Duck enteritis virus and the uses thereof
10717967 ยท 2020-07-21
Assignee
Inventors
Cpc classification
C12N7/00
CHEMISTRY; METALLURGY
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12N7/04
CHEMISTRY; METALLURGY
C12N2710/16334
CHEMISTRY; METALLURGY
C12N2710/16343
CHEMISTRY; METALLURGY
International classification
C12N7/00
CHEMISTRY; METALLURGY
C12N7/04
CHEMISTRY; METALLURGY
Abstract
The present invention relates to DEV and the uses thereof. The invention is particularly suited to vaccinate poultry against avian pathogens.
Claims
1. A Duck Enteritis Virus (DEV) comprising a foreign nucleic acid, wherein said virus has an inactive UL4 gene, and wherein the foreign nucleic acid is located in the intergenic region of the virus between UL45 and UL46.
2. The DEV of claim 1, wherein at least 20% of the UL4 gene sequence is deleted.
3. The DEV of claim 1, wherein the foreign nucleic acid encodes an antigen.
4. The DEV of claim 3, wherein the antigen is a surface protein hemagglutinin (HA) of an avian influenza virus or an immunogenic fragment thereof.
5. The DEV of claim 3, wherein the foreign nucleic acid contains a transcriptional promoter.
6. The DEV of claim 1, wherein said DEV comprises a deleted UL4 gene and a foreign nucleic acid encoding a surface protein hemagglutinin (HA) of an avian influenza virus under control of a Pec promoter located in the intergenic region of the virus between UL45 and UL46.
7. A nucleic acid molecule comprising the genome of a DEV of claim 1.
8. A host cell comprising a DEV of claim 1 or a nucleic acid molecule comprising the genome of said DEV.
9. A composition comprising a DEV of claim 1 and a pharmaceutically or veterinary acceptable excipient or carrier.
10. The composition of claim 9, which further comprises an adjuvant.
11. A composition comprising a nucleic acid molecule comprising the genome of a DEV of claim 1 and a pharmaceutically or veterinary acceptable excipient or carrier.
12. The composition of claim 11, which further comprises an adjuvant.
13. A composition comprising a host cell according to claim 8 and a pharmaceutically or veterinary acceptable excipient or carrier.
14. The composition of claim 13, which further comprises an adjuvant.
Description
LEGEND TO THE FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
DETAILED DESCRIPTION OF THE INVENTION
(9) The present invention generally relates to attenuated DEVs, as well as to DEVs which comprise foreign gene sequence(s) located in particular insertion sites within the genome. The present invention also relates to compositions comprising such DEVs, as well as to the use thereof for vaccination of animals, particularly poultry, more particularly young poultry (at Day 3 post-hatch or earlier, or in ovo).
(10) The present disclosure will be best understood by reference to the following definitions:
Definitions
(11) The term virus designates in particular a viral particle comprising a nucleic acid molecule (e.g., a genome) encapsulated in a capsid or capsule. The term virus also designates a viral vector or an isolated viral genome.
(12) The term recombinant designates a molecule which has been created, designed or modified using genetic technologies. In relation to a virus, the term recombinant more specifically designates a virus whose genome (or whose ancestor's genome) has been modified by insertion or deletion of at least one nucleic acid sequence.
(13) The term foreign nucleic acid in relation to a virus designates a nucleic acid which is not found naturally in the genome of the virus, or which is found naturally in said genome but in a different form or at a different position.
(14) In the present description, the term nucleic acid or nucleic acids designates any nucleic acid molecule or sequence such as deoxyribonucleotide (DNA) or ribonucleotide (RNA), which may be e.g., single- or double-stranded. Nucleic acids may comprise an ORF or not. Nucleic acid molecules may be produced by techniques known per se in the art such as by artificial synthesis, recombinant technology, enzymatic technology, replication in host cells, or combinations thereof.
(15) A gene designates a nucleic acid molecule or sequence which comprises an open reading frame encoding a product, such as a polypeptide (e.g., a peptide, protein, etc.) or an RNA.
(16) The term attenuated as used herein refers to a virus which essentially does not cause illness in an animal model. An attenuated virus can typically replicate in a host without causing death thereof. An attenuated virus more particularly designates a virus which is not virulent in embryos when injected at a dose of 110.sup.3 plaque forming unit (pfu)/egg. Most preferred attenuated viruses are safe at a dose of 110.sup.3 pfu/egg in at least 70% injected eggs, more preferably in at least 80% injected eggs, even more preferably in at least 90%, 95% 97%, 98%, 99% or more. Attenuated viruses of the invention are also safe for injection post-hatch, including at Day 0 (i.e., between 0.1 and 48 hours post-hatch).
(17) The term avian is intended to encompass all kinds of avians such as birds of the class of Ayes, i.e., vertebrate animals which are feathered, winged, bipedal, endothermic, and egg-laying. In the context of the invention, avians or avian species refer more particularly to birds with economical and/or agronomical interests, such as poultry, more preferably chickens and turkeys; or ornamental birds such as swans and psittacines.
(18) The term vaccine as used herein designates an agent which may be used to cause, stimulate or amplify an immune response in an organism.
(19) An immune response designates the development in a host of a cellular and/or antibody-mediated immune response to a composition or vaccine of interest. Usually, an immune response includes the production of antibodies, B cells, helper T cells, and/or cytotoxic T cells, directed specifically to an antigen or antigens included in the composition or vaccine of interest. Preferably, the immune response is protective such that resistance to new infection will be enhanced and/or the clinical severity of the disease reduced.
(20) The term in ovo administration or injection generally means inoculation or injection in the embryo contained in an egg. In ovo injection is preferably conducted anytime between Day 5 and Day 1 before hatch.
Duck Enteritis Virus
(21) Duck Enteritis Virus (DEV), also known as a duck viral enteritis virus (DVEV), naturally infects ducks and geese. The full nucleotide sequence of DEV has been determined and is available online (see for instance JQ673560). The viral genome contains about 162 Kb, encoding nearly 80 distinct proteins. Several serotypes and strains of DEV have been isolated, such as the Jansen strain, the CSC strain, the CHv strain, the VAC strain, and the 2085 strain.
(22) DEV is poorly characterized and its use as a vector to express genes has not been deeply investigated. For instance, Liu et al (2013) and WO2014/0036735 have attempted to use a recombinant DEV for expressing genes into chicken. They have utilized a DEV construct wherein a nucleic acid has been cloned between the US7 and US8 genes of the viral genome, without altering native gene expression. Although it is reported that such a construct may be transferred by intramuscular injection into 1-week-old chicken, there is, however, no disclosure in this document or in any other prior art document of any possible use of DEV for in ovo vaccination of poultry, or for vaccination of young poultry, i.e., at Day 3 post-hatch or before, particularly at Day 1 or Day 2 post-hatch.
(23) By conducting further experiments with DEV, the inventors surprisingly found that this virus is lethal when administered to young chicken (3 days or less) or in ovo. Surprisingly, although administration to chicken of a wild-type DEV (or a DEV construct containing all native genes as proposed in WO2014/0036735) one week after hatch appears well tolerated, administration of such a construct at day 1 post-hatch or in ovo causes a very massive death of the animals (i.e., between 80-100%), as reported in example 1.
(24) Even more surprisingly, the inventors have been able to modify the structure of the DEV to produce DEV constructs that may be used in poultry, including at very early stage (3 days or less) or in ovo, and that can cause substantial and early stage protein expression in vivo. More particularly, the present inventors conducted further research with DEV and generated various recombinants with different gene deletions or alterations. The inventors have surprisingly discovered that one of these constructs was a stable, safe and potent DEV recombinant, while the others were essentially lethal in ovo. More particularly, by inactivation of the UL4 gene, recombinant DEVs can be obtained which are (i) attenuated in vivo, particularly in chicken, and (ii) stable and capable of expressing foreign genes in a manner suitable for inducing protective immunity. The invention indeed shows that by inactivating the UL4 gene, viable, stable and replicative DEVs can be obtained, and that such viruses may be used to insert foreign genetic material. The results further show that such foreign genetic material is highly expressed from such viruses upon cell infection, and that such expression remains stable over time. Moreover, and strikingly, while native DEV or other recombinant DEV are pathogenic or lethal in young chicken (below age of 3 days or in ovo), inactivation of UL4 generates attenuated DEVs which can be used safely to express proteins or antigens into young poultry and in ovo. Because DEV has no known natural tropism for e.g., chicken, the use of DEV constructs of the invention for vaccinating chicken involves no risk of dissemination or contamination to non-vaccinated animals. Furthermore, chicken have no maternal antibodies or immunity against DEV and the viruses of the invention can be used to induce very early onset of immunity in vaccinated animals.
