Micro-Needle Sampling Device and use Thereof
20200229803 ยท 2020-07-23
Inventors
Cpc classification
A61B10/0035
HUMAN NECESSITIES
A61M2205/0238
HUMAN NECESSITIES
International classification
Abstract
The present invention relates to a device (10) for obtaining a sample (30) from a biological material (40) in solid form, said device comprising an array of micro-needles (30) arranged on a base plate (20). It further relates to a method for obtaining a sample (50) from a biological material (40) in solid form, comprising pressing the micro-needles (30) of the device (10) into said biological material (40), and subsequently removing the device from the biological material (40), and to the use of the device (10) in such a method.
Claims
1. A device for obtaining a sample from a biological material in solid form, said device comprising an array of micro-needles arranged on a base plate, wherein the micro-needles are coated with a coating enhancing adherence of biological material to the microneedle, wherein said coating preferably comprises extracellular matrix attachment and/or adhesion proteins, mucopolysaccharides, basic synthetic polymers, or any combination thereof.
2. The device according to claim 1, wherein the micro-needles are solid.
3. The device according to claim 1, wherein the micro-needles have a length of 0.1-1.5 mm, preferably 0.15-1.0 mm, such as 0.2-0.5 mm.
4. The device according to claim 1, wherein the micro-needles have an average diameter of 0.1-0.3 mm.
5. The device according to claim 1, wherein the micro-needles are in the shape of cones, pyramids, or rods with conical or pyramidal tips, pointing upward from the base plate.
6. The device according to claim 1, wherein the micro-needles have a barbed or rugged surface.
7. (canceled)
8. The device according to claim 1, wherein the coating comprises extracellular matrix attachment and/or adhesion proteins selected from collagen, laminin and fibronectin; mucopolysaccharides selected from heparin sulfate, hyaluronidate and chondroitin sulfate; basic synthetic polymers selected from poly-D-lysine; or any combination thereof.
9. The device according to claim 1, wherein the concentration of micro-needles on the base plate is 400-12,000 micro-needles per cm.sup.2.
10. The device according to claim 1, wherein the base plate is made of a flexible material.
11. The device according to claim 1, wherein the micro-needles and the base plate are made of the same or different material.
12. The device according to claim 1, wherein the micro-needles and/or the base plate are made of a material selected from silica; polymers, such as epoxy resins, acrylic polymers, polyurethane, polypropylene, and silicone resins; ceramics; metal; or a combination thereof.
13. Method for obtaining a sample from a biological material in solid form, comprising pressing the micro-needles of a device according to claim 1 into said biological material and subsequently removing the device from the biological material, and transferring the sample of biological material to a solid medium for storage of samples of biological material, by pressing the micro-needles into the solid medium.
14. (canceled)
15. Method according to claim 13, wherein the micro-needles are left in the solid medium until the sample is analysed.
16. Method according to claim 14, wherein the solid medium comprises a matrix of cellulose, woven porous polymers, or non-woven polymers.
17. Method according to claim 13, wherein the biological material is skin from a living or deceased human.
18. Method according to claim 13, wherein the biological material is a fresh, frozen, or Formalin Fixed, Paraffin Embedded tissue sample.
19. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0011]
[0012]
[0013]
[0014]
DETAILED DESCRIPTION OF THE INVENTION
[0015] In one aspect, the present invention relates to a device for obtaining a sample from a biological material in solid form, wherein the device comprises an array of micro-needles arranged on a base plate. This is shown in
[0016] The micro-needles arranged on the base plate may be solid. However, hollow micro-needles of the type used in some types of drug delivery may be used also in the present invention. The micro-needles may also have a rugged or generally uneven surface in order to increase the surface area of the micro-needle in order to increase the amount of biological material that may adhere to the micro-needle. It is also contemplated that the micro-needles may be porous so that biological material may diffuse into the micro-needle to further increase the amount of biological material that adheres to the micro-needle.
[0017] The base plate (10) is typically made of a flexible material for ease of application to the surface of a biological material, such as the skin of a human or animal subject. The base plate and the micro-needles may be made from the same or different material. Suitable materials for manufacture of the base plate and/or the micro-needles are from silica; polymers, such as epoxy resins, acrylic polymers, polyurethane, polypropylene, and silicone resins; ceramics; metal; or a combination thereof.
