Composition for preventing odors containing odorless microorganism

10716872 ยท 2020-07-21

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to a composition for preventing odors containing odorless microorganisms or a culture thereof. The present invention also relates to a method for preventing odors including coating the composition for preventing odors. When a biofilm is formed by coating an object offensive odor-generating microorganisms can inhabit with the composition for preventing odors of the present invention, odors can be effectively prevented by significantly preventing the inflow and inhabitation of outside microorganisms that may generate offensive odors.

Claims

1. An evaporator core coated with a composition for preventing odors, wherein the composition comprises Methylobacterium or a culture thereof, wherein the Methylobacterium is one or more Methylobacterium selected from the group consisting of Methylobacterium komagatae, Methylobacterium aquaticum, Methylobacterium brachiatum and Methylobacterium platani.

2. The evaporator core according to claim 1, wherein microorganisms in the composition are coated on the evaporator core at a concentration of 10.sup.4-10.sup.8 CFU/g.

3. The evaporator core according to claim 2, wherein the microorganisms are coated using a microorganism culture having an optical density (O.D.) of 0.3-0.9.

4. The evaporator core according to claim 2, wherein the microorganisms in the composition form a biofilm on the evaporator core.

5. The evaporator core according to claim 1, wherein the Methylobacterium is one or more Methylobacterium selected from the group consisting of Methylobacterium komagatae HKMC-11 (KCCM11335P), Methylobacterium aquaticum HKMC-1 (KCCM11325P), Methylobacterium brachiatum HKMC-2 (KCCM11326P) and Methylobacterium platani HKMC-3 (KCCM11327P).

6. The evaporator core according to claim 1, wherein the composition further comprises one or more microorganism selected from the group consisting of Acinetobacter johnsonii HKMC-4 (KCCM11328P), Bacillus vietnamensis HKMC-5 (KCCM11329P), Brevibacillus invocatus HKMC-6 (KCCM11330P), Deinococcus ficus HKMC-7 (KCCM11331P), Leifsonia soli HKMC-8 (KCCM11332P), Pseudomonas nitroreducens HKMC-9 (KCCM11333P), Sphingomonas aquatilis HKMC-10 (KCCM11334P), Deinococcus apachensis HKMC-12 (KCCM11499P) and Flavobacterium oceanosedimentum HKMC-13 (KCCM11500P) or a culture thereof.

7. An air-conditioning system comprising an evaporator and a composition, wherein the evaporator is coated with the composition and the composition comprising Methylobacterium or a culture thereof, wherein the Methylobacterium is one or more Methylobacterium selected from the group consisting of Methylobacterium komagatae, Methylobacterium aquaticum, Methylobacterium brachiatum and Methylobacterium platani.

8. The air-conditioning system according to claim 7, wherein the Methylobacterium is one or more Methylobacterium selected from the group consisting of Methylobacterium komagatae HKMC-11 (KCCM11335P), Methylobacterium aquaticum HKMC-1 (KCCM11325P), Methylobacterium brachiatum HKMC-2 (KCCM11326P) and Methylobacterium platani HKMC-3 (KCCM11327P).

9. The air-conditioning system according to claim 7, wherein the composition further comprises one or more microorganism selected from the group consisting of Acinetobacter johnsonii HKMC-4 (KCCM11328P), Bacillus vietnamensis HKMC-5 (KCCM11329P), Brevibacillus invocatus HKMC-6 (KCCM11330P), Deinococcus ficus HKMC-7 (KCCM11331P), Leifsonia soli HKMC-8 (KCCM11332P), Pseudomonas nitroreducens HKMC-9 (KCCM11333P), Sphingomonas aquatilis HKMC-10 (KCCM11334P), Deinococcus apachensis HKMC-12 (KCCM11499P) and Flavobacterium oceanosedimentum HKMC-13 (KCCM11500P) or a culture thereof.

10. The air-conditioning system according to claim 7, wherein microorganisms in the composition are coated on the evaporator core at a concentration of 10.sup.4-10.sup.8 CFU/g.

11. The air-conditioning system according to claim 10, wherein the microorganisms are coated using a microorganism culture having an optical density (O.D.) of 0.3-0.9.

12. The air-conditioning system according to claim 10, wherein the microorganisms in the composition form a biofilm on the evaporator core.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows a Petri dish in which a sterilized aluminum fin is dipped in a nutrient medium for inoculation with odorless microorganisms.

(2) FIG. 2 shows the population of colonies of different colors for a combination 1 in survival evaluation for 30 days.

(3) FIG. 3 shows the ratio of colonies of different colors for a combination 1 in survival evaluation for 30 days.

(4) FIG. 4 shows the ratio of strains for a combination 1 in survival evaluation for 30 days measured by REP-PCR.

(5) FIG. 5 shows the ratio of strains for a combination 2 in survival evaluation for 30 days measured by REP-PCR.

(6) FIG. 6 shows the ratio of strains for a combination 3 in survival evaluation for 30 days measured by REP-PCR.

(7) FIG. 7 shows the ratio of Methylobacterium sp. strains for a combination 3 in survival evaluation for 30 days measured by REP-PCR.

(8) FIG. 8 shows the ratio of strains for a combination 4 in survival evaluation for 30 days measured by REP-PCR.

(9) FIG. 9 shows the ratio of strains for a combination 5 in survival evaluation for 30 days measured by REP-PCR.

(10) FIG. 10 shows the ratio of strains for a combination A in survival evaluation for 30 days measured by REP-PCR.

(11) FIG. 11 shows the ratio of strains for a combination B in survival evaluation for 30 days measured by REP-PCR.

(12) FIG. 12 shows the ratio of strains for a combination C in survival evaluation for 30 days measured by REP-PCR.

(13) FIG. 13 shows the ratio of strains for a combination D in survival evaluation for 30 days measured by REP-PCR.

(14) FIG. 14 shows the ratio of strains for a combination E in survival evaluation for 30 days measured by REP-PCR.

(15) FIG. 15 shows the ratio of strains for a combination F in survival evaluation for 30 days measured by REP-PCR.

(16) FIG. 16 shows the population of a combination of Methylobacterium aquaticum and Methylobacterium komagatae in survival evaluation for 90 days.

(17) FIG. 17 shows the ratio of strains for a combination of Methylobacterium aquaticum and Methylobacterium komagatae in survival evaluation for 90 days measured by REP-PCR.

(18) FIG. 18 shows the population of a combination of Methylobacterium aquaticum and Methylobacterium komagatae on a jig.

(19) FIG. 19 shows the change in the population of a combination of Methylobacterium aquaticum and Methylobacterium komagatae on a jig measured by REP-PCR.

DETAILED DESCRIPTION

(20) Hereinafter, the present invention will be described in more detail through examples. The following examples are for illustrative purposes only and it will be apparent to those or ordinary skill in the related art that the scope of this invention is not limited by the examples.

EXAMPLES

Example 1

Used Vehicles Giving Off Offensive Odors

(21) TABLE-US-00001 TABLE 1 No. Vehicle Sample type 1 Vehicle A Evaporator core 2 Vehicle B Evaporator core 3 Vehicle C Evaporator core 4 Vehicle D Evaporator core 5 Vehicle E Evaporator core

(22) Evaporator core samples were taken from the evaporator cores mounted in 5 used vehicles (vehicles A-E) giving off offensive odors.

Example 2

Preparation of Evaporator Core Samples

(23) The evaporator core samples taken from the evaporator cores of the used vehicles A-E were stored in sealed polyethylene bags at 4 C. until use. For isolation and culturing of microorganisms, 5 g of fin samples were taken from each evaporator core at various parts including front and rear parts using sterilized long-nose pliers and then mixed before use.