(25) An object of the invention thus relates to a Duck Enteritis Virus (DEV), wherein said virus has an inactive UL4 gene.
(26) A further object of the invention relates to a Duck Enteritis Virus (DEV), wherein said virus has an inactive UL4 gene and contains a foreign nucleic acid.
(27) Another object of the invention relates to a Duck Enteritis Virus (DEV), wherein said virus comprises has at least a first and a second inactive genes, wherein the first inactive gene is UL4 gene and the second inactive gene is selected from UL23 and US7 genes.
(28) The DEV of the invention may be prepared from any DEV species or strain. A number of strains of DEV have been reported, which are available from public collections, such as the CSC strain (Genbank # JQ673560), the Jansen strain, the CHv strain (Genbank # JQ647509), the VAC strain (Genbank # EU082088), and the 2085 strain (Genbank # JF999965).
(29) In a preferred embodiment, the DEV of the invention is derived or prepared from a parental strain selected from the Jansen strain or the CSC strain, or any DEV strain having at least 90% sequence identity to the Jansen strain or CSC strain, more preferably at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%.
(30) The invention shows that, by inactivating (i.e., rendering non-functional or deleting) the UL4 gene, it is possible to generate attenuated DEVs that are safe even when injected in ovo or in young poultry, and that can replicate and express proteins in poultry. The UL4 gene of DEV is predicted to encode a nuclear protein. However, the actual function of the UL4 gene of DEV remains unclear. Up to the present invention, the ability to generate UL4-defective DEV viruses was not known, and the ability of UL4-defective DEV viruses to replicate and express foreign genes, without being lethal in avians was totally unknown.
(31) The UL4 gene is typically composed of 717 bp of a DEV genome. By reference to a CSC strain, the UL4 gene corresponds to nt112845 to nt113561 of the genome. The nucleotide sequence of a UL4 gene of a Jansen-type strain of DEV is represented in SEQ NO: 13. It is understood that the skilled artisan may easily identify the exact location of the UL4 gene in any DEV strain using the information contained in the present application and general common knowledge, or by sequence alignment.
(32) Within the context of the invention, a DEV having an inactive UL4 gene designates a DEV that cannot express a functional UL4 protein. An inactive UL4 gene thus designates a mutated, a deleted, and/or an interrupted UL4 gene that cannot encode a wild-type UL4 protein.
(33) Particular mutations are point mutations in the UL4 coding sequence that prevent expression of a full length UL4 protein. Such mutations may introduce a stop or non-sense codon in the sequence, or cause substitution of essential amino acid residue(s) in the encoded protein, resulting in an inactive protein.
(34) In a particular DEV of the invention, at least 20% of the UL4 gene sequence is deleted, more preferably at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 85%, up to 100%. In a preferred example, the DEV of the invention has a deletion of at least 400 bp of the UL4 gene sequence, more preferably at least 500 bp, at least 600 bp, or more.
(35) In a specific embodiment, a DEV of the invention has a deletion spanning at least nt 200-500 of the UL4 gene sequence, more preferably at least nt100-600, even more preferably at least nt80-650. In a specific example, a DEV of the invention has a deletion of nt51 to nt667 (i.e., about 85%) of the UL4 gene sequence (e.g., DEV/UL4/rpsLneo-DsRed2).
(36) As shown in the examples, DEV constructs having an inactive UL4 gene are stable, can be replicated in culture, and can be safely administered to poultry eggs or young poultry. Such viruses may thus be used to produce recombinant DEVs containing foreign nucleic acid material, particularly antigenic-coding genes, to express such genes in poultry.
(37) In a particular embodiment, the invention thus relates to a Duck Enteritis Virus (DEV), wherein said virus has an inactive UL4 gene and comprises a foreign nucleic acid.
(38) In a preferred embodiment, the foreign nucleic acid is located in the UL4 gene sequence of the DEV viral genome, either in addition to the existing UL4 gene sequence (thus rendering the gene inactive by interrupting the gene sequence), or in replacement of a deleted sequence of the UL4 gene, or in a mutated UL4 gene sequence.
(39) In a preferred embodiment, the DEV of the invention has a deletion in the UL4 gene sequence, and contains a foreign nucleic acid located in place of the deleted nucleotides.
(40) In another particular embodiment, the foreign nucleic acid is located in a cloning site of the DEV viral genome distinct from the UL4 gene sequence, either in addition to an existing gene sequence, or in replacement of a deleted sequence, or in a mutated gene sequence. Such additional insertion site may be selected from the UL44 gene, the UL27-UL26 intergenic region, the UL23 gene, the UL45-UL46 intergenic region, the UL50-UL51 intergenic region, the US4 gene, the US5 gene, the US7 gene, the US7-US8 intergenic region, or the US10 gene.
(41) In the DEV of the invention, the foreign gene is generally under control of a transcriptional promoter. Preferably the promoter is cloned with the foreign gene. The promoter may be any natural or synthetic promoter, derived from cellular or viral genes. Examples of suitable promoters include, for instance, the chicken beta-actin (Bac) promoter or a derivative thereof such as Coa5, the Pec promoter, the Murine Cytomegalovirus (Mcmv) immediate-early (ie)1 promoter, the Human Cytomegalovirus promoter (Hcmv), the Simian virus (SV)40 promoter, and the Rous Sarcoma virus (RSV) promoter, or any fragments thereof which retain a promoter activity.
(42) Furthermore, the DEV of the invention may comprise several foreign nucleic acids. In this regard, several foreign nucleic acids may be inserted in the UL4 region as described above, under the control of a single or several distinct promoters. Alternatively, the DEV may comprise a foreign nucleic acid inserted in UL4 and one or more foreign nucleic acids inserted in one or more distinct insertion sites. Such additional insertion sites may be selected from the UL44 gene, the UL27-UL26 intergenic region, the UL23 gene, the UL45-UL46 intergenic region, the UL50-UL51 intergenic region, the US4 gene, the US5 gene, the US7 gene, the US7-US8 intergenic region, or the US10 gene.
(43) In this regard, in a particular embodiment, the invention relates to a Duck Enteritis Virus (DEV), wherein said virus has an inactive UL4 gene and an inactive UL44 gene. More particularly, the invention relates to a DEV, wherein said virus comprises a first foreign nucleic acid cloned into the UL4 gene, in replacement of at least 20% of said gene, and a second foreign nucleic acid cloned into the UL44 gene, in replacement of at least 20% of said gene. The UL44 gene is typically composed of 1296 bp of a DEV genome. By reference to a CSC strain, the UL44 gene corresponds to nt27419 to nt28714 of the genome. It is understood that the skilled artisan may easily identify the exact location of the UL44 gene in any DEV strain using the information contained in the present application and general common knowledge, or by sequence alignment. In a particular DEV of the invention, at least 20% of the UL44 gene sequence is deleted, more preferably at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, up to 100%. In a preferred example, the DEV of the invention has a deletion of at least 500 bp of the UL44 gene sequence, more preferably at least 600, 700, 800, 900, 1000, or more. In a specific embodiment, a DEV of the invention has a deletion spanning at least nt 200-1000 of the UL44 gene sequence, more preferably at least nt100-1100, even more preferably at least nt100-1200. In a specific example, a DEV of the invention has a deletion of nt51 to nt1246 (i.e., more than 90%) of the UL44 gene sequence.
