Recombinant Antigen Derived From Zika Virus E Protein And Use Thereof
20200230227 ยท 2020-07-23
Assignee
Inventors
- You-Jin Kim (Chungcheongbuk-do, KR)
- Hyun Ju In (Chungcheongbuk-do, KR)
- HeeJi Lim (Chungcheongbuk-do, KR)
- Sun-Dong Jang (Chungcheongbuk-do, KR)
- Jung-Sik Yoo (Chungcheongbuk-do, KR)
- Gyung Tae Chung (Chungcheongbuk-do, KR)
Cpc classification
C12N2710/14041
CHEMISTRY; METALLURGY
C12N2770/24122
CHEMISTRY; METALLURGY
C12N7/00
CHEMISTRY; METALLURGY
C12N2770/24134
CHEMISTRY; METALLURGY
C07K16/1081
CHEMISTRY; METALLURGY
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C07K2317/76
CHEMISTRY; METALLURGY
C12N15/70
CHEMISTRY; METALLURGY
A61K2039/57
HUMAN NECESSITIES
International classification
C12N15/70
CHEMISTRY; METALLURGY
Abstract
The present invention relates to a recombinant antigen derived from Zika virus E protein and use thereof. Specifically, the present invention provides a polynucleotide encoding Zika virus E protein domain III alone or repeatedly three times, a recombinant plasmid vector comprising the polynucleotide, and a DNA vaccine composition that may induce an immune response to Zika virus by expressing a Zika virus antigen protein effectively. In addition, the present invention provides a neutralizing antibody against Zika virus obtained using the polynucleotide and a method for preparing the neutralizing antibody.
Claims
1. A polynucleotide comprising SEQ ID NO: 1 encoding Zika virus E protein domain III repeatedly three times or SEQ ID NO: 7 encoding Zika virus E protein domain III.
2. The polynucleotide according to claim 1 comprising SEQ ID NO: 1.
3. The polynucleotide according to claim 1 comprising SEQ ID NO: 7.
4. The polynucleotide according to claim 1, further comprising a polynucleotide of SEQ ID NO: 2 encoding an IgE signal peptide.
5. A recombinant expression vector comprising the polynucleotide according to claim 1.
6. A recombinant expression vector having a base sequence of SEQ ID NO: 3 or SEQ ID NO: 6.
7. An isolated host cell comprising the recombinant expression vector according to claim 6.
8. The isolated host cell according to claim 7, characterized in that the host cell is E. coli-DH5 deposited as an accession number KCTC13685BP.
9. A vaccine composition for the prevention of the infection of Zika virus, comprising the polynucleotide according to claim 1.
10. The vaccine composition for the prevention of the infection of Zika virus according to claim 9, characterized in that the polynucleotide further comprises a polynucleotide of SEQ ID NO: 2 encoding an IgE signal peptide.
11. The vaccine composition according to claim 9, further comprising an adjuvant.
12. The vaccine composition according to claim 9, characterized in that the vaccine composition induces a cellular or humoral immune response to Zika virus by expressing a Zika virus antigen protein.
13. The vaccine composition according to claim 9, characterized in that the vaccine composition induces a production of a neutralizing antibody against Zika virus by expressing a Zika virus antigen protein.
14. A vaccine composition for the prevention of the infection of Zika virus, comprising the recombinant expression vector according to claim 6.
15. The vaccine composition according to claim 14, further comprising an adjuvant.
16. The vaccine composition according to claim 14, characterized in that the vaccine composition induces a cellular or humoral immune response to Zika virus by expressing a Zika virus antigen protein.
17. The vaccine composition according to claim 14, characterized in that the vaccine composition induces a production of a neutralizing antibody against Zika virus by expressing a Zika virus antigen protein.
18. A method for preparing a neutralizing antibody against Zika virus, comprising (a) step of administering the polynucleotide according to claim 1 to a mammalian excluding a human; and (b) a step of obtaining a neutralizing antibody that specifically binds to Zika virus from the mammalian.
