Modified <i>Brucella </i>vaccine strain for the treatment of brucellosis
11707515 · 2023-07-25
Assignee
- CONSEJO SUPERIOR DE INVESTIGACIONES CIENTÍFICAS (CSIC) (Madrid, ES)
- UNIVERSIDAD PÚBLICA DE NAVARRA (Pamplona, ES)
Inventors
- María Jesús Grilló Dolset (Aranguren, ES)
- Beatriz San Román Aberasturi (Aranguren, ES)
- Leyre Palacios Chaves (Aranguren, ES)
- Sara Mena Bueno (Aranguren, ES)
- Ana Zabalza Baranguá (Aranguren, ES)
Cpc classification
International classification
Abstract
The present application provides a modified Brucella strain, its use as a medicament, and its use as a medicament for the treatment and/or prevention of brucellosis. The Brucella strain has been modified through an inactivation of the wzm gene. Further, the present application provides a pharmaceutical composition which comprises the modified Brucella strain, its use as a medicament, and its use as a medicament for the treatment and/or prevention of brucellosis. The present application also provides a kit which comprises the modified Brucella strain and a pharmaceutically acceptable carrier or diluent and its use for the treatment and/or prevention of brucellosis.
Claims
1. A vaccine composition comprising a modified Brucella melitensis Rev1 strain, wherein the wzm gene has been inactivated, and a pharmaceutically acceptable carrier, diluent and/or adjuvant.
2. The vaccine composition according to claim 1, wherein the wzm gene has been partially deleted.
3. The vaccine composition according to claim 1, wherein the wzm gene has been completely deleted.
4. The vaccine composition according to claim 1, wherein the wild type wzm gene has the nucleotide sequence of SEQ ID NO: 1.
5. The vaccine composition according to claim 4, wherein at least 50% of SEQ ID NO: 1 has been deleted.
6. The vaccine composition according to claim 4, wherein at least 60% of SEQ ID NO: 1 has been deleted.
7. The vaccine composition according to claim 4, wherein at least 70% of SEQ ID NO: 1 has been deleted.
8. The vaccine composition according to claim 4, wherein at least 80% of SEQ ID NO: 1 has been deleted.
9. The vaccine composition according to claim 4, wherein nucleotides 80-721 of SEQ ID NO: 1 have been deleted.
10. The vaccine composition according to claim 1, wherein the strain has been further modified to express a fluorescent protein.
11. The vaccine composition according to claim 10, wherein the fluorescent protein is green fluorescent protein (GFP).
12. The vaccine composition according to claim 1, wherein the strain has been lyophilized.
Description
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
SUMMARY OF THE INVENTION
(13) The present application provides a modified Brucella strain, its use as a medicament, and its use as a medicament for the treatment and/or prevention of brucellosis. The Brucella strain has been modified through an inactivation of the wzm gene. Further, the present application provides a pharmaceutical composition which comprises the modified Brucella strain, its use as a medicament, and its use as a medicament for the treatment and/or prevention of brucellosis. The present application also provides a kit which comprises the modified Brucella strain and a pharmaceutically acceptable carrier or diluent and its use for the treatment and/or prevention of brucellosis.
DETAILED DESCRIPTION
Definitions
(14) The terms “treatment” and “therapy,” as used in the present application, refer to a set of hygienic, pharmacological, surgical and/or physical means used with the intent to cure and/or alleviate a disease and/or symptoms with the goal of remediating the health problem. The terms “treatment” and “therapy” include preventive and curative methods, since both are directed to the maintenance and/or reestablishment of the health of an individual or animal. Regardless of the origin of the symptoms, disease and disability, the administration of a suitable medicament to alleviate and/or cure a health problem should be interpreted as a form of treatment or therapy within the context of this application.
(15) The term “prevention,” as used in the present application, refers to a set of hygienic, pharmacological, surgical and/or physical means used to prevent the onset and/or development of a disease and/or symptoms. The term “prevention” encompasses prophylactic methods, since these are used to maintain the health of an animal or individual.
(16) The term “therapeutically effective amount” refers to an amount of matter which has a therapeutic effect and which is able to treat and/or prevent brucellosis.
(17) The term “brucellosis” refers to an infectious disease caused by bacteria from the genus Brucella. Brucellosis may occur in individuals or animals.
(18) The terms “individual,” “patient” or “subject” are used interchangeably in the present application and are not meant to be limiting in any way. The “individual,” “patient” or “subject” can be of any age, sex and physical condition. The term “animal,” as used in the present application, refers to any multicellular eukaryotic heterotroph which is not a human.
(19) The term “vaccine,” as used in the present application, refers to both “therapeutic vaccines,” which are intended to treat an existing disease and/or infection by strengthening the body's natural immune response, and “prophylactic vaccines,” which are intended to prevent a disease and/or infection from developing in a healthy individual or animal.
(20) The term “modified” refers to any matter which has been altered from its original form. In the present application, the term “modified” refers to any alteration which relies on human intervention.
(21) As used herein, “pharmaceutically acceptable carrier” or “pharmaceutically acceptable diluent” means any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed and, without limiting the scope of the present invention, include: additional buffering agents; preservatives; co-solvents; antioxidants, including ascorbic acid and methionine; chelating agents such as EDTA; metal complexes (e.g., Zn-protein complexes); biodegradable polymers, such as polyesters; salt-forming counterions, such as sodium, polyhydric sugar alcohols; amino acids, such as alanine, glycine, glutamine, asparagine, histidine, arginine, lysine, ornithine, leucine, 2-phenylalanine, glutamic acid, and threonine; organic sugars or sugar alcohols, such as lactitol, stachyose, mannose, sorbose, xylose, ribose, ribitol, myoinisitose, myoinisitol, galactose, galactitol, glycerol, cyclitols (e.g., inositol), polyethylene glycol; sulfur containing reducing agents, such as urea, glutathione, thioctic acid, sodium thioglycolate, thioglycerol, [alpha]-monothioglycerol, and sodium thio sulfate; low molecular weight proteins, such as human serum albumin, bovine serum albumin, gelatin, or other immunoglobulins; and hydrophilic polymers, such as polyvinylpyrrolidone. In a preferred embodiment, the pharmaceutically acceptable carrier or diluent is Phosphate Buffered Saline (PBS). Preferably, the pH of the PBS is 6.85
(22) The term “pharmaceutically acceptable adjuvant” refers to any and all substances which enhance the body's immune response to an antigen. Non-limiting examples of pharmaceutically acceptable adjuvants are: Alum, Freund's Incomplete Adjuvant, MF59, synthetic analogs of dsRNA such as poly(I:C), bacterial LPS, bacterial flagellin, imidazolquinolines, oligodeoxynucleotides containing specific CpG motifs, fragments of bacterial cell walls such as muramyl dipeptide and Quil-A®.
(23) Modified B. melitensis Rev1 Strain
(24) In a first aspect, the present application provides a modified Brucella melitensis Rev1 strain, wherein the wzm gene has been inactivated.
(25) Brucella melitensis Rev1 is a strain which was spontaneously attenuated and obtained from the virulent strain B. melitensis 6056, through successive spontaneous mutations associated with streptomycin (Str) dependence and the subsequent reversal of that dependency (Herzberg and Elberg 1953. Journal of Bacteriology 66: 585-599; Herzberg and Elberg 1953. Journal of Bacteriology 66: 600-605). The Rev1 strain has been used worldwide since the 50's as the only effective vaccine to prevent brucellosis in small ruminants, and is internationally considered the standard vaccine to control ovine and caprine brucellosis (OIE Terrestrial Manual, 2016—chapters 2.4.3. and 2.7.2). The original seed lots of Rev1 are available at the Brucellosis Reference Laboratory of the OIE of AFSSA (94706 Maisons-Alfort, France) or at the European Pharmacopoeia (BP 907, 67029 Strasbourg Cedex 1, France). Further, the Rev1 strain is commercially available and can be bought from various vendors. For example, the strain can be bought from CZV Veterinaria in Spain under the name “CZV Rev1.”