(44) In another particular embodiment, the invention relates to a Duck Enteritis Virus (DEV), wherein said virus has an inactive UL4 gene and an inactive UL23 gene. Examples of such recombinant DEVs of the invention include JK015, JK022, JK023, JK024, and JK025. The invention shows that inactivation of these two genes generates DEVs which are highly attenuated, with about 95% survival rate upon in ovo administration. The results obtained also show that such attenuated viruses can replicate effectively in vitro and can express foreign gene sequences. More particularly, the invention relates to a DEV, wherein said virus comprises a first foreign nucleic acid cloned into the UL4 gene, in replacement of at least 20% of said gene, and a second foreign nucleic acid cloned into the UL23 gene, in replacement of at least 20% of said gene. The invention also relates to a DEV, wherein said virus comprises an inactive UL4 gene, and wherein said virus comprises a foreign nucleic acid cloned into the UL23 gene, in replacement of at least 20% of said gene. The invention also relates to a DEV, wherein said virus comprises an inactive UL4 gene and an inactive US7 gene, and wherein said virus comprises a foreign nucleic acid cloned into the UL23 gene, in replacement of at least 20% of said gene. The invention also relates to a DEV, wherein said virus comprises an inactive UL4 gene and an inactive UL23 gene, and wherein said virus comprises a foreign nucleic acid cloned into the UL26-27 intergenic region, or into the UL45-46 intergenic region, or into the UL50-51 intergenic region. The UL23 gene of DEV encodes thymidine kinase, which is believed to be involved in catalysis of nucleotide synthesis. Up to the present invention, the ability to generate UL23-defective DEV viruses was not known. The UL23 gene is typically composed of 1077 bp of a DEV genome. By reference to a CSC strain, the UL23 gene corresponds to nt77997 to nt79073 of the genome. It is understood that the skilled artisan may easily identify the exact location of the UL23 gene in any DEV strain using the information contained in the present application and general common knowledge, or by sequence alignment. In a particular DEV of the invention, at least 20% of the UL23 gene sequence is deleted, more preferably at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, up to 100%. In a preferred example, the DEV of the invention has a deletion of at least 500 bp of the UL23 gene sequence, more preferable at least 600, 700, 800, 900, 1000, or more. In a specific embodiment, a DEV of the invention has a deletion spanning at least nt 200-900 of the UL23 gene sequence, more preferably at least nt100-1000, even more preferably at least nt80-1000. In a specific example, a DEV of the invention has a deletion of nt51 to nt1027 (i.e., about 90%) of the UL23 gene sequence.
(45) In a further particular embodiment, the invention relates to a Duck Enteritis Virus (DEV), wherein said virus has an inactive UL4 gene and an inactive US4 gene. More particularly, the invention relates to a DEV, wherein said virus comprises a first foreign nucleic acid cloned into the UL4 gene, in replacement of at least 20% of said gene, and a second foreign nucleic acid cloned into the US4 gene, in replacement of at least 20% of said gene. The US4 gene of DEV encodes glycoprotein D, which is believed to be located on the viral envelope and the plasma membrane of infected cells. Up to the present invention, the ability to generate US4-defective DEV viruses was not known. The US4 gene is typically composed of 1380 bp of a DEV genome. By reference to a CSC strain, the US4 gene corresponds to nt141123 to nt142502 of the genome. It is understood that the skilled artisan may easily identify the exact location of the US4 gene in any DEV strain using the information contained in the present application and general common knowledge, or by sequence alignment. In a particular DEV of the invention, at least 20% of the US4 gene sequence is deleted, more preferably at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, up to 100%. In a preferred example, the DEV of the invention has a deletion of at least 500 bp of the US4 gene sequence, more preferable at least 600, 700, 800, 900, 1000, or more. In a specific embodiment, a DEV of the invention has a deletion spanning at least nt 200-1000 of the US4 gene sequence, more preferably at least nt150-1150, even more preferably at least nt100-1300. In a specific example, a DEV of the invention has a deletion of nt51 to nt1330 (i.e., above 90%) of the US4 gene sequence.
(46) In this regard, in a particular embodiment, the invention relates to a Duck Enteritis Virus (DEV), wherein said virus has an inactive UL4 gene and an inactive US5 gene. More particularly, the invention relates to a DEV, wherein said virus comprises a first foreign nucleic acid cloned into the UL4 gene, in replacement of at least 20% of said gene, and a second foreign nucleic acid cloned into the US5 gene, in replacement of at least 20% of said gene. The US5 gene of DEV encodes glycoprotein J, the function of which remains unknown. Up to the present invention, the ability to generate US5-defective DEV viruses was not known. The US5 gene is typically composed of 1620 bp of a DEV genome. In particular DEV strains, such as a 2085 strain and a Jansen strain, the US5 gene is shorter (about 1197 bp) as a result of mutations in the gene. By reference to a CSC strain, the US5 gene corresponds to nt142662 to nt144281 of the genome. It is understood that the skilled artisan may easily identify the exact location of the US5 gene in any DEV strain using the information contained in the present application and general common knowledge, or by sequence alignment. In a particular DEV of the invention, at least 20% of the US5 gene sequence is deleted, more preferably at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, up to 100%. In a preferred example, the DEV of the invention has a deletion of at least 500 bp of the US5 gene sequence, more preferably at least 600, 700, 800, 900, 1000, or more. In a specific embodiment, a DEV of the invention has a deletion spanning at least nt 200-1000 of the US5 gene sequence, more preferably at least nt100-1100, even more preferably at least nt80-1120. In a specific example, a DEV of the invention produced from a Jansen strain has a deletion of nt51 to nt1147 (i.e., more than 90%) of the US5 gene sequence, and a DEV produced from a CSC strain has a deletion of nt51 to nt1570 of the US5 gene sequence.
(47) In another particular embodiment, the invention relates to a Duck Enteritis Virus (DEV), wherein said virus has an inactive UL4 gene and an inactive US7 gene. Examples of such recombinant DEVs of the invention include JK016, JK025, JK026, JK027, and JK028. The invention shows that inactivation of these two genes generates DEVs which are highly attenuated, causing a 0% mortality upon in ovo administration. The results obtained also show that such attenuated viruses can replicate effectively in vitro and can express foreign gene sequences. More particularly, the invention relates to a DEV, wherein said virus comprises a first foreign nucleic acid cloned into the UL4 gene, in replacement of at least 20% of said gene, and a second foreign nucleic acid cloned into the US7 gene, in replacement of at least 20% of said gene. The invention also relates to a DEV, wherein said virus comprises an inactive UL4 gene, and wherein said virus comprises a foreign nucleic acid cloned into the US7 gene, in replacement of at least 20% of said gene. The invention also relates to a DEV, wherein said virus comprises an inactive UL4 gene and an inactive US7 gene, and wherein said virus comprises a foreign nucleic acid cloned into the UL23 gene, in replacement of at least 20% of said gene. The invention also relates to a DEV, wherein said virus comprises an inactive UL4 gene and an inactive US7 gene, and wherein said virus comprises a foreign nucleic acid cloned into the UL26-27 intergenic region, or into the UL45-46 intergenic region, or into the UL50-51 intergenic region. The US7 gene of DEV encodes glycoprotein I, which is believed to be involved in viral cell to cell spread. Up to the present invention, the ability to generate US7-defective DEV viruses was not known. The US7 gene is typically composed of 1116 bp of a DEV genome. By reference to a CSC strain, the US7 gene corresponds to nt145769 to nt146884 of the genome. It is understood that the skilled artisan may easily identify the exact location of the US7 gene in any DEV strain using the information contained in the present application and general common knowledge, or by sequence alignment. In a particular DEV of the invention, at least 20% of the US7 gene sequence is deleted, more preferably at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, up to 100%. In a preferred example, the DEV of the invention has a deletion of at least 500 bp of the US7 gene sequence, more preferable at least 600, 700, 800, 900, 1000, or more. In a specific embodiment, a DEV of the invention has a deletion spanning at least nt 200-900 of the US7 gene sequence, more preferably at least nt100-1000, even more preferably at least nt80-1120. In a specific example, a DEV of the invention has a deletion of nt51 to nt1066 (i.e., more than 90%) of the US7 gene sequence.
(48) In this regard, in a particular embodiment, the invention relates to a Duck Enteritis Virus (DEV), wherein said virus has an inactive UL4 gene and an inactive US10. More particularly, the invention relates to a DEV, wherein said virus comprises a first foreign nucleic acid cloned into the UL4 gene, in replacement of at least 20% of said gene, and a second foreign nucleic acid cloned into the US10 gene, in replacement of at least 20% of said gene. The US10 gene of DEV is predicted to encode a virion protein, the function of which remains unknown. Up to the present invention, the ability to generate US10-defective DEV viruses was not known. The US10 gene is typically composed of about 900 to 970 bp of a DEV genome, depending on the strain. By reference to a CSC strain, the US10 gene corresponds to nt136391 to nt137320 of the genome. It is understood that the skilled artisan may easily identify the exact location of the US10 gene in any DEV strain using the information contained in the present application and general common knowledge, or by sequence alignment. In a particular DEV of the invention, at least 20% of the US10 gene sequence is deleted, more preferably at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, up to 100%. In a preferred example, the DEV of the invention has a deletion of at least 500 bp of the US10 gene sequence, more preferable at least 600, 700, or 800, or more. In a specific embodiment, a DEV of the invention has a deletion spanning at least nt 200-700 of the US10 gene sequence, more preferably at least nt100-800, even more preferably at least nt80-850. In a specific example, a DEV of the invention produced from a CSC strain has a deletion of nt51 to nt880 (i.e., more than 80%) of the US10 gene sequence, and a DEV produce from a VAC strain has a deletion of nt51 to nt847 of the US10 gene sequence.