19. The method for preparing a neutralizing antibody against Zika virus according to claim 18, further comprising (c) a step of humanizing the neutralizing antibody obtained in step (b).
20. A neutralizing antibody produced by the method according to claim 18.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
DETAILED DESCRIPTION OF THE INVENTION
[0033] 1. Polynucleotide
[0034] The present invention relates to a polynucleotide of SEQ ID NO: 1 encoding Zika virus E protein domain III repeatedly three times. The present invention also provides a polynucleotide of SEQ ID NO: 7 encoding Zika virus E protein domain III. In a preferred embodiment, the polynucleotide may further comprise a polynucleotide of SEQ ID NO: 2 encoding an IgE signal peptide.
[0035] In the present invention, Zika virus E protein domain III is selected as an antigen of a Zika virus vaccine. The Zika virus E protein (envelope protein) mediates virus assembly, attachment to cell receptors, and is necessary for subsequent membrane fusion associated with virus entry. The Zika virus E protein consists of three (3-sheet domains. Among them, domain III includes a cell receptor binding motif. In particular, domain III is mapped with a type-specific neutralizing epitope that induces a strong host antibody response or protective immunity.
[0036] In order to use the selected Zika virus E protein domain III as an antigen of a DNA vaccine, it is necessary to efficiently express a gene derived from a virus in a mammalian. For this purpose, polynucleotides may be substituted with a codon having a high expression frequency in a host cell. The expression substituting with a codon having a high expression frequency in a host cell or codon optimization, as used in the present invention, refers to substituting with the codon having a high preference, and thus increasing the expression efficiency of the amino acid or protein that is encoded by the nucleic acids, since there is a codon having high preference depending on hosts among codons designating the amino acids upon transcription and translation of DNA to a protein in a host cell.
[0037] In the present invention, the polynucleotide of the natural type Zika virus E protein domain III was used in a suitable form for expression in a mammalian by codon optimization (SEQ ID NO: 7), or was prepared so as to have a three-fold repeated structure after codon optimization (SEQ ID NO: 1). For example, the Kazusa program (www.kazusa.or.jp/codon/) may be used for the codon optimization.
[0038] In accordance with a preferred embodiment of the present invention, the codon optimized polynucleotide may further comprise a polynucleotide that is linked to its N-terminus and encodes an IgE signal peptide. The term signal peptide, as used herein, refers to a peptide that plays a role in transferring the E protein domain III expressed in a cell to outside of the cell. Generally, when an antigen protein produced in a DNA vaccine is secreted out of a cell, a more effective immune response can be obtained by inducing the production of an antigen specific IgG in a larger amount in comparison with being placed inside of a cell (cytosol) or on a cellular membrane.
[0039] In the present invention, by linking the polynucleotide of SEQ ID NO: 2 encoding the IgE signal peptide to a N-terminus portion of the codon optimized polynucleotide of SEQ ID NO: 1 or SEQ ID NO: 7, Zika virus E protein domain III expressed in a cell may be induced to transfer to outside of the cell.
[0040] The polynucleotide may further comprise a polynucleotide encoding one or more immunity enhancing peptides. The term immunity enhancing peptide, as used herein, refers to a peptide that activates cells (for example, dendritic cells and the like) involved in the immune response to increase the immune response. The peptides known in the art can be used as the immunity enhancing peptide, and the peptides known in the art may be, for example, CD40 ligand, Flt3 (fins-like tyrosine kinase-3) ligand, flagellin, or CTLA4 (cytotoxic T lymphocyte associated protein 4) and the like.
[0041] Methods for obtaining the polynucleotide of the present invention are known in the art. For example, polynucleotide molecules can be prepared directly through a chemical synthesis.
[0042] 2. Recombinant Expression Vector
[0043] The present invention provides a recombinant expression vector comprising the polynucleotide.