Example 3

Detachment of Microorganisms From Evaporator Cores

(24) Microorganisms were detached from the evaporator cores as follows. {circle around (1)} The samples taken from the evaporator core were mixed and put in a mixer. {circle around (2)} 200 mL of sterilized 1 phosphate buffed saline (PBS) were added to the mixer. {circle around (3)} The mixed samples and the PBS were mixed for 30 seconds. {circle around (4)} The mixer was left on ice for 1 minute. {circle around (5)} The steps {circle around (3)} and {circle around (4)} were repeated 2 more times. {circle around (6)} The resulting suspension was centrifuged at 4 C. for 3 minutes at 13000 rpm. {circle around (7)} Only the supernatant was taken and transferred to a fresh tube. {circle around (8)} The surface of the evaporator core from which the samples were taken was wiped several times with a sterilized cotton swab soaked with the supernatant. {circle around (9)} The head of the cotton swab was put in the supernatant and then vortexed. custom character The precipitate obtained in the step {circle around (6)} and the mixture obtained in the {circle around (9)} were mixed and used as an inoculation solution.

(25) Microorganisms were physically detached from the evaporator cores of the vehicles A-E through the steps {circle around (1)}-custom character.

Example 4

Isolation and Culturing of Microorganisms

(26) Aerobic heterotrophic bacteria usually called normal bacteria were isolated from the air conditioner by culturing on a heterotrophic plate. PTYG agar medium and R2A agar medium were used as complex nutrient media to isolate the normal bacteria. The PTYG agar medium was prepared by adding 0.25 g of peptone (Difco), 0.25 g of triptone (Difco), 0.5 g of yeast extract (Difco), 0.5 g of glucose (Difco), 30 mg of MgSO.sub.4 (Sigma), 3 mg of CaCl.sub.2 (Sigma) and 15 g of Bacto agar (Difco) to 980 mL of distilled water and sterilizing at 121 C. for 15 minutes under high pressure after adjusting pH to 7.0. The R2A agar medium was prepared by adding 0.5 g of yeast extract (Difco), 0.5 g of proteose peptone No. 3 (Difco), 0.5 g of casamino acids (Difco), 0.5 g of dextrose (Difco), 0.5 g of soluble starch (Difco), 0.3 g of sodium pyruvate (Difco), 0.3 g of dipotassium sulfate (Difco), 0.05 g of magnesium sulfate (Difco) and 15 g of Bacto agar (Difco) to 980 mL of distilled water and sterilizing at 121 C. for 15 minutes under high pressure after adjusting pH to 7.2. Three kinds of antibiotics (Table 2) were used to isolate the non-dominant normal bacteria. Each antibiotic was inoculated at about 50 C. after filter-sterilizing the medium to a concentration of 100 ppm.

(27) TABLE-US-00002 TABLE 2 No. Antibiotic Type Manufacturer 1 Kanamycin Aminoglycoside Sigma 2 Ampicillin beta-lactam Sigma 3 Chloramphenicol Chloramphenicol Sigma

Example 5

Isolation and Culturing of Fungi (Molds)

(28) Fungi (molds) were isolated from the air conditioner by culturing on an aerobic plate using nutrient media. Potato dextrose agar medium and malt extract agar medium were used to isolate the fungi (molds). The potato dextrose agar medium was prepared by adding 4 g of potato starch (Difco), 20 g of dextrose (Difco) and 15 g of Bacto agar (Difco) to 980 mL of distilled water and sterilizing at 121 C. for 15 minutes under high pressure after adjusting pH to 5.1. The malt extract agar medium was prepared by adding 20 g of malt extract (Difco) and 15 g (Difco) of Bacto agar to 980 mL of distilled water and sterilizing at 121 C. for 15 minutes under high pressure after adjusting pH to 5.0.

(29) A 90 mm15 mm Petri dish was used to culture the fungi and the cultured fungi were isolated using a 60 mm15 mm Petri dish.

Example 6

Isolation and Culturing of Dominant Strains

(30) Dominant strains were isolated and cultured based on dilution ratios or morphological characteristics such as the color, size, shape, etc. of the colonies as follows. {circle around (1)} Molds and bacteria were separated from the culture media. {circle around (2)} The bacteria exhibiting different morphologies were separated by inoculating to complex media using a loop. {circle around (3)} From the inoculated media, the bacterial culture showing the best growth was selected and subcultured. {circle around (4)} The molds were inoculated to complex media after removing the hypha end portions using a scalpel. {circle around (5)} From the inoculated media, the mold culture showing the best growth was selected and subcultured.

Example 7

Genetic Characterization of Dominant Bacteria

(31) Fingerprinting Based on Analysis of REP-PCR Patterns

(32) REP-PCR is a molecular biological fingerprinting technique for structural analysis of bacterial chromosomes, which allows distinguishment of different bacterial strains. Genetic characterization was carried out by REP-PCR as follows.

(33) (1) Cell Lysis {circle around (1)} 2.5 L of a Lyse-N-Go PCR reagent (Thermo) was added to a PCR tube. {circle around (2)} A colony was pipetted onto the tube on a clean bench. During the pipetting, caution was made such that the resulting solution did not become turbid. {circle around (3)} Culturing was performed on a PCR machine according to the manufacturer's instructions. {circle around (4)} Cell lysis was conducted according to the lysis protocol described in Table 3. At the 9th cycle, the temperature was held at 80 C.

(34) TABLE-US-00003 TABLE 3 Cycle Temperature ( C.) Time (seconds) 1 65 30 2 8 30 3 65 90 4 97 180 5 8 60 6 65 180 7 97 60 8 65 60 9 80 hold

(35) (2) PCR Reaction

(36) Using a PCR reagent prepared as described in Table 4, PCR amplification was carried out by conducting pre-denaturation at 94 C. for 7 minutes and repeating 33 cycles of denaturation at 92 C. for 1 minute, annealing at 51.5 C. for 1 minute and extension at 65 C. for 8 minutes, as described in Table 5.

(37) TABLE-US-00004 TABLE4 {circle around (1)} dNTP(2.5mMeach) 12.5L {circle around (2)} Gitschierbuffer 5.0L {circle around (3)} DMSO(100%) 2.5L {circle around (4)} Autoclaved3 D.W. 0.3L {circle around (5)} BOXA1Rprimer(50pmole/L) 1.0L 5CTACGGCAAGGCGACGCTGACG {circle around (6)} BSA(10mg/mL) 0.4L {circle around (7)} BacterialDNA 2.5L {circle around (8)} Taqpolymerase(Roche)(5U/L) 0.8L

(38) TABLE-US-00005 TABLE 5 Step 1 93 C. 7 min Step 2 92 C. 1 min Step 3 51.5 C. 1 min Step 4 65 C. 8 min Steps 2, 3, 4: additional 33 cycles Step 6 65 C. 16 min Step 7 4 C.

(39) (3) Gel Electrophoresis

(40) The PCR-amplified DNA fragments were loaded onto 1.2-1.5% agarose gel supplemented with EtBr after mixing a 6 dye with the sample at a ratio of 1:5. Since most PCR products were in the range of 100-1000 bp, they were loaded tougher with 100 bp ladders. Then, electrophoresis was carried out as slowly as possible (50 V) such that bromophenol blue and xylene cyanol dyes moved halfway of the entire gel. The strains exhibiting the same DNA pattern on the gel were regarded as the same strains.

(41) (4) Isolation of Dominant Bacteria Based on 16S rRNA Gene Analysis

(42) The 16S ribosomal ribonucleic acid (rRNA) gene is used to genetic identification of bacteria. The bacteria differentiated by REP-PCR can be identified in the levels of genus and species thereby. 16S rRNA is an RNA which constitutes a ribosome by interacting with various proteins. Since the full sequences or base sequences of oligonucleotides are known for more than 2000 bacterial species, bacteria can be grouped based on the similarity of the 16S rRNA gene. Because the difference in the base sequence of the 16S rRNA gene is much smaller than those of the base sequences of other genes in the genome, the similarity of the base sequence of 16S rRNA is considered as a measure of the evolutionary distance between organisms. The identification of microorganisms, in particular, industrially useful microorganisms, based on the similarity of the base sequence of 16S rRNA gene fragments has been used as a typical identification method together with fatty acid analysis and carbohydrate assimilation profiling.

(43) <16S rRNA PCR>

(44) PCR conditions (total 50 L): A mixture (44.5 L) of the solutions described in Table 6, except for DNA and Taq, was added to the lysis solution described above. Subsequently, PCR amplification was carried out by conducting pre-denaturation at 94 C. for 5 minutes and repeating 29 cycles of denaturation at 94 C. for 1 minute, annealing at 55 C. for 1 minute and extension at 72 C. for 1 minute and 30 seconds, as described in Table 7.