[0018] The micro-needles are generally of a length in the micrometer range, i.e. from 1-10 micrometers up to a 1 or 2 milimeters. The length of the micro-needles may be adapted to be long enough to penetrate through the strateum corneum and into the epidermis of a subject to which the micro-needles are applied when in use. Typical lengths of micro-needles may be 0.1-1.5 mm preferably 0.15-1.0 mm, such as 0.2-0.5 mm. The concentration of micro-needles on the base plate is typically in the range 400-12,000 micro-needles per cm.sup.2, such as 1,000, 2,000, 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, or 11,000 micro-needles per cm.sup.2.
[0019] The micro-needles may have an average diameter of 0.1-0.3 mm and be in the shape of cones, three-sided or four-sided pyramids, or rods with conical or pyramidal tips, extending from the base plate.
[0020] The micro-needles may also have a barbed or rugged surface. An embodiment wherein the micro-needles are equipped with bristles (32) is shown in
[0021] The micro-needles may also be coated with a coating (36) enhancing adherence of biological material, such as cells, proteins, and/or nucleic acids including DNA, to the micro-needles. Such coatings may be selected from extracellular matrix attachment proteins, extracellular matrix adhesion proteins, mucopolysaccharides, basic synthetic polymers, or any combination thereof. Examples of coatings that may be suitable for use with the present invention are collagen, laminin, fibronectin, from heparin sulfate, hyaluronidate, chondroitin sulfate, and poly-D-lysine.
[0022] In a further aspect, the invention relates to a method for obtaining a sample (50) from a biological material (40) in solid form, comprising pressing the micro-needles (30) of a device (10) according to the above aspect, into said biological material (40), and subsequently removing the device from the biological material (40). Part of the biological material (40), including whole cells, proteins, and/or nucleic acids including DNA, will adhere to the micro-needles (30) and thus constitute the sample (50). This workflow is shown in
[0023] The biological material (40) may be the skin from a living or deceased human or animal, or a fresh, frozen, or Formalin Fixed, Paraffin Embedded (FFPE) tissue sample. The sample (50) obtained from the biological material (40) thus typically comprise whole cells, proteins, and/or nucleic acids including DNA, and may originate from the subject from which the biological material originates or from foreign organisms such as microbes.
[0024] In a preferred embodiment, the sample of biological material is transferred to a solid medium (60) for storage of samples of biological material, by pressing the micro-needles (30) into the solid medium (60). This workflow is shown in
[0025] Such media for storage of samples of biological material are well-known in the art and include 903 Sample Collection Cards, Whatman FTA/FTA Elute Sample Collection Cards, and DMPK Sample Collection Cards, all available from GE Healthcare, Uppsala, Sweden. Whatman FTA technology is a patented process that incorporates chemically coated matrices to collect, transport, archive and isolate nucleic acids in a single device. The technology, which consists of two distinct chemistries for FTA and FTA Elute, has the ability to lyse cells on contact, denature proteins, and protect DNA from degradation caused by environmental challenges and microbial attack. FTA contains chemical denaturants and a free radical scavenger, while FTA Elute contains a chaotropic salt. The difference in the chemical coatings is what allows the DNA to be eluted from FTA Elute into a solution phase, while purified DNA remains bound to FTA. Purified genomic DNA from FTA and FTA Elute is suitable for use in PCR, STR, SNP genotyping, allelic discrimination genotyping, and RFLP analyses. DNA from FTA is also suitable for AFLP; DNA from FTA Elute is also suitable for use in TaqMan assays.
[0026] Samples may thus be collected onto FTA or FTA Elute cards by pressing the micro-needles into the cards, and cards are dried. Discs of FTA and FTA Elute are removed from sample areas using a coring device, such as a Harris Micro Punch or Uni-Core. These coring devices come in various sizes (i.e., 1.2 mm, 2.0 mm, and 3.0 mm); the choice of size depends on both the downstream application and the initial sample type. For applications that require DNA in solution, multiple discs can be treated at once. Genomic DNA purification from sample applied to FTA cards may be performed according to the manufacturer's instructions.