(26) The wzm gene encodes for part of the two-component ABC transporter system required to export the O-PS to the periplasm where the O-PS is then assembled onto a core moiety to generate a S-LPS. The wzm gene may have the following sequence (SEQ ID NO: 1):
(27) TABLE-US-00001 ATGATATCGTATATGGCTAATGTCTGGAAGGTACGCCACTTCTGGTGGC ACCTTTCAATGTCTGATTTACGTGGGCGCTTCAGGCGGTCCTCCTTGGG AATATTATGGGCAGTTATACAGCCACTAGCGCTCACGCTGCTACTGTCT TTCGTGTTTTCTAAATTGTTGAATCAAAGTATATCTGCATATGCCCCCT ATATTCTATCTGGGATTATTATCTGGGAATACATATCATTTACAGTGGT TGGTGGCTCAACAGCGCTTGTGCAAGCCGATGCATATATAAAGCAAACC AGAAATCCTCTTGCAATTTACACGCTTAGGAACACTGTTTCTGGCTTGG TCGTATTATCCGTAGCAAGTATCTCCCTATTCGGGTGGGTACTTATCAT GTTTCCTGAAAACTTCTCGCTTTCATGGTTAGCAATACCAACTTTGCTA CCCATCCTTGCTTTGATAGTTTGGCCGCTTGCCACAATCGTCGGCTACA TCGGCGCAAGATTTCGAGATCTGCCGAATGCTCTGGCGCTCGTGTTACA GGCAGCTTGGTTTGTTTCGCCGGTCTATTTTAAAGAATCGATGTTCAGG CAGGGTGGATTGAATGCATTCGTTGATTATAACCCTATTTACCACGTGA TGCAGATTCTAAGAGCCCCTGTCCTTTATGGGGAATGGCCTACGGCTAC CAATTACATTTGGTGCTTAGGTGTGAGCCTCCTCCTAACCTGCGTGGCA GTAGCTGTGGGGATGCGTGCGGAGAAGAGAGCCATTTTTTACCTATGA
(28) The wzm gene may be inactivated through any form of genetic modification known in the art. The inactivation may involve the partial or complete deletion of the gene from the host genome. The inactivation may involve a single none-sense mutation which renders the expressed protein non-functional. The inactivation may involve the mutation and/or deletion of the promoter, ribosome binding site or other transcriptional regulators which are involved in the transcription of the wzm gene. The inactivation may involve the insertion of a sequence which causes a frame shift and/or makes the resultant nascent protein non-functional. Any of the aforementioned deletions, insertions or mutations can be performed using allelic exchange (Hmelo et al., 2015. Nature Protocols, 10(11): 1820-41) or by using the CRISPR/Cas9 system (Wang et al., 2016. ACS Synthetic Biology, 5(7): 721-32). In a preferred embodiment, the wzt gene is not inactivated.
(29) In a preferred embodiment, the inactivation of the wzm gene is due to a partial deletion of the gene. Preferably, the partial deletion involves the deletion of at least 50, 60 or 70% of SEQ ID NO: 1. More preferably, the partial deletion involves the deletion of at least 80% of SEQ ID NO: 1. In a preferred embodiment, the inactivation of the wzm gene is not achieved by inserting a transposon into the coding sequence of the gene.
(30) In the Examples of the present invention, nucleotides 80-721 of SEQ ID NO: 1 have been deleted in B. melitensis Rev1 and 16M using the allelic exchange plasmid pJQKmΔwzm, which generates the correspondent Δwzm mutants (
(31) In a preferred embodiment, the modified B. melitensis Rev1 strain has been further modified to inactivate znuA, norD, bip, tcpB, cgs, ricA, bvrR, bvrS, one or more of the genes encoding the virB type IV secretion system selected from the group consisting of the B. melitensis 16M ORFs: BMEII0025, BMEII0026, BMEII0027, BMEII0028, BMEII0029, BMEII0030, BMEII0031, BMEII0032, BMEII0033, BMEII0034, and BMEII0035, and/or one or more of the genes involved in the formation, modification and/or assembly of LPS and/or metabolic pathways, including but not limited to ppdK, wbdR, gmd, manA, manB, manC, per, pgm, wbkA, wbkB, wbkC, wbkD, wbkF, wadC, and wzt (chromosomic regions wbk, wbo and wad).
(32) In a preferred embodiment, the modified B. melitensis Rev1 strain has been further modified so that the autologous N-formyltransferase activity has been suppressed and a heterologous gene encoding a N-acyltransferase other than a N-formyltransferase enzyme is functionally expressed. For example, the wbkC may be inactivated and a heterologous wbdR may be introduced and expressed in the strain (see WO 2017/108515 A1).
(33) In a preferred embodiment, the modified B. melitensis Rev1 strain has been further modified to express a fluorescent protein, preferably GFP. The expression of the fluorescent protein in the modified strain could be used to further distinguish Rev1 inoculated individuals or animals from infected individuals or animals (Chacón-Diaz et al., 2011. Vaccine. 29(3): 577-82; EP 2 508 201 A1). Briefly, this approach can be described as follows: when an individual or animal is vaccinated with the further modified strain, antibodies will be raised against the modified strain as well as the fluorescent protein. The antibodies raised against the fluorescent protein can be used in a serological test to test whether the individual or animal has been infected with a naturally occurring Brucella strain or with the further modified strain of the present invention. Thus, a kit which comprises the modified B. melitensis Rev1 strain which has been further modified to express a fluorescent protein may further comprise antibodies which bind to the fluorescent protein, and/or the fluorescent protein. Preferably, the fluorescent protein is GFP.
(34) In a preferred embodiment, the strain has been lyophilized. Lyophilization can be used to increase the stability and shelf-life of the strain.
(35) In a second aspect, the present invention provides a pharmaceutical composition which comprises the modified strain in accordance with any of the previously disclosed embodiments and a pharmaceutically acceptable carrier or diluent and/or a pharmaceutically acceptable adjuvant.
(36) In a preferred embodiment, the pharmaceutical composition comprises the modified B. melitensis Rev1 strain which has been further modified to express a fluorescent protein.
(37) A pharmaceutical composition as described herein may also contain other substances. These substances include, but are not limited to, cryoprotectants, lyoprotectants, surfactants, bulking agents, anti-oxidants, and stabilizing agents. In some embodiments, the pharmaceutical composition may be lyophilized.
(38) The term “cryoprotectant” as used herein, includes agents which provide stability to the strain against freezing-induced stresses, by being preferentially excluded from the strain's surface. Cryoprotectants may also offer protection during primary and secondary drying and long-term product storage. Non-limiting examples of cryoprotectants include sugars, such as sucrose, glucose, trehalose, mannitol, mannose, and lactose; polymers, such as dextran, hydroxyethyl starch and polyethylene glycol; surfactants, such as polysorbates (e.g., PS-20 or PS-80); and amino acids, such as glycine, arginine, leucine, and serine. A cryoprotectant exhibiting low toxicity in biological systems is generally used.
(39) In one embodiment, a lyoprotectant is added to a pharmaceutical composition described herein. The term “lyoprotectant” as used herein, includes agents that provide stability to the strain during the freeze-drying or dehydration process (primary and secondary freeze-drying cycles), by providing an amorphous glassy matrix and by binding with the strain's surface through hydrogen bonding, replacing the water molecules that are removed during the drying process. This helps to minimize product degradation during the lyophilization cycle, and improve the long-term product stability. Non-limiting examples of lyoprotectants include sugars, such as sucrose or trehalose; an amino acid, such as monosodium glutamate, non-crystalline glycine or histidine; a methylamine, such as betaine; a lyotropic salt, such as magnesium sulfate; a polyol, such as trihydric or higher sugar alcohols, e.g., glycerin, erythritol, glycerol, arabitol, xylitol, sorbitol, and mannitol; propylene glycol; polyethylene glycol; pluronics; and combinations thereof. The amount of lyoprotectant added to a pharmaceutical composition is generally an amount that does not lead to an unacceptable amount of degradation of the strain when the pharmaceutical composition is lyophilized.
(40) In some embodiments, a bulking agent is included in the pharmaceutical composition. The term “bulking agent” as used herein, includes agents that provide the structure of the freeze-dried product without interacting directly with the pharmaceutical product. In addition to providing a pharmaceutically elegant cake, bulking agents may also impart useful qualities in regard to modifying the collapse temperature, providing freeze-thaw protection, and enhancing the strain stability over long-term storage. Non-limiting examples of bulking agents include mannitol, glycine, lactose, and sucrose. Bulking agents may be crystalline (such as glycine, mannitol, or sodium chloride) or amorphous (such as dextran, hydroxyethyl starch) and are generally used in formulations in an amount from 0.5% to 10%.
(41) Other pharmaceutically acceptable carriers, excipients, or stabilizers, such as those described in Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980) may also be included in a pharmaceutical composition described herein, provided that they do not adversely affect the desired characteristics of the pharmaceutical composition. As used herein, “pharmaceutically acceptable carrier” means any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed and include: additional buffering agents; preservatives; co-solvents; antioxidants, including ascorbic acid and methionine; chelating agents such as EDTA; metal complexes (e.g., Zn-protein complexes); biodegradable polymers, such as polyesters; salt-forming counterions, such as sodium, polyhydric sugar alcohols; amino acids, such as alanine, glycine, glutamine, asparagine, histidine, arginine, lysine, ornithine, leucine, 2-phenylalanine, glutamic acid, and threonine; organic sugars or sugar alcohols, such as lactitol, stachyose, mannose, sorbose, xylose, ribose, ribitol, myoinisitose, myoinisitol, galactose, galactitol, glycerol, cyclitols (e.g., inositol), polyethylene glycol; sulfur containing reducing agents, such as urea, glutathione, thioctic acid, sodium thioglycolate, thioglycerol, [alpha]-monothioglycerol, and sodium thio sulfate; low molecular weight proteins, such as human serum albumin, bovine serum albumin, gelatin, or other immunoglobulins; and hydrophilic polymers, such as polyvinylpyrrolidone.
(42) In a preferred embodiment, the pharmaceutical composition further comprises an adjuvant. Preferably, the adjuvant is selected from the list consisting of Alum Hydroxide, Freund's Incomplete Adjuvant, MF59®, synthetic analogs of dsRNA such as poly(I:C), bacterial LPS, bacterial flagellin, imidazolquinolines, oligodeoxynucleotides containing specific CpG motifs, fragments of bacterial cell walls such as muramyl dipeptide and Quil-A®.