[0044] The vector according to one embodiment of the present invention may be an expression vector in which the polynucleotide comprises a gene construct operably linked to a regulatory sequence so that it can express Zika virus E protein domain III in a host cell. The expression vector may be a plasmid vector, a viral vector, a cosmid vector, a phagemid vector, or an artificial human chromosome.
[0045] Operably linked to means that the desired nucleic acid sequence is linked to a regulatory sequence so as to perform the expression.
[0046] Regulatory sequences may be promoters, enhancers, initiation codons, stop codons, or polyadenylation signals. Regulatory sequences include directing the expression of the nucleic acid of interest in many host cells at all times, directing the expression of the nucleic acid of interest only in a certain tissue cell (e.g., a tissue-specific regulatory sequence), and directing the expression to be induced by a certain signal (e.g., inducible regulatory sequences). The design of the expression vector may vary depending on factors, such as the selection of a host cell to be transformed and the expression level of the desired protein.
[0047] In a preferred embodiment, the expression vector is a plasmid vector, more preferably, pVAX1 (Invitrogen, San Diego, Calif.) expression plasmid. This expression vector is to be modified by substituting the high copy pUC replication origin with the low copy pMB1 replication origin of pBR322. The low copy modification was performed to make the construct more stable by reducing the metabolism burden.
[0048] In the present invention, pVAX1 is used as an expression vector backbone, and a polynucleotide encoding Zika virus E protein domain III repeatedly three times is inserted into the vector to produce the expression plasmid pVAX1-ENV domain III X 3. The plasmid pVAX1-ENV domain III X 3 construct is illustrated in
[0049] The vectors of the present invention can be prepared by standard recombinant DNA techniques. The standard recombinant DNA techniques include, for example, blunt end and adhesive end ligation, restriction enzyme treatment to provide appropriate ends, removal of phosphate groups by alkaline phosphatase treatment to prevent an unsuitable binding, and an enzymatic linkage by T4 DNA ligase and the like. DNA encoding the IgE signal peptide obtained by chemical synthesis or genetic recombination technique, DNA encoding Zika virus E protein domain III of the present invention repeatedly three times, is recombined into a vector comprising an appropriate regulatory sequence, thereby the vector of the present invention can be produced. The vector comprising the regulatory sequence can be commercially purchased or manufactured. In one embodiment of the present invention, pVAX1, which is a vector for producing a DNA vaccine, was prepared and used.
[0050] 3. Host Cell
[0051] The present invention relates to an isolated host cell comprising the vector.
[0052] The term host cell, as used herein, includes prokaryotic or eukaryotic cells, and eukaryotic cells include lower eukaryotic cells including fungi, yeast and the like, as well as higher eukaryotic cells including mammalian and the like. Suitable prokaryotic cells are those cells commonly used for cloning, such as E. coli or Bacillus subtilis. In addition, eukaryotic cells include fungal cells, plant cells, or animal cells. Examples of suitable fungal cells may be yeast, preferably yeast belonging to the genus Saccharomyces sp. Examples of suitable animal cells may include insect cells, plant cells, preferably mammalian cells such as HEK293, 293T, NSO, CHO, MDCK, U2-OSHela, NIH3T3, MOLT-4, Jurkat, PC-12, PC-3, IMR, NT2N, Sk-n-sh, CaSki, and C33A.
[0053] A host cell transfected or transformed with the vector according to one embodiment of the present invention may be a host cell genetically modified by the vector. The term genetically modified, as used herein, means that a host cell comprises a polynucleotide or vector introduced into a host cell other than its genome. Furthermore, the polynucleotide or vector according to one embodiment of the present invention may be present in a genetically modified host cell as an independent molecule outside the genome, preferably as a replicable molecule, or may be stably inserted into the genome of the host cell.
[0054] In a preferred embodiment of the present invention, the host cell is E. coli. More preferably, the host cell is E. coli-DH5, which comprises the recombinant expression vector pVAX1-ENV domain III X 3 and is deposited as an accession number KCTC13685BP.