[0027] The invention also relates to the use of a device according to the first aspect in a method according to the second aspect.
SEQUENCES
[0028] The following sequences are included in the attached sequence listing.
TABLE-US-00001 Forwardprimer: (SEQIDNO:1) CTAAGATCATGGCATCAGGTCC Reverseprimer: (SEQIDNO:2) CCCCAAAATAAAGTCAGCCAC FAMTAMprobe: (SEQIDNO:3) [6FAM]TCCACTGTTTCCCCATCTATTTGCCA[TAM]
EXAMPLE
[0029] The invention is further illustrated in the example below. The examples are not intended to limit the invention, which is defined in the appended claims.
[0030] The principle of the invention is shown in this example by analysis of samples obtained from bovine meat with the use of a micro-needle device.
[0031] Materials: [0032] FTA cards: GEHC WB120055 #9463630 (GE Healthcare, Uppsala, Sweden) [0033] Indicating FTA cards: GEHC WB120211 #384045 (GE Healthcare, Uppsala, Sweden) [0034] Foam tipped swabs, GEHC WB100032 #3673(GE Healthcare, Uppsala, Sweden) [0035] Sirloin steak (obtained from the local supermarket) [0036] Bovine genomic DNA. AMSBIO cat: D1634999-G01 #6601033 [0037] Primers and probes (obtained from Sigma-Aldrich)
TABLE-US-00002 Forward: (SEQIDNO:1) CTAAGATCATGGCATCAGGTCC Reverse: (SEQIDNO:2) CCCCAAAATAAAGTCAGCCAC FAMTAMprobe: (SEQIDNO:3) [6FAM]TCCACTGTTTCCCCATCTATTTGCCA[TAM] [0038] Applied Biosystems: 2Taqman Universal PCR Master Mix cat:4324018 #1406029, exp October 2015 [0039] Sterile water [0040] Derma roller 0.2 mm: MT roller, Model MT2 (no other details supplied) [0041] Derma roller 0.5 mm: Dermaroller System (DRS), model DRS50 (no other details supplied) [0042] Derma roller 1.0 mm: Micro Needle Roller System, model MR100, RoHS ref JMF-003, lot: 130348, Exp March 2015. [0043] 2 mm Harris micro-punch [0044] Applied Biosystems real-time 7900 QPCR machine, CL/LE/PE/00293, calibration due September 2015.
[0045] Method
[0046] Real-time detection and quantification of bovine DNA were performed essentially as described in Cai et al., Journal of Food Composition and Analysis, 25 (2012) pp. 83-87.
[0047] Samples were obtained from the bovine meat using micro-needles of length 0.2 mm, 0.5 mm or 1.0 mm, or a swab, and transferred to a FTA card, and also using micro-needles of length 0.5 mm or a swab and transferred onto an indicating FTA card. All samples were repeated six times, as set out in the table below.
TABLE-US-00003 TABLE 1 Sample ID Details 1 0.5 mm micro-needle onto FTA 2 3 4 5 6 7 Swab onto FTA 8 9 10 11 12 13 0.2 mm micro-needle onto FTA 14 15 16 17 18 19 1.0 mm micro-needle onto FTA 20 21 22 23 24 25 0.5 mm micro-needle onto indicating FTA 26 27 28 29 30 31 Swab onto indicating FTA 32 33 34 35 36
[0048] Day 1: For micro-needle application, the dermaroller was placed on the fresh joint of beef (not rolled) and then pressed onto the FTA paper. For swab application, the swab head was rolled back & forth 4 times on the joint of beef, then applied to the FTA paper & rolled back & forth 4 times. Post application samples were left to dry in a laminar flow cabinet for >3 hours, then stored in a desiccator cabinet overnight.
[0049] Day 2:
[0050] 1. Dilute primers to give 250 nM in PCR reaction (20 ul):
[0051] Dilute supplied primers to 100 uM as follows: [0052] Forward primer (supplied at 37.9 nmol)add 379 ul sterile water to give 100 uM solution. [0053] Reverse primer (supplied at 37.2 nmol)add 372 ul sterile water to give 100 uM solution.
