was decreased after treatment with the peptide consisting of the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4, as measured by Oil Red 0 staining.

(47) As shown in FIG. 2, it was confirmed that the degree of fat accumulation in the cells was also decreased after treatment with various concentrations of the peptide complexes.

(48) 1-2. Suppression of Expression of Genes Involved in Adipogenesis

(49) 3T3-L1 cells (pre-adipocytes) were seeded at a density of 310.sup.5 cells/well into 6-well plates. After incubating for 24 hours, the cells were incubated for 14 days in a 37 C. incubator after treatment with various concentrations (0.1, 1, and 10 g/ml) of the peptides. Thereafter, the cells were harvested and treated with an RNA extraction solution (Easy Blue, Intron) to prepare for RNA from which cDNA was then synthesized using an RT premix (Intron). PCR was performed using primers for the adipogenic markers (PPAR, ACC, and aP2), and a PCR premix (Intron). Next, the PCR products were each loaded in an amount of 5 l into a 1% agarose gel and electrophoresis was performed, and then bands were identified in a Gel-Doc. The results are shown in FIGS. 3a and 3b.

(50) Target-specific primer sequences for PCR of adipogenic markers are as follows:

(51) TABLE-US-00002 SEQ Annealing ID Temperature NO Primer Sequence(5-3) ( C.) 8 PPAR_F TTTTCAAGGGTGCCAGTTTC 60 9 PPAR_R AATCCTTGGCCCTCTGAGAT 60 10 ACC_F ACCTTACTGCCATCCCATGTGCT 60 A 11 ACC_R GTGCCTGATGATCGCACGAACAA 60 A 12 aP2_F CATCAGCGTAAATGGGGATT 60 13 aP2_R ACACATTCCACCACCAGCTT 60

(52) As shown in FIGS. 3a and 3b, it was observed that in the mouse osteoblast cell line 3T3-L1 which was incubated for three days after treatment with the peptide consisting of the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4, the expression levels of the adipogenic marker aP2 were decreased.

(53) As shown in FIG. 4, it was observed that when the mouse osteoblast cell line 3T3-L1 were incubated for three days after treatment with the peptide complexes at a concentration of 0.1 g/ml, 1 g/ml, and 10 g/ml, the expression levels of the adipogenic markers PPAR, ACC, and aP2 were also decreased in both the positive control group treated with 100 ng/ml of TNF and the peptide complex-treated group.

(54) 1-3. Observation of Expression Levels of Adipogenesis- and Lipolysis-Inducing Proteins Using Pre-Adipocyte

(55) 3T3-L1 cells (pre-adipocytes) were seeded at a density of 310.sup.5 cells/well into 6-well plates. After incubating for 24 hours, the cells were incubated for 14 days in a 37 C. incubator after treatment with various concentrations (0.1, 1, and 10 g/ml) of the peptide complexes. Cell lysates obtained by treatment with a cell lysis buffer were used for protein quantitation, and then Western blotting was performed using an anti-PPAR antibody (Santa Cruz Biotechnology, USA), which is an antibody against an adipogenic marker, and an anti-pHSL antibody (Santa Cruz Biotechnology, USA), which is an antibody against an lipolytic factor.

(56) As shown in FIG. 5, it was observed that the expression levels of the adipogenic marker PPAR protein after treatment with various concentration of the peptide complexes were all decreased in a dose-dependent manner, and the expression levels of the lipolytic factor pHSL protein were all decreased in the the peptide complex-treated group.

Example 2: Assay for Lipolytic Activity

(57) 2-1. Increased Expression Levels of Genes Involved in Lipolysis

(58) 3T3-L1 cells (pre-adipocytes) were seeded at a density of 310.sup.5 cells/well into 6-well plates. After incubating for 24 hours, the cells were incubated for 14 days in a 37 C. incubator after treatment with various concentrations (0.1, 1, and 10 g/ml) of the peptides (positive control group: 100 ng/ml of TNF(SIGMA)). Thereafter, the cells were harvested and treated with an RNA extraction solution (Easy Blue, Intron) to prepare RNA from which cDNA was then synthesized using an RT premix (Intron). PCR was performed using primers for the markers (AMPK-al, CGI58), and a PCR premix (Intron). Next, the PCR products were each loaded in an amount of 5 l into a 1% agarose gel and electrophoresis was performed, and then bands were identified in a Gel-Doc. The results are shown in FIG. 6.