(45) TABLE-US-00006 TABLE 6 Autoclaved 3 D.W. 22 L 10x buffer (Roche) 5 L dNTP (Roche, 2.5 mM) 5 L DMSO 5 L BSA (10 mg/mL) 2.5 L 27mf (20 pmole/L) 2.5 L 1492r (20 pmole/L) 2.5 L DNA 5 L Taq (Roche) 0.5 L

(46) TABLE-US-00007 TABLE 7 Step 1 94 C. 5 min Step 2 94 C. 1 min Step 3 55 C. 1 min Step 4 72 C. 1 min 30 sec Go to step 2: additional 29 cycles Step 6 72 C. 10 min Step 7 4 C. hold

(47) (5) PCR Purification

(48) The 16S rRNA PCR products were purified using a QIAquick PCR purification kit. {circle around (1)} The PCR products were added to a 5PB buffer. {circle around (2)} The resulting solution was transferred to a QIAquick column. {circle around (3)} For DNA binding, the solution was centrifuged for 1 minute. {circle around (4)} For washing, 750 L of PE buffer was added to the QIAquick column and centrifugation was performed for 1 minute. {circle around (5)} Centrifugation was performed for 1 minute. {circle around (6)} The resulting solution was transferred to a fresh QIAquick column. {circle around (7)} For DNA extraction, 30 L of EB buffer was added and the resulting solution was allowed to stand for 1 minute. {circle around (8)} After performing centrifugation for 1 minute, the DNA dissolved in EB was collected in a tube.

(49) (6) Isolated Microorganisms and Characteristics Thereof

(50) <Microorganism 1>

(51) 1. Name of microorganism: HKMC-1 Genus: Methylobacterium Species: aquaticum

(52) Accession number: KCCM11325P (2012.11.14)

(53) Depository: Korean Culture Center of Microorganisms

(54) Depository Address: 361-221, Yurim B/D Hongje-1-dong, Seodaemun-gu, SEOUL, 120-091, Republic of Korea

(55) 2. Reconstitution Condition

(56) a. Reconstituting Agent (1) Composition: PTYG medium (per 1 L of medium, 0.25 g of peptone, 0.25 g of triptone, 0.5 g of yeast extract, 0.5 g of glucose, 30 mg of MgSO.sub.4 and 3 mg of CaCl.sub.2) or R2A medium.

(57) (2) pH: 7.0

(58) (3) Sterilizing condition: 20 minutes at 121 C. b. Culturing at 28 C. for 7 days

(59) 3. Medium (1) Composition: PTYG medium (per 1 L of medium, 0.25 g of peptone, 0.25 g of triptone, 0.5 g of yeast extract, 0.5 g of glucose, 30 mg of MgSO.sub.4 and 3 mg of CaCl.sub.2) or R2A medium. (2) pH: 7.0 (3) Sterilizing condition: 20 minutes at 121 C.

(60) 4. Culturing Condition a. Aerobic/anaerobic: aerobic b. Temperature: 28 C. c. Culturing with or without agitation (liquid or solid)

(61) 5. Storing Condition Temperature: 70 C.

(62) <Microorganism 2>

(63) 1. Name of microorganism: HKMC-2 Genus: Methylobacterium Species: brachiatum

(64) Accession number: KCCM11326P (2012.11.14)

(65) Depository: Korean Culture Center of Microorganisms

(66) Depository Address: 361-221, Yurim B/D Hongje-1-dong, Seodaemun-gu, SEOUL, 120-091, Republic of Korea

(67) 2. Reconstitution Condition a. Reconstituting Agent (1) Composition: PTYG medium (per 1 L of medium, 0.25 g of peptone, 0.25 g of triptone, 0.5 g of yeast extract, 0.5 g of glucose, 30 mg of MgSO.sub.4 and 3 mg of CaCl.sub.2) or R2A medium. (2) pH: 7.0 (3) Sterilizing condition: 20 minutes at 121 C. b. Culturing at 28 C. for 7 days

(68) 3. Medium (1) Composition: PTYG medium (per 1 L of medium, 0.25 g of peptone, 0.25 g of triptone, 0.5 g of yeast extract, 0.5 g of glucose, 30 mg of MgSO.sub.4 and 3 mg of CaCl.sub.2) or R2A medium. (2) pH: 7.0 (3) Sterilizing condition: 20 minutes at 121 C.

(69) 4. Culturing Condition a. Aerobic/anaerobic: aerobic b. Temperature: 28 C. c. Culturing with or without agitation (liquid or solid)

(70) 5. Storing Condition Temperature: 70 C.

(71) <Microorganism 3>

(72) 1. Name of microorganism: HKMC-3 Genus: Methylobacterium Species: platani Accession number: KCCM11327P (2012.11.14) Depository: Korean Culture Center of Microorganisms

(73) Depository Address: 361-221, Yurim B/D Hongje-1-dong, Seodaemun-gu, SEOUL, 120-091, Republic of Korea

(74) 2. Reconstitution Condition a. Reconstituting agent (1) Composition: PTYG medium (per 1 L of medium, 0.25 g of peptone, 0.25 g of triptone, 0.5 g of yeast extract, 0.5 g of glucose, 30 mg of MgSO.sub.4 and 3 mg of CaCl.sub.2) or R2A medium. (2) pH: 7.0 (3) Sterilizing condition: 20 minutes at 121 C. b. Culturing at 28 C. for 7 days

(75) 3. Medium (1) Composition: PTYG medium (per 1 L of medium, 0.25 g of peptone, 0.25 g of triptone, 0.5 g of yeast extract, 0.5 g of glucose, 30 mg of MgSO.sub.4 and 3 mg of CaCl.sub.2) or R2A medium. (2) pH: 7.0 (3) Sterilizing condition: 20 minutes at 121 C.

(76) 4. Culturing Condition a. Aerobic/anaerobic: aerobic b. Temperature: 28 C. c. Culturing with or without agitation (liquid or solid)

(77) 5. Storing Condition Temperature: 70 C.

(78) <Microorganism 4>

(79) 1. Name of microorganism: HKMC-4 Genus: Acinetobacter Species: johnsonii Accession number: KCCM11328P (2012.11.14) Depository: Korean Culture Center of Microorganisms Depository Address: 361-221, Yurim B/D Hongje-1-dong, Seodaemun-gu, SEOUL, 120-091, Republic of Korea

(80) 2. Reconstitution Condition a. Reconstituting Agent (1) Composition: PTYG medium (per 1 L of medium, 0.25 g of peptone, 0.25 g of triptone, 0.5 g of yeast extract, 0.5 g of glucose, 30 mg of MgSO.sub.4 and 3 mg of CaCl.sub.2) or R2A medium.

(81) (2) pH: 7.0 (3) Sterilizing condition: 20 minutes at 121 C. b. Culturing at 28 C. for 7 days

(82) 3. Medium (1) Composition: PTYG medium (per 1 L of medium, 0.25 g of peptone, 0.25 g of triptone, 0.5 g of yeast extract, 0.5 g of glucose, 30 mg of MgSO.sub.4 and 3 mg of CaCl.sub.2) or R2A medium. (2) pH: 7.0 (3) Sterilizing condition: 20 minutes at 121 C.

(83) 4. Culturing Condition a. Aerobic/anaerobic: aerobic b. Temperature: 28 C. c. Culturing with or without agitation (liquid or solid)

(84) 5. Storing Condition Temperature: 70 C.

