ANTIMICROBIAL ADHESIVE PROTEIN, ANTIMICROBIAL NANOPARTICLE, ANTIMICROBIAL COMPOSITION COMPRISING SAME NANOPARTICLE, AND PREPARATION METHOD FOR SAME COMPOSITION
20200231637 ยท 2020-07-23
Assignee
- POSCO (Pohang-si, Gyeongsangbuk-do, KR)
- POSTECH ACADEMY-INDUSTRY FOUNDATION (Pohang-si, Gyeongsangbuk-do, KR)
Inventors
- Hyung Joon Cha (Pohang-si, Gyeongsangbuk-do, KR)
- Yun Kee Jo (Pohang-si, Gyeongsangbuk-do, KR)
- Yeonsu Jeong (Busan, KR)
Cpc classification
A61P31/00
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
A61K9/0019
HUMAN NECESSITIES
B82Y5/00
PERFORMING OPERATIONS; TRANSPORTING
International classification
Abstract
The present invention relates to an antimicrobial adhesive protein, an antimicrobial nanoparticle, an antimicrobial composition comprising the same nanoparticle, and a preparation method for the same composition and, more particularly, to an antimicrobial adhesive protein in which an antibiotic peptide is linked to a mussel adhesive protein, a mussel adhesive protein derivative in which a tyrosine residue within the antimicrobial adhesive protein is modified with a catechol derivative, an antimicrobial nanoparticle including a metal capable of forming a coordinate bond with a derivative of the mussel adhesive protein and having intrinsic antimicrobial activity, an antimicrobial composition comprising the same nanoparticle, and a preparation method for the same composition.
Claims
1. An antimicrobial adhesive protein, comprising an antibiotic peptide linked to a mussel adhesive protein.
2. The antimicrobial adhesive protein of claim 1, wherein the mussel adhesive protein is a protein selected from the group consisting of Mytilus edulis foot protein (Mefp)-1, Mefp-2, Mefp-3, Mefp-4, Mefp-5, Mytilus galloprovincialis foot protein (Mgfp)-1, Mgfp-2, Mgfp-3, Mgfp-4, Mgfp-5, Mytilus coruscus foot protein (Mcfp)-1, Mcfp-2, Mcfp-3, Mcfp-4, Mcfp-5, foot protein (fp)-1, fp-2, fp-3, fp-4, fp-5 and fp-6, a variant thereof, or a fusion protein to which at least one protein selected from the group is linked.
3. The antimicrobial adhesive protein of claim 1, wherein the antibiotic peptide is at least one peptide selected from the group consisting of an A7 peptide, a Tet-20 peptide, a minTBP peptide and an MP196 peptide.
4. An antimicrobial nanoparticle, comprising a mussel adhesive protein derivative of which a tyrosine residue in the antimicrobial adhesive protein of claim 1 is modified to a catechol derivative, and a metal capable of coordinating with the mussel adhesive protein derivative, and having inherent antimicrobial activity.
5. The antimicrobial nanoparticle of claim 4, wherein the catechol derivative is at least one selected from the group consisting of 3,4-dihydroxyphenylalanine (DOPA), DOPA o-quinone, dopamine, norepinephrine, epinephrine, epigallocatechin gallate and derivatives thereof.
6. The antimicrobial adhesive protein of claim 4, wherein the metal capable of coordinating with the mussel adhesive protein derivative is at least one selected from the group consisting of titanium, vanadium, chrome, manganese, iron, cobalt, nickel, zirconium, niobium, molybdenum, technetium, ruthenium, rhodium, palladium, silver, hafnium, tantalum, tungsten, rhenium, osmium, iridium, platinum and gold.
7. The antimicrobial adhesive protein of claim 4, wherein the antimicrobial adhesive protein is additionally loaded with an antimicrobial agent.
8. The antimicrobial adhesive protein of claim 7, wherein the antimicrobial agent is at least one selected from the group consisting of penicillins, cephalosporins, -lactams, macrolides, glycopeptides, lincosamides, quinolones, rifamycin, chloramphenicol, polymyxin, trimethoprim, streptogramin, oxazolidinone, gentamicin and bacitracin.
9. The antimicrobial adhesive protein of claim 4, wherein the antimicrobial adhesive protein has an antimicrobial effect under a bacterial infection environment condition of pH 0.1 to pH 6.5.