(59) Target-specific primer sequences for PCR of adipogenic markers are as follows:

(60) TABLE-US-00003 SEQ Annealing ID Temperature NO. Primer Sequence(5-3) ( C.) 14 AMPK-1_F TGACCGGACATAAAGTGGCTGTGA 60 15 AMPK-1_R TGATGATGTGAGGGTGCCTGAACA 60 16 CGI58_F TGTGCAGGACTCTTACTTGGCAGT 60 17 CGI58_R GTTTCTTTGGGCAGACCGGTTTCT 60

(61) As shown in FIGS. 6a and 6b, it was observed that in the pre-adipocytes (3T3-L1) which were incubated after treatment with the peptides, the expression levels of the adipogenic marker the lipolytic factors AMPK-1 and CGI-58 were increased in all the peptides-treated group.

(62) As shown in FIG. 6c, it was observed that, the expression levels of AMPK-1 and CGI-58 after treatment with the peptide complexes were increased in a dose-dependent manner, and the expression levels of the lipolytic factors were higher compared to the positive control group treated with 100 ng/ml of TNF.

(63) 2-2. Observation of Expression Levels of Lipolysis-Inducing Proteins Using Pre-Adipocyte

(64) 3T3-L1 cells (pre-adipocytes) were seeded at a density of 310.sup.5 cells/well into 6-well plates. After incubating for 24 hours, the cells were incubated for 14 days in a 37 C. incubator after treatment with various concentrations (0.1, 1, and 10 g/ml) of the peptide complexes (positive control group: 100 ng/ml of TNF(SIGMA)). Cell lysates obtained by treatment with a cell lysis buffer were used for protein quantitation, and then Western blotting was performed using an anti-ATGL antibody (Santa Cruz Biotechnology, USA), which is an antibody against an lipolytic factor.

(65) As shown in FIG. 7, it was confirmed that the expression levels of the lipolytic factor ATGL were increased by treatment with the peptide complexes.

(66) 2-3. Fluorescence Microscopic Observation of Expression Levels of Lipolysis-Inducing Proteins Using Pre-Adipocyte

(67) 3T3-L1 cells (pre-adipocytes) were seeded at a density of 310.sup.5 cells/well into 6-well plates. After incubating for 24 hours, the cells were incubated for 14 days in a 37 C. incubator after treatment with each peptide or peptide complex (1 g/ml) (positive control group: 100 ng/ml of TNF(SIGMA)). Thereafter, the cells were fixed with 70% ethanol, and then subjected to immunostaining with an anti-phospho-HSL antibody (Santa Cruz Biotechnology, USA) to observe the cellular expression levels of phospho-HSL, a lipolytic factor.

(68) As shown in FIGS. 8a to 8c, it was confirmed that the expression levels of the lipolytic factor phospho-HSL after treatment with each peptide (see FIGS. 8a and 8b) and peptide complex (see FIG. 8c) were increased.

(69) 2-4. Quantitation of Lipolysis Product Glycerol

(70) Adipose tissues were taken from the abdomens of obesity-induced mice and plated at an amount of 100 mg/well into 24-well culture plates, and then incubated in a culture medium (1 ml Krebs-Ringer buffer containing 25 mM HEPES, 5.5 mM glucose, and 2% (w/v) bovine serum albumin). At the time of incubation, the tissues were incubated for 48 hours after treatment with 0.1 g/ml, 1 g/ml, and 10 g/ml of the peptide complexes, and 100 ng/ml of TNF as a positive control. Glycerol produced during lipolysis was quantitatively measured.

(71) As shown in FIG. 9, it was confirmed that the amount of glycerol resulting from lipolysis after treatment with various concentration of peptide complexes was increased in a dose-dependent manner. It was confirmed that the amount of glycerol was also greater than that resulting from the positive control group treated with TNF.

(72) 2-5. Lipolytic Effect on Adipose Tissues Isolated From Obese Mouse

(73) Adipose tissues are classified into white fat and brown fat depending on the color and are classified into subcutaneous fat, abdominal fat, mesentery fat (visceral fat), and epididymal fat depending on the site. After dissection, each fat was extracted to isolate white fats. The white fats were placed at an amount of 100 mg/well into 24-well culture plates, and then incubated for 72 hours in a culture medium (1 ml Krebs-Ringer buffer containing 25 mM HEPES, 5.5 mM glucose, and 2% (w/v) bovine serum albumin) after treatment with various concentrations of the peptide complexes. The fats were sectioned into slices and were dyed with hematoxylin and eosin. Sizes of adipocytes were compared under a microscope (TS100, Nikon) with 200 magnification.