(85) <Microorganism 5>

(86) 1. Name of microorganism: HKMC-5 Genus: Bacillus Species: vietnamensis Accession number: KCCM11329P (2012.11.14) Depository: Korean Culture Center of Microorganisms Depository Address: 361-221, Yurim B/D Hongje-1-dong, Seodaemun-gu, SEOUL, 120-091, Republic of Korea

(87) 2. Reconstitution Condition a. Reconstituting agent (1) Composition: PTYG medium (per 1 L of medium, 0.25 g of peptone, 0.25 g of triptone, 0.5 g of yeast extract, 0.5 g of glucose, 30 mg of MgSO.sub.4 and 3 mg of CaCl.sub.2) or R2A medium. (2) pH: 7.0 (3) Sterilizing condition: 20 minutes at 121 C. b. Culturing at 28 C. for 7 days

(88) 3. Medium (1) Composition: PTYG medium (per 1 L of medium, 0.25 g of peptone, 0.25 g of triptone, 0.5 g of yeast extract, 0.5 g of glucose, 30 mg of MgSO.sub.4 and 3 mg of CaCl.sub.2) or R2A medium. (2) pH: 7.0 (3) Sterilizing condition: 20 minutes at 121 C.

(89) 4. Culturing Condition a. Aerobic/anaerobic: aerobic b. Temperature: 28 C. c. Culturing with or without agitation (liquid or solid)

(90) 5. Storing Condition Temperature: 70 C.

(91) <Microorganism 6>

(92) 1. Name of microorganism: HKMC-6 Genus: Brevibacillus Species: invocatus Accession number: KCCM11330P (2012.11.14) Depository: Korean Culture Center of Microorganisms Depository Address: 361-221, Yurim B/D Hongje-1-dong, Seodaemun-gu, SEOUL, 120-091, Republic of Korea

(93) 2. Reconstitution Condition a. Reconstituting agent (1) Composition: PTYG medium (per 1 L of medium, 0.25 g of peptone, 0.25 g of triptone, 0.5 g of yeast extract, 0.5 g of glucose, 30 mg of MgSO.sub.4 and 3 mg of CaCl.sub.2) or R2A medium. (2) pH: 7.0 (3) Sterilizing condition: 20 minutes at 121 C. b. Culturing at 28 C. for 7 days

(94) 3. Medium (1) Composition: PTYG medium (per 1 L of medium, 0.25 g of peptone, 0.25 g of triptone, 0.5 g of yeast extract, 0.5 g of glucose, 30 mg of MgSO.sub.4 and 3 mg of CaCl.sub.2) or R2A medium. (2) pH: 7.0 (3) Sterilizing condition: 20 minutes at 121 C.

(95) 4. Culturing Condition a. Aerobic/anaerobic: aerobic b. Temperature: 28 C. c. Culturing with or without agitation (liquid or solid)

(96) 5. Storing Condition Temperature: 70 C.

(97) <Microorganism 7>

(98) 1. Name of microorganism: HKMC-7 Genus: Deinococcus Species: ficus Accession number: KCCM11331P (2012.11.14) Depository: Korean Culture Center of Microorganisms Depository Address: 361-221, Yurim B/D Hongje-1-dong, Seodaemun-gu, SEOUL, 120-091, Republic of Korea

(99) 2. Reconstitution Condition a. Reconstituting agent (1) Composition: PTYG medium (per 1 L of medium, 0.25 g of peptone, 0.25 g of triptone, 0.5 g of yeast extract, 0.5 g of glucose, 30 mg of MgSO.sub.4 and 3 mg of CaCl.sub.2) or R2A medium. (2) pH: 7.0 (3) Sterilizing condition: 20 minutes at 121 C. b. Culturing at 28 C. for 7 days

(100) 3. Medium (1) Composition: PTYG medium (per 1 L of medium, 0.25 g of peptone, 0.25 g of triptone, 0.5 g of yeast extract, 0.5 g of glucose, 30 mg of MgSO.sub.4 and 3 mg of CaCl.sub.2) or R2A medium. (2) pH: 7.0 (3) Sterilizing condition: 20 minutes at 121 C.

(101) 4. Culturing Condition a. Aerobic/anaerobic: aerobic b. Temperature: 28 C. c. Culturing with or without agitation (liquid or solid)

(102) 5. Storing Condition Temperature: 70 C.

(103) <Microorganism 8>

(104) 1. Name of microorganism: HKMC-8 Genus: Leifsonia Species: soli Accession number: KCCM11332P (2012.11.14) Depository: Korean Culture Center of Microorganisms Depository Address: 361-221, Yurim B/D Hongje-1-dong, Seodaemun-gu, SEOUL, 120-091, Republic of Korea

(105) 2. Reconstitution Condition a. Reconstituting agent (1) Composition: PTYG medium (per 1 L of medium, 0.25 g of peptone, 0.25 g of triptone, 0.5 g of yeast extract, 0.5 g of glucose, 30 mg of MgSO.sub.4 and 3 mg of CaCl.sub.2) or R2A medium. (2) pH: 7.0 (3) Sterilizing condition: 20 minutes at 121 C. b. Culturing at 28 C. for 7 days

(106) 3. Medium (1) Composition: PTYG medium (per 1 L of medium, 0.25 g of peptone, 0.25 g of triptone, 0.5 g of yeast extract, 0.5 g of glucose, 30 mg of MgSO.sub.4 and 3 mg of CaCl.sub.2) or R2A medium. (2) pH: 7.0 (3) Sterilizing condition: 20 minutes at 121 C.

(107) 4. Culturing Condition a. Aerobic/anaerobic: aerobic b. Temperature: 28 C. c. Culturing with or without agitation (liquid or solid)

(108) 5. Storing Condition Temperature: 70 C.

(109) <Microorganism 9>

(110) 1. Name of microorganism: HKMC-9 Genus: Pseudomonas Species: nitroreducens Accession number: KCCM11333P (2012.11.14) Depository: Korean Culture Center of Microorganisms Depository Address: 361-221, Yurim B/D Hongje-1-dong, Seodaemun-gu, SEOUL, 120-091, Republic of Korea

(111) 2. Reconstitution Condition a. Reconstituting agent (1) Composition: PTYG medium (per 1 L of medium, 0.25 g of peptone, 0.25 g of triptone, 0.5 g of yeast extract, 0.5 g of glucose, 30 mg of MgSO.sub.4 and 3 mg of CaCl.sub.2) or R2A medium. (2) pH: 7.0 (3) Sterilizing condition: 20 minutes at 121 C. b. Culturing at 28 C. for 7 days

(112) 3. Medium (1) Composition: PTYG medium (per 1 L of medium, 0.25 g of peptone, 0.25 g of triptone, 0.5 g of yeast extract, 0.5 g of glucose, 30 mg of MgSO.sub.4 and 3 mg of CaCl.sub.2) or R2A medium. (2) pH: 7.0 (3) Sterilizing condition: 20 minutes at 121 C.

(113) 4. Culturing Condition a. Aerobic/anaerobic: aerobic b. Temperature: 28 C. c. Culturing with or without agitation (liquid or solid)

(114) 5. Storing Condition Temperature: 70 C.

(115) <Microorganism 10>

(116) 1. Name of microorganism: HKMC-10 Genus: Sphingomonas Species: aquatilis Accession number: KCCM11334P (2012.11.14) Depository: Korean Culture Center of Microorganisms Depository Address: 361-221, Yurim B/D Hongje-1-dong, Seodaemun-gu, SEOUL, 120-091, Republic of Korea

(117) 2. Reconstitution Condition a. Reconstituting agent (1) Composition: PTYG medium (per 1 L of medium, 0.25 g of peptone, 0.25 g of triptone, 0.5 g of yeast extract, 0.5 g of glucose, 30 mg of MgSO.sub.4 and 3 mg of CaCl.sub.2) or R2A medium. (2) pH: 7.0 (3) Sterilizing condition: 20 minutes at 121 C. b. Culturing at 28 C. for 7 days

(118) 3. Medium (1) Composition: PTYG medium (per 1 L of medium, 0.25 g of peptone, 0.25 g of triptone, 0.5 g of yeast extract, 0.5 g of glucose, 30 mg of MgSO.sub.4 and 3 mg of CaCl.sub.2) or R2A medium. (2) pH: 7.0 (3) Sterilizing condition: 20 minutes at 121 C.

(119) 4. Culturing Condition a. Aerobic/anaerobic: aerobic b. Temperature: 28 C. c. Culturing with or without agitation (liquid or solid)

(120) 5. Storing Condition Temperature: 70 C.