10. A method for preparing an antimicrobial nanoparticle, comprising: dissolving a mussel adhesive protein derivative of which a tyrosine residue in the antimicrobial adhesive protein of claim 1 is modified to a catechol derivative in a mixed solvent of water and ethanol; preparing a spinning solution by adding a salt of a metal capable of coordinating with the mussel adhesive protein derivative; and electrospinning the spinning solution.
11. The method for preparing an antimicrobial nanoparticle of claim 10, wherein the mixed solvent comprises water and ethanol in a weight ratio of 20:80 to 40:60.
12. The method for preparing an antimicrobial nanoparticle of claim 10, wherein the metal salt is added so as that a molar ratio of a metal ion and a catechol derivative is 1:3 to 1:4.
13. The method for preparing an antimicrobial nanoparticle of claim 10, wherein the metal is at least one selected from the group consisting of titanium, vanadium, chrome, manganese, iron, cobalt, nickel, zirconium, niobium, molybdenum, technetium, ruthenium, rhodium, palladium, silver, hafnium, tantalum, tungsten, rhenium, osmium, iridium, platinum and gold.
14-15. (canceled)
Description
BRIEF DESCRIPTIONS OF THE DRAWINGS
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
BEST MODE
[0042] Hereinafter, the preferred embodiment of the present invention will be described with reference to the accompanying drawings. The present invention may, however, be embodied in many different forms and should not be construed as being limited to the embodiments set forth herein.
[0043] According to the present invention, an antimicrobial adhesive protein, an antimicrobial nanoparticle and a preparation method therefor are provided.
[0044] The antimicrobial adhesive protein provided in the present invention refers to a protein having antimicrobial activity itself and having an antibiotic peptide connected to a mussel adhesive protein.
[0045] The mussel adhesive proteins disclosed in KR10-2014-0002244 A, WO2006/107183, WO2005/092920, or the like may be used for that of the present invention. A detailed preparation process may be the same as that disclosed in WO2006/107183 and WO2005/092920.
[0046] A mussel adhesive protein, which can be applied hereto, may be a mussel-derived adhesive protein, and may preferably include a mussel adhesive protein derived from Mytilus edulis, Mytilus galloprovincialis or Mytilus coruscus, or a variant thereof, but is not limited thereto.
[0047] The mussel adhesive protein may include a Mytilus edulis foot protein (Mefp)-1, Mefp-2, Mefp-3, Mefp-4, Mefp-5, Mytilus galloprovincialis foot protein (Mgfp)-1, Mgfp-2, Mgfp-3, Mgfp-4, Mgfp-5, Mytilus coruscus foot protein (Mcfp)-1, Mcfp-2, Mcfp-3, Mcfp-4, Mcfp-5, which is derived from said mussel, or a variant thereof, and may preferably include a protein selected from the group consisting of foot protein (fp)-1, fp-2, fp-3, fp-4, fp-5 and fp-6, or a fusion protein to which at least one protein selected from the group is linked, or a variant thereof, but is not limited thereto.
[0048] Further, the mussel adhesive protein of the present invention may include all mussel adhesive proteins disclosed in WO2006/107183 and WO2005/092920. Preferably, the mussel adhesive protein may include fusion proteins such as fp-151, fp-131, fp-353, fp-153, fp-351, and the like, but is not limited thereto. In addition, the mussel adhesive protein may include a polypeptide, in which 1 to 12 or more decapeptides are linked in tandem, where the decapeptides recur about 80 times in fp-1 is, and may preferably be an fp-1 variant polypeptide in which 12 decapeptides of SEQ ID NO:2 are connected in tandem, but is not limited thereto.
[0049] The present inventors developed an fp-151, a novel mussel adhesive protein in which a structure of their previous study, in which 10 repeating amino acids of the fp-1 recur 6 times, is connected to N- and C-termini of fp-5 at a genetic level, and successfully expressed the recombinant mussel adhesive protein in E. coli, thereby finding feasibility of mass production thereof and significantly high industrial applicability through simple purification processes (WO2006/107183 and WO2005/092920).