(74) As shown in FIG. 10a, it was confirmed that the fats after treatment with various concentrations of the peptide complexes decreased in size compared to the control group.

(75) As shown in FIG. 10b, it was observed that as a result of measuring the size of the adipocytes using the program after dying, the size of the cells in adipose tissues having distinct cell membrane compartments were decreased in the peptide complex-treated group.

(76) 2-6. Observation of Lipolytic Factor in Adipose Tissues

(77) Adipose tissues were taken from the abdomens of obesity-induced mice and plated at an amount of 100 mg/well into 24-well culture plates, and then incubated in a culture medium (1 ml Krebs-Ringer buffer containing 25 mM HEPES, 5.5 mM glucose, and 2% (w/v) bovine serum albumin). At the time of incubation, the tissues were incubated for 48 hours after treatment with the peptide complexes, and 100 ng/ml of TNF as a positive control. The expression of the labeled lipolytic factor phospho-HSL (green fluorescent substance) was confirmed.

(78) As shown in FIG. 11, it was confirmed that the expression levels of the lipolytic factor phospho-HSL in adipose tissues were increased after treatment with the peptide complex.

Example 3: Adipogenesis-Suppressive and Lipolysis-Promotive Effect in Experimental Animal

(79) Obesity-induced Models DIO (diets induced obesity), which had become obese by feeding high-fat diets to normal C57BL/6 mouse, were used for the anti-obesity experiment in which 5 g/ml of TNF was used as a positive control drug. For a control, a general diet, not a high-fat diet, was fed. In this experiment, a high-fat diet was fed for 12 weeks, while the peptide complexes or the positive control drug were applied. During the experiment, the weight loss was confirmed.

(80) TNF and the anti-obesity active compounds were intraperitoneally injected at 3:00 to 4:00 pm every week for 12 weeks. Body weights and dietary amounts were measured just before the first drug injection, and then measured at weekly intervals.

(81) Blood samples were collected from the tail vein after the end of the drug injection experiment, and then blood sugar levels were measured using Accu-Check Active (Roche) and cholesterol levels were analyzed using Cholesterol calculation Kit (BioVision).

(82) Adipose tissues are classified into white fat and brown fat depending on the color and are classified into subcutaneous fat, abdominal fat, mesentery fat (visceral fat), and epididymal fat depending on the site. After dissection, each fat was extracted. For histological examination, the fats were fixed with 10% neutral buffered formalin, embedded in paraffin blocks, cut into 5 M-thick sections, and dyed with hematoxylin and eosin.

(83) To analyze the degree of phosphorylation of the lipolytic factor HSL, fluorescent staining was carried out using an anti-pHSL antibody. The tissue samples were prepared, mounted on glycerine jell mounting media, and covered with a cover glass. The tissues were taken with a digital camera built into a microscope (Nikon, TS100) and images were observed under the microscope.

(84) It was confirmed that there was the body gain of mice from 20.9 g to 28.74 g when fed with a general diet and from 20.99 g to 49.5 g when fed with a high-fat diet, for 12 weeks from the beginning of the experiment to the end of the experiment. However, it was confirmed that there was the weight gain of both the high-fat diet-fed and peptide complex-treated group from 21.1 g to 36.76 g for 12 weeks from the beginning of the experiment to the end of the experiment, indicating a significant decrease of weight gain (174.2%) compared to the high-fat diet-fed control group (235.8%) (see Tables 4 and 5 and FIG. 12). Tables 4 and 5 show the measured results of the body weight in gram (g) and percentage (%) after treatment with peptide complexes in obese mouse models.