(121) <Microorganism 11>

(122) 1. Name of microorganism: HKMC-11 Genus: Methylobacterium Species: komagatae Accession number: KCCM11335P (2012.11.14) Depository: Korean Culture Center of Microorganisms Depository Address: 361-221, Yurim B/D Hongje-1-dong, Seodaemun-gu, SEOUL, 120-091, Republic of Korea

(123) 2. Reconstitution Condition a. Reconstituting agent (1) Composition: PTYG medium (per 1 L of medium, 0.25 g of peptone, 0.25 g of triptone, 0.5 g of yeast extract, 0.5 g of glucose, 30 mg of MgSO.sub.4 and 3 mg of CaCl.sub.2) or R2A medium. (2) pH: 7.0 (3) Sterilizing condition: 20 minutes at 121 C. b. Culturing at 28 C. for 7 days

(124) 3. Medium (1) Composition: PTYG medium (per 1 L of medium, 0.25 g of peptone, 0.25 g of triptone, 0.5 g of yeast extract, 0.5 g of glucose, 30 mg of MgSO.sub.4 and 3 mg of CaCl.sub.2) or R2A medium. (2) pH: 7.0 (3) Sterilizing condition: 20 minutes at 121 C.

(125) 4. Culturing Condition a. Aerobic/anaerobic: aerobic b. Temperature: 28 C. c. Culturing with or without agitation (liquid or solid)

(126) 5. Storing Condition Temperature: 70 C.

(127) <Microorganism 12>

(128) 1. Name of microorganism: HKMC-12 Genus: Deinococcus Species: apachensis Accession number: KCCM11499P (2013.12.10) Depository: Korean Culture Center of Microorganisms Depository Address: 361-221, Yurim B/D Hongje-1-dong, Seodaemun-gu, SEOUL, 120-091, Republic of Korea

(129) 2. Reconstitution Condition a. Reconstituting agent (1) Composition: PTYG medium (per 1 L of medium, 0.25 g of peptone, 0.25 g of triptone, 0.5 g of yeast extract, 0.5 g of glucose, 30 mg of MgSO.sub.4 and 3 mg of CaCl.sub.2) or R2A medium. (2) pH: 7.0 (3) Sterilizing condition: 20 minutes at 121 C. b. Culturing at 28 C. for 7 days

(130) 3. Medium (1) Composition: PTYG medium (per 1 L of medium, 0.25 g of peptone, 0.25 g of triptone, 0.5 g of yeast extract, 0.5 g of glucose, 30 mg of MgSO.sub.4 and 3 mg of CaCl.sub.2) or R2A medium. (2) pH: 7.0 (3) Sterilizing condition: 20 minutes at 121 C.

(131) 4. Culturing Condition a. Aerobic/anaerobic: aerobic b. Temperature: 28 C. c. Culturing with or without agitation (liquid or solid)

(132) 5. Storing Condition Temperature: 70 C.

(133) <Microorganism 13>

(134) 1. Name of microorganism: HKMC-13 Genus: Flavobacterium Species: oceanosedimentum Accession number: KCCM11500P (2013.12.10) Depository: Korean Culture Center of Microorganisms Depository Address: 361-221, Yurim B/D Hongje-1-dong, Seodaemun-gu, SEOUL, 120-091, Republic of Korea

(135) 2. Reconstitution Condition a. Reconstituting agent (1) Composition: PTYG medium (per 1 L of medium, 0.25 g of peptone, 0.25 g of triptone, 0.5 g of yeast extract, 0.5 g of glucose, 30 mg of MgSO.sub.4 and 3 mg of CaCl.sub.2) or R2A medium. (2) pH: 7.0 (3) Sterilizing condition: 20 minutes at 121 C. b. Culturing at 28 C. for 7 days

(136) 3. Medium (1) Composition: PTYG medium (per 1 L of medium, 0.25 g of peptone, 0.25 g of triptone, 0.5 g of yeast extract, 0.5 g of glucose, 30 mg of MgSO.sub.4 and 3 mg of CaCl.sub.2) or R2A medium. (2) pH: 7.0 (3) Sterilizing condition: 20 minutes at 121 C.

(137) 4. Culturing Condition a. Aerobic/anaerobic: aerobic b. Temperature: 28 C. c. Culturing with or without agitation (liquid or solid)

(138) 5. Storing Condition Temperature: 70 C.

Example 8

Sensory Evaluation of Isolated Microorganisms on Aluminum Fin

(139) (1) Culturing in Nutrient Medium

(140) For sensory evaluation of 11 species from among the microorganisms identified in Example 7, the microorganisms were cultured in nutrient media at 28 C. for 7 days. The procedure of culturing the bacteria in nutrient media was as follows. {circle around (1)} The isolated microorganisms were inoculated to a liquid nutrient medium. {circle around (2)} Culturing was performed at 28 C. for 5-7 days. {circle around (3)} 100 L of the bacteria cultured in the liquid medium were inoculated to a solid nutrient medium. {circle around (4)} The inoculated bacteria were spread uniformly using a spreader. {circle around (5)} The bacteria were cultured on a sealed Petri dish at 28 C. for 10 days.

(141) (2) Sensory Evaluation on Aluminum Fin

(142) A rectangular aluminum fin was sterilized and then dipped in a nutrient medium. For bacterial inoculation, culturing was performed in the nutrient medium under the same conditions of the steps {circle around (2)}-{circle around (4)}. The sensory evaluation result is given in Table 8. {circle around (1)} Antimicrobial-treated aluminum fin: A commercially available, antimicrobial-coated evaporator core product was used. {circle around (2)} Non-antimicrobial-treated, hydrophilic-coated aluminum fin: An aluminum fin which was hydrophilic-coated only, without antimicrobial coating, was specially manufactured for comparison with the antibacterial-coated fin. Although the evaporator core was manufactured from aluminum to reduce weight, it can also be made from other metals such as copper, stainless steel, etc.

(143) TABLE-US-00008 TABLE 8 Non- Anti- anti- microbial- microbial- No. treated fin treated fin Strain 1 odorless odorless Methylobacterium aquaticum HKMC-1 2 odorless odorless Methylobacterium brachiatum HKMC-2 3 odorless odorless Methylobacterium platani HKMC-3 4 odorless odorless Acinetobacter johnsonii HKMC-4 5 odorless odorless Bacillus vietnamensis HKMC-5 6 odorless odorless Brevibacillus invocatus HKMC-6 7 odorless odorless Deinococcus ficus HKMC-7 8 odorless odorless Leifsonia soli HKMC-8 9 odorless odorless Pseudomonas nitroreducens HKMC-9 10 odorless odorless Sphingomonas aquatilis HKMC-10 11 odorless odorless Methylobacterium komagatae HKMC-11

(144) No odor was detectable for all of the 11 microorganism species when they were cultured after inoculation onto the antimicrobial-treated aluminum fin and the non-antimicrobial-treated fin.

Example 9

Evaluation of Optimal Condition For Coating Odorless Microorganisms

(145) (1) Analysis of Optimal Concentration For Coating Odorless Microorganisms on Fin

(146) For coating of the 11 odorless microorganism species on an evaporator core, optimal coating concentration for inoculating the microorganisms to a concentration of about 10.sup.6 CFU/g was investigated as described in the priority application of 2012. Methylobacterium aquaticum was cultured at 28 C. until the late log phase and then cultured at 4 C. for 18 hours after washing with sterilized 0.85% saline. After the culturing at 4 C., optical density (O.D.) was measured to be 0.749, 0.588, 0.55, 0.5 and 0.45. 2 g of a U-shaped fin was coated with the culture by dipping for 1 hour at room temperature and shaking at constant rpm. The fin coated with the microorganism at different concentrations was removed from the mixer and plated onto an R2A agar plate after serial dilution.