[0050] For example, the mussel adhesive protein may be a protein selected from the group consisting of Mytilus edulis foot protein (Mefp)-1, Mefp-2, Mefp-3, Mefp-4, Mefp-5, Mytilus galloprovincialis foot protein (Mgfp)-1, Mgfp-2, Mgfp-3, Mgfp-4, Mgfp-5, Mytilus coruscus foot protein (Mcfp)-1, Mcfp-2, Mcfp-3, Mcfp-4, Mcfp-5, foot protein (fp)-1, fp-2, fp-3, fp-4, fp-5 and fp-6, a variant thereof, or a fusion protein to which at least one protein selected from the group is linked.
[0051] Meanwhile, the antibiotic peptide, which can be used in the present invention, may be at least one peptide selected from the group consisting of an A7 peptide, a Tet-20 peptide, a minTBP peptide, an MP196 peptide, a PTP7 peptide and temporin 1CEa as disclosed in Table 1, but is not limited thereto.
[0052] For example, the antibiotic peptide may consist of an amino acid sequence of SEQ ID NO:16.
TABLE-US-00001 TABLE1 SEQIDNO Peptide AAsequence 16 A7 ILKWKWKWWKWRR 17 Tet-20 KRWRIRVRVIRKC 18 minTBP RKLPDAP 19 MP196 RWRWRW 20 PTP7 FLGALFKALSKLL 21 Temporin1CEa FVDLKKIANIINSIF
[0053] According to the present invention, an antimicrobial nanoparticle having inherent antimicrobial activity is provided, and the antimicrobial nanoparticle include a metal capable of coordinating with a derivative of a mussel adhesive protein, of which a tyrosine residue in the antimicrobial adhesive protein is modified to a catechol derivative, and a derivative of the mussel adhesive protein.
[0054] As used herein, the expression antimicrobial activity may include an antibiotic effect of inhibiting growth of microorganisms or strains and a bactericidal effect of removing existing microorganisms or strains.
[0055] The mussel adhesive protein of the present invention, of which the tyrosine residue is modified to a catechol derivative, may refer to a modified mussel adhesive protein or a a mussel adhesive protein derivative, and a modification method is not particularly limited.
[0056] The catechol derivative is a compound containing a dihydroxyl group and is coordinatable with a metal. The catechol derivative is preferably at least one selected from the group consisting of 3,4-dihydroxyphenylalanine (DOPA), DOPA o-quinone, dopamine, norepinephrine, epinephrine, epigallocatechin gallate and derivatives thereof.
[0057] For example, the catechol derivative may have 10% to 100% of the entire tyrosine residue modified to a catechol derivative, particularly to DOPA.
[0058] The coordinatable metal is any metal coordinatable with the catechol derivative and may be a typical metal or a transition metal. For example, the metal may be at least one selected from the group consisting of titanium, vanadium, chrome, manganese, iron, cobalt, nickel, zirconium, niobium, molybdenum, technetium, ruthenium, rhodium, palladium, silver, hafnium, tantalum, tungsten, rhenium, osmium, iridium, platinum and gold. The metal is preferably an iron (III).
[0059] A salt of the metal, which can be used here, may be, for example, iron (II) chloride (FeCl.sub.2), iron (III) chloride (FeCl.sub.3), titanium tetrachloride (TiCl.sub.4), titanium (III) chloride (TiCl.sub.3), cobalt (III) chloride (CoCl.sub.3), Cobalt (II) chloride (CoCl.sub.2), nickel chloride (NiCl.sub.2), silver chloride (AgCl), and the like, but is not limited thereto.
[0060] The catechol derivative and the metal coordinate with each other to form a metal-catechol derivative complex. Preferably, the metal-catechol derivative complex may be an Fe(III)-DOPA complex. According to an exemplary embodiment, the DOPA and the Fe(III) form a crosslink through a coordination bond. As the DOPA and the Fe(III) are already present in the human bodies and are advantageous due to excellent biocompatibility.
[0061] The DOPA is known to is known to form mono-, bis-, or tris-cross-links, while reacting with the Fe(III), depending on pH. Further, the DOPA is known to exhibit unique colors of Fe(III)-DOPA complexes depending on bonding aspects. According to an exemplary embodiment of the present invention, a reagent containing Fe(III), that is, FeCl.sub.3, may be used to provide Fe(III) metals. Preferably, an FeCl.sub.3 solution may be added so as that a molar ratio of Fe(III) to DOPA is 1:3 or a ratio of Fe(III) is less than that.