[0054] For each primerdilute to 2.5 uM as follows: [0055] 100 uM/2.5 uM=1:40 dilution [0056] Add 5 ul 100uM solution to 195 ul sterile water
[0057] 2. Dilute probe to give 500 nM in PCR reaction (20 ul)
[0058] Dilute supplied probe to 100 uM as follows: [0059] Probe (supplied at 13.2 nmol)add 132 ul sterile water to give 100 uM solution.
[0060] Dilute probe to 5 uM as follows: [0061] 100 uM/5 uM=1:20 dilution [0062] Add 10 ul 100 uM solution to 190 ul sterile water
[0063] 3. Preparation of standard curve: [0064] Stock=1.10 ug/ml (i.e., 1100 pg/ul) [0065] Dilute bovine gDNA to 50 pg/ul as follows: [0066] 1100/50=1:22 dilution [0067] Add 10 ul stock to 210 ul sterile water to give 50 pg/ul=100 pg/2 ul [0068] Prepare 1:10 dilutions (10 ul+90 ul sterile water) to give the following standard curve solutions: [0069] 1. 100 pg/2 ul [0070] 2. 10 pg/2 ul [0071] 3. 1 pg/2 ul [0072] 4. 0.1 pg/2 ul [0073] 5. 0.01 pg/2 ul [0074] 6. 0.001 pg/2 ul
[0075] 4. Preparation of FTA punches: [0076] 2 mm punches (using a Harris punch) were removed from bovine-spotted FTA punches and transferred to sterile 0.5 ml eddpendorf tubes. [0077] Each punch was washed 3 using 200 ul GEHC FTA purification reagent, then 2 using 200 ulTE buffer (0.01M Tris, 0.001M EDTA, pH 7.4). [0078] Punches were left to dry for .sup.30 mins prior to using in direct QPCR reactions as below:
[0079] 5. Gel Electrophoresis: [0080] Pour a 1TAE, 1% agarose gel: [0081] a) Weigh out 1 g agarose in a sterile erlenmeyer flask [0082] b) Add 100 ml 1TAE buffer (Tris-Acetate/EDTA) [0083] c) Heat in a microwave, heat for 1 minute, mix, then further 30 sec intervals until the agarose has dissolved [0084] d) Leave to cool for .sup.2 minutes, then add 10 ul Gel Red stain [0085] e) Pour into gel tray, avoid air bubble formation, insert gel combs and leave to dry for .sup.30 mins [0086] To load PCR samples: [0087] a) Fill the gel tank with 1TAE buffer (remove the stoppers used to cast the gel) [0088] b) Add 4 ul of 6loading dye to 15 ul PCR reactions and load between 10 ul into each well of the gel [0089] c) Load DNA markers into 1 lane of the gel. [0090] d) Connect the electrophoresis tank to the power & run at .sup.80 volts for .sup.30-40 mins [0091] e)
[0092] A resulting gel is shown in
[0093] PCR reaction
TABLE-US-00004 TABLE 2 Reagent/concentration Volume (ul) Forward primer @ 2.5 uM 2 Reverse primer @ 2.5 uM 2 Probe @ 5.0 uM 2 2X PCR Master Mix 10 Water 4 2 mm punch x1 Final volume 20
TABLE-US-00005 TABLE 3 Reagent/concentration Volume (ul) Forward primer @ 2.5 uM 2 Reverse primer @ 2.5 uM 2 Probe @ 5.0 uM 2 2X PCR Master Mix 10 Water 2 Control bovine gDNA @ 1 ng/ul 2 Final volume 20
TABLE-US-00006 TABLE 4 PCR cycling conditions 1. Initial denaturation 50 C. 2 min 2. Initial denaturation 95 C. 10 min 3. Denaturation 95 C. 15 sec 4. Anneal, elongate 60 C. 1 min Repeat steps 3 & 4 40 times