(147) It was found out that the concentration of the microorganisms coated on the fin varied depending on the O.D. values. When O.D. was 0.749, the coating degree was about 1.5310.sup.81.5210.sup.7 CFU/g fin. And, when O.D. was 0.588 and 0.55, the coating degree was about 4.0010.sup.71.0010.sup.7 CFU/g fin and 1.0310.sup.78.5010.sup.5 CFU/g fin, respectively. In addition, when O.D. was 0.5 and 0.45, the coating degree was 6.0010.sup.67.0010.sup.5 CFU/g fin and 2.5310.sup.63.5110.sup.5 CFU/g respectively. That is to say, the coating degree was proportional to O.D. The O.D. value of 0.5 at which the microorganisms were coated at a concentration of 10.sup.6 CFU/g, which is similar to the level of the evaporator core from which the microorganisms were isolated, was selected for coating of the other 10 odorless microorganism species.

(148) (2) Evaluation of Coatability of Odorless Microorganisms on Evaporator Core and Fin

(149) As a result of a fin coating test, the 11 odorless microorganism species showed the same coating degree at the same O.D. regardless of the genus. Accordingly, the amount of Methylobacterium aquaticum coated on an evaporator core was measured using a culture corresponding to the O.D. value of the fin.

(150) Methylobacterium aquaticum adjusted to O.D. 0.5 showed a coating degree of 8.9510.sup.65.5110.sup.5 CFU/g fin on the evaporator core. When the same culture was coated on the evaporator core, the coating degree was 2.5510.sup.63.5110.sup.5 CFU/g fin. Accordingly, it was confirmed that the microorganisms was coated with the same degree when the culture of the same O.D. is used.

Example 10

Sensory Evaluation of Isolated Microorganisms Coated on Evaporator Core

(151) (1) Coating of 11 Odorless Microorganism Species on Evaporator Core Coating and Sensory Evaluation

(152) For sensory evaluation of the microorganisms identified in Example 8, each of the 11 odorless microorganism species was coated on an evaporator core.

(153) Offensive odors generated by the microorganisms were analyzed through an olfactory evaluation test. The microorganism-coated evaporator cores were evaluated by 15 sensory evaluation panels. As a result, the 11 microorganism species scored 1.780.41 (5-point scale, 0: no odor; 1: very weak odor (hardly detectable odor); 2: weak odor (difficult-to-distinguish odor); 3: distinct odor (distinguishable odor); 4: strong odor; 5: very strong odor). Methylobacterium sp. showed a lower-than-average score of 1.6250.29. The 3 common strains, Methylobacterium aquaticum, Methylobacterium brachiatum and Methylobacterium platani, scored 1.60.35. Deinococcus ficus scored highest at 2.8, followed by Bacillus vietnamensis at 2.1 (Table 8).

(154) Based on the sensory evaluation result, the 3 microorganism species which generate relatively strong odors, Methylobacterium brachiatum, Bacillus vietnamensis and Deinococcus ficus, were excluded.

(155) TABLE-US-00009 TABLE 9 Sensory evaluation of microorganisms coated on evaporator core Evaluation Odor under result reconstitution (5-point No. Strain Odor in air condition* scale) Selection 1 Methylobacterium aquaticum odorless odorless 1.4 selected 2 Methylobacterium brachiatum odorless X 2 3 Methylobacterium platani odorless odorless 1.4 selected 4 Acinetobacter johnsonii odorless odorless 1.5 selected 5 Bacillus vietnamensis odorless X 2.1 6 Brevibacillus invocatus odorless odorless 1.5 selected 7 Deinococcus ficus odorless X 2.8 8 Leifsonia soli odorless odorless 1.7 selected 9 Pseudomonas nitroreducens odorless odorless 1.6 selected 10 Sphingomonas aquatilis odorless odorless 1.6 selected 11 Methylobacterium komagatae odorless odorless 1.7 selected Ref. Control (sterilized evaporator core) 2.1
Reconstitution condition*: Step 1: After supplying gasoline (nutritional source for microorganisms), a reconstitution apparatus was operated for 2 hours (temperature: 25 C., humidity: 50-90%, air velocity: 170 CMH, nutritional source: 10 ppm gasoline).
Step 2: After stopping the operation of the reconstitution apparatus (temperature: 25 C., humidity: 30-50%, air velocity: 0 CMH), odor was evaluated after slightly opening the inlet of the reconstitution apparatus.

(156) (2) Sensory Evaluation of Combinations of Odorless Microorganisms

(157) The 8 odorless microorganism species selected based on the sensory evaluation was combined with Methylobacterium aquaticum and Methylobacterium platani to obtain 14 optimized combinations of odorless microorganisms. For sensory evaluation of the combinations of odorless microorganisms, they were mixed with the same density and coated on an evaporator core.

(158) As a result of olfactory evaluation, the average sensory evaluation score of the 14 combinations was 1.890.52 (5-point scale). The combination 14 which contained the common strains as well as Acinetobacter johnsonii, Sphingomonas aquatilis and Pseudomonas nitroreducens showed the lowest sensory evaluation score of 1.25 and the combination containing the common strains and Acinetobacter johnsonii showed the highest sensory evaluation score of 3.14 (Table 10). Based on this quantitative evaluation and an odor quality evaluation test, the 10 combinations excluding the 2 combinations containing the common strains and one of Acinetobacter johnsonii and Brevibacillus invocatus, the combination 7 containing Brevibacillus invocatus, Sphingomonas aquatilis and Methylobacterium komagatae, and the combination 13 containing Leifsonia soli, Sphingomonas aquatilis and Pseudomonas nitroreducens were selected for a final survival test.

(159) TABLE-US-00010 TABLE 10 Sensory evaluation of combinations of odorless microorganisms Olfactory No. Combination evaluation Result 1 Common strains (Methylobacterium aquaticum 1.98 selected and Methylobacterium platani) 2 Acinetobacter johnsonii 3.14 X 3 Brevibacillus invocatus 2.12 X 4 Sphingomonas aquatilis and Brevibacillus 1.38 selected invocatus 5 Leifsonia soli and Methylobacterium komagatae 1.38 selected 6 Acinetobacter johnsonii, Sphingomonas aquatilis 1.33 selected and Methylobacterium komagatae 7 Brevibacillus invocatus, Sphingomonas aquatilis 2.33 X and Methylobacterium komagatae 8 Pseudomonas nitroreducens 2.13 selected 9 Acinetobacter johnsonii and Pseudomonas 2 selected nitroreducens 10 Brevibacillus invocatus, Acinetobacter johnsonii 1.5 selected and Pseudomonas nitroreducens 11 Leifsonia soli and Pseudomonas nitroreducens 1.86 selected 12 Brevibacillus invocatus, Sphingomonas aquatilis 1.7 selected and Pseudomonas nitroreducens 13 Leifsonia soli, Sphingomonas aquatilis and 2.38 X Pseudomonas nitroreducens 14 Acinetobacter johnsonii, Sphingomonas 1.25 selected aquatilis and Pseudomonas nitroreducens

Example 11

Survival Evaluation of 10 Combinations For 30 Days

(160) For the combinations of microorganisms selected based on the result of sensory evaluation in Example 9-(2), survival evaluation was conducted for 30 days. The number and microorganisms of the combinations are as follows (Table 11).

(161) TABLE-US-00011 TABLE 11 Combinations of microorganisms used in survival evaluation for 30 days No. Combination 1 Methylobacterium aquaticum, Methylobacterium platani, Brevibacillus invocatus, Sphingomonas aquatilis and Pseudomonas nitroreducens 2 Methylobacterium aquaticum, Methylobacterium platani, Acinetobacter johnsonii, Sphingomonas aquatilis and Pseudomonas nitroreducens 3 Methylobacterium aquaticum, Methylobacterium platani, Acinetobacter johnsonii, Sphingomonas aquatilis and Methylobacterium komagatae 4 Methylobacterium aquaticum, Methylobacterium platani, Brevibacillus invocatus, Acinetobacter johnsonii and Pseudomonas nitroreducens 5 Methylobacterium aquaticum, Methylobacterium platani, Acinetobacter johnsonii and Pseudomonas nitroreducens 6 Methylobacterium aquaticum, Methylobacterium platani, Leifsonia soli and Pseudomonas nitroreducens 7 Methylobacterium aquaticum, Methylobacterium platani, Leifsonia soli and Methylobacterium komagatae 8 Methylobacterium aquaticum, Methylobacterium platani, Sphingomonas aquatilis and Brevibacillus invocatus 9 Methylobacterium aquaticum, Methylobacterium platani and Pseudomonas nitroreducens 10 Methylobacterium aquaticum and Methylobacterium platani

(162) The microorganisms were cultured and coated on an evaporator core in order from the combination 1 to the combination 10. The coating degree was 10.sup.6 CFU/g fin.