[0062] Further, the antimicrobial nanoparticle may have an antimicrobial agent additionally loaded and may be applied as a multi-drug form by for example, carrying an antimicrobial drug. The antimicrobial drug may be penicillins such as penicillin, methicillin, oxacillin, naphcillin, ampicillin, carboxyphenicillin, amoxicillin, piperecillin, or the like; cephalosporins such as cephalosporin, cephazoline, ceftazidime, cefoperazone, cefotaxime, ceftizoxime, ceftriaxone, ceftazidime, or the like; other beta-lactams such as carbapenem, meropenem, sulbactam, clavulanate, tazobactam, or the like; aminoglycosides such as streptomycin, neomycin, gentamicin, tobramycin, amikacin, sisomicin, astromicin, isepamicin, arbekacin, or the like; macrolides such as erythromycin, clarithromycin, or the like; tetracyclines such as tetracycline, metacycline, minocycline, tigecycline, doxycycline, or the like; glycopeptides such as vancomycin, teicoplanin, or the like; lincosamides such as lincomycin, clindamycin, or the like; quinolones such as nalidixic acid, oxolinic acid, fluoroquinolone, ciprofloxacin, norfloxacin, levofloxacin, or the like; rifamycin, chloramphenicol, polymyxin, trimethoprim, streptogramin, oxazolidinone, bacitracin and mixtures thereof, but is not limited thereto.
[0063] For example, it is preferable that the antibiotic agent be at least one selected from the group consisting of penicillins, cephalosporins, -lactams, macrolides, glycopeptides, lincosamides, quinolones, rifamycin, chloramphenicol, polymycin, trimethoprim, streptogamine, oxazolidinone, gentamicin and bacitracin.
[0064] The antimicrobial nanoparticle of the present invention has inherent antimicrobial activity, and particularly in an acidic condition, that is, at pH 0.1 to pH 6.5, preferably at pH 0.1 to pH 5, for example, at pH 4.0 to pH 5.0, the nanoparticle is dissolved, thereby exhibiting antimicrobial activity.
[0065] That is, the nanoparticle maintain the nanoparticle form in body fluids having a pH of 7.4, thereby exhibiting stable properties, whereas in an acidic environment (pH of about 6.5) formed by producing acetic acids and lactic acids, metabolites produced due to bacterial infections, the nanoparticle loses its form and may induce positive charges of an original antimicrobial adhesive protein.
[0066] Accordingly, the nanoparticle based on the antimicrobial adhesive protein MAP-cAMP is present in an inactive form and dissolved at a time point where antimicrobial activity is required, thereby establishing technology enabling expression of the antimicrobial activity. This in particular enables an application of the nanoparticle in killing infected bacteria inside cells without affecting infected host animal cells.
[0067] The nanoparticle may have an average diameter of 80 nm to 130 nm, preferably 110 nm. The nanoparticle with this size is appropriate to migrate to a target cell and can be delivered via various routes including injection, oral administration, and dermal administration, when introduced to the human body. The loaded drug may be appropriately delivered to human or other mammals having a treatment-effective disease or symptoms thereof via injection or other routes, but preferably via parenteral administration.
[0068] The term parenteral refers to intramuscular, intraperitoneal, intraabdominal, subcutaneous, intravenous and intraarterial. Accordingly, the nanoparticle of the present invention may representatively be formulated into an injection formulation.
[0069] The injectable nanoparticle of the present invention may be injected or inserted into a human body or other mammals' bodies via any appropriate administration route, preferably via an injection with a subcutaneous needle. For example, the nanoparticle may be administered via injection to artery, vein, urogenital organs, under the skin, muscle, under the skin, skull, pericardium, pleura, or other body cavities or available spaces. Alternately, the nanoparticle may be introduced into, for example, joint during arthroscopic surgery, urogenital organs, vas, palate, pleura, or any body cavities or available spaces via a catheter or a syringe during an operation, surgical treatment, diagnosis or interventional procedure.
[0070] The nanoparticle can be used for tuberculosis, hepatitis, typhoid fever, food poisoning, cholera, dysentery and other infectious diseases, but is not limited thereto.