[0055] 4. DNA Vaccine Composition
[0056] The present invention relates to a DNA vaccine composition comprising the polynucleotide or the recombinant expression vector as an active ingredient.
[0057] The term DNA vaccine, as used herein, a vaccine platform in which a gene encoding an antigen that induces an immune response in order to prevent and treat a disease caused by a pathogenic infection is inserted into a purified plasmid vector, and is injected in vivo, and the antigen expressed in protein/peptide form through the transcription and translation process in a host system simultaneously induces cellular and humoral immune responses.
[0058] Plasmids used in DNA vaccines have promoter sequences that can strongly express antigen proteins in animal cells, and use shuttle vectors that are applicable to both animal cells and bacteria to amplify plasmids in a large amount in bacteria. Plasmid DNA, which is amplified in a large amount in bacteria, separated and purified, is injected into cells, transcribed in the cell nucleus, and translated in the cytoplasm to express the desired antigen protein/peptide.
[0059] When the antigen protein/peptide expressed in the cell is broken down into a small peptide in the cytoplasmic proteasome, it is bound to the major histocompatibility complex (MHC) class I molecule in the Golgi complex and presented on the cell surface, which is recognized by CD8+ cytotoxic T cells to induce cellular immunity. When the antigen protein expressed in vivo is captured in B cells or macrophages, which are antigen presenting cells in the body, it is bound to MHC class II molecules in intracellular lysosomes and presented on the cell surface, which is recognized by CD4+ helper T cells to activate the humoral immune response. In addition, B cells that recognize the antigen protein are activated to produce antigen specific antibodies.
[0060] In addition, the vaccine composition of the present invention induces a neutralizing antibody of high titer. In one embodiment, the vaccine composition of the present invention induces a neutralizing antibody of higher titer than when using a polynucleotide that encodes a structural protein of Zika virus, for example, the E protein and/or prM. Therefore, the vaccine composition of the present invention shows an effective neutralizing antibody response.
[0061] In accordance with one embodiment of the present invention, the DNA vaccine composition of the present invention may further comprise one or more pharmaceutically acceptable carriers or excipients. Pharmaceutically acceptable carriers include, for example, carriers for parenteral administration, such as water, suitable oil, saline, aqueous glucose, and glycol and the like, and may further include stabilizers and preservatives. Suitable stabilizers include antioxidants such as sodium hydrogen sulfite, sodium sulfite, or ascorbic acid. Suitable preservatives include benzakonium chloride, methyl- or propyl-paraben, and chlorobutanol.
[0062] In addition, the composition according to the present invention may adequately comprise suspending agents, solubilizing agents, stabilizers, isotonic agents, preservatives, anti-adsorption agents, surfactants, diluents, excipients, pH adjusters, analgesic agents, buffers, antioxidants, and the like depending on administration methods or formulations, if necessary.
[0063] In accordance with one embodiment of the present invention, the DNA vaccine composition of the present invention may comprise at least one or more pharmaceutically acceptable adjuvants or immunity enhancers. The term adjuvant or immunity enhancer, as used herein, refers to a pharmaceutical or immunological preparation to be administered for enhancing an immune response of a vaccine. The adjuvant may be aluminum hydroxide, aluminum phosphate, alum (potassium aluminum sulfate), MF59, virosome, AS04 [a mixture of aluminum hydroxide and monophosphoryl lipid A (MPL)], AS03 (a mixture of DL--tocopherol, squalene, and polysorbate 80, which is an emulsifying agent), CpG, Flagellin, Poly I:C, AS01, AS02, ISCOMs, or ISCOMMATRIX.