(49) The invention also relates to a DEV, wherein said virus comprises a first foreign nucleic acid cloned into the UL4 gene, in replacement of at least 20% of said gene, and a second foreign nucleic acid cloned in an intergenic region located between UL27 and UL26 genes. The invention also relates to a DEV, wherein said virus comprises an inactive UL4 gene, and wherein said virus comprises a foreign nucleic acid cloned in an intergenic region located between UL27 and UL26 genes. By reference to a CSC strain, the intergenic region located between UL27 and UL26 corresponds to nt72195 to nt72646 of the genome. Cloning may be performed at any position within such domain, more preferably between nt72300 and nt72500, furthermore preferably between nt72350 and nt72450. In a specific embodiment, cloning is performed between nt72431 and nt72432.
(50) The invention also relates to a DEV, wherein said virus comprises a first foreign nucleic acid cloned into the UL4 gene, in replacement of at least 20% of said gene, and a second foreign nucleic acid cloned in an intergenic region located between US7 and US8 genes. Such an intergenic cloning site has been described in WO2014/0036735.
(51) The invention also relates to a DEV, wherein said virus comprises an inactive UL4 gene, and wherein said virus comprises a foreign nucleic acid cloned in an intergenic region located between UL45 and UL46 genes, or between UL50 and UL51 genes. By reference to a CSC strain, the intergenic region located between UL45 and UL46 corresponds to nt25132 to nt25352 of the genome. Cloning may be performed at any position within such domain, more preferably between nt25200 and nt25300. In a specific embodiment, cloning is performed between nt25275 and nt25276. By reference to a CSC strain, the intergenic region located between UL50 and UL51 corresponds to nt15914 to nt16063 of the genome. Cloning may be performed at any position within such domain, more preferably between nt15970 and nt16010. In a specific embodiment, cloning is performed between nt15979 and nt15980.
(52) Virus construction and cloning may be accomplished by techniques know per se in the art. Gene cloning and plasmid construction are well known to one person of ordinary skill in the art and may be essentially performed by standard molecular biology techniques (Molecular Cloning: A Laboratory Manual. 4th Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., USA, 2012). Typically, the recombinant viruses may be prepared by homologous recombination between the viral genome and a construct (e.g., a homology plasmid) comprising the nucleic acid to be inserted, flanked by nucleotides from the insertion site to allow recombination. Cloning can be made with or without deletion of endogenous sequences. In a particular embodiment, the recombinant sequence is cloned in replacement of at least part of a sequence of the genome, such as at least 50 nucleotides or more. Such deletion increases the cloning capacity of the virus.
(53) For construction, a sequence containing the targeted insertion region is typically first cloned into a suitable vector to produce a homology vector. Examples of vectors include plasmids, such as pBR322, pBR325, pBR327, pBR328, pUC18, pUC19, pUC7, pUC8, or pUC9; phages such as lambda phage and M13 phage; or cosmids such as pHC79. The target region sequence is integrated into the vector by conventional cloning methods. The target region sequence used is preferably of sufficient length so as to allow subsequent in vivo homologous recombination with a DEV viral genome. Preferably, the cloned target region sequence shall have at least approximately 100 nucleotides in length, typically above 300, such as between 500 and 2000 nucleotides. The foreign nucleic acid (which typically contains a gene and a promoter) is then inserted into the target region cloned in the vector. Insertion shall be made preferably in a manner that leaves a portion of sequence of the target region on each side of the cloned insert of a length sufficient to allow homologous recombination (e.g. of at least 50 nucleotides, preferably of at least 100 nucleotides). The foreign nucleic acid can be introduced into the cloned target region by classical techniques such as restriction enzyme and ligation procedures. If appropriate, mutation(s) may be introduced at a specific site of the target region to create a new cleavage site for a restriction enzyme. Conventional mutagenesis techniques well known by a person skilled in the art may be used for that purpose, such as e.g., in vitro mutagenesis or PCR. Homology vectors in which the foreign nucleic acid has been inserted into the target region may then be introduced into a DEV-infected cell or DEV genome-transfected cells using known techniques such as electroporation, calcium phosphate, lipofectin-based method, or the like. The recombinant viruses are thereby produced by recombination in said cells between the virus and the vector. The resulting recombinant virus may be selected genotypically or phenotypically using known techniques, e.g., by hybridization, sequencing, PCR or a functional assay to detect any product encoded by the foreign nucleic acid, as described in the examples. The selected recombinant virus can be cultured on a large scale in cell culture after which, recombinant viruses can be collected.
Foreign Gene
(54) The DEV of the invention may contain any foreign nucleic acid, preferably any foreign gene. The foreign gene may encode any product of interest such as RNAs or biologically active and/or immunogenic (e.g., antigenic) proteins, polypeptides or peptides. In a preferred embodiment, the foreign gene encodes an antigen, even more preferably a peptide or polypeptide derived from an antigen of a pathogenic organism capable of causing an infection in an animal, particularly an avian. Examples of pathogens that cause infection in avian include viruses, bacteria, fungi, protozoa, etc. The immunogenic (poly)peptide may preferably be (derived from) a surface protein, a secreted protein, or a structural protein of said pathogen, or fragments thereof. The polypeptide can be derived from any source, e.g., viral, prokaryotic, eukaryotic or synthetic.
(55) In a preferred embodiment, the foreign gene encodes an antigenic peptide of a bird pathogenic agent.
(56) Specific examples of pathogenic agents include, without limitation, avian influenza virus, avian paramyxovirus type 1, also called Newcastle disease virus (NDV), avian metapneumovirus, Marek's disease virus, Gumboro disease virus, also called infectious bursal disease virus (IBDV), Infectious laryngotracheitis virus (ILTV), Infectious bronchitis virus (IBV), Escherichia coli, Salmonella species, Pasteurella multocida, Riemerella anatipestifer, Ornithobacterium rhinotracheale, Mycoplasma gallisepticum, Mycoplasma synoviae, Mycoplasmas microorganisms infecting avian species or coccidian.
(57) Preferentially, the foreign gene encodes an antigen selected from the F protein of NDV, the HN protein of NDV, the VP2 protein of IBDV, the gB protein of ILTV, the 40K protein of Mycoplasma gallisepticum, or the surface protein hemagglutinin (HA) of the avian influenza virus, or immunogenic fragments thereof. Within the context of the invention, the term fragment of a protein designates preferably a fragment comprising at least 5 consecutive amino acid residues of said protein, even more preferably from 5-100. In a preferred embodiment, such a fragment comprises at least one epitope and/or is immunogenic in vivo, i.e., can cause production of antibodies that bind the full length protein.
(58) Specific examples of immunogenic peptides include, for instance, a peptide comprising amino acid residues 1-453 of VP2, 1-469 of gB, or 1-540 of F.
Preferred DEVs
(59) A preferred DEV of the invention comprises a deletion of the entire UL4 gene.
(60) A particular DEV of the invention comprises a deletion of at least nt100-nt600 of the UL4 gene sequence, such as a deletion of nt51 to nt667 of a DEV UL4 genome.
(61) Another preferred DEV of the invention comprises an inactive UL4 gene and an inactive UL23 gene.
(62) Another preferred DEV of the invention comprises an inactive UL4 gene and an inactive US7 gene.
(63) In a preferred DEV of the invention, the foreign nucleic acid encodes an avian antigen, more preferably a VP2, HN or F protein or an immunogenic fragment thereof.
(64) Another preferred DEV of the invention comprises a deletion of at least nt100-nt600 of the UL4 gene sequence and at least one further deletion selected from: a deletion of at least nt100-nt1200 of the UL44 gene sequence, a deletion of at least nt100-nt1000 of the UL23 gene sequence, a deletion of at least nt100-nt1300 of the US4 gene sequence, a deletion of at least nt100-nt1100 of the US5 gene sequence, a deletion of at least nt100-nt1000 of the US7 gene sequence, and/or a deletion of at least nt100-nt800 of the US10 gene sequence, or combinations thereof.
Nucleic Acids
(65) The invention also relates to a nucleic acid molecule comprising the genome of a DEV having an inactive UL4 gene. Such nucleic acid may be single- or double-stranded, DNA or RNA. In a particular embodiment, the nucleic acid is a DNA molecule containing the genome of a DEV as defined above.
(66) The nucleic acid may be in free form, or in a vector such as a plasmid, BAC, and the like. The nucleic acid may be isolated, or contained in a host cell.
Cell Cultures
(67) The recombinant viruses of the present invention may be propagated in any competent cell cultures. After required growth of the viruses is achieved, the cells may be detached from the wells using a scraper or with trypsin and the infected cells may be separated from the supernatant by centrifugation.