[0071] Further, according to the present invention, a method for preparing an antimicrobial nanoparticle having inherent antimicrobial activity as described above.
[0072] The antimicrobial nanoparticle preparation method of the present invention includes dissolving a mussel adhesive protein derivative, of which a tyrosine residue in the antimicrobial adhesive protein of the present invention, is modified to a catechol derivative in a mixed solvent of water and ethanol; preparing a spinning solution by adding a salt of a metal capable of coordinating with the mussel adhesive protein derivative; and electrospinning the spinning solution.
[0073] The electrospinning is a technique forming a nanoparticle using electrical attraction and repulsion occurring when charging a polymer solution or a molten polymer with a predetermined voltage. According to electrospinning, nanoparticles having various diameters of several nanometers to several thousands of nanometers can be prepared with simple equipment and may be applied to a variety of substances.
[0074] Use of the water-based solvent, instead of an organic solvent, may eliminate a toxic effect of the solvent remaining during the electrospinning. In order to improve evaporation of the water-based solvent, an organic solvent may be further mixed, and preferably, 60% to 80% (v/v) of ethanol may be additionally mixed with respect to distilled water. That is, the mixed solvent includes water and ethanol mixed preferably in a weight ratio of 20:80 to 40:60, more preferably in a weight ratio of 30:70.
[0075] Meanwhile, it is preferable that a salt of the metal is added so as that a molar ratio of a metal ion and a catechol derivative is 1:3 to 1:4. The metal maybe at least one selected from the group consisting of titanium, vanadium, chrome, manganese, iron, cobalt, nickel, zirconium, niobium, molybdenum, technetium, ruthenium, rhodium, palladium, silver, hafnium, tantalum, tungsten, rhenium, osmium, iridium, platinum and gold.
[0076] Electrospinning of thus-prepared spun solution is not particularly limited, but for example, may involve discharging the spun solution using a syringe pump at a speed of 0.5 mL/h to 2 mL/h and applying a high voltage of 6 kV to 14 kV when passing through a needle having a diameter of 0.1 mm to 0.8 m to generate a nanoparticle. Thus-prepared nanoparticle may be collected on a stirred tank containing aluminum phosphate buffered saline (PBS; pH 7.4), and the like, or an aluminum foil.
[0077] Further, according to the present invention, an antimicrobial composition containing the antimicrobial nanoparticle having the inherent antimicrobial activity as describe above is provided.
[0078] The antimicrobial nanoparticle is contained preferably at a concentration of 1.0 g/mL to 2 g/mL, more preferably at a concentration of 1.5 g/mL. When the concentration of the antimicrobial nanoparticle is less than 1.0 g/mL, the antimicrobial activity may be insufficient, whereas difference in effects may not be significant compared to the concentration when the concentration exceeds 2 g/mL, thereby making it not preferable in terms of process economy.
[0079] A strain, in which the antimicrobial nanoparticle and antimicrobial composition of the present disclosure can exhibit an antibiotic effect of inhibiting growth of microorganisms or strains and a bactericidal effect of removing existing microorganisms or strains, is not particularly limited, but may be, for example, E. coli, and the like.
[0080] Hereinafter, the present invention will be described in more detail with reference to specific exemplary embodiments. The following exemplary embodiments are merely examples to help understanding of the present invention, and the scope of the present invention is not limited thereto.
MODE FOR INVENTION
Examples
[0081] 1. Preparation of Antimicrobial Adhesive Protein MAP-cAMP
[0082] A mussel adhesive protein fp-1 (Mytilus mussel foot protein type 1) variant composed of 12 times-repeated decapeptides (AKPSYPPTYK) was prepared according to a known process (see Proc. Natl. Acad. Sci. USA 2010, 107, 12850-3).
[0083] A primer of a sequence for an A7 peptide (Nan, Y H, Bang, J-K, Shin, S Y, 2009. Peptides 30: 832-838), a pseudopeptide derived from indolicidin, an antimicrobial peptide, was prepared to connect to thus-prepared mussel adhesive protein fp-1 using a polymerase chain reaction (Table 2).