(43) The pharmaceutical composition may be prepared for oral, sublingual, buccal, intravenous, intramuscular, subcutaneous, intraperitoneal, conjunctival, rectal, transdermal, topical and/or inhalation-mediated administration. In a preferred embodiment, the pharmaceutical composition may be a solution which is suitable for intravenous, intramuscular, conjunctival, transdermal, intraperitoneal and/or subcutaneous administration. In another embodiment, the pharmaceutical composition may be a solution which is suitable for sublingual, buccal and/or inhalation-mediated administration routes. In an alternative embodiment, the pharmaceutical composition may be an aerosol which is suitable for inhalation-mediated administration. In a preferred embodiment, the pharmaceutical composition may be prepared for subcutaneous and/or intraperitoneal administration.
(44) The pharmaceutical composition may further comprise common excipients and carriers which are known in the state of the art. For solid pharmaceutical compositions, conventional nontoxic solid carriers may be used which include, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium carbonate, and the like. For solution for injection, the pharmaceutical composition may further comprise cryoprotectants, lyoprotectants, surfactants, bulking agents, anti-oxidants, stabilizing agents and pharmaceutically acceptable carriers. For aerosol administration, the pharmaceutical compositions are generally supplied in finely divided form along with a surfactant and propellant. The surfactant must, of course, be nontoxic, and is generally soluble in the propellant. Representative of such agents are the esters or partial esters of fatty acids containing from 6 to 22 carbon atoms, such as caproic, octanoic, lauric, palmitic, stearic, linoleic, linolenic, olesteric and oleic acids with an aliphatic polyhydric alcohol or its cyclic anhydride. Mixed esters, such as mixed or natural glycerides may be employed. A carrier can also be included, as desired, as with, e.g., lecithin for intranasal delivery. For suppositories, traditional binders and carriers may include, for example, polyalkalene glycols or triglycerides.
(45) In a preferred embodiment, the pharmaceutical composition is a vaccine capable of inducing an immune response. The design of pharmaceutical compositions for vaccines is well established, and is described, for example, in Remington's Pharmaceutical Sciences, latest edition, Mack Publishing Co., Easton, Pa., and in Plotkin and Orenstein's book entitled Vaccines, 4th Ed., Saunders, Philadelphia, Pa. (2004).
(46) Medical Uses of the Modified Rev1 Strain
(47) In a third aspect, the strain or pharmaceutical composition of the present invention can be used as a medicament. In a fourth aspect, the modified strain or pharmaceutical composition of the present invention can be used to treat and/or prevent brucellosis.
(48) In a preferred embodiment, the infectious agent causing brucellosis is selected from the group consisting of B. abortus, B. melitensis, B. suis, B. ovis, B. canis, B. neotomae, B. microti, B. ceti and B. pinnipedialis. Preferably, the infectious agent causing brucellosis is selected from the group consisting of B. abortus, B. melitensis and B. ovis.
(49) In a preferred embodiment, the strain or pharmaceutical composition is used to treat and/or prevent brucellosis in humans, cattle, goats, sheep, pigs, and/or dogs. Preferably, the strain or pharmaceutical composition is used to treat and/or prevent brucellosis in goats and/or sheep.
(50) In a preferred embodiment, the individual or animal is inoculated with at least 10.sup.4 CFU (colony forming units) of the strain. Preferably, the individual or animal is inoculated with at least 10.sup.5, 10.sup.6, 10.sup.7, 10.sup.8, 10.sup.9, 10.sup.10, 10.sup.11 or 10.sup.12 CFU of the strain. More preferably, the individual or animal is inoculated with at least 10.sup.9 CFU of the strain. In an alternative embodiment, the individual or animal is inoculated with 10.sup.4 to 10.sup.12 CFU of the strain.
(51) In a preferred embodiment, the strain or pharmaceutical composition is administered subcutaneously, intradermally, intravenously, intraperitoneally, by mucosae and/or conjunctively. Preferably, the strain or pharmaceutical composition is administered subcutaneously. In an alternative embodiment, the pharmaceutical composition is administered via a conjunctival administration.
(52) In a preferred embodiment, the strain or pharmaceutical composition is used to prevent brucellosis. In this embodiment, the strain or pharmaceutical is administered as a prophylactic vaccine. Preferably, the strain or pharmaceutical composition is administered to an individual or animal who/which is at risk of becoming infected with bacteria of the genus Brucella.
(53) In one embodiment, the modified strain or pharmaceutical composition is used to treat brucellosis. In a preferred embodiment, the treatment of brucellosis also involves the administration of a drug. Embodiments where the drug is administered at the same time or at different times as the modified strain or pharmaceutical composition are also envisioned. The drug may be selected from the group consisting of corticosteroids, penicillins, cephalosporins, macrolides, chloramphenicol, tetracyclines, aminoglycosides, trimethoprim, rifampin, quinolones and sulfamethoxazole.
(54) Kit Comprising the Modified Rev1 Strain
(55) In a fifth aspect, the present invention provides a kit comprising (i) a modified B. melitensis Rev1 strain, wherein the wzm gene has been inactivated and (ii) a pharmaceutically acceptable carrier or diluent.
(56) The modified strain may be in accordance with any of the aforementioned embodiments outlined in this application. Further, the pharmaceutically acceptable carrier or diluent may be any of the aforementioned pharmaceutically acceptable carriers or diluents described in this application. In a preferred embodiment, the kit comprises instructions on how to combine the strain with the pharmaceutically acceptable carrier or diluent.
(57) In a preferred embodiment, the modified strain is a lyophilisate. The lyophilisate may be contained in a separate container from the pharmaceutically acceptable carrier or diluent. Further, the kit may comprise instructions on how to combine the lyophilized strain with the pharmaceutically acceptable carrier or diluent.
(58) In a preferred embodiment, the kit may further comprise an adjuvant. Preferably the adjuvant is selected from a list consisting of Alum, Freund's Incomplete Adjuvant, MF59, synthetic analogs of dsRNA such as poly(I:C), bacterial LPS, bacterial flagellin, imidazolquinolines, oligodeoxynucleotides containing specific CpG motifs, fragments of bacterial cell walls such as muramyl dipeptide and Quil-A®.
(59) In a preferred embodiment, the instructions included with the kit may also outline the administration of the strain to an individual or animal. The outline of the administration may include the dosage to be used, the frequency of administration and/or the administration route to be used.
(60) In a sixth aspect, the present invention provides the use of any of the described kits for the treatment and/or prevention of brucellosis. The use of the kit may be in line with any of the medical uses and methods of administration outlined in this application.
(61) Modified B. melitensis 16M Strain
(62) In a seventh aspect, the present application provides a modified B. melitensis 16M strain, wherein the wzm gene has been inactivated.
(63) “B. melitensis 16M” is well characterized and freely available at the American Type Culture Collection (ATCC 23456).
(64) The wzm gene may be inactivated through any form of genetic modification known in the art. The inactivation may involve the partial or complete deletion of the gene from the host genome. The inactivation may involve a single none-sense mutation which renders the expressed protein non-functional. The inactivation may involve the mutation and/or deletion of the promoter, ribosome binding site or other transcriptional regulators which are involved in the transcription of the wzm gene. The inactivation may involve the insertion of a sequence which causes a frame shift and/or makes the resultant nascent protein non-functional. Any of the aforementioned deletions, insertions or mutations can be performed using allelic exchange (Hmelo et al., 2015. Nature Protocols, 10(11): 1820-41) or by using the CRISPR/Cas9 system (Wang et al., 2016. ACS Synthetic Biology, 5(7): 721-32). In a preferred embodiment, the wzt gene is not inactivated.
(65) In a preferred embodiment, the inactivation of the wzm gene is due to a partial deletion of the gene. Preferably, the partial deletion involves the deletion of at least 50, 60 or 70% of SEQ ID NO: 1. More preferably, the partial deletion involves the deletion of at least 80% of SEQ ID NO: 1. In a preferred embodiment, the inactivation of the wzm gene is not achieved by inserting a transposon into the coding sequence of the gene.
(66) In a preferred embodiment, the inactivation of the wzm gene is achieved through the deletion of nucleotides 80-721 of SEQ ID NO: 1.
(67) In a preferred embodiment, the modified B. melitensis 16M strain has been further modified to inactivate znuA, norD, bip, tcpB, cgs, ricA, bvrR, bvrS, one or more of the genes encoding the virB type IV secretion system selected from the group consisting of the B. melitensis 16M ORFs: BMEII0025, BMEII0026, BMEII0027, BMEII0028, BMEII0029, BMEII0030, BMEII0031, BMEII0032, BMEII0033, BMEII0034, and BMEII0035, and/or one or more of the genes involved in the formation, modification and/or assembly of LPS and/or metabolic pathways, including but not limited to ppdK, wbdR, gmd, manA, manB, manC, per, pgm, wbkA, wbkB, wbkC, wbkD, wbkF, wadC, and wzt (chromosomic regions wbk, wbo and wad).
(68) In a preferred embodiment, the modified B. melitensis 16M strain has been further modified so that the autologous N-formyltransferase activity has been suppressed and a heterologous gene encoding a N-acyltransferase other than a N-formyltransferase enzyme is functionally expressed. For example, the wbkC may be inactivated and a heterologous wbdR may be introduced and expressed in the strain (see WO 2017/108515 A1).