(163) The combination 1 showed a coating degree of 1.0910.sup.78.6510.sup.5 CFU/g fin on the evaporator core. A red colony was detected at 8.7010.sup.62.3510.sup.6 CFU/g fin, a white colony at 2.5010.sup.57.0710.sup.4 CFU/g fin, and a yellow colony at 1.9010.sup.61.7310.sup.5 CFU/g fin. 30 days later, the total bacterial count was 4.6310.sup.55.0910.sup.4 CFU/g fin, with that of the red colony only being 4.6310.sup.61.5310.sup.5 CFU/g fin (FIG. 2). That is to say, the proportion of the red colony, which had accounted for over 80%, was increased to 100% 30 days later (FIG. 3). Based on the phenotype, the red colony was suspected to contain Methylobacterium which contains a pink pigment. Upon REP-PCR analysis, Methylobacterium platani and Brevibacillus invocatus were not detected at time 0. Particularly, it is to be noted that the Methylobacterium platani that was used as a common strain was not detected. For the combination 1, Methylobacterium aquaticum was detected the most in 70 out of a total of 86 REP-PCR samples at time 0. Sphingomonas aquatilis was detected in 12 samples, and Pseudomonas nitroreducens was detected in 4 samples. After 30 days, Methylobacterium aquaticum was detected in all the 32 samples, whereas the other microorganisms were not detected (FIG. 4).

(164) In the combination 2, Acinetobacter johnsonii, Sphingomonas aquatilis and Pseudomonas nitroreducens were used together with the common strains Methylobacterium aquaticum and Methylobacterium platani. At time 0, the total bacterial count on the evaporator core was 1.5210.sup.75.4210.sup.5 CFU/g fin. 30 days later, the total bacterial count on the evaporator core was 3.2310.sup.68.3910.sup.4 CFU/g fin. REP-PCR pattern analysis revealed that Methylobacterium aquaticum, Sphingomonas aquatilis and Pseudomonas nitroreducens were surviving on the evaporator core at time 0. Out of 105 REP-PCR samples, Methylobacterium aquaticum was detected in 94 samples, Sphingomonas aquatilis was detected in 7 samples, and Pseudomonas nitroreducens was detected in 4 samples. After 30 days, Methylobacterium aquaticum was detected in all the 30 REP-PCR samples (FIG. 5).

(165) For the combination 3, the total bacterial count was 1.8310.sup.73.8910.sup.5 CFU/g fin at time 0. 30 days later, total bacterial count was 5.2310.sup.61.5010.sup.5 CFU/g fin. When the population of microorganisms was analyzed by REP-PCR, among the 5 microorganisms contained in the combination, 4 microorganisms Methylobacterium aquaticum, Acinetobacter johnsonii, Sphingomonas aquatilis and Methylobacterium komagatae excluding Methylobacterium platani were surviving on the evaporator core at time 0. After 30 days, Methylobacterium komagatae as well as Methylobacterium aquaticum, one of the common strains, was surviving. At time 0, out of 101 samples, Methylobacterium aquaticum was detected in 49 samples, Acinetobacter johnsonii was detected in 1 sample, Sphingomonas aquatilis was detected in 11 samples, and Methylobacterium komagatae was detected in 40 samples. After 30 days, Methylobacterium aquaticum was detected in 19 samples and Methylobacterium komagatae was detected in 15 samples (FIG. 6). It was found that the ratio of the surviving two Methylobacterium species was constant at about 1:1 for 30 days (FIG. 7).

(166) For the combination 4, the total bacterial count of the 5 strains was 2.0410.sup.74.9110.sup.5 CFU/g fin at the time of coating. When the population of microorganisms was analyzed by REP-PCR, out of 86 samples, Methylobacterium aquaticum was detected in 80 samples, Methylobacterium platani was detected in 1 sample, Brevibacillus invocatus was detected in 3 samples, and Pseudomonas nitroreducens was detected in 2 samples (FIG. 8).

(167) The combination 5 consisted of 4 strains Methylobacterium aquaticum, Methylobacterium platani, Acinetobacter johnsonii and Pseudomonas nitroreducens. At the time of coating on an evaporator core, the total bacterial count was 2.8610.sup.71.1910.sup.6 CFU/g fin. When the population of microorganisms was analyzed by REP-PCR, out of 28 samples, Methylobacterium aquaticum was detected in 24 samples, and Acinetobacter johnsonii and Pseudomonas nitroreducens were detected in 2 samples, respectively (FIG. 9).

(168) From the survival evaluation of the combinations of microorganisms, it was found out that the Methylobacterium platani used as the common strain show low survivability when coated on the evaporator core with other microorganisms. Therefore, additional microorganism combinations were prepared using the other common strain Methylobacterium aquaticum and the Methylobacterium komagatae, which showed comparable survivability for 30 days, and survivability was evaluated for 30 days.

Example 12

Survival Evaluation of Additional 6 Combinations For 30 Days

(169) Methylobacterium komagatae was selected as a microorganism to replace Methylobacterium platani, which showed poor survivability in the survival evaluation for 30 days. Methylobacterium komagatae was combined with the common strain Methylobacterium aquaticum to prepare 6 additional combinations of microorganisms (Table 12). The additionally prepared combinations contained a small number of microorganisms that exhibited excellent survivability, although they were not odorless, in order to prepare more stable combinations.

(170) TABLE-US-00012 TABLE 12 Additional combinations of microorganisms used in survival evaluation for 30 days Combination A Methylobacterium aquaticum, Methylobacterium komagatae, Bacillus vietnamensis and Deinococcus ficus B Methylobacterium aquaticum, Methylobacterium komagatae, Curtobacterium flaccumfaciens, Deinococcus apachensis and Bacillus subtilis subsp. Subtilis C Methylobacterium aquaticum, Methylobacterium komagatae, Spirosoma linguale, Sphingomonas dokdonensis and Leifsonia soli D Methylobacterium aquaticum, Methylobacterium komagatae, Microbacterium flavescens, Leifsonia shinshuensis and Methylobacterium aerolatum E Methylobacterium aquaticum, Methylobacterium komagatae, Spirosoma panaciterrae, Flavobacterium oceanosedimentum and Brevundimonas kwangchunensis F Methylobacterium aquaticum, Methylobacterium komagatae, Methylobacterium brachiatum, Paenibacillus timonensis and Rhizobium massiliae, Bacillus lichemformis

(171) For the combination A, the total bacterial count on the evaporator core was 4.3010.sup.61.2510.sup.6 CFU/g fin at the time of coating. Even after 30 days, the microorganisms were surviving at 4.3010.sup.61.2510.sup.6 CFU/g fin. When the population of the coated microorganisms was investigated by REP-PCR pattern analysis, out of 45 samples, Methylobacterium aquaticum was detected in 8 samples and Methylobacterium komagatae was detected in 37 samples. After 30 days, out of 20 samples, Methylobacterium aquaticum was detected in 5 samples, Methylobacterium komagatae was detected in 15 samples. Although the ratio of Methylobacterium aquaticum was slightly increased, the change was not significant (FIG. 10).

(172) For the combination B, the total bacterial count was 2.0710.sup.71.1110.sup.6 CFU/g fin at time 0. After 30 days, the total bacterial count was 1.7410.sup.71.3010.sup.6 CFU/g fin. When the population of the microorganisms was investigated by REP-PCR, out of 34 representative samples, Methylobacterium aquaticum was detected in 1 sample and Methylobacterium komagatae was detected in 11 samples. All of the other 22 samples were found to be Deinococcus apachensis. That is to say, 40% or more of the coated microorganisms was Deinococcus apachensis (FIG. 11). After 30 days, REP-PCR pattern analysis revealed that the surviving microorganisms were Methylobacterium aquaticum 11.1%, Methylobacterium komagatae 22.2% and Deinococcus apachensis 66.6%. That is to say, although the ratio of Methylobacterium aquaticum was slightly increased as compared to time 0, all of the 3 microorganisms were surviving.