TABLE-US-00002 TABLE2 SEQIDNO Primer Nucleotidesequence(5'.fwdarw.3') 20 Forward GCCATATGGCTAGCGCTAAACCGTCTTAC forfp-1 21 Reverse CTCGAGTTAGCGGCGCCATTTCCACCATT forA7 TCCATTTCCATTTCAGAATCTTGTACGTT GGAGGATAAGAAG
[0084] A product, MAP-cAMP gene was transformed into an E. coli TOP10 strain using a pET-22b (+) vector containing a T7 promoter as a plasmid carrier. Further, a cloned recombinant vector was transformed back into an E. coli BL21 (DE3) strain to express a fusion protein.
[0085] The E. coli BL21 transformed into the MAP-cAMP gene was cultured in an LB liquid medium containing 50 g/mL of ampicillin at 37 C. and 300 rpm. When optical density for 600 nm (OD.sub.600) reached 0.4 to 0.6, 1 mM isopropyl--D-thiogalactopyranoside (IPTG) was added and cultured at the same conditions. Thus-cultured cell was centrifuged for 10 min under conditions of 4 C. and 18,000>g, and resuspended in an elution buffer (10 mM Tris-HCl, and 100 mM sodium phosphate, pH 8) to lyse the cell at 200 Kpsi.
[0086] To obtain cell debris from thus-obtained cell lysate, a resultant was centrifuged for 20 min under conditions of 4 C. and 18,000>g. 25% (v/v) acetic acid was used to extract a target fusion protein, and the fusion protein lastly purified was lyophilized and stored at 80 C.
[0087] The preparation and purification of the protein was analyzed using 12% (w/v) SDS-PAGE, and consequently confirmed successful expression of the fusion protein (
[0088] 2. Antimicrobial Effect of Surface Coated with Antimicrobial Surface Coating Agent
[0089] To measure the antimicrobial activity of the MAP-cAMP, the antimicrobial adhesive protein prepared in 1., the protein was dissolved in distilled water at concentrations of 0 mg/mL, 5 mg/mL, 10 mg/mL and 20 mg/mL and applied to a surface in a predetermined amount so as to cover a cover slip formed of polystyrene, followed by drying for an hour at 37 C. to coat the surface. Thus-prepared MAP-cAMP-coated surface was applied to a solid medium and a liquid medium, which were inoculated with bacteria, to confirm the antimicrobial effect. An uncoated material was used as a negative control.
[0090] (1) Measurement of Antimicrobial Effect in Solid Medium
[0091] The surfaces coated with 0 mg/mL, 5 mg/mL, 10 mg/mL and 20 mg/mL MAP-cAMP as described above was cultured in an agar plate medium spread with Escherichia coli, a gram-negative bacterium in a log phase, at 37 C. for 1 day.
[0092] The antimicrobial effect was analyzed by measuring an inhibition area using a graphic program (ImageJ). As a result, all MAP-cAMP-coated surfaces showed bacterial growth inhibition, which indicates that the higher the coating concentration, the larger the inhibition area (
[0093] (2) Measurement of Antimicrobial Effect in Liquid Medium
[0094] The cover slip formed of polystyrene used in (1) was applied to 500 L of an LB liquid medium inoculated with Escherichia coli, a gram-negative bacterium in a log phase, and cultured for 24 hours to measure optical density for 600 nm (OD.sub.600). A 48-well culture plate was used for the culturing of the bacterial strain at 37 C. and 300 rpm.
[0095] As a result, a minimum coating concentration of the MAP-cAMP was shown to be 20 mg/mL for 90% inhibition of the growth of the E. coli and that was shown to be 5 mg/mL for 50% inhibition of the growth of the E. coli (
[0096] 3. Preparation of Antimicrobial Nanoparticle Using Fusion Protein MAP-cAMP
[0097] (1) Preparation of DOPA-Modified Fusion Protein mMAP-cAMP
[0098] The MAP-cAMP, the fusion protein prepared in 1, was subject to an in vitro enzymatic reaction using a mushroom tyrosinase to convert a tyrosine residue of the MAP-cAMP to dihydroxyphenylalanine (DOPA). Specifically, 1.50 mg/mL of an MAP-cAMP solution and 100 g/mL of the tyrosinase were reacted in a buffer solution (100 mM of sodium phosphate, 20 mM of boric acid, and 25 mM of ascorbic acid; pH 6.8) for 1 hour, and dialyzed with 1% acetic acid.