(69) In a preferred embodiment, the modified B. melitensis 16M strain has been further modified to express a fluorescent protein, preferably GFP. The expression of the fluorescent protein in the modified strain could be used to further distinguish 16M inoculated individuals or animals from infected individuals or animals (Chacón-Diaz et al., 2011. Vaccine. 29(3): 577-82; EP 2 508 201 A1). Thus, a kit which comprises the modified B. melitensis 16M strain which has been further modified to express a fluorescent protein may further comprise antibodies which bind to the fluorescent protein, and/or the fluorescent protein. Preferably, the fluorescent protein is GFP.
(70) In a preferred embodiment, the strain has been lyophilized. Lyophilization can be used to increase the stability and shelf-life of the strain.
(71) In an eighth aspect, the present invention provides a pharmaceutical composition which comprises the modified strain in accordance with any of the previously disclosed embodiments and a pharmaceutically acceptable carrier or diluent and/or a pharmaceutically acceptable adjuvant.
(72) In a preferred embodiment, the pharmaceutical composition comprises the modified B. melitensis 16M strain which has been further modified to express a fluorescent protein.
(73) A pharmaceutical composition as described herein may also contain other substances. These substances include, but are not limited to, cryoprotectants, lyoprotectants, surfactants, bulking agents, anti-oxidants, and stabilizing agents. In some embodiments, the pharmaceutical composition may be lyophilized.
(74) In one embodiment, a lyoprotectant is added to a pharmaceutical composition described herein. In some embodiments, a bulking agent is included in the pharmaceutical composition. Other pharmaceutically acceptable carriers, excipients, or stabilizers, such as those described in Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980) may also be included in a pharmaceutical composition described herein, provided that they do not adversely affect the desired characteristics of the pharmaceutical composition.
(75) In a preferred embodiment, the pharmaceutical composition further comprises an adjuvant. Preferably, the adjuvant is selected from the list consisting of Alum, Freund's Incomplete Adjuvant, MF59®, synthetic analogs of dsRNA such as poly(I:C), bacterial LPSs, bacterial flagellin, imidazolquinolines, oligodeoxynucleotides containing specific CpG motifs, fragments of bacterial cell walls such as muramyl dipeptide and Quil-A®.
(76) The pharmaceutical composition may be prepared for oral, sublingual, buccal, intravenous, intramuscular, subcutaneous, intraperitoneal, conjunctival, rectal, transdermal, topical and/or inhalation-mediated administration. In a preferred embodiment, the pharmaceutical composition may be a solution which is suitable for intravenous, intramuscular, conjunctival, transdermal, intraperitoneal and/or subcutaneous administration. In another embodiment, the pharmaceutical composition may be a solution which is suitable for sublingual, buccal and/or inhalation-mediated administration routes. In an alternative embodiment, the pharmaceutical composition may be an aerosol which is suitable for inhalation-mediated administration. In a preferred embodiment, the pharmaceutical composition may be prepared for subcutaneous and/or intraperitoneal administration.
(77) The pharmaceutical composition may further comprise common excipients and carriers which are known in the state of the art. For solid pharmaceutical compositions, conventional nontoxic solid carriers may be used which include, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium carbonate, and the like. For solution for injection, the pharmaceutical composition may further comprise cryoprotectants, lyoprotectants, surfactants, bulking agents, anti-oxidants, stabilizing agents and pharmaceutically acceptable carriers. For aerosol administration, the pharmaceutical compositions are generally supplied in finely divided form along with a surfactant and propellant. The surfactant must, of course, be nontoxic, and is generally soluble in the propellant. Representative of such agents are the esters or partial esters of fatty acids containing from 6 to 22 carbon atoms, such as caproic, octanoic, lauric, palmitic, stearic, linoleic, linolenic, olesteric and oleic acids with an aliphatic polyhydric alcohol or its cyclic anhydride. Mixed esters, such as mixed or natural glycerides may be employed. A carrier can also be included, as desired, as with, e.g., lecithin for intranasal delivery. For suppositories, traditional binders and carriers may include, for example, polyalkalene glycols or triglycerides.
(78) In a preferred embodiment, the pharmaceutical composition is a vaccine capable of inducing an immune response. The design of pharmaceutical compositions for vaccines is well established, and is described, for example, in Remington's Pharmaceutical Sciences, latest edition, Mack Publishing Co., Easton, Pa., and in Plotkin and Orenstein's book entitled Vaccines, 4th Ed., Saunders, Philadelphia, Pa. (2004).
(79) Medical Uses of the Modified 16M Strain
(80) In a ninth aspect, the strain or pharmaceutical composition of the present invention can be used as a medicament. In a tenth aspect, the modified strain or pharmaceutical composition of the present invention can be used to treat and/or prevent brucellosis.
(81) In a preferred embodiment, the infectious agent causing brucellosis is selected from the group consisting of B. abortus, B. melitensis, B. suis, B. ovis, B. canis, B. neotomae, B. microti, B. ceti and B. pinnipedialis. Preferably, the infectious agent causing brucellosis is selected from the group consisting of B. abortus, B. melitensis and B. ovis.
(82) In a preferred embodiment, the strain or pharmaceutical composition is used to treat and/or prevent brucellosis in humans, cattle, goats, sheep, pigs, and/or dogs. Preferably, the strain or pharmaceutical composition is used to treat and/or prevent brucellosis in goats and/or sheep.
(83) In a preferred embodiment, the individual or animal is inoculated with at least 10.sup.4 CFU (colony forming units) of the strain. Preferably, the individual or animal is inoculated with at least 10.sup.5, 10.sup.6, 10.sup.7, 10.sup.8, 10.sup.9, 10.sup.10 or 10.sup.11 CFU of the strain. More preferably, the individual or animal is inoculated with at least 10.sup.9 CFU of the strain. In an alternative embodiment, the individual or animal is inoculated with 10.sup.4 to 10.sup.12 CFU of the strain.
(84) In a preferred embodiment, the strain or pharmaceutical composition is administered subcutaneously, intradermally, intravenously, intraperitoneally, by mucosae and/or conjunctively. Preferably, the strain or pharmaceutical composition is administered subcutaneously. In an alternative embodiment, the pharmaceutical composition is administered via a conjunctival administration.
(85) In a preferred embodiment, the strain or pharmaceutical composition is used to prevent brucellosis. In this embodiment, the strain or pharmaceutical is administered as a prophylactic vaccine. Preferably, the strain or pharmaceutical composition is administered to an individual or animal who/which is at risk of becoming infected with bacteria of the genus Brucella.
(86) In a preferred embodiment, the strain or pharmaceutical composition is used to treat brucellosis. In this embodiment, the strain or pharmaceutical is administered as a therapeutic vaccine. Preferably, the strain or pharmaceutical composition is administered to an individual or animal who/which suffers an infection from bacteria of the genus Brucella.
(87) Kit Comprising the Modified 16M Strain
(88) In an eleventh aspect, the present invention provides a kit comprising (i) a modified B. melitensis 16M strain wherein the wzm gene has been inactivated; and (ii) a pharmaceutically acceptable carrier or diluent.
(89) The modified strain may be in accordance with any of the aforementioned embodiments outlined in this application. Further, the pharmaceutically acceptable carrier or diluent may be any of the aforementioned pharmaceutically acceptable carriers or diluents described in this application. In a preferred embodiment, the kit comprises instructions on how to combine the strain with the pharmaceutically acceptable carrier or diluent.
(90) In a preferred embodiment, the modified strain is a lyophilisate. The lyophilisate may be contained in a separate container from the pharmaceutically acceptable carrier or diluent. Further, the kit may comprise instructions on how to combine the lyophilized strain with the pharmaceutically acceptable carrier or diluent.
(91) In a preferred embodiment, the kit may further comprise an adjuvant. Preferably the adjuvant is selected from a list consisting of Alum, Freund's Incomplete Adjuvant, MF59, synthetic analogs of dsRNA such as poly(I:C), bacterial LPSs, bacterial flagellin, imidazolquinolines, oligodeoxynucleotides containing specific CpG motifs, fragments of bacterial cell walls such as muramyl dipeptide and Quil-A®.
(92) In a preferred embodiment, the instructions included with the kit may also outline the administration of the strain to an individual or animal. The outline of the administration may include the dosage to be used, the frequency of administration and/or the administration route to be used.
(93) In a twelfth aspect, the present invention provides the use of any of the described kits for the treatment and/or prevention of brucellosis. The use of the kit may be in line with any of the medical uses and methods of administration outlined in this application.
(94) PCR-Multiplex Diagnostic Kit
(95) In a thirteenth aspect, the present invention provides a kit for the identification of Brucella strains which comprise a partial or complete deletion of wzm. In a preferred embodiment, the kit comprises a forward and reverse primer which anneal to the regions flanking the wzm in the genome of a species of the genus Brucella. Preferably, the kit comprises SEQ ID NO: 2 as the forward primer and, SEQ ID NO: 3 and/or SEQ ID NO: 4 as the reverse primer(s). The primer sets may amplify an amplicon of about 1,573 bp (F1 and R4; AMP NO: 1) or about 724 bp (F1 and R5; AMP NO: 2) in Rev1 or 16M wild type strain; or a band of 931 bp (F1 and R4; AMP NO: 3) in the Δwzm mutants (Table 1). Since the identity between BMEI1415 and the corresponding orthologs in other Brucella species is at least 99.6%, this kit could be used to differentiate the wild type Brucella strains and BrucellaΔwzm mutants.