(68) Examples of competent cells include CEF, embryonated egg, chicken kidney cell, and the like. The cells or viruses may be cultured in a culture medium such as Eagle's MEM, Leibowitz-L-15/McCoy 5A (1:1 mixture) culture medium at about 37 C. for 3 to 6 days. The infected cells are typically suspended in a culture medium containing 10% dimethyl sulfoxide (DMSO) and stored frozen under liquid nitrogen.
Compositions and Vaccines
(69) The invention also relates to compositions, such as vaccines, which comprise one or more DEVs of the invention.
(70) Compositions and vaccines of the invention may comprise the DEVs in a pharmaceutically or veterinary acceptable vehicle or excipient. The compositions and vaccines may, in addition or alternatively, comprise a suitable adjuvant.
(71) The compositions and vaccines according to the present invention may comprise a suitable solvent, such as for example an aqueous buffer or a phosphate buffer. Preferably, the compositions and vaccines also comprise additives, such as a stabilizing agent, a preservative, a coloring agent, a surfactant, etc.
(72) For instance, the compositions or vaccines of the present invention may be formulated with one or more further additives to maintain isotonicity, physiological pH and stability, for example, a buffer such as physiological saline (0.85%), phosphate-buffered saline (PBS), citrate buffers, Tris(hydroxymethyl aminomethane (TRIS), Tris-buffered saline and the like, or an antibiotic, for example, neomycin or streptomycin, etc.
(73) In a particular embodiment, the composition of the invention comprises a preservative.
(74) In another particular embodiment, the composition of the invention comprises a solubilizing agent.
(75) In another particular embodiment, the composition of the invention comprises an adjuvant. Adjuvants may be obtained from any of a number of sources including various proteins and peptides derived from animals (e.g., hormones, cytokines, co-stimulatory factors), and novel nucleic acids derived from viruses and other sources (e.g., double stranded RNA, CpG), and the like which, alone or in combination(s), are sufficient to enhance the immune response.
(76) The compositions of the invention may be liquid (solutions, suspensions, emulsions) or solid (powder, gel, paste, oil) and they may be formulated for any administration route. Preferably, they are formulated for injection, such as in ovo injection or for e.g., intravenous, subcutaneous, intramuscular, intraorbital, intraocular, intradermal, and/or intraperitoneal injection. Alternatively, they may be formulated for oral, ocular (e.g., by eye drop), intranasal, or oculo-nasal administration, e.g., using aerosol or spray.
(77) Each vaccine dose may contain a suitable dose sufficient to elicit a protective immune response in avian species. Optimization of such dose is well known in the art. The amount of antigen per dose may be determined by known methods using antigen/anti-body reactions, for example by the ELISA method.
(78) The vaccines of the invention can be administered as single doses or in repeated doses, depending on the vaccination protocol.
(79) In a particular embodiment, the invention relates to a vaccine comprising a virus, nucleic acid or cell as defined above and a suitable excipient or adjuvant.
(80) In a further particular embodiment, the invention relates to a vaccine comprising a liquid composition of a virus, nucleic acid or cell as defined above and a suitable excipient or adjuvant.
(81) The present invention further relates to the use of the virus, composition, vaccine, nucleic acid or cell as described above for immunizing avian species, such as poultry, and to method of immunizing avian species by administering an immunologically effective amount of the virus, composition, vaccine, nucleic acid or cell as described above.
(82) A further object of the invention relates to a composition, DEV, nucleic acid or host cell as defined above, for use to vaccinate or immunize avians, particularly poultry, more particularly chicken, more particularly young poultry (at Day 3 post-hatch or earlier) or in ovo.
(83) A further object of the invention relates to a composition, vaccine, DEV, nucleic acid or host cell as defined above, for use to induce protective immunity in avians, particularly poultry, more particularly chicken, more particularly young poultry (at Day 3 post-hatch or earlier) or in ovo.
(84) The invention also relates to a method of vaccinating a non-human animal, particularly poultry, more particularly chicken, more particularly young poultry (at Day 3 post-hatch or earlier or in ovo), comprising administering to said non-human animal a composition, vaccine, DEV, nucleic acid or host cell as defined above.
(85) A particular object of the invention is a method of vaccinating poultry comprising in ovo administration of a composition, vaccine, DEV, nucleic acid or host cell as defined above.
(86) Another particular object of the invention is a method of vaccinating poultry comprising administration of a composition, vaccine, DEV, nucleic acid or host cell as defined above, at Day 1 or at Day 2 post-hatch.
(87) In a further aspect, the invention provides a method for inducing an immunogenic or protective response in a non-human animal against one or more avian pathogens, comprising administering to said non-human animal, particularly poultry, more particularly chicken, more particularly young poultry (at Day 3 post-hatch or earlier) or in ovo, a composition, vaccine, DEV, nucleic acid or host cell as defined above.
(88) As indicated in the experimental section, the viruses of the invention are particularly advantageous for vaccinating young poultry (at Day 1, Day 2 or Day 3 post-hatch) or for in ovo vaccination. Indeed, the invention surprisingly shows that the viruses of the invention are safe upon such early administration, while native or wild-type DEV is lethal. Such early administration, combined with the early onset of immunity caused by these viruses, are particularly advantageous to induce early protective immunity, before poultry can be substantially exposed to pathogens.
(89) In this regard, in a more general aspect, the invention also relates to a method for vaccinating or immunizing an avian, particularly poultry, more particularly chicken, the method comprising in ovo administration to said avian of an attenuated DEV encoding an antigen. The invention also relates to a method for expressing a foreign gene in an avian, particularly poultry, more particularly chicken, the method comprising in ovo administration to said avian of an attenuated DEV containing said foreign gene. The invention also relates to the use of an attenuated DEV containing a foreign gene for expressing said gene into an avian by in ovo administration of said DEV. The invention also relates to an attenuated DEV encoding an antigen, for use to induce an immune response or to vaccinate an avian by in ovo administration of said DEV. The DEV preferably comprises an inactive endogenous gene, rendering said DEV attenuated and well tolerated upon in ovo injection.
(90) The present invention further relates to vaccination kits for immunizing avian species which comprises an effective amount of the multivalent vaccine as described above and a means for administering said components to said species. For example, such kit comprises an injection device filled with the vaccine according to the invention and instructions for intradermic, subcutaneous, intramuscular, or in ovo injection. Alternatively, the kit comprises a spray/aerosol or eye drop device filled with the vaccine according to the invention and instructions for oculo-nasal administration, oral or mucosal administration.
(91) Further aspects and advantages of the invention will be disclosed in the following experimental section, which is illustrative of the claimed invention.
EXAMPLES
Example 1: Virulence of Wild-Type DEV in Eggs or Young Poultry
(92) A clinical study was performed to investigate the pathogenicity or virulence of DEV at in chicken upon injection at different time schedule. More particularly, injection was performed in ovo (Day 3 before hatch), at Day 1 post-hatch, or at Day 4 post-hatch. DEV used was a wild-type DEV Jansen strain. The administered dose was either 100 or 1000 pfu/dose. As a control a PBS solution was administered in Group 1. Pathogenicity was assessed by measuring mortality each day after hatch.
(93) The results are presented in the following table.
(94) TABLE-US-00001 Dose Number of birds to death in each day of age Group Vaccine pfu Route Day.sup.1 n D0 D1 D2 D3 D4 D5 D6 D7 D8 >D9.sup.2 % Mortality 1 PBS in ovo 3 17 0 0 0 0 0 0 0 0 0 2 12 2 DEV 100 in ovo 3 16 3 2 9 1 1 100 3 DEV 1000 in ovo 3 17 5 2 9 1 100 4 DEV 1000 sc 1 17 0 0 0 0 0 6 4 2 1 1 82 5 DEV 1000 sc 4 17 0 0 0 0 0 0 0 0 0 0 0 .sup.1Day of age at inoculation .sup.2Number of birds died between 9-day to 19-days of age
(95) The above results show that injection of wtDEV at Day 4 post-hatch is safe with 100% survival rate (see group 5). In sharp contrast, after in ovo injection of DEV, 100% of birds died by 4-days of age, while in ovo injection of PBS is safe. These results thus show that, while wtDEV may be suitable for administration to adult animals, surprisingly, it is lethal in young animals (Day 3 or less post hatch) or when administered in ovo.