(85) TABLE-US-00004 TABLE 4 General Diet High-Fat Diet H.F + P. Week (control) (control) H.F + P/C Complex 0 20.09 20.99 22.41 21.10 1 20.75 22.32 23.00 21.26 2 21.99 25.25 26.12 23.72 3 18.23 27.35 27.45 24.36 4 23.26 30.20 30.51 25.29 5 23.16 32.76 32.76 28.65 6 23.28 36.78 33.49 28.79 7 24.71 38.31 35.14 30.37 8 25.84 40.12 37.15 31.53 9 25.59 42.14 38.97 32.59 10 28.13 43.02 40.39 33.78 11 27.90 45.70 41.35 35.33 12 28.74 49.50 43.91 36.76

(86) TABLE-US-00005 TABLE 5 General Diet High-Fat Diet H.F + P. Week (control) (control) H.F + P/C Complex 0 100 100 100 100 1 103.3 106.3 102.6 100.8 2 109.5 120.3 116.6 112.4 3 90.7 130.3 122.5 115.5 4 115.8 143.9 136.1 119.9 5 115.3 156.1 146.2 135.8 6 115.9 175.2 149.4 136.4 7 123.0 182.5 156.8 143.9 8 128.6 191.1 165.8 149.4 9 127.4 200.8 173.9 154.5 10 140.0 205.0 180.2 160.1 11 138.9 217.7 184.5 167.4 12 143.1 235.8 195.9 174.2

(87) As shown in FIG. 13, it was observed that after completion of the 12-week experiment, the body sizes of the peptide complex-treated group were maintained similar to those of the normal mice (general diet) compared to those of the high-fat diet-fed group, as analyzed on the photographs.

(88) TABLE-US-00006 TABLE 6 Total Total Visceral Subcutaneous Volume Fat Fat Fat (mm.sup.3) (mm.sup.3) (mm.sup.3) (mm.sup.3) Control (General Diet) 4958.25 702.72 380.09 322.63 HFD (2 weeks) 6530.09 2084.98 1411.14 673.84 HFD (10 weeks) 12464.91 8014.03 5821.27 2192.76 HDF (10 weeks) + 6012.12 1391.75 871.15 520.60 complex (8 weeks) HDF (10 weeks) + 8240.67 4165.80 2833.72 1332.08 P.C (8 weeks)

(89) As shown in FIG. 14 and Table 6, it was confirmed that as a result of examining the fat (yellow) distributed throughout the mouse body by micro-CT imaging after 12 weeks of the experiment, the amount of the fats distributed throughout the body in the mice of the high-fat diet-fed control group was remarkably increased compared to that of the general diet-fed control group, whereas the amount of the fats distributed throughout the body in both the peptide complex-fed and high-fat diets-fed group was remarkably decreased.

(90) As shown in FIG. 15, it was confirmed that as a result of comparing the volumes of adipose tissues after the mice which had completed micro-CT imaging were dissected to extract the adipose tissues distributed throughout the body, the amount of the fats in the mice of the high-fat diet-fed control group was higher than that in the general diet-fed control group, whereas the amount of the fats in both the high-fat diets-fed and peptide complex-fed group was remarkably decreased.

(91) As shown in FIG. 16a, it was confirmed that as a result of visualizing fat sizes after fats were isolated and dyed with H&E, the fat size of both the high-fat diets-fed and peptide complex-fed group was smaller than that of the high-fat diet-fed control group.

(92) As shown in FIGS. 16b and 16c, it was confirmed that as a result of analyzing the size of the fats using the program, when the fat size of the general diet-fed control group was assumed to be 100%, the fat size of the high-fat diet-fed group was increased to 127%, whereas the fat size of the high-fat diets-fed and peptide complex-fed group was decreased to 97%.

(93) As shown in FIG. 17, it was confirmed that as a result of measuring the expression levels of the lipolytic factor phospho-HSL expressed in adipose tissues after isolation of fats, the expression levels of phospho-HSL in the high-fat diets-fed and peptide complex-fed group were increased.

(94) As shown in FIG. 18, it was confirmed that as a result of measuring blood cholesterol levels in the mice after completion of the experiment, the blood cholesterol levels were 2.52 g/ml in the general diet-fed group, 3.5 g/ml in the high-fat diet-fed group, and 2.86 g/ml in the high-fat diets-fed and peptide complex-fed group. It indicates that the peptide complex lowered the elevated cholesterol levels by obesity.

(95) As shown in FIG. 19, it was confirmed that as a result of measuring blood sugar levels after completion of the experiment, the blood sugar levels were 174 mg/dL in mice of the general diet-fed group, and increased to 235 mg/dL in the high-fat diet-fed group, whereas a blood sugar levels were 183 mg/dL in the high-fat diets-fed and peptide complex-fed group and decreased similarly to the the general diet-fed group.