[0064] The vaccine composition of the present invention for parenteral administration may comprise antioxidants, buffers, bacteriostatic agents, and aqueous and non-aqueous sterile injection solvents comprising solutes for making a solution condition isotonic to blood of an intended recipient and the like, and aqueous and non-aqueous sterile suspensions may include suspending agents and thickening agents. Additives that are useful for utilizing as a solvent for injection include, for example, water, alcohol, polyol, glycerin, and vegetable oil and the like. The composition may provide as a unit dose (one dose) or multiple doses (several doses) container. For example, the composition may provide as a sealed ampoule and vial, and may be stored under freeze dried condition that needs only the addition of sterile liquid carrier, for example, water that is necessary for preparing an injection solution just before use. For example, the administration may be carried out via muscular injection, subcutaneous injection, or intraperitoneal injection.
[0065] The vaccine composition of the present invention may be administered with a dose that is properly determined depending on health condition, body weight, sex of a subject to be administered, and administration purpose and the like.
[0066] According to one embodiment of the present invention, a polynucleotide that encodes Zika virus E protein domain III that is contained in the DNA vaccine composition of the present invention, or encodes Zika virus E protein domain III repeatedly three times, or a recombinant expression vector comprising the polynucleotide, for example, expression plasmid pVAX1-ENV domain III or pVAX1-ENV domain III X 3 expresses a Zika virus antigen protein in vivo after being injected in vivo, and produces and secretes a Zika virus antigen protein out of a cell. For example, the antigen protein may be produced inside a cell, and then, be transported by a signal peptide to outside of the cell. By the Zika virus antigen protein produced therefrom, an immune response to Zika virus may be induced in vivo.
[0067] The term immune response, as used herein, refers to an activation of immune system of a host, for example, a mammalian in response to an antigen introduction. The immune response may be cellular or humoral response, or both cellular and humoral response. In addition, the immune response may induce the production of a neutralizing antibody.
[0068] 5. Neutralizing Antibody and Preparation Method Thereof
[0069] The present invention provides a neutralizing antibody against Zika virus that is obtained using the polynucleotide, and a method for preparing the neutralizing antibody.
[0070] In one embodiment of the present invention, the neutralizing antibody may be obtained by the immunization of a mammalian using the polynucleotide. Specifically, a method for preparing the neutralizing antibody comprises a step of administering the polynucleotide to a mammalian, and a step of obtaining a neutralizing antibody that specifically binds to Zika virus from the mammalian. Wherein, the mammalian may be a mammalian excluding a human. For example, the mammalian includes rats, mice, hamsters, pigs, rabbits, horses, donkeys, goats, sheep, guinea pigs, llama and the like, but is not limited thereto. For example, mice may be used to produce monoclonal antibodies, and rabbits or guinea pigs may be used to produce polyclonal antibodies.
[0071] In one embodiment of the present invention, the neutralizing antibody produced in a non-human mammalian may be converted to a humanized antibody. In this case, the method of the present invention may further comprise a step of humanizing the neutralizing antibody produced in the non-human mammalian
[0072] The term humanized antibody, as used herein, is a genetically engineered antibody in which the CDRs from a non-human donor antibody are conjugated to a human recipient antibody sequence. The recipient antibody sequence may be, for example, a mature human antibody sequence, a complex of such sequences, a common sequence or a germline sequence of a human antibody sequence. Methods for converting from a non-human antibody to a humanized antibody can be performed by methods known in the art.
[0073] The neutralizing antibody of the present invention may be used for the prevention or treatment of diseases caused by the infection of Zika virus among mammalians The neutralizing antibody is used in a sufficient dose to neutralize Zika virus.
[0074] Hereinafter, the present invention will be described in more detail with reference to the following examples. However, the following examples are for illustrative purposes only and are not intended to limit the scope of the present invention.