Example 2: Construction of DEV Comprising an Inactive UL4 Gene
2.1 Construction of rpsLneo-DsRed2 Cassette
(96) A 2.8-kb DNA fragment of rpsLneo-DsRed2 cassette was constructed by PCR reactions. Briefly, three PCR reactions were conducted. First PCR reaction was conducted using primer pair of SEQ ID NO: 1 (5-GGCCTGGTGATGATGGCGGGATCGTTGTAT-3) and SEQ ID NO: 2 (5-CCATGGTGCTGCGCTCAGAAGAACTCGTCA-3) with the template of synthesized fragment of rpsLneo (SEQ ID NO: 3). Second PCR reaction was conducted using primer pair of SEQ ID NO: 4 (5-ACGAGTTCTTCTGAGCGCAGCACCATGGCC-3) and SEQ ID NO: 5 (5-TCGGAGGAGGCCATCCTTAAGAGCTGTAAT-3) with the template plasmid of pSI Mammalian Expression Vectors (Promega, Cat # E1721). Third PCR reaction was conducted using primer pair of SEQ ID NO: 6 (5-TACAGCTCTTAAGGATGGCCTCCTCCGAGA-3) and SEQ ID NO: 7 (5-GCAGTGAAAAAAATGCTTTATTTGTGAAAT-3) with the template plasmid of pIRES2-DsRed2 (Clontech, Cat #632420). Another PCR reaction was conducted using a mixture of PCR products from the first and second PCR reactions as a template and SEQ ID NO: 1 and SEQ ID NO: 5 as primers. This PCR product and the PCR product from third PCR reaction were mixed and used for final PCR reaction with primer pair of SEQ ID NO:1 and SEQ ID NO:7, resulting in rpsLneo-DsRed2 cassette.
2.2. Construction of Insertion Cassette
(97) A DNA fragment of rpsLneo-DsRed2 cassette that was added Duck enteritis virus (DEV) UL4 region homologous sequences (50 bp each) of both 5 and 3 ends to both ends of it was constructed by PCR reaction (
2.3. Construction of Recombinant DEV Carrying rpsLneo-DsRed2 Gene
(98) Construction of recombinant DEV carrying rpsLneo-DsRed2 gene in UL4 region was conducted by homologous recombination in E. coli. strain carrying DEV genome was transfected with 0.1 g of the insertion cassette. Transfection was conducted by electroporation using Gene Pulser Xcell (Bio-Rad Laboratories) at 1.75 kV, 25 F, and 200 ohm. After transfection, the E. coli was planted onto Luria-Bertani (LB) agar plates, and incubated overnight at 30 C. E. coli clones carrying an appropriate insert containing the rpsLneo-DsRed2 gene were identified by PCR using primer pair amplifying a region between rpsLneo-DsRed2 gene and the insertion site region of DEV genome (Junction 1,
2.4. Verification of Genome Structure
(99) Genome structure of the recombinant DEV/UL4/rpsLneo-DsRed2 was verified by three PCR reactions amplifying junction regions (Junction 1, Junction 2, and Junction 3;
Example 3: Expression of Foreign Gene by Recombinant DEV Having Inactive UL4 Gene
(100) Expression of the DsRed2 protein by the recombinant DEV/UL4/rpsLneo-DsRed2 was confirmed by excitation for DsRed2. Excitation for DsRed2 was conducted using CEF cells infected with the recombinant DEV/UL4/rpsLneo-DsRed2. Briefly, CEF cells in 6-well plate were infected with the rDEV/UL4/rpsLneo-DsRed2 or the parent DEV strain at a multiplicity of infection of approximately 0.01. Three days post inoculation, cells were excited at 563 nm. Red fluorescence was only observed in the plaques of recombinant DEV/UL4/rpsLneo-DsRed2.
Example 4: Viability and Stability of Recombinant DEV Having Inactive UL4 Gene
(101) Recombinant DEV/UL4/rpsLneo-DsRed2 was passaged in CEF cells at fifteen times and confirmed stability of inserted gene of rpsLneo-DsRed2. Passage was conducted every three to four days. Every five passages, plaques of rDEV/UL4/rpsLneo-DsRed2 were checked red fluorescence by fluorescence microscope and genome structure of rDEV/UL4/rpsLneo-DsRed2 was confirmed by PCR analysis amplifying junction regions (Junction 1, Junction 2, and Junction 3;
Example 5: In Ovo Administration
(102) Recombinant DEV/UL4/rpsLneo-DsRed2 or parental DEV was inoculated into 18-days-old embryo of specific pathogen free (SPF) chickens or commercial layer (white leghorn) chickens with maternal antibodies. All groups of embryos are vaccinated in ovo with approximately 1000 pfu/0.1 ml of the recombinant DEV/UL4/rpsLneo-DsRed2, parental DEV or PBS via 20 gauge and 1.5 inch needles. The hatched chicks are bled each week between 1 and 3 weeks of age. Chicks are observed daily for clinical signs associated with DEV, such as depression and death. Three weeks post hatch, chicks are examined for weight gain and necropsied and observed for grossly observable lesions.
(103) TABLE-US-00002 Number of birds to death in each day of age Not >D6- D10- % Mor- Vaccine n hatch D0 D1 D2 D3 D4 D5 D8.sup.1 D9 D11.sup.2 tality PBS 22 2 0 0 0 0 2 0 0 0 0 18 DEV/UL4/rpsL 22 0 0 0 0 0 5 2 0 1 0 36 neo-DsRed2 DEV 22 0 6 1 8 4 2 0 0 0 0 95 .sup.1Number of birds died between 6-day to 8-days of age .sup.2Number of birds died between 10-day to 11-days of age
(104) The results are shown above. While almost all birds inoculated with parental DEV died, more than 60% birds inoculated with DEV/UL4/rpsLneo-DsRed2 survived.
Example 6: Construction and In Ovo Administration of a DEV Having an Inactive UL4 Gene and a Foreign Gene Sequence Inserted Between UL27 and UL26
(105) DEV having an inactive UL4 gene and a foreign gene sequence inserted between UL27 and UL26 was constructed.
6.1. Construction of pUC18-KAPEVAC-UL4del
(106) A 1.0-kb DNA fragment of DEV genome flanking the UL5 and UL3.5 genes was cloned by PCR reactions adding SfiI recognition site at the insertion site (
6.2. Construction of pUC18-KAPEVAC-UL26-BacVP2
(107) A 1.0-kb DNA fragment of DEV genome flanking the UL26 and UL27 genes was cloned by PCR reactions adding SfiI recognition site at the insertion site (
6.3. Construction of DEV Having an Inactive UL4 Gene and a Foreign Gene Sequence Inserted Between UL27 and UL26
(108) Construction of recombinant DEV having an inactive UL4 gene and a foreign gene sequence inserted between UL27 and UL26 region was conducted by homologous recombination in an E. coli strain carrying DEV genome and transfected with 0.1 g of the pUC18-KAPEVAC-UL4del and pUC18-KAPEVAC-UL26-BacVP2. Transfection was conducted by electroporation using Gene Pulser Xcell (Bio-Rad Laboratories) at 1.75 kV, 25 g, and 200 ohm. After transfection, the E. coli was planted onto Luria-Bertani (LB) agar plates, and incubated overnight at 30 C. E. coli clones carrying an appropriate insert containing the rpsLneo-DsRed2 gene were identified by PCR using primer pair amplifying a region between UL3.5 and UL5 genes (Junction 4;
6.4. Verification of Genome Structure
(109) Genome structure of the recombinant DEV/UL4del/UL26/BacVP2 was verified by four PCR reactions amplifying junction regions (Junction 1, Junction 2, and Junction 3;
6.5. In Ovo Administration
(110) 18-days-old chick embryos were administered 1000 plaque forming unit of rDEV/UL4del/UL26/BacVP2 or parental KAPEVAC virus in ovo at DOA 3. Clinical signs of the birds were observed for 35 days after hatch. The results of 17 birds show a survival rate above 80%.
Example 7: Construction and In Ovo Administration of DEVs Having an Inactive UL4 Gene and an Inactive UL23 Gene
(111) DEVs having an inactive UL4 and UL23 gene and a foreign gene were constructed.