EXAMPLES
Example 1
Culturing of E. coli and Brucella Strains
(96) All strains were preserved in cryovials at −20° C., harvesting bacterial cultures in skimmed milk supplemented with 3% sterile lactose (Applichem Panreac) or with 20-40% glycerol (v/v).
(97) To prepare suspensions with known concentration of Brucella, a preculture from a cryovial was prepared by growing bacteria onto a Blood Agar Base number 2 (Oxoid) plate, either plain (BAB) or supplemented with 5% Fetal Bovine Serum (Gibco) (BAB-S) for B. ovis. After incubation (3-5 days, at 37° C., and in atmosphere supplemented with 10% CO.sub.2 for B. ovis) of this preculture, 2-3 colonies from BAB or BAB-S plates were transferred onto fresh BAB or BAB-S plates and incubated for 2 days as before. The grown colonies were harvested in sterile PBS pH 6.85 to obtain a concentrated suspension of bacteria, which was diluted in the same diluent up to obtain a suspension with around 0.170 units of absorbance at Optical Density of 600 nm adjusted by spectrophotometry. In our conditions, this suspension contains around 10.sup.9 CFU/mL. The exact number of bacteria was always determined retrospectively by serial dilutions in PBS, plating (100 μL by triplicate) and incubation of plates for 3-5 days at 37° C. The number of CFU/mL was calculated.
(98) For the liquid culture of Brucella, 4-5 colonies of a BAB or BAB-S plate were inoculated into a trypticase soy broth (TSB, Pronadisa) and were incubated overnight at 37° C. and 150 rpm.
(99) E. coli was cultured in Luria Bertani (LB, Pronadisa) broth or on LB agar plates. E. coli cultures were incubated at 37° C.
(100) Appropriate concentrations of antibiotics were included in the agar plates and cultures for selection. All antibiotics were purchased from Sigma.
Example 2
Sequencing of the wzm Gene
(101) The genome of Rev1 was extracted using the PureLink™ Microbiome DNA Purification Kit (Thermo Fisher Scientific). The wzm gene was amplified using primers F1 gcaaattgaaatggcagatg and R4 atgaaacgtggcgttagtcc (Table 1) and the PCR product was purified using a QIAquick PCR purification kit (Qiagen) and sequenced by Sanger method.
(102) The resultant sequence is AMP NO: 1 (Table 1) including the SEQ ID NO: 1 described in the present application. This sequence in Rev1 is identical to that of the wzm gene in the B. melitensis 16M virulent strain (Genbank: CP007763.1) as well as 99.6% identity to that of B. abortus 2308 (Genbank: NC_007618) and vaccine S19 (Genbank: CP000887.1).
(103) According to sequencing, the same allelic exchange plasmid can be used to partially delete wzm in both B. melitensis (16M and Rev1 strains) and B. abortus (2308 and S19 strains) species.
(104) TABLE-US-00002 TABLE 1 Amplicon Numbers (AMP NO) used in this work and the correspondent DNA fragment size obtained by sequencing or by PCR with the indicated primer pairs with DNA from wild-type wzm or Δwzm genes. DNA PCR AMP amplicon primer Primers nucleotide NO: size pairs* sequence (5′-3′) 1 1,573 bp F1/R4 F1: gcaaattgaaatggca (in wt) gatg (SEQ ID NO: 2) R4: atgaaacgtggcgtta gtcc (SEQ ID NO: 3) 2 724 bp F1/R5 F1: gcaaattgaaatggca gatg (SEQ ID NO: 2) R5: gcgtgtaaattgcaag agga (SEQ ID NO: 4) 3 931 bp F1/R4 F1: gcaaattgaaatggca (in Δwzm) gatg (SEQ ID NO: 2) R4: atgaaacgtggcgtta gtcc (SEQ ID NO: 3) 4 484 bp F1/R2 F1: gcaaattgaaatggca gatg (SEQ ID NO: 2) R2: agcgcccacgtaaatc ag (SEQ ID NO: 5) 5 465 bp F3/R4 F3: ctgatttacgtgggcg cttaacctgcgtggcagtag c (SEQ ID NO: 6) R4: atgaaacgtggcgtta gtcc (SEQ ID NO: 3) 6 319 bp F9/R5 F9: atgatatcgtatatgg ctaatg (SEQ ID NO: 7) R5: gcgtgtaaattgcaag agga (SEQ ID NO: 4) 7 816 bp rrnBP1- rrnBP1-F: gttgcgcggt F/Gfp_F- cagaaaattatttta R2 (SEQ ID NO: 8) Gfp_F-R2: ttatttgtat agttcatccatgcca (SEQ ID NO: 9) *F: forward; R: reverse.
Example 3
Cloning of Allelic Exchange Plasmids
(105) All the BrucellaΔwzm strains were constructed via a double recombination event using the allelic exchange plasmid pJQKm-Δwzm (
(106) The genome of Brucella strains was extracted and purified using a PureLink™ Microbiome DNA Purification Kit (Thermo Fisher Scientific). Alternatively, the DNA was extracted by re-suspending the bacteria in ultrapure water and boiling the suspension (100° C., 20 minutes) and then centrifuging (4,000 rpm, 10 minutes). DNA was recovered by collecting the supernatant.
(107) To clone the allelic exchange plasmid for the partial deletion of wzm, a 484 bp fragment (AMP NO: 4, Table 1) was amplified using PCR with the primers F1 gcaaattgaaatggcagatg and R2 agcgcccacgtaaatcag (AMP NO: 3, Table 1). A 465 bp fragment (AMP NO: 5, Table 1) was amplified using PCR and primers F3 ctgatttacgtgggcgcttaacctgcgtggcagtagc and R4 atgaaacgtggcgttagtcc (Table 1). The two PCR products were combined by using overlap extension PCR and the full-length product was amplified using F1 gcaaattgaaatggcagatg and R4 atgaaacgtggcgttagtcc to produce the Δwzm cassette (
(108) The pJQKm suicide vector has been described previously (Scupham and Triplett, 1997. Gene, 202, 53-59). The pCR2.1Δwzm and pJQKm were digested using BamHI and XbaI and the Δwzm insert and pJQKm vector were gel extracted and purified. The Δwzm insert and pJQKm vector were ligated using a T4 DNA ligase resulting in the allelic exchange plasmid pJQKmΔwzm.
(109) To insert gfp into the genome of the B. melitensis strains, the mini-Tn7 system was used by adaptation of the method described previously (Choi et al, 2005. Nature Methods, 2(6):443-8). The constitutive gfp expression was controlled by the rrnB P1 promoter contained in the fragment rrnB P1-gfp. The rrnB P1-gfp construct was extracted from the plasmid pUC18T-mini-Tn7-gfp-Gm.sup.r (GenBank: DQ493877.2). Thus, the rrnB P1-gfp fragment was amplified with the primers rrnBP1-F gttgcgcggtcagaaaattatttta and Gfp_F-R2 ttatttgtatagttcatccatgcca (AMP NO: 7) and cloned into a pCR2.1 plasmid using the manufacturer's instructions (TOPO® TA Cloning®, Thermo Fisher Scientific), and then subcloned into pUC18R6KT-mini-Tn7-Km.sup.r resistant to 50 μg/mL kanamycin (Km.sup.r) (Llobet et al, 2009. Antimicrobial Agents and Chemotherapy, 53(1): 298-302) using EcoRI. This resulted in the plasmid pUC18R6KT-mini-Tn7-gfp (Table 1).
Example 4
Conjugation of E. coli with Brucella Strains and PCR Assessment of Mutants
(110) The pUC18R6KT-mini-Tn7-gfp or pJQKmΔwzm were transformed into E. coli S17 (λpir) and the plasmids were transferred into the receiving Brucella strains via conjugation. In the case of the partial deletion of wzm using the pJQKmΔwzm allelic exchange plasmid, 1 mL of overnight liquid culture of B. melitensis was cultured with 0.5 mL of overnight liquid cultures of E. coli S17 (λpir)-pJQKmΔwzm.
(111) For BrucellaΔwzm strains, the selection of transconjugants after the first recombination (integration of the suicide vector in the chromosome) was selected by growing the bacteria in BAB supplemented with 50 μg/mL kanamycin (Km.sup.r) and susceptibility to 5% sucrose (Sac.sup.s). The second recombination (excision of the mutator plasmid and leading to construction of the mutant strain by allelic exchange) was selected by sucrose resistance and kanamycin sensitivity (
(112) In all cases, three clones of each mutant and one sibling strain (i.e., submitted to the same subcultures than the correspondent mutant;
(113) A Rev1 strain containing the partial deletion (82%) of the wzm gene was identified and called Rev1Δwzm. This strain was also deposited at a depository in accordance with the Budapest Treaty.