EXAMPLE 1
Construction of DNA Vaccine Candidate
[0075] The polynucleotide encoding E protein (ENV) and prM, which are structural proteins of Zika virus (Candidate 1); the polynucleotide encoding E protein (Candidate 2); the polynucleotide encoding E protein domain III (Candidate 3); or the polynucleotide encoding E protein domain III repeatedly three times (Candidate 4) were separately inserted into the pVAX1 vector designed for the purpose of the development of a DNA vaccine, thereby four DNA vaccine candidates were constructed (Table 1 and
TABLE-US-00001 TABLE 1 Polynucleotide of DNA DNA Vaccine Vaccine Candidate Candidate Expression Protein (pVAX1 Vector) 1 prM + ENV SEQ ID NO: 4 2 ENV SEQ ID NO: 5 3 ENV domain III (alone) SEQ ID NO: 6 4 ENV domain III X 3 SEQ ID NO: 3 (repeatedly three times)
[0076] The domain III portion of the E protein is known to be important for antibody-forming reactions and protective immunity, since it contains a large number of cell receptor attaching motifs in the structural proteins of Zika virus. The domain III portion of the E protein was constructed alone or in a repeated structure by codon optimization so as to be expressed among mammalians (Candidates 3 and 4).
[0077] For this purpose, a PCR reaction was carried out using a SPH2O15 strain (Brazil Zika virus) clone as a template to amplify each protein gene of Candidates 1 to 3. Wherein the polynucleotide having the base sequence of SEQ ID NO: 7 was used as the polynucleotide that encodes the E protein domain III in Candidate 3. Forward (F) Primer and Reviser Primer used at that time are shown in Tables 2 to 4.
TABLE-US-00002 TABLE2 PrimerUsedinExpressionProteinGenePCR ofCandidate1 prME_Pstl_F ACAAGAGTGCACAGCGTCACTAGACGT GGGAGTG prME_Pstl_R CCTCTAGACTCGAGCTAATCAGCAGAG ACGGCTGTG
TABLE-US-00003 TABLE3 PrimerUsedinExpressionProteinGenePCR ofCandidate2 E_Pstl_F ACAAGAGTGCACAGCATCAGGTGCATA GGAGTC prME_Pstl_R CCTCTAGACTCGAGCTAATCAGCAGAG ACGGCTGTG
TABLE-US-00004 TABLE4 PrimerUsedinExpressionProteinGene PCRofCandidate3 ED3domainIII_Pstl_F ACAAGAGTGCACAGCGGCGTG TCATACTCCTTG ED3domainIII_Pstl_R CCTCTAGACTCGAGCTAGGTG CTGCCACTCCTGTG
[0078] In case of Candidate 4, the polynucleotide of SEQ ID NO: 1 encoding the E protein domain III repeatedly three times was constructed through the gene synthesis and then amplified by the PCR synthesis using the primer of Table 5.
TABLE-US-00005 TABLE5 Primerusedinexpressionproteingene PCRofCandidate4 ED3domainIIIx3_BHI_F TACCGAGCTCGGATCCGC CACCATGGATTG ED3domainIIIx3_Xhol_R GCCCTCTAGACTCGAGTC ATGTGCTACC
[0079] Each DNA vaccine candidate was constructed by linking the polynucleotide encoding the IgE signal peptide (SEQ ID NO: 2) to increase the amount of the expressed antigen. Specifically, pVAX1 vector comprising the IgE signal peptide and Kozak consensus sequence and each of the amplified genes were treated with the same restriction enzyme and ligated to construct each DNA vaccine candidate.
EXAMPLE 2
Mouse Immunization
[0080] 200 g of each DNA vaccine candidate prepared in Example 1 and aluminum hydroxide as an adjuvant were mixed, and 5-week-old female C57BL/6 mice were immunized by muscle inoculation three times at intervals of 3 weeks. Blood and splenocytes obtained from mice one week after the second and third inoculation were used to analyze cellular immune responses and humoral immune responses. Specific mouse immunization and immune response analysis schedules are shown in
EXAMPLE 3
Analysis of Antigen Specific Antibody Titer Against Zika Virus E Protein
[0081] Antigen specific antibody titers of vaccine candidates were analyzed using the serum obtained from mice immunized according to Example 2.