7.1. Construction of pUC18-KAPEVAC-UL23-BacVP2 and pUC18-KAPEVAC-UL23-Coa5VP2
(112) A 1.0-kb DNA fragment of DEV genome flanking the UL24 and UL22 genes was cloned by PCR reactions adding SfiI recognition site at the insertion site (
7.2. Construction of pUC18-KAPEVAC-UL26-Coa5VP2
(113) pUC18-KAPEVAC-UL26-Coa5VP2 was constructed by utilizing the SfiI-digested pUC18-KAPEVAC-UL26-SfiI. Coa5-VP2 cassette was obtained from pUC18-KAPEVAC-UL23-Coa5VP2 by SfiI digestion and inserted into SfiI-digested pUC18-KAPEVAC-UL26-SfiI, resulting in pUC18-KAPEVAC-UL26-Coa5VP2 (
7.3. Construction of pUC18-KAPEVAC-UL45-Coa5VP2
(114) A 1.0-kb DNA fragment of DEV genome flanking the UL45 and UL46 genes was cloned by PCR reactions adding SfiI recognition site at the insertion site (
7.4. Construction of pUC18-KAPEVAC-UL50-Coa5VP2
(115) A 1.0-kb DNA fragment of DEV genome flanking the UL50 and UL51 genes was cloned by PCR reactions adding SfiI recognition site at the insertion site (
7.5. Construction of pUC18-KAPEVAC-UL23del
(116) A 1.0-kb DNA fragment of DEV genome flanking the UL24 and UL22 genes was cloned by PCR reactions adding SfiI recognition site at the insertion site (
7.6. Construction of DEV Having an Inactive UL4 and UL23 Genes and a Foreign Gene Sequence
(117) The construction of recombinant DEVs having inactive UL4 and UL23 genes and a foreign gene sequence was conducted by homologous recombination in an E. coli. strain carrying DEV genome and transfected with 0.1 g of the pUC18-KAPEVAC-UL4del and pUC18-KAPEVAC-UL23-BacVP2 for JK015, of the pUC18-KAPEVAC-UL4del, pUC18-KAPEVAC-UL23del, and pUC18-KAPEVAC-UL26-Coa5VP2 for JK022, of the pUC18-KAPEVAC-UL4del, pUC18-KAPEVAC-UL23del, and pUC18-KAPEVAC-UL45-Coa5VP2 for JK023, or of the pUC18-KAPEVAC-UL4del, pUC18-KAPEVAC-UL23del, and pUC18-KAPEVAC-UL50-Coa5VP2 for JK024. Transfection was conducted as described above and DEVs having an inactive UL4 and UL23 genes and a foreign gene sequence were rescued (JK022-JK024).
(118) TABLE-US-00003 promoter/ deletion insertion insertion Number Name site site gene/polyA JK015 rDEV/UL4del/ UL23 Ba/VP2stc/ UL23/BacVP2 SV40polyA JK022 rDEV/UL4del/ UL4, UL23 UL26/27 Coa5/VP2stc/ UL23del/UL26/ SV40polyA BacVP2 JK023 rDEV/UL4del/ UL4, UL23 UL45/46 Coa5/VP2stc/ UL23del/UL45/ SV40polyA Coa5VP2 JK024 rDEV/UL4del/ UL4, UL23 UL50/51 Coa5/VP2stc/ UL23del/UL51/ SV40polyA Coa5VP2 JK025 rDEV/UL4del/ UL4, UL23, UL23 Coa5/VP2stc/ US7del/UL23/ US7 SV40polyA Coa5VP2
(119) JK015, JK022, JK023, and JK024 were successfully rescued.
7.7. Growth Rate
(120) The growth rate of these DEVs was assessed and the results are provided below:
(121) TABLE-US-00004 DEV Deletion site Insertion site Stock titer JK022 UL4, UL23 UL26/27 9.6 10E4 JK023 UL4, UL23 UL45/46 8.5 10E4 JK024 UL4, UL23 UL50/51 6.1 10E4 JK025 UL4, UL23, US7 UL23 1.57 10E4
7.8. In Ovo Administration
(122) 18-days-old chick embryos were administered 1000 plaque forming unit of the following DEVs or parental KAPEVAC virus in ovo at DOA 3. Clinical signs of the birds were observed for 35 days after hatch. The results are shown in the table below:
(123) TABLE-US-00005 Dead Deletion Insertion Number birds at Survival DEV site site of eggs Not hatch day 35 rate Non 16 0 0 100% immunized control JK015 UL4, UL23 17 1 1 94% UL23 parental 17 7 10 0% DEV
(124) In this trial, most chickens inoculated with rDEV/UL4del/UL23/BacVP2 survived for the observation period, while all chickens inoculated with parental DEV strain died.
Example 8: Construction and In Ovo Administration of DEVs Having an Inactive UL4 Gene and an Inactive US7 Gene
(125) DEVs having an inactive UL4 and US7 genes and a foreign gene were constructed.
8.1. Construction of pUC18-KAPEVAC-US7-BacVP2
(126) A 0.6-kb DNA fragment of DEV genome flanking the US6 and US8 genes was cloned by PCR reactions adding SfiI recognition site at the insertion site (
8.2. Construction of pUC18-KAPEVAC-US7del
(127) A 0.6-kb DNA fragment of DEV genome flanking the US6 and US8 genes was cloned by PCR reactions (
8.3. Construction of DEV Having an Inactive UL4 and US7 Genes and a Foreign Gene Sequence
(128) Construction of recombinant DEVs having inactive UL4 and US7 genes and a foreign gene sequence was conducted by homologous recombination in an E. coli strain carrying DEV genome and transfected with 0.1 g of the pUC18-KAPEVAC-UL4del and pUC18-KAPEVAC-US7-BacVP2 for JK016, of the pUC18-KAPEVAC-UL4del, pUC18-KAPEVAC-US7del, and pUC18-KAPEVAC-UL23del-Coa5VP2 for JK025, of the pUC18-KAPEVAC-UL4del, pUC18-KAPEVAC-US7del, and pUC18-KAPEVAC-UL26-Coa5VP2 for JK026, of the pUC18-KAPEVAC-UL4del, pUC18-KAPEVAC-US7del, and pUC18-KAPEVAC-UL45-Coa5VP2 for JK027, or of the pUC18-KAPEVAC-UL4del, pUC18-KAPEVAC-US7del, and pUC18-KAPEVAC-UL50-Coa5VP2 for JK028. Transfection was conducted as described above and DEVs having an inactive UL4 and US7 genes and a foreign gene sequence were rescued (JK016, and JK025-JK028).
(129) TABLE-US-00006 promoter/ deletion insertion insertion Number Name site site gene/polyA JK016 rDEV/UL4del/ UL4, US7 US7 Bac/VP2stc/ US7/BacVP2 SV40polyA JK025 rDEV/UL4del/ UL4, UL23, UL23 Coa5/VP2stc/ US7del/UL23/ US7 SV40polyA Coa5VP2 JK026 rDEV/UL4del/ UL4, US7 UL26/27 Coa5/VP2stc/ US7del/UL26/ SV40polyA Coa5VP2 JK027 rDEV/UL4del/ UL4, US7 UL45/46 Coa5/VP2stc/ US7del/UL45/ SV40polyA Coa5VP2 JK028 rDEV/UL4del/ UL4, US7 UL50/51 Coa5/VP2stc/ US7del/UL50/ SV40polyA Coa5VP2
(130) JK016, JK025-JK028 were successfully constructed.
8.4. Growth Rate
(131) The growth rate of these DEVs was assessed and the results are provided below:
(132) TABLE-US-00007 DEV Deletion site Insertion site Stock titer JK025 UL4, UL23, US7 UL23 1.57 10E4 JK026 UL4, US7 UL26/27 5.2 10E4 JK027 UL4, US7 UL45/46 1.18 10E5 JK028 UL4, US7 UL50/51 2.2 10E5
8.5. In Ovo Administration
(133) 18-days-old chick embryos were administered 1000 plaque forming unit of the following DEVs or parental KAPEVAC virus in ovo at DOA 3. Clinical signs of the birds were observed for 35 days after hatch. The results are shown in the table below:
(134) TABLE-US-00008 Dead Deletion Insertion Number birds at Survival DEV site site of eggs Not hatch day 35 rate Non 16 0 0 100% immunized control JK016 UL4, US7 US7 17 0 0 100% Parental 17 7 10 0% DEV
(135) In this trial, all the chickens inoculated with rDEV/UL4del/US7/BacVP2 survived for 35 days.
(136) TABLE-US-00009 LISTOFSEQUENCES SEQIDNO:1F-rpsL:(5-GGCCTGGTGATGATGGCGGGATCGTTGTAT-3) SEQIDNO:2R-SV40promoter-neoR-rpsL:(5-CCATGGTGCTGCGCTCAGAAGAACTCGTCA-3) SEQIDNO:3rpsLneo:(5- GGCCTGGTGATGATGGCGGGATCGTTGTATATTTCTTGACACCTTTTCGGCATCGCCCTAAAATTC GGCGTCCTCATATTGTGTGAGGACGTTTTATTACGTGTTTACGAAGCAAAAGCTAAAACCAGGAGC TATTTAATGGCAACAGTTAACCAGCTGGTACGCAAACCACGTGCTCGCAAAGTTGCGAAAAGCAA CGTGCCTGCGCTGGAAGCATGCCCGCAAAAACGTGGCGTATGTACTCGTGTATATACTACCACTCC TAAAAAACCGAACTCCGCGCTGCGTAAAGTATGCCGTGTTCGTCTGACTAACGGTTTCGAAGTGAC TTCCTACATCGGTGGTGAAGGTCACAACCTGCAGGAGCACTCCGTGATCCTGATCCGTGGCGGTCG TGTTAAAGACCTCCCGGGTGTTCGTTACCACACCGTACGTGGTGCGCTTGACTGCTCCGGCGTTAA AGACCGTAAGCAGGCTCGTTCCAAGTATGGCGTGAAGCGTCCTAAGGCTTAAGGAGGACAATCAT GATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATG ACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGC CCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGG CTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGA AGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCC GAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCA TTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGA TCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGG CGCGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGG TGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGG ACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCG TGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTT CTGA-3) SEQIDNO:4F-neoR-SV40promoter:(5-ACGAGTTCTTCTGAGCGCAGCACCATGGCC-3) SEQIDNO:5R-dsRed-SV40promoter-intron:(5-TCGGAGGAGGCCATCCTTAAGAGCTGTAAT-3) SEQIDNO:6F-SV40promoter-intron-dsRed:(5-TACAGCTCTTAAGGATGGCCTCCTCCGAGA-3) SEQIDNO:7R-SV40polyA-dsRed:(5-GCAGTGAAAAAAATGCTTTATTTGTGAAAT-3) SEQIDNO:8F-DEV-UL4-rpsLneo:(5- ATGCAATCGCATCCGGCAACGTTTATAACTTACACTCTGGGGGGTACCGGGGCCTGGTGATGATGG CGGG-3) SEQIDNO:9R-DEV-UL4-rpsLneoSV40DsRed:(5- TTAAATGTCTATACCGTTCACTGCAATTGGCTCCTGAGACGTTCCATTGCGCAGTGAAAAAAATGC TTTA-3) SEQIDNO:10F-VAC-109228:(5-TGTTTAGCGTTATCCGCCCACTGTGTAAAC-3) SEQIDNO:11R-neo:(5-TCAGAAGAACTCGTCAAGAAGGC-3) SEQIDNO:12R-VAC-110144:(5-GGGAGTATTCACAAAATAATAAACAAAC-3) SEQIDNO:13UL4genesequenceofaDEVJansenstrain:(5 - ATGCAATCGCATCCGGCAACGTTTATAACTTACACTCTGGGGGGTACCGGTGCTTCGCATACGTGG ACTGTTCCAGAATATGAACAAGTGATCTGTTCGTGCGATGGAGGATCGAGATCTGTTCTGGTCGGG AACAAGACACGCTGTGACAAACTCCCTCCGTGTAATGTTATTATTCAACGCGGCCCTCTTGGGACT CTATTCGTCGTAGATATTGGGTATGCAATATATTCCTATATGCTACGTTGTGATCTAAAAAAACAA CAGGTCGGTACATTATCAGCCTCACCTGGTTCATTATATGTAGTTCCGTTTACATCATGTACCGTAG TCGGAGTAGATAGCTACATCCGCAGTGACTCTAGTGGTGTATTAACGATTGCATGGTCTCATAATA CAGTGCATATAACAATAACTGTATATGGTCTGTCGGAAGAGTCTCAGCGCATGGCAAGCGTTTCGG CCATATCTACTGTCGGGCAAGACTATGAAAATCTTCAGGATATAGCCAACCAAGAGCAAAGTGAA GATTTACTATCTGCTGCAATAAAAGAAGCTAATATTGGTGTCGACTACATATCAGATAGTGAGTCG TCATCTAGAACGGTTATGGACGACTTACTAACTTCTATTCAAGATGAATGCCTAGAGACGGCCGAC TGCTTCTGCAATGGAACGTCTCAGGAGCCAATTGCAGTGAACGGTATAGACATTTAA-3) SEQIDNO:14F-SphI-KAPEVAC-111150:(5-gcGCATGCACTATAGCGCGCTCACAG-3) SEQIDNO:15R-KAPEUL4del:(5-CAGACCTAAAGGTTAGGCCGTCTGTGAATG-3) SEQIDNO:16F-KAPEUL4del:(5-CATTCACAGACGGCCTAACCTTTAGGTCTG-3) SEQIDNO:17R-EcoRI-KAPEVAC-112880:(5-gcGAATTCCGCAAACTACACAAGTCCG-3) SEQIDNO:18F-SalI-VAC68400:(5-CGGTCGACACTCCCAGGGGTGAAGC-3) SEQIDNO:19R-SfiI-UL26-27-insertion:(5-CGGCCAATAAGGCCAAGAATGCATTCGGCC-3) SEQIDNO:20F-SfiI-UL26-27-insertion:(5-TGGCCTTATTGGCCGCCGTATGAATTGCGC-3) SEQIDNO:21R-SacI-VAC69400:(5-GCGAGCTCCTGCAACCACAGACCGC-3) SEQIDNO:22F-VAC-68351:(5-GACGCTATACCCAATGACGATGAAAAC-3) SEQIDNO:23STC1109S:(5-GAGCAACTTCGAGCTGATCC-3) SEQIDNO:24R-VAC68971:(5-GTACTGCCCGGCCGGTCTAATG-3) SEQIDNO:25STC201AS:(5-GCCAGGGAATCCAGGGAAAAAGAC-3) SEQIDNO:26F-SphI-KAPEVAC-76350:(5-GCGCATGCCAATTGTCTAATTCCAG-3) SEQIDNO:27R-KAPE-UL23del-SfiIinsertion:(5- CCCGGCCAATAAGGCCACAGAAAAAGCGCG-3) SEQIDNO:28F-KAPE-UL23del-SfiIinsertion:(5-CTGTGGCCTTATTGGCCGGGATCTGGAAC-3) SEQIDNO:29R-EcoRI-KAPEVAC-78350:(5-GCGAATTCATGTGCTACGCCCAG-3) SEQIDNO:30F-SalI-VAC21300:(5-CGGTCGACATAGAACGCGCTTCATCTAA-3) SEQIDNO:31R-SfiI-UL45-46-insertion:(5-TGGCCAATAAGGCCGTTTATTGTTTATTAT-3) SEQIDNO:32F-SfiI-UL45-46-insertion:(5-CGGCCTTATTGGCCAATCTGATTCATCCAA-3) SEQIDNO:33R-SacI-VAC22300:(5-GCGAGCTCCGCCTAATCACAATCGGTATTG-3) SEQIDNO:34F-SphI-VAC12000:(5-CCGCATGCGCAACTATATATGTCGGTC-3) SEQIDNO:35R-SfiI-UL50-51-insertion:(5-GGGCCAATAAGGCCCAAAAGTACATTTTGT-3) SEQIDNO:36F-SfiI-UL50-51-insertion:(5-GGGCCTTATTGGCCCAATTTATTTACTATT-3) SEQIDNO:37R-EcoRI-VAC13000:(5-GCGAATTCTGGATATGATATACCGTTGC-3) SEQIDNO:38R-KAPE-UL23del:(5-CTTGTTCCAGATCCCACAGAAAAAGCGCG-3) SEQIDNO:39F-KAPE-UL23del:(5-CGCGCTTTTTCTGTGGGATCTGGAACAAG-3) SEQIDNO:40F-SphI-KAPEVAC-US7del-new:(5-gcGCATGCCCACCCATAGCCTATTAC-3) SEQIDNO:41R-KAPEUS7del-SfiIinsertion:(5- TATGATTGACTGTTTGCCTTTCATTAACATCCAAATATATTTGTACATGAGGTAATAGGCTATGGGT GCCTTATTGGCCA-3) SEQIDNO:42F-KAPEUS7del-SfiIinsertion:(5- AACAGTCAATCATAACAAAAACATTTACTTTTAGTCATACTGATGTGAATTAggccttattggccTTCTATT TTTGAAAC-3) SEQIDNO:43R-EcoRI-KAPEVAC-138100:(5-gcGAATTCATGACCATGGACATGC-3) SEQIDNO:44R-KAPE-U57del:(5-GTGCGCCATATAGACGTAATTCACATCAG-3) SEQIDNO:45F-KAPE-U57del:(5-CTGATGTGAATTACGTCTATATGGCGCAC-3)