(114) BrucellaΔwzm mutants were complemented by conjugation with the donor E. coli S17pBBR-wzm or E. coli S17pSRK-wzm. The complemented strains were selected on BAB plates supplemented with 20 μg/mL of chloramphenicol (BAB-Cm.sub.20) or 50 μg/mL of kanamycin (BAB-Km.sub.50) allowing the selection of conjugants carrying the non-integrative plasmid pBBR-wzm or pSRKwzm, respectively. Transconjugants were checked by PCR (
Example 5
Phenotypic Characterization of the BrucellaΔwzm Mutants
(115) The selected clones of Δwzm mutants were analyzed by the classical markers for Brucella typing following the standard protocols (Alton et al., 1988. Techniques for the Brucellosis. Laboratory Paris: INRA) of crystal violet-oxalate exclusion, catalase, oxidase, urease and acriflavine tests (all from Sigma Aldrich), sensitivity to Tb, Wb, Iz and R/C phages, agglutination with anti-A and anti-M monospecific sera, both CO.sub.2- and serum-dependence, susceptibility to dyes (i.e., thionine blue 10, 20 and 40 μg/mL, fuchsine 10 and 20 μg/mL, and safranin 100 μg/mL; Sigma) and to the antibiotics penicillin 5 mg/mL (P.sub.5) and streptomycin 2.5 μg/mL (Str.sub.2.5), as shown in Table 2.
(116) Moreover, Rev1Δwzm, 16MΔwzm, 2308Δwzm and S19Δwzm strains showed a R-LPS phenotype, regarding positive staining with crystal violet-oxalate technique (
(117) Also, the LPS structure of all Δwzm mutants and complemented strains was studied by SDS-PAGE and silver staining modified for LPS. As shown in
(118) Besides PCR assessment (see Example 4,
(119) TABLE-US-00003 TABLE 2 Phenotypic characterization of Rev1Δwzm, 16MΔwzm, 230SΔwzm and S19Δwzm Agglutination with Growth in dyes in BAB-S CO.sub.2 Catalse/ Acriflavine Sera presence/absence of CO.sub.2 Phage lysis depen- Oxidase/ and crystal anti- Thionine Basic fuchsine Safranin STRAIN Tb Wb Iz R/C dent Urease violet staining A M 10 20 40 10 20 100 16M — — −2 — — +/+/+ −/− − + +/+ +/− −/− +/+ +/+ +/+ 16MΔwzm — — — −3 — +/+/+ +/+ − − +/+ +/− −/− +/+ +/+ +/− Rev1 — — 0 — — +/+/+ −/− − + +/+ +/− −/− +/+ +/− +/− Rev1Δwzm — — — −4 — +/+/+ +/+ − − +/+ −/− −/− +/+ +/+ −/− 2308 −3 −4 −4 — — +/+/+ −/− + − −/− −/− −/− +/+ +/+ +/+ 2308Δwzm ND ND ND ND — +/+/+ +/+ − − −/− −/− −/− −/− +/+ +/+ S19 −3 −3 −2 — — +/+/+ −/− + − −/− −/− −/− +/+ +/+ +/+ S19Δwzm — — — −3 — +/+/+ +/+ − − −/− −/− −/− +/+ +/+ +/+ ND: Not Determined
Example 6
Deletion of wzm in Rev1Δwzm and 16MΔwzm is Stable After Subcultures In Vitro and In Vivo in Mice
(120) BrucellaΔwzm mutants were subcultured for 20 consecutive passages in BAB plates by transferring colonies onto fresh plates every 3-4 days, after the plates were incubated at 37° C. Besides analysis of these cultures, the grown bacteria were kept for 2 months at 4° C. to assess their stability after storage. Moreover, representative number of CFU isolated from mice spleens in the experiments described in Examples 12 and 13 were selected for stability assessment.
(121) Each selected culture was analyzed for the presence of the deletion by PCR with primers F1 gcaaattgaaatggcagatg and R4 atgaaacgtggcgttagtcc, allowing DNA amplification in both wt and Δwzm bacteria (Table 1), and by phenotypic analysis, i.e., colony size after incubation at 37° C. and crystal violet-oxalate staining. Finally, inocula containing 2×10.sup.3 CFU/mL were adjusted by spectrophotometry and plated in triplicate (3×100 μL) in five plates, in order to analyses the colony size after 5 days of incubation at 37° C. and colony phase by crystal violet staining in around 3,000 CFU.
(122) All the colonies analyzed showed the expected genotype and phenotype, indicating that the genetic modification is stable.
Example 7
The Growth of 16MΔwzm but not Rev1Δwzm is Inhibited by the Presence of 10% CO.SUB.2 .in the Atmosphere of Incubation. This Defect is Restored by Growing in Agar Supplemented with Bovine Foetal Sera
(123) Bacterial growth of Δwzm mutants were studied in BAB plates incubated in normal atmosphere or supplemented with 10% CO.sub.2. For this, 100 μL of bacterial suspensions containing ≈5×10.sup.2 CFU/mL were plated in triplicate, and the number of CFU/100 μL determined after incubation (3-5 days, 37° C.). Moreover, 16MΔwzm was analyzed to determine the frequency of inhibition (i.e., the number of CFU/mL isolated after CO.sub.2 incubation with respect to the number of CFU/mL isolated after incubation in normal atmosphere) by seeding all the bacterial dilutions prepared in both BAB and BAB-S. Each counting was repeated three times. Results are presented as mean±standard deviation (n=9) of individual counts. Statistical comparisons of means were performed by a one-way ANOVA and PLSD tests.
(124) As shown in Table 3, 16MΔwzm but not Rev1Δwzm was unable to growth in BAB under CO.sub.2 incubation conditions.
(125) TABLE-US-00004 TABLE 3 Growth in BAB plates incubated in normal atmosphere or supplemented with 10% CO.sub.2. Number of CFU/100 μL of bacterial suspensions containing ≈5 × l0.sup.2 CFU/mL. Mean and standard deviation of three experiments by triplicate plating of 100 μL in BAB. No. CFU/100 μL (mean ± SD) Strain Normal atmosphere 10% CO.sub.2 Rev1 70.1 ± 5.4 62.9 ± 8.3 Rev1-sibling 53.8 ± 3.0 61.8 ± 4.5 Rev1Δwzm 42.3 ± 2.3 28.6 ± 4.2 Rev1Δwzm::gfp 37.7 ± 2.4 21.5 ± 1.3 16M 57.9 ± 2.8 67.8 ± 2.5 16M-sibling 50.5 ± 1.8 73.1 ± 3.1 16MΔwzm 31.7 ± 3.5 0 .sup.a 16MΔwzm::gfp 21.4 ± 1.5 0 .sup.a .sup.a PLSD tests: p < 0.0001 vs. normal atmosphere and vs. 16M and Rev1 sibling strains
(126) The frequency of inhibition of 16MΔwzm after incubation of BAB plates in CO.sub.2-atmosphere was of 1-0.39×10.sup.−2 CFU/mL. This phenotype did not occur when 16MΔwzm was cultured in BAB-S plates (Table 4).
(127) TABLE-US-00005 TABLE 4 Inhibition frequency of 16MΔwzm and 16MΔwzm::gfp in BAB and BAB-S plates incubated in atmosphere normal or supplemented with a 10% CO.sub.2. CFU/mL 10% CO.sub.2 Normal (Inhibition Strain atmosphere frequency) 16M BAB 4.3 × 10.sup.8 4.2 × 10.sup.8 (1 × 10.sup.0) BAB-S 4.9 × 10.sup.8 4.2 × 10.sup.8 (1 × 10.sup.0) 16M sibling BAB 5.4 × 10.sup.8 6.2 × 10.sup.8 (1 × 10.sup.0) BAB-S 6.6 × 10.sup.8 6.2 × 10.sup.8 (0.9 × 10.sup.0) 16MΔwzm BAB 4.3 × 10.sup.8 4.4 × 10.sup.6 (1 × 10.sup.−2) BAB-S 3.4 × 10.sup.8 4.5 × 10.sup.8 (1 × 10.sup.0) 16MΔwzm::gfp BAB 4.1 × 10.sup.8 1.6 × 10.sup.6 (0.39 × 10.sup.−2) BAB-S 3.9 × 10.sup.8 4.5 × 10.sup.8 (1 × 10.sup.0)
Example 8
Rev1Δwzm is More Susceptible to Streptomycin than Rev1
(128) In contrast to other Brucella species such as B. melitensis 16M, and B. abortus 2308 and S19, Rev1 presents a relative resistance to 2.5 μg/mL of streptomycin (Str.sub.2.5) when incubated in normal atmosphere (in 10% CO.sub.2 all the B. melitensis strains show similar resistance). This relative resistance to Str.sub.2.5 in vitro is directly related to the inefficiency of streptomycin-based treatments (an antibiotic of choice in humans) against Rev1 infections in both humans and in animal models (Grilló et al. 2006. J Antimic Chemother. 58 (3):622-626).
(129) To assess this property in Rev1Δwzm, bacterial suspensions containing ≈2×10.sup.3 CFU/mL were prepared in PBS and cultured by plating 100 μL in triplicate in BAB and BAB supplemented with Str.sub.2.5 (BAB-Str.sub.2.5). The Rev1 sibling strain was used as control. Plates were incubated at 37° C., for 5 days, in normal atmosphere and the mean±standard deviation (n=3) number of CFU/mL was determined. The experiment was repeated three times. Statistical comparisons of means were performed by ANOVA and PLSD tests.