TABLE-US-00007 TABLE 5 Plate map 1 2 3 4 5 6 7 8 9 10 11 12 A 100 pg/well Punches from 0.5 mm micro-needle (samples 1 to 6) Empty Empty Empty B 10 pg/well Punches from swab (samples 7 to 12) Empty Empty Empty C 1 pg/well Punches from 0.2 mm micro-needle (samples 13 to 18) Empty Empty Empty D 0.1 pg/well Punches from 1.0 mm micro-needle (samples 19 to 24) Empty Empty Empty E 0.01 pg/well No Template Control Empty Empty Empty Empty Empty Empty F 0.01 pg/well Empty Empty Empty Empty Empty Empty Empty Empty Empty G 10 pg/ 10 pg/ 10 pg/ Empty Empty Empty Empty Empty Empty Empty Empty Empty H well + well + well + Empty Empty Empty Empty Empty Empty Empty Empty Empty blank blank blank punch punch punch
[0094] Results
[0095] The results are summarized in Table 6
TABLE-US-00008 TABLE 6 Well Sample Name Ct Quantity (pg/ul) Quantity (pg/ml) 4 0.5 mm miconeedle 20.601551 1.0145711 1014.571 5 0.5 mm miconeedle 26.268627 0.014150693 14.151 6 0.5 mm miconeedle 33.313503 6.98E05 0.070 7 0.5 mm miconeedle 35.29981 1.56E05 0.016 8 0.5 mm miconeedle 29.670776 0.001088558 1.089 9 0.5 mm miconeedle 26.111387 0.015931653 15.932 16 Swab 26.547935 0.011463758 11.464 17 Swab 31.232628 3.35E04 0.335 18 Swab 27.237637 0.006815631 6.816 19 Swab 27.346052 0.006280713 6.281 20 Swab 24.847023 0.04132729 41.327 21 Swab 25.545555 0.02440758 24.408 28 0.2 mm micro-needle 29.195902 0.001557163 1.557 29 0.2 mm micro-needle 1.1531498 2366172 2366172000 30 0.2 mm micro-needle 27.272406 0.006639297 6.639 31 0.2 mm micro-needle 28.55655 0.002521564 2.522 32 0.2 mm micro-needle 39.614628 6.04E07 0.001 33 0.2 mm micro-needle 37.7316 2.50E06 0.002 40 1 mm micro-needle 22.972874 0.16977271 169.773 41 1 mm micro-needle 28.513432 0.002604879 2.605 42 1 mm micro-needle 26.627182 0.010798915 10.799 43 1 mm micro-needle 34.065872 3.96E05 0.040 44 1 mm micro-needle Undetermined 0 0.000 45 1 mm micro-needle 33.36794 6.70E05 0.067 52 No template control Undetermined 0 0 53 No template control Undetermined 0 0 54 No template control Undetermined 0 0 13 10 pg/ul 17.68969 10 10000.000 14 10 pg/ul 17.678354 10 10000.000 15 10 pg/ul 17.447315 10 10000.000 73 punch + 10 pg/ul 19.211739 2.8928947 2892.895 85 punch + 10 pg/ul 17.58295 9.877061 9877.061 37 0.1 pg/ul 23.980858 0.1 100.000 38 0.1 pg/ul 23.688795 0.1 100.000 39 0.1 pg/ul 23.7168 0.1 100.000 74 punch + 0.1 pg/ul 23.077671 0.15687558 156.876 86 punch + 0.1 pg/ul 23.667562 0.10055739 100.557 49 0.01 pg/ul 26.331987 0.01 10.000 50 0.01 pg/ul 26.249264 0.01 10.000 51 0.01 pg/ul 26.419891 0.01 10.000 61 0.001 30.151587 0.001 1.000 62 0.001 29.975388 0.001 1.000 63 0.001 29.93187 0.001 1.000 75 punch + 0.001 pg/ul 29.214556 0.001535418 1.535 87 punch + 0.001 pg/ul 30.067472 8.0717E04 0.807
[0096] The average quantity of DNA obtained from the biological material is, with the outliers of wells 4 and 29 removed:
TABLE-US-00009 TABLE 7 0.2 mm micro-needle 2.144225 pg/ml 0.5 mm miconeedle 6.251275 pg/ml 1 mm micro-needle 30.547192 pg/ml Swab 15.10505 pg/ml
[0097] These results demonstrate that microneedles can be used to obtain sufficient DNA for QPCR analysis, using a device with micro-needles of a length of 0.2, 0.5, or 1 mm.