[0099] (2) Preparation of Antimicrobial Nanoparticle
[0100] Electrospinning was used to prepare a nanoparticle using the mMAP-cAMP prepared in (1). Specifically, 1.5 wt % to 3 wt % mMAP-cAMP was dissolved in a solvent of distilled water:ethanol (30:70), and an FeCl.sub.3 solution was added such that a molar ratio of Fe.sup.3+:DOPA is 1:3. The mixed solution was then electrospun. The electrospinning was performed by applying a high voltage of 6 kV to 14 kV when passing through a needle having a diameter of 0.4 mm while discharging the solution at a flow rate of 1 mL/h using a syringe pump, thereby forming a nanoparticle. Thus-prepared nanoparticle was collected into a stirring water bath containing phosphate buffered saline (PBS; pH 7.4) or an aluminum foil. Compared to a conventional solution phase, the MAP-cAMP showed a reduced positive charge as it becomes a nanoparticle and showed a surface potential similar to a charge pattern of the nanoparticle of the control MAP (
[0101] Accordingly, the nanoparticle based on the antimicrobial adhesive protein according to the present invention is present in an inactive form and dissolved at a time point where antimicrobial activity is required, thereby establishing technology enabling expression of the antimicrobial activity. In this regard, the nanoparticle can be used in killing of infected bacteria inside cells without affecting infected host animal cells.
[0102] (3) Preparation of Gentamicin-Loaded Antimicrobial Nanoparticle
[0103] To prepare an Fe(III)-DOPA nanoparticle loaded with gentamicin (GENT), a GENT solution was added to the mixed solution, and the mixed solution was directly electrospun into PBS. Dialysis was performed three times against the PBS (pH 7.4) using a molecular weight cut off (MWCO) 3500 membrane to remove unloaded GENTs, thereby obtaining a purple pure GENT-loaded Fe(III)-DOPA complex nanoparticle.
[0104] A DLS analysis showed that the MAP-cAMP-NP and (MAP-cAMP@GENT)-NP had average diameters of about 90 nm and about 135 nm, respectively (
[0105] 4. Measurement of Antimicrobial Effect of Antimicrobial Nanoparticle
[0106] (1) Measurement of Antimicrobial Effect of Antimicrobial Nanoparticle According to pH Condition
[0107] To examine whether the MAP-cAMP-NP, the antimicrobial nanoparticle obtained in 3.(2), exhibits antimicrobial activity, the nanoparticle was applied to 500 L of an LB liquid medium inoculated with 5 L of E. coli, a gram-negative bacterium and cultured for 24 hours to measure optical density for 600 nm (OD.sub.600). A 48-well culture plate was used for the culturing of the bacterial strain at 37 C. and 300 rpm.
[0108] As a result, the antimicrobial nanoparticle MAP-cAMP-NP was shown to exhibit a higher positive charge in a solution of pH 4.0, an acidic environment, than in a solution of pH 7.4, a neutral environment (
[0109] (2) Measurement of Antimicrobial Effect of Antimicrobial Nanoparticle in a Bacterial Infection Environment
[0110] To measure the antimicrobial activity of the antimicrobial nanoparticle MAP-cAMP-NP obtained in 3.(2), the nanoparticle was applied to the liquid medium inoculated with bacteria at concentrations of 0 g/mL, 0.25 g/mL, 0.5 g/mL, 1 g/mL, 1.5 g/mL and 2 g/mL.
[0111] Specifically, the nanoparticle of each concentration was applied to 500 L of an LB liquid medium inoculated with 5 L (about 510.sup.5 CFU) of gram negative E. coli and cultured for 12 hours and 24 hours to measure optical density for 600 nm (OD.sub.600). A 48-well culture plate was used for the culturing of the bacterial strain at 37 C. and 300 rpm.
[0112] As a result, a minimum coating concentration (MIC.sub.90) of the MAP-cAMP-NP was shown to be 1.5 g/mL for 90% inhibition of the growth of the E. coli and that (MIC.sub.50) was shown to be 1.0 mg/mL for 50% inhibition of the growth of the E. coli (
[0113] While embodiments have been shown and described in detail above, it will be apparent to those skilled in the art that modifications and variations could be made without departing from the scope of the present disclosure as defined by the appended claims.