(130) As result, Rev1Δwzm was more (p<0.001) susceptible to Str.sub.2.5 than Rev1 sibling (
Example 9
16Δwzm is More Susceptible to Desiccation than 16M, and Rev1Δwzm is as Susceptible as Rev1
(131) Desiccation resistance Rev1Δwzm, 16MΔwzm, Rev1 and 16M was tested by aliquoting 200 μL/well of a ≈10.sup.9 CFU/mL suspension in TSB in 12-well polystyrene plates. The suspensions were allowed to dry at room temperature in the dark for 6 days. Then, the pellet was rehydrated in PBS, serially diluted, and plated on BAB plates in order to determine the number and percentage of surviving bacteria.
(132) As can be seen in
Example 10
Rev1Δwzm is More Susceptible than 16MΔwzm to the Bactericidal Cationic Peptides of the Innate Immune System. Both Δwzm Mutants are More Susceptible than Parental or Sibling Strains
(133) Polymyxin B was used as model of bacterial susceptibility to cationic peptides of the innate immune system. For this, exponentially growing Rev1Δwzm or 16MΔwzm were adjusted to 2-3×10.sup.3 CFU/mL in PBS and mixed with different concentrations from 3 to 0.188 mg/mL Polymyxin B in Phosphate Saline Acid buffer (PSA; 0.133M NaCl, 0.1M; NaH.sub.2PO.sub.4, pH 4.6) in 24-well microtiter plates in duplicate. Suspensions (100 μL, in triplicate) were plated in BAB and the number of viable CFU was recorded after incubation for 1 h at 37° C. Both parental and sibling strains were used as controls. Data points represent the mean±standard deviation (n=3) of CFU/mL.
(134)
Example 11
Rev1Δwzm and 16MΔwzm are More Susceptible Than Rev1 and 16M Parental Strains to Conventional Sheep and Cattle Sera
(135) Bacteria in exponential phase were adjusted to a concentration of ≈10.sup.4 CFU/mL in PBS and dispensed in microtiter plates (45 μL/well) by mixing with either normal or decomplemented (1 hour, 56° C.) ovine or bovine sera (90 μL/well). After incubation (18 h, 37° C.), 65 μL of TSB was dispensed into each well, the bacterial suspension mixed, 50 μL/well was plated onto BAB, and plates were incubated (5 days, 37° C.) to determine the number of CFU/mL and the percentage of bacterial survival. A B. melitensis mutant with minimal core was used as positive control (C+) of high susceptibility to normal serum. Results are expressed as the mean±standard deviation (n=3) of survival percentage. Statistical comparisons of means were performed by ANOVA and PLSD tests.
(136) As can be seen in
Example 12
Rev1Δwzm is More Attenuated Than 16MΔwzm in Balb/C Mice
(137) Female BALB/c mice of 7 weeks of age (Charles River Laboratories, Barcelona, Spain) were housed in the animal building of the Instituto de Agrobiotecnologia (registration number ES/31-2016-000002-CR-SU-US) with water and food ad libitum. Animals were randomly allotted and acclimated for 1-2 weeks before the start of the experiments. Animal handling and experimental procedures were in accordance with European (DOCE 86/609/EEC), National (RD 1201/2005) and Regional (Ley 11/2003) directives, and were supervised by the Ethical Committee of the Institution.
(138) Mice were inoculated intraperitoneally with ≈10.sup.8 CFU/mouse of Rev1Δwzm, Rev1Δwzm::gfp, 16MΔwzm or 16MΔwzm::gfp (R-LPS strains) and 10.sup.6 CFU/mouse of Rev1 or 16M sibling strains (S-LPS strains). Additional groups of mice inoculated with ≈10.sup.8 CFU/mouse of S19Δwzm or 2308Δwzm B. abortus mutants and with 10.sup.6 CFU/mouse of S19 or 2308 sibling strains were used to compare the effect of this mutation in different Brucellae backgrounds. At selected intervals, groups of 5 mice were necropsied to determine the number of viable bacteria present in the spleens as well as the spleens weights, as previously reported (Grilló et al., 2012. Veterinary Research, 43 (1): 29). Viable bacteria were identified on BAB plates. The rough identity of the spleen isolates was confirmed by the crystal violet-oxalate staining method as well as by PCR. Results were expressed as the mean±standard deviation (n=5) of individual log CFU/spleen or grams/spleen. Statistical comparison of means was performed by a one-way ANOVA followed by the Fisher Protected Least Significant Differences (PLSD) tests.
(139) As can be seen in
(140) Unexpectedly, the higher attenuation of Rev1Δwzm was accompanied by the induction of a transient splenomegaly that peaked at week 2 post-infection (
(141) The Rev1Δwzm::fp and 16MΔwzm::gfp strains showed similar virulence and splenomegaly than Rev1Δwzm and 16MΔwzm, respectively (
Example 13
Rev1Δwzm Does Not Infect Placentas or Foetuses of Pregnant Mice
(142) CD1 female mice (n=7) at 4.5 days of pregnancy were intraperitoneally infected with ≈7×10.sup.6 CFU/mouse of Rev1Δwzm or 16MΔwzm or with 7×10.sup.5 CFU/mouse of Rev1 or 16M. All mice were sacrificed at term pregnancy to assess macroscopic lesions at necropsy as well as bacteriology of spleen, placenta and foetus samples. The number of viable bacteria (log CFU/organ) in each tissue was determined by plating on BAB. Moreover, the number of pregnant females, the infected placentas, and the dams carrying infected foetuses were recorded.
(143) As can be seen in Table 5, all mice showed well-established infections in spleens at similar levels (4-5 logs) between groups. However, the splenomegaly generated by Rev1Δwzm and 16MΔwzm in pregnant dams were moderate or low, respectively, in contrast to Rev1 and 16M parental strains (Table 5). Surprisingly, Rev1 (and to less extend 16M) induced higher splenomegaly in pregnant (Table 5) than in non-pregnant mice at week 2 (
(144) These levels of infection were accompanied by macroscopic lesions in Rev1 and 16M infected placentas but not in those from dams inoculated with Rev1Δwzm or 16MΔwzm mutants (
(145) TABLE-US-00006 TABLE 5 Spleen, placental and foetal infections, and term pregnancies in CD1 mice infected with Rev1Δwzm, 16MΔwzm, Rev1 or 16M, at day 4.5 of pregnancy and slaughtered 15 days later. Spleen Pregnancy Placenta Fetuses Spleen No. of No. of dams with log CFU/ No. of dams log CFU/ Strain Inoculation log CFU/ weight pregnant/ infected placentas/ gram of with infected gram of B. melitensis Dose/route spleen (grams) total dams pregnant placenta* fetuses/pregnant fetuses* Rev1 (vaccine) 6.0 × 10.sup.5/IP 5.70 ± 0.80 0.89 ± 0.29 10/14 10/10 8.5 ± 0.8 10/10 6.71 ± 0.49 Rev1Δwzm 6.3 × 10.sup.5/IP 4.70 ± 0.80 0.30.sup.1 ± 0.80 12/14 0/12 1.52 ± 0* 0/5 1.52 ± 0.sup.a 16M (virulent) 6.9 × 10.sup.5/IP 4.10 ± 0.50 0.83 ± 0.43 4/14 4/4 6.0 ± 1.42 2/2 6.16 ± 1.21 16MΔwzm 6.5 × 10.sup.5/IP 3.60 ± 0.70 0.16.sup.1 ± 0.08 5/7 0/5 1.32 ± 0* 0/5 1.52 ± 0.sup.a IP: intraperitoneal; .sup.ap < 0.001 vs. 16M (virulent) or Rev1 (vaccine) infected mice; *Limit of Detection = 1.52 logs (i.e. no CFU isolated).
Example 14
Rev1 Δwzm and 16MΔwzm Confer Solid Protection Against S And R Virulent Infections in Mice, Equivalent or Better Than That Conferred by Rev1
(146) Vaccine efficacy of the BrucellaΔwzm mutants was evaluated in 8-10 week-old female BALB/c mice (n=5) by intraperitoneal or subcutaneous vaccination with ≈10.sup.8 CFU/mouse of the corresponding mutant. Mice (n=5) vaccinated subcutaneously with 2×10.sup.5 CFU/mouse of Rev1 or S19 were used as reference vaccinated controls against either B. melitensis H38 and B. ovis PA or B. abortus infections, respectively. Three groups of mice (n=5) inoculated with 0.1 mL of sterile PBS were used as non-vaccinated controls in the corresponding experiment. Four weeks after vaccination, all mice were challenged intraperitoneally with 1×10.sup.4 CFU/mouse of B. melitensis H38::Gm.sup.r, 2×10.sup.5 CFU/mouse of B. ovis BoPA::Gm.sup.r or 5×10.sup.4 CFU/mouse of B. abortus 2308::Gm.sup.r, challenge strains resistant to 15 μg/mL of gentamycin (Gm.sub.15). Finally, the number of virulent bacteria in the spleens were determined at 2 (H38::Gm.sup.r and 2308::Gm.sup.r) and 3 (BoPA::Gm.sup.r) weeks after the challenge by plating each spleen onto BAB-S-Gm.sub.15.