(173) For the combination C, Methylobacterium aquaticum, Methylobacterium komagatae, Spirosoma linguale, Sphingomonas dokdonensis and Leifsonia soli were used. When the combination of the 5 strains was coated on an evaporator core, the total bacterial count was 7.5310.sup.63.7410.sup.5 CFU/g fin. After 30 days, the total bacterial count was 3.7010.sup.61.3710.sup.5 CFU/g fin.

(174) As a result of REP-PCR pattern analysis for identification of the surviving microorganisms, out of 51 representative samples, Methylobacterium aquaticum was detected in 4 samples, Methylobacterium komagatae was detected in 30 samples, Spirosoma linguale was detected in 3 samples and Sphingomonas dokdonensis was detected in 14 samples at time 0. After 30 days, Methylobacterium aquaticum was 29.6% and Methylobacterium komagatae was 59.2%. That is to say, the ratio of Methylobacterium aquaticum was slightly increased. Spirosoma linguale was not detected and the ratio of Sphingomonas dokdonensis was slightly decreased to 11.1% as compared to time 0 (FIG. 12).

(175) For the combination D, the total bacterial count at time 0 was 1.7510.sup.71.2410.sup.6 CFU/g fin. After 30 days, the total bacterial count was 6.0310.sup.61.0110.sup.6 CFU/g fin. When the ratio of the bacteria was investigated by REP-PCR, Methylobacterium aquaticum was 16.3%, Methylobacterium komagatae was 47.3% and Microbacterium flavescens was 36.4% at time 0. After 30 days, Methylobacterium aquaticum was increased to 34.3% and Methylobacterium komagatae was also increased slightly to 57.1%. In contrast, Microbacterium flavescens was decreased to 8.6% (FIG. 13).

(176) For the combination E, the total bacterial count was 8.5310.sup.63.2110.sup.5 CFU/g fin at time 0. After 30 days, the total bacterial count was 1.2010.sup.63.8410.sup.4 CFU/g fin. When population was analyzed by REP-PCR, out of 75 samples, Methylobacterium aquaticum was detected in 8 samples, Methylobacterium komagatae was detected in 21 samples, Flavobacterium oceanosedimentum was detected in 32 samples and Brevundimonas kwangchunensis was detected in 14 samples at time 0. After 30 days, out of 89 representative samples, Methylobacterium aquaticum was detected in 16 samples, Methylobacterium komagatae was detected in 32 samples, Flavobacterium oceanosedimentum was detected in 39 samples and Brevundimonas kwangchunensis was detected in 2 samples, respectively (FIG. 14).

(177) Spirosoma panaciterrae was hardly detectable at time 0 and the ratio of Brevundimonas kwangchunensis was significantly decreased after 30 days.

(178) For the combination F, 6 strains including the two Methylobacterium sp. common strains were used. At time 0, the total bacterial count was 1.6010.sup.71.1510.sup.6 CFU/g fin. After 30 days, the total bacterial count was 9.0310.sup.62.4210.sup.5 CFU/g fin. When the population of the strains was analyzed by REP-PCR, out of 71 representative samples, Methylobacterium aquaticum was detected in 54 samples and Methylobacterium komagatae was detected in 17 samples at time 0. After 30 days, Methylobacterium aquaticum was detected in 50 samples and Methylobacterium komagatae was detected in 23 samples out of 73 samples (FIG. 15).

Example 13

Survival Evaluation of Combinations of Common Strains For 90 Days

(179) For evaluation of long-term effect for 90 days, various combinations of odorless microorganisms were prepared. First, Methylobacterium aquaticum and Methylobacterium komagatae, as common strains included in all combinations, were tested for 90 days.

(180) When the two Methylobacterium sp. strains were coated on an evaporator core, the total bacterial count was measured to be 1.9210.sup.78.0210.sup.5 CFU/g fin at time 0. 5 g of the fin was taken every 30 days and the total bacterial count was measured. The number of surviving bacterial was 8.7010.sup.66.5610.sup.5 CFU/g fin after 30 days, 4.1010.sup.63.0010.sup.5 CFU/g fin after 60 days and 3.1310.sup.65.5110.sup.5 CFU/g fin after 90 days (FIG. 16). 71, 66, 41 and 44 representative samples taken from each sampling location were subjected to REP-PCR pattern analysis. At time 0, Methylobacterium aquaticum was detected in 37 samples and Methylobacterium komagatae was detected in 34 samples. After 30, 60 and 90 days, the numbers of the samples were 35 and 31, 27 and 14, and 25 and 19, respectively (FIG. 17). That is to say, the % ratio of Methylobacterium aquaticum was 52.1-65.8% and that of Methylobacterium komagatae was 34.1-47.9%. This uniform ratio suggests that the two strains can coexist for a long-term period.

Example 14

Survival Evaluation of Combinations of Common Strains on Vehicle Jig

(181) In order to investigate the growth of a combination of the common strains Methylobacterium aquaticum and Methylobacterium komagatae under an outdoor condition, the two strains were coated on an evaporator core and the evaporator core was mounted on a jig which was in turn installed on a vehicle roof. After operation, the change in the strains exposed to outdoor air was investigated.

(182) On the evaporator core coated with the two strains, the total bacterial count was 3.2010.sup.76.5610.sup.6 CFU/g fin. The total bacterial count on the evaporator core was 6.2310.sup.61.9910.sup.5 CFU/g fin after 30 days and 1.0810.sup.64.3610.sup.4 CFU/g fin after 60 days (FIG. 18). Even though the evaporator core was exposed to the outdoor environment, no exogenous microorganism other than the colony of Methylobacterium sp. was detected after 60 days. When the detected microorganisms were identified by REP-PCR, the ratio of the strains was 1:1 at time 0. After 30 days, Methylobacterium aquaticum was decreased to 4.2% and, after 60 days, only Methylobacterium komagatae was detected (FIG. 19).

Conclusion

(183) The 11 odorless microorganism species isolated from the evaporator core were divided into 4 groups based on morphological characteristics. The 11 microorganism species were identified as different species through 16S rDNA sequencing.

(184) The microorganisms identified by 16S rDNA sequencing were subjected to REP-PCR and were found to be 11 different REP-PCR groups.

(185) After conducting sensory evaluation of the individual strains after coating on an evaporator core, 8 microorganisms which generated relatively less offensive odors, Methylobacterium aquaticum, Methylobacterium platani, Acinetobacter johnsonii, Brevibacillus invocatus, Leifsonia soli, Pseudomonas nitroreducens, Sphingomonas aquatilis and Methylobacterium komagatae, were selected finally.

(186) Sensory evaluation was conducted for 14 combinations prepared from the selected 8 microorganism species. As a result, a total of 10 combinations were selected for the final survival test. Among them, 4 combinations consisted of 5 strains, 4 combinations consisted of 4 strains, 1 combination consisted of 3 combinations and 1 combination consisted of 2 strains, including 2 common strains. Because Methylobacterium platani was found to be unsuitable, 6 additional combinations were prepared and subjected to survival evaluation for 30 days. As a result, Methylobacterium aquaticum and Methylobacterium komagatae were selected as common strains. A combination consisting only of the two common strains Methylobacterium aquaticum and Methylobacterium komagatae was subjected to survival evaluation for 90 days. As a result of conducting survival evaluation for 90 days under a laboratory condition, the combination maintained a similar population as that at the time of coating. In addition, an evaporator core coated with the combination of microorganisms was installed on a jig of a vehicle roof and survivability was evaluated after exposure to outdoor air. As a result, the total bacterial count was maintained at 10.sup.6 CFU/g fin and no exogenous microorganism was detected.

(187) The present invention has been described in detail with reference to specific embodiments thereof. However, it will be appreciated by those skilled in the art that various changes and modifications may be made in these embodiments without departing from the principles and spirit of the invention, the scope of which is defined in the appended claims and their equivalents.