[0082] 50 l of 1 g/ml of the E protein derived from Baculovirus was added to each well of ELISA 96-well plate (Nunc Maxisorp; Nunc, 442404) using ELISA coating buffer (Biolegend, 4217), and was coated by reacting at 4 C. overnight. After the reaction, the reaction solution was removed, and washing buffer 1 PBST (0.05% Tween20) was added to each well to wash the cells repeatedly twice, and then, 100 l of blocking buffer PBS+ 1% BSA was added to each well, and was blocked by reacting at 37 C. for 2 hours.
[0083] As in the same manner, after washing with 1 PBST (0.05% Tween20) repeatedly twice, the immunized mouse serum of Example 2 diluted continuously in a dilution buffer PBS+ 1% BSA from 100:1 to 2:1 was used as a primary antibody and added to each well in an amount of 50 l, and reacted at 37 C. for 1 hour. After washing with 1 PBST (0.05% Tween20) repeatedly three times, mouse IgG (Santacruz, sc-2005) conjugated with horseradish peroxidase (HRP) as a secondary antibody was diluted with a dilution buffer PBS+ 1% BSA to 5000:1 and added to each well in an amount of 50 l, followed by reacting at 37 C. for 1 hour. After washing with 1 PBST (0.05% Tween20) repeatedly five times, 50 l of the coloring reagent TMB was added to each well, followed by reacting at room temperature for 10 minutes. The reaction was stopped by adding 100 l of the stop solution (GenDEPOT, T3550-100) to each well, and then, the absorbance was measured at 450 nm with an ELISA reader. The results are shown in
[0084] As shown in
EXAMPLE 4
Analysis of Specific IgG Subtype for Zika Virus E Protein
[0085] The subtypes of anti-Zika virus IgG antibodies formed in the immunized mice were analyzed using the serum of mice collected at Week 7 after inoculation with the vaccine candidates of Example 2.
[0086] The same ELISA analysis as used in Example 3 was used except that each subtype antibody of mouse IgG of Table 6 was used as a secondary antibody.
TABLE-US-00006 TABLE 6 Manufacturer (Southern Biotech) Subtype Catalog No. IgG1 1071-05 IgG2a 1081-05 IgG2b 1091-05 IgG3 1101-05
[0087] As a result, as shown in
EXAMPLE 5
Analysis of Neutralizing Antibody Titer
[0088] Neutralizing antibody titers of the vaccine candidates were analyzed using the serum obtained from the mice immunized according to Example 2.
[0089] Serum neutralization analysis was carried out in 96-well plates comprising confluent Vero cells seeded 24 hours prior to an analysis. Serum samples, which were two-fold serially diluted in the same volume, were mixed with 50 l of 100 TCID50 Zika virus (strain MR766, African line) and incubated at 37 C. for 1 hour. The mixture was applied to a monolayer of Vero cells and incubated at 37 C. for 5 days. The neutralizing antibody titer was determined as the highest-order dilution with no cytopathic effect (CPE), and the results are shown in
[0090] As shown in
EXAMPLE 6
Cellular Immune Response Analysis
[0091] The antigen specific T cell response was analyzed using splenocytes obtained from mice by the third inoculation of the DNA vaccine candidates in Example 2.
[0092] The separated splenocytes were stimulated with 1 g/ml of Zika virus pepmix (JPT), which consists of 146 mixtures of 15-mer peptides constituting the E protein of Zika virus, at 37 C. for 24 hours.
[0093] The expression level of interferon-gamma (IFN-) in splenocytes was analyzed by ELISPOT, and the results are shown in
[0094] In addition, the results of confirming IFN- expression in T cell through the flow cytometry (specifically, Fluorescence-Activated Cell Sorting (FACS)) analysis are shown in
[0095] Depositary authority name: Korea Research Institute of Bioscience and Biotechnology
[0096] Accession number: KCTC13685BP
[0097] Deposit date: Oct. 25, 2018