(147) As can be seen in Table 6A, both Rev1Δwzm and 16MΔwzm::gfp mutants showed a degree of protection against a B. melitensis virulent infection similar to that showed by the Rev1 reference vaccine strain, not only by intraperitoneal but also by subcutaneous vaccination. Moreover, both B. melitensis Δwzm mutants conferred a superior protection against B. ovis infection (p<0.001) to that conferred by the Rev1 strain. In contrast, surprisingly, the Δwzm mutation in both B. abortus 2308Δwzm and S19Δwzm strains did not confer adequate protection against B. abortus virulent infection in mice (Table 6B).
(148) TABLE-US-00007 TABLE 6A Efficacy of vaccination against virulent infection by B. melitensis H38 (S-LPS virulent strain) or B. ovis PA (R-LPS virulent strain). Challenge B. ovis PA::Gm.sup.r Vaccination log H38/spleen Challenge H38::Gm.sup.r log PoPA/spleen Uninfected/ Dose/route (mean ± SD) Uninfected.sup.a/totals UP.sup.b (mean ± SD) totals.sup.a UP.sup.b Rev1Δwzm 10.sup.8/IP 1.44 ± 1.28.sup.c 3/5 4.32 0.7 ± 0.00.sup.a 5/5 5.37 10.sup.8/SC 1.93 ± 1.43.sup.c 2/5 3.83 ND 16M Δwzm::gfp 10.sup.8/ IP 1.75 ± 1.52.sup.c 3/5 4.01 0.62 ± 0.05.sup.a 5/5 5.45 10.sup.8/SC 2.05 ± 1.00.sup.c 1/5 3.71 1.91 ± 1.76.sup.a 2/5 4.16 Rev1 2 × 10.sup.5/SC 1.38 ± 1.16.sup.c 3/5 4.37 2.58 ± 1.88.sup.a 2/5 3.49 PBS Control — 5.76 ± 0.58.sup.c 0/5 — 6.07 ± 0.24 .sup.a 0/5 IP: intraperitoneal; SC: subcutaneous; .sup.a<5CFU/spleen; .sup.bUnits of Protection − log CFU/spleen in unvaccinated control − in test group; .sup.cp < 0.001 vs. PBS control by PLSD test. ND: Not Determined
(149) TABLE-US-00008 TABLE 6B Efficacy of vaccination with 2308Δwzm or S19Δwzm against virulent infection by B. abortus2308::Gm.sup.R (S-LPS virulent strain) Challenge 2308::Gm.sup.r Vaccination log 2308/spleen Uninfected/ Vaccine strain Dose/route (mean ± SD) totals* 2308Δwzm 10.sup.8/IP 2.97 ± 1.41 .sup.b 1/5 10.sup.8/SC 4.13 ± 1.08 0/5 S19Δwzm 10.sup.8/IP 4.18 ± 1.91 0/5 S19 10.sup.5/SC 1.57 ± 1.96 .sup.a 4/5 PBS Control — 5.87 ± 0.26 0/5 IP: intraperitoneal; SC: subcutaneous; *<5 CFU/spleen; **Units of Protection = log CFU/spleen in unvaccinated control − in tested group; .sup.a p < 0.001; .sup.b p < 0.05 vs. PBS control by PLSD test
Example 15
Serological Response of Lambs Inoculated with Rev1Δwzm:gfp or 16MΔwzm::gfp vs. Rev1::gfp
(150) Rasa Aragonesa male and female breed lambs born in the experimental flock of the Centro de Investigación y Tecnologia Agroalimentaria (CITA) del Gobierno de Aragón (Zaragoza, Spain) were used in these experiments, at 3-4 months of age. These animals were housed in the authorized facilities of the CITA (registration number ES/50-2970-12005), handled and manipulated according to the FELASA (www.felasa.eu) and ARRIVE (Kilkenny et al., 2010. PLoS Biology, 8: e1000412) recommendations.
(151) Lambs were vaccinated by subcutaneous inoculation of a suspension containing 1-2×10.sup.10 CFU of Rev1Δwzm::gfp (n=14) or 16MΔwzm::gfp (n=8). Groups of lambs non-vaccinated (n=13) or vaccinated with 1-2×10.sup.9 CFU of Rev1::gfp (n=12) were used as controls. Thereafter, innocuousness was assessed by clinical inspection (rectal body temperature and palpation of the inoculation site) for one month after vaccination, and by periodical examination of epididymis and testicles all throughout the experiment. Moreover, blood samples were taken just before vaccination and, thereafter, weekly or every two weeks, by jugular vein puncture by using Venojet® (Terumo) vacuum tubes. After draining at room temperature for 24 h, blood samples were centrifuged at 3,500 rpm for 10 minutes and the resultant serum was conserved at −20° C. until its analysis.
(152) The anti-LPS response was measured using a standard Rose Bengal Test (sRBT) and Complement Fixation Test (CFT), recommended by the WHO/OIE. Additionally, Gel Diffusion Tests (GDT) with R-LPS antigen was carried out in order to assess by seroconversion that vaccination was effective. Details on these serological tests can be found in the “Manual of diagnostic tests and vaccines for terrestrial animals” of the World Organization for Animal Health (OIE, 2016). An ELISA for anti-GFP antibodies in the serum was also performed on samples obtained from the serum of the lambs inoculated with 16MΔwzm::gfp.
(153)
(154)
Example 16
Efficacy of Rev1Δwzm:gfp Vaccination Against a B. Ovis PA Experimental Infection in Rams
(155) Rasa Aragonesa male and female breed lambs born in the experimental flock of the Centro de Investigación y Tecnologia Agroalimentaria (CITA) del Gobierno de Aragón (Zaragoza, Spain) were used in these experiments, at 3-4 months of age. These animals were housed in the authorized facilities of the CITA (registration number ES/50-2970-12005), handled and manipulated according to the FELASA (www.felasa.eu) and ARRIVE (Kilkenny et al., 2010. PLoS Biology, 8: e1000412) recommendations.
(156) Lambs (n=14) were vaccinated by subcutaneous injection of 1-2×10.sup.10 CFU of Rev1Δwzm::gfp. One group (n=13) kept unvaccinated were used as control. Thereafter, innocuousness was assessed by clinical inspection (rectal body temperature and palpation of the inoculation site) for one month after vaccination, and by periodical examination of epididymis and testicles all throughout the experiment. At 8 months after vaccination, all lambs were experimentally challenged with 2×10.sup.9 CFU de B. ovis PA by conjunctival and preputial routes (30 μL/each route) and slaughtered 2 months later for bacteriological purposes. Samples of spleens, epididymis, seminal vesicles and cranial, prescapular, crural, iliac and scrotal lymph nodes were taken, homogenized in sterile PBS and cultured by duplicate in CITA medium (De Miguel et al. 2011. Journal of Clinical Microbiology. 49(4): 1458-1463). The number and percentage of infected animals and samples were determined as previously described (Grilló et al. 2009. Vaccine, 27: 187-191) and the mean infection index was calculated as the sum of the infection levels assigned to each sample divided by all the samples processed from each group. The infection level was assigned as follows: 1 (1-5 CFU), 2 (6-25 CFU); 3 (26-125 CFU); 4 (126-300 CFU); 5 (>300 CFU). The statistical comparisons of percentages and means were performed by the Chi-square and Kruskal-Wallis tests, respectively.
(157) As shown in Table 7, vaccination of lambs at 3-4 months of age with Rev1Δwzm::gfp induces significant protection against a challenge infection by B. ovis PA at 11-12 months of age, regarding not only the number of animals found infected but also the number of samples detected as infected by B. ovis PA. Moreover, the level of infection observed in both vaccine groups were lower than that observed in the unvaccinated control group.
(158) TABLE-US-00009 TABLE 7 Efficacy against B. ovis PA infection in rams vaccinated with Rev1Δwzm::gfp at 3-4 months old. No. (%) Infected/total No. (%) Infected/ Mean Infection Vaccination group.sup.1 animals total samples Index .sup.2 Rev1Δwzm::gfp 5/14 (35.7%) .sup.a 15/112 (13.4%) .sup.b 0.29 Unvaccinated 12/13 (92.3%) 47/104 (45.2%) 1.00 .sup.1Male lambs of 3-4 months old were vaccinated subcutaneously with 2 × 10.sup.10 CFU of Rev1Δwzm::gfp, challenged 8 months post-vaccination, and analyzed by bacteriology 2 months after challenge; .sup.2 Mean Infection Index = the sum of the infection levels assigned to each sample divided by all the samples processed from each group; Statistical comparisons: .sup.a p = 0.002; .sup.b p < 0.0001.
Example 17
Immune Sera from Lambs Vaccinated with Rev1Δwzm are Effective Against B. melitensis H38 And B. Abortus 2308 S-LPS Virulent Strains
(159) Exponentially grown B. melitensis H38, B. abortus 2308 and B. ovis PA were adjusted to 10.sup.4 CFU/mL in PBS and mixed, in triplicate in microtiter plates (45 μL/well), with 90 μL/well of normal or heat-treated (1 h, 56° C.) sera extracted from lambs showing anti-R/LPS antibodies in GDT-R/LPS (one of them was positive in CFT as well) at 2 weeks after inoculation with Rev1Δwzm. After 18 h of incubation at 37° C., and 10% CO.sub.2 for B. ovis, 65 μL of TSB were dispensed into each well, the bacterial suspension was mixed, and 50 μL were plated on BAB in triplicate. The results were expressed as the standardized percentage of bacteria counts with respect to initial count in the inocula. As it can be seen in the