Example 4: Control of Blood Sugar Levels

(96) In this animal experiment, male C57BL/6 (normal mouse) (purchased from Samtako Bio Korea, Co., Ltd.) and C57BLKS/JLepr (diabetes model mouse, db/db mouse) (purchased from Central Lab. Animal Inc.) were used, together with the peptide complex as an anti-diabetic and/or anti-obesity active material, and sitagliptin as a positive control drug.

(97) In this example, the anti-diabetes and/or anti-obesity active complex was evaluated for acute anti-diabetic efficacy (single administration) in a normal mouse model and a genetically potential-diabetic model, using GTT (glucose tolerance test), which is a representative diagnostic method for diabetes.

(98) The environmental condition for housing the mice was maintained at a temperature of 22-24 C. and a relative humidity of 50-30%, with four per cage. In addition, the environmental condition was maintained at an illuminance of 150-300 Lux from 8:00 am to 8:00 pm, and 12 hours lighting and 12 hours lights out per day. The mice were allowed free access to a general diet (18% protein, manufactured in 2018, Harlan Laboratories Inc, USA). The mice were fasted for 4 hours or more before the ITT experiment and for 12 hours or more before the GTT experiment. The complex formulations were orally administered by force with the aid of a disposable oral administration syringe one hour before the GTT experiment. For the GTT experiment, the mice were allowed free access to a high-fat diet at 0 (zero) hour of the experiment. After 40 minutes of free access to a high-fat diet, blood samples were collected from the tail vein at intervals of 0, 30, 60, 90, 120, and 180 minutes to examine the blood glucose levels. Blood samples were measured for blood glucose levels using Accu-Chek active (Roche). On the other hand, sitagliptin, used as a therapeutic agent for diabetes, was selected as a positive control drug and administered at a dose of 100 mg/kg. The complex formulations selected as anti-diabetes and/or anti-obesity active candidates were divided into doses of 100 mg/kg for experimental groups, and four mice were used in each experimental group.

(99) As shown in FIG. 20, it was observed that the elevated blood sugar levels by the high-fat diet were reduced after treatment with the peptide complex. In the diabetes-induced mouse models, the high blood sugar levels in the diabetes were decreased.

(100) As shown in FIG. 21, it was confirmed that the blood cholesterol levels in the both the high-fat diets-fed and peptide complex-fed group were lower than those in the high-fat diet-fed control group.

(101) In addition, after starvation for 16 hours, DB/DB diabetes-induced mice were fed for 30 minutes and then administered with the peptides. Blood sugar levels were measured over times and the results are shown in FIGS. 22 and 23 and Tables 7 and 8.

(102) TABLE-US-00007 TABLE 7 High-Fat Diabetes Normal PBS SEQ ID NO: 2 Fasting 105 78 181 30 minutes 184 227 219 60 minutes 181 250 231 120 minutes 147 301 174 240 minutes 151 247 158 300 minutes 135 200 152

(103) TABLE-US-00008 TABLE 8 High-Fat Diabetes Normal PBS SEQ ID NO: 4 Fasting 115 218 222 30 minutes 159 251 249 60 minutes 125 255 229 120 minutes 121 366 215 240 minutes 112 312 180 300 minutes 119 253 165

(104) As shown in FIGS. 22 and 23 and Tables 7 and 8, it was observed that the blood sugar levels in the groups treated with the peptide consisting of the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4 were lowered in a time-dependent manner.

Example 5: Observation of Effect of Reducing Blood Sugar Level Through Clinical Experiment

(105) A brief clinical test was performed for subjects aged 45 to 65 years with a fasting blood sugar level of 170 mg/dL or more. They were given a complex formulation 30 minutes after meals. Blood samples were collected from the subjects at intervals of 30, 60, 90, 120, 150, and 180 minutes, and then measured for blood sugar levels using Accu-Chek active (Roche). The results are shown in FIGS. 24a and 24b.

(106) As shown in FIGS. 24a to 24d, it was observed that the blood sugar levels by the complex formulation were decreased in all the tested subjects.

INDUSTRIAL AVAILABILITY

(107) The prevent invention relates to a peptide having anti-obesity and anti-diabetic efficacy and use thereof.