Methods for conferring or enhancing herbicide resistance on plants and/or alga with protoporphyrinogen oxidase variants

10717985 ยท 2020-07-21

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided are methods for conferring and/or enhancing herbicide resistance on plants or algae including agricultural crops by introducing prokaryote-derived protoporphynnogen oxidase variants.

Claims

1. A method of conferring herbicide resistance on a plant or an alga, the method comprising: transforming an alga, plant cell, protoplast, callus, hypocotyl, seed, cotyledon, shoot, or plant with a nucleotide sequence encoding a polypeptide consisting of the amino acid sequence of SEQ ID NO: 5, wherein the herbicide is selected from the group consisting of Tiafenacil, Saflufenacil, Butfenacil, Flumioxazin, Fomesafen, Actifluorfen, Oxyfluorfen, Sulfentrazone, Pentoxazone, Pyraflufen-ethyl, Oxadiozon, Fluthiacet-methyl, Pyraclonil, and a combination thereof.

2. The method of claim 1, wherein the nucleotide sequence consists of the nucleotide sequence of SEQ ID NO: 6 or a nucleotide sequence having 95% or higher sequence identity to the full length sequence.

3. The method of claim 1, wherein the coding sequence is included in the form of a recombinant plant expression vector or a recombinant algae expression vector.

4. The method of claim 1, wherein the plant is monocotyledonous plant, dicotyledonous plant, herbaceous plant, or woody plant.

5. The method of claim 1, wherein the plant or the alga additionally comprises a second nucleotide sequence encoding an herbicide-resistant polypeptide that confers resistance to a second herbicide.

6. The method of claim 5, wherein the second herbicide is selected from the group consisting of glyphosate, glufosinate, dicamba, 2,4-D (2,4-Dichlorophenoxyacetic acid), isoxaflutole, ALS (acetolactate synthase)-inhibiting herbicide, a photosystem II-inhibiting herbicide, a phenylurea-based herbicide, a bromoxynil-based herbicide, and a combination thereof.

7. The method of claim 5, wherein the second herbicide-resistant polypeptide is selected from the group consisting of EPSPS (5-enolpyruvylshikimate-3-phosphate synthase), GOX (glyphosate oxidase), GAT (glyphosate-N-acetyltransferase), glyphosate decarboxylase, PAT(phosphinothricin-N-acetyltransferase), DMO (monooxygenase), 2,4-D-monooxygenase, AAD (aryloxyalkanoate Dioxygenase), AHAS (acetohydroxyacid synthase), AtAHASL (Acetohydroxyacid synthase Large Subunit), photosystem II protein D1, cytochrome P450, HPPD (Hydroxylphenylpyruvate dioxygenase), nitrilase and a combination thereof.

8. The method of claim 5, wherein the nucleotide sequence encoding the second herbicide-resistant polypeptide is selected from the group consisting of CP4 EPSPS, MEPSPS, 2MEPSPS, GOXV247, GAT4601, GAT4621, BAR, PAT, DMO, ADD-1, AAD-12, HPPDPF W336, ALS, SCR1, CSR1-1, CSR1-2, GM-HRA, S4-HRA, ZM-HRA, SURA, SURB, PSBA, phenylurea herbicide-resistant CYP76B 1, BXN, and a combination thereof.

9. A transformant, clone or progeny thereof, having herbicide resistance, comprising the nucleotide sequence of claim 1.

10. The transformant, clone or progeny thereof of claim 9, wherein the transformant is plant cell, protoplast, callus, hypocotyl, seed, cotyledon, shoot, or plant.

11. A method of preparing a plant or an alga having herbicide resistance, the method comprising transforming a plant, plant cell, protoplast, callus, hypocotyl, seed, cotyledon, shoot, or alga with the nucleotide sequence of claim 1.

12. A method of controlling weeds in a cropland, the method comprising providing the cropland with a plant comprising the nucleotide sequence of claim 1, and applying an effective dosage of protoporphyrinogen oxidase-inhibiting herbicide to the croplands.

13. The method of claim 12, wherein the applying an effective dosage of a protoporphyrinogen oxidase-inhibiting herbicide to the cropland is performed by applying two or more combinations of protoporphyrinogen oxidase-inhibiting herbicides at an effective dosage thereof, sequentially or simultaneously.

14. The method of claim 12, wherein the plant further comprises a second nucleotide sequence encoding an herbicide resistant polypeptide that confers resistance to a second herbicide, and the method further comprises applying an effective amount of the protoporphyrinogen oxidase-inhibiting herbicide and the second herbicide to the cropland, sequentially or simultaneously.

15. A method of controlling undesired aquatic species in a cultivation medium, the method comprising providing the cultivation medium with an alga comprising the nucleotide sequence of claim 1, and applying an effective dosage of protoporphyrinogen oxidase-inhibiting herbicide to the cultivation medium.

Description

BRIEF DESCRIPTION OF DRAWINGS

(1) FIG. 1 is a photograph showing growth of Halothece sp. PCC 7418 strain which was cultured for 8 days in a CRBIP medium (Institut Pasteur, France) added without Tiafenacil or with 2 M or 10 M Tiafenacil.

(2) FIG. 2 shows a structure of pACBB vector used in E. coli BT3(PPO) of the present invention. eGFP was removed before use, when each PPO gene was cloned into the vector.

(3) FIG. 3 is a photograph showing growth inhibition of respective BT3(PPO) strains transformed with the wild-type AtPPO1 (indicated by WT) and mutant AtPPO1 (indicated by MT) genes after spotting them onto agar medium containing 025 M Tiafenacil, and culturing them under light and dark conditions.

(4) FIG. 4 is a photograph showing growth inhibition of respective BT3(PPO) strains transformed with the wild-type AtPPO1 (indicated by WT), mutant AtPPO1 (indicated by MT), CyPPO2 (indicated by 2), CyPPO4 (indicated by 4) and CyPPO8 (indicated by 8) genes on agar medium containing 025 M of a pyrimidinedione-based herbicide, Tiafenacil, Saflufenacil or Butafenacil, or an N-phenylphthalimide-based PPO herbicide, Flumioxazin. V indicates a strain prepared by transforming BT3(PPO) with empty pACBB vector.

(5) FIG. 5 is a photograph showing growth inhibition of respective BT3(PPO) strains transformed with the wild-type AtPPO1 (indicated by WT), mutant AtPPO1 (indicated by MT), CyPPO2 (indicated by 2), CyPPO4 (indicated by 4) and CyPPO8 (indicated by 8) genes on agar medium containing 0400 M of a diphenyl ether-based PPO herbicide, Fomesafen, Acifluorfen or Oxyfluorfen. V indicates a strain prepared by transforming BT3(PPO) with empty pACBB vector.

(6) FIG. 6 is a photograph showing growth inhibition of respective BT3(PPO) strains transformed with the wild-type AtPPO1 (indicated by WT), mutant AtPPO1 (indicated by MT), CyPPO2 (indicated by 2), CyPPO4 (indicated by 4) and CyPPO8 (indicated by 8) genes on agar medium containing 0400 M of a triazolinone-based PPO herbicide, Sulfentrazone, an oxizolidinedione-based PPO herbicide, Pentoxazone, a phenylpyrazole-based PPO herbicide, Pyraflufen-ethyl, an oxadiazole-based PPO herbicide, Oxadiazon, a thiadiazole-based PPO herbicide, Fluthiacet-methyl, or other PPO herbicide, Pyraclonil. V indicates a strain prepared by transforming BT3(PPO) with empty pACBB vector.

(7) FIG. 7 is a photograph showing growth inhibition of respective BT3(PPO) strains transformed with the wild-type AtPPO1 (indicated by WT), mutant AtPPO1 (indicated by MT), and CyPPO12 gene on agar medium containing 0400 M of Tiafenacil, Saflufenacil, Flumioxazin, Fomesafen or Oxyfluorfen.

(8) FIG. 8 is a photograph showing growth inhibition of respective BT3(PPO) strains transformed with the wild-type AtPPO1 (indicated by WT), mutant AtPPO1 (indicated by MT), and CyPPO12 gene on agar medium containing 0400 M of Pyraflufen-ethyl, Oxadiazon, Sulfentrazone, Pentoxazone or Pyraclonil.

(9) FIG. 9 is a graph showing growth inhibition of respective BT3(PPO) strains transformed with the wild-type AtPPO1 (indicated by WT), mutant AtPPO1 (indicated by MT), CyPPO2 and CyPPO4 genes in liquid LB medium containing 0100 M of Tiafenacil over culture time.

(10) FIG. 10 is a graph showing growth inhibition of respective BT3(PPO) strains transformed with the wild-type AtPPO1 (indicated by WT), mutant AtPPO1 (indicated by MT), CyPPO2, CyPPO4 and CyPPO8 genes in liquid LB medium containing 0100 M of Saflufenacil over culture time.

(11) FIG. 11 is a graph showing growth inhibition of respective BT3(PPO) strains transformed with the wild-type AtPPO1 (indicated by WT), mutant AtPPO1 (indicated by MT), CyPPO2, CyPPO4 and CyPPO8 genes in liquid LB medium containing 0100 M of Fomesafen over culture time.

(12) FIG. 12 is a schematic diagram showing a structure of a plant expression vector which was used to examine PPO gene expression in chloroplasts of tobacco leaves.

(13) FIG. 13 shows the result of examining expressions of YFP, wild-type AtPPO1 (indicated by WT), CyPPO2, CyPPO4 and CyPPO8 genes in plant chloroplasts, after each of them was subcloned into the vector of FIG. 12, and then introduced into the plant.

(14) FIG. 14 is a schematic diagram showing a structure of a vector for plant transformation, which was used for transformation of Arabidopsis thaliana with PPO gene.

(15) FIG. 15 is the result of examining seed germination of respective Arabidopsis thaliana T2 seeds transformed with the mutant AtPPO1 (indicated by MT), CyPPO2 and CyPPO8 genes in 1/2 MS medium or 1/2 MS medium containing 70 nM of tiafenacil. The mutant AtPPO1 (indicated by MT) as a control was a seed(T2) which was transformed with the gene having resistance against a PPO-based herbicide by amino acid replacement.

(16) FIG. 16 shows the result of Western blotting of each line of Arabidopsis thaliana T2 generation transformed with CyPPO2 gene to examine whether expression of CyPPO2 protein is maintained in the next generation. CyPPO2(R) indicates the herbicide-resistant transformant line, and CyPPO2(S) indicates the herbicide-sensitive transformant line. The lower panel of FIG. 16 shows the result of PCR to examine insertion of BAR gene into a binary vector.

(17) FIG. 17 shows the result of Western blotting of each line of Arabidopsis thaliana T2 generation transformed with CyPPO8 gene to examine whether expression of CyPPO8 protein is maintained in the next generation. CyPPO8(R) indicates the herbicide-resistant transformant line, and CyPPO8(S) indicates the herbicide-sensitive transformant line. The lower panel of FIG. 17 shows the result of PCR to examine insertion of BAR gene into a binary vector.

(18) FIG. 18 shows the result of examining growth of respective Arabidopsis thaliana T2 generations transformed with CyPPO2, CyPPO4 and CyPPO8 genes and a control mutant AtPPO1 (indicated by MT) gene at 7 days after spraying 1 M Tiafenacil thereto. WT indicates the result of the wild-type Arabidopsis thaliana.

(19) FIG. 19 shows the result of examining growth of respective Arabidopsis thaliana T2 generations transformed with CyPPO2, CyPPO4 and CyPPO8 genes and the control mutant AtPPO1 (indicated by MT) gene at 7 days after spraying 0.5 M Tiafenacil, 1 M Saflufenacil, or 3 M Fomesafen thereto. WT indicates the result of the wild-type Arabidopsis thaliana.

(20) FIG. 20 shows the result of culturing respective seeds of CyPPO2 and BAR gene-inserted Arabidopsis thaliana transformant and CyPPO8 and BAR gene-inserted Arabidopsis thaliana transformant in a glufosinate-added medium, Tiafenacil-added medium, or glufosinate and Tiafenacil-added medium.

(21) FIG. 21 shows the result of culturing the seed of CyPPO2 or CyPPO8 gene-inserted Arabidopsis thaliana transformant in a Tiafenacil-added medium, Saflufenacil-added medium, or Tiafenacil and Saflufenacil-added medium.

(22) FIG. 22 shows the result of examining a relationship between amino acid homology of CyPPO2, CyPPO4, or CyPPO8 protein and herbicide resistance, and is a photograph showing growth inhibition of respective BT3(PPO) strains transformed with CyPPO2 amino acid sequence variant (indicated by 2M), CyPPO4 amino acid sequence variant (indicated by 4M) and CyPPO8 amino acid sequence variant (indicated by 8M) genes in agar media with varying concentrations of Tiafenacil, Saflufenacil and Butafenacil. As a control group to determine growth inhibition, wild-type AtPPO1 (indicated by WT) and Mutant AtPPO1 (indicated by MT) were used.

(23) FIG. 23 is a photograph showing growth inhibition of respective BT3(PPO) strains transformed with CyPPO2 amino acid sequence variant (indicated by 2M), CyPPO4 amino acid sequence variant (indicated by 4M) and CyPPO8 amino acid sequence variant (indicated by 8M) genes in agar media with varying concentrations of Acifluorfen, Oxyfluorfen and Fomesafen. As a control group to determine growth inhibition, wild-type AtPPO1 (indicated by WT) and Mutant AtPPO1 (indicated by MT) were used.

(24) FIG. 24 is a photograph showing growth inhibition of respective BT3(PPO) strains transformed with CyPPO2 amino acid sequence variant (indicated by 2M), CyPPO4 amino acid sequence variant (indicated by 4M) and CyPPO8 amino acid sequence variant (indicated by 8M) genes in agar media with varying concentrations of Sulfentrazone, Oxadiazon, Pentoxazone and Pyraclonil. As a control group to determine growth inhibition, wild-type AtPPO1 (indicated by WT) and Mutant AtPPO1 (indicated by MT) were used.

(25) FIG. 25 is a photograph showing growth inhibition of respective BT3(PPO) strains transformed with CyPPO2 amino acid sequence variant (indicated by 2M), CyPPO4 amino acid sequence variant (indicated by 4M) and CyPPO8 amino acid sequence variant (indicated by 8M) genes in agar media with varying concentrations of Fluthiacet-methyl, Pyraflufen-ethyl and Flumioxazin. As a control group to determine growth inhibition, wild-type AtPPO1 (indicated by WT) and Mutant AtPPO1 (indicated by MT) were used.

DETAILED DESCRIPTION OF THE EMBODIMENTS

(26) Hereinafter, the present invention will be described in detail with reference to Examples. However, these Examples are for illustrative purposes only, and the invention is not intended to be limited by these Examples.

Example 1. Isolation of PPO Gene from Prokaryote

(27) Oscillatoria nigro-viridis PCC 7112, Lyngbya sp. PCC 8106 strain, and Halothece sp. PCC 7418 strain were provided by the Institut Pasteur, (France), and PPO genes were isolated therefrom by PCR using primers of Table 1. Genomic DNA was isolated from each strain, and PPO gene was isolated and amplified using the primers of Table 1. The sequence of the PPO gene of Microcoleus vaginatus (GenScript) was synthesized by codon usage optimization of Arabidopsis thaliana using Genbank database information and amplified using primers of Table 1. 50 l of PCR reaction mixture was prepared by mixing 1 l of each template (genomic DNA of each strain), 5 l of 10 buffer, 2 l of dNTP mixture (each 10 mM), 3 l of a forward primer (10 M), 3 l of a reverse primer (10 M), 35.5 l of DDW, and 0.5 l of Pfu-X (Solgent, 2.5 unit/l) or EF-taq (Solgent, 2.5 u/l), and amplification was performed under conditions of at 94 C. for 4 minutes, and 30 cycles (at 94 C. for 30 seconds, at 56 C. for 30 seconds and at 72 C. for 1.5 minutes), at 72 C. for 5 minutes and at 4 C. for 5 minutes. PPO isolated from Oscillatoria nigro-viridis PCC 7112 was designated as CyPPO2, PPO isolated from Lyngbya sp. PCC 8106 strain was designated as CyPPO4, PPO isolated from Halothece sp. PCC 7418 strain was designated as CyPPO8, and PPO isolated from Microcoleus vaginatus was designated as CyPPO12.

(28) Further, respective amino acid sequences and nucleotide sequences of CyPPO2, CyPPO4, CyPPO8 and CyPPO12 were examined, and represented by SEQ ID NOS: 1 to 8, and in particular, the amino acid sequence of CyPPO2 showed 94% sequence homology to that of CyPPO12.

(29) TABLE-US-00001 TABLE1 SEQID Strain Primer Sequence NO: Oscillatoria PCC7112_BmHIF ccccggatccATGGAACTATTAGATACCTTGATT 18 nigro-viridis GTGGG PCC7112 PCC7112_StuIR cccaggcctGATCGATCGAGTATCTGATTG 19 Halothecesp. PCC7418_BmHIF ccccggatccATGATAGATACTTTAATTGTGGG 20 PCC7418 PCC7418_XhoIR ccccctcgagACCCAAATAATCTAACACGG 21 Lyngbyasp.PCC PCC8106_BglIIF ccccagatctATGACTCACGTACTCGATAG 22 8106 PCC8106_XhoIR ccccctcgagTTGACCCAAAAAACTGAGAATTTC 23 Microcoleus CyPPO12_BamHIF CCCCGGATCCATGGAACTCTTGGATACTCT 24 vaginatus CyPPO12_XhoIR CCCCCTCGAGGATTGACCTGGTATCAGATT 25

Example 2. Test of Herbicide Resistance of Halothece sp. PCC 7418 Strain

(30) Halothece sp. PCC 7418 strain was cultured in CRBIP Medium 1538 (Institut Pasteur, France). CRBIP Medium 1538 is a mixed medium of ASNIII and Turks Island Salts 4 at a ratio of 1:1 (v/v), and ASNIII medium was composed of 25.0 g of NaCl, 3.5 g of MgSO.sub.4.7H.sub.2O, 2.0 g of MgCl.sub.2.6H.sub.2O, 0.5 g of KCl, 0.5 g of CaCl.sub.2.2H.sub.2O, 0.75 g of NaNO.sub.3, 0.02 g of K.sub.2HPO.sub.4.3H.sub.2O, 0.04 g of NaCO.sub.3, 2.5 ml of ammonium iron (III) citrate/citric acid monohydrate solution [a mixture of 300 mg of ammonium iron (III) citrate, 300 mg of citric acid monohydrate, and 250 ml of distilled water], 2.5 ml of magnesium titriplex dihydrate solution [a mixture of 0.1 g of Mg EDTA and 500 ml of distilled water], 1 ml of trace metal A5+Co [a mixture of 2.86 g of H.sub.3BO.sub.3, 1.81 g of MnCl.sub.2.4H.sub.2O, 0.222 g of ZnSO.sub.4.7H.sub.2O, 0.39 g of NaMoO.sub.4.2H.sub.2O, 0.079 g of CuSO.sub.4.5H.sub.2O, 0.049 g of Co(NO.sub.3).sub.2.6H.sub.2O and 1000 ml of distilled water], and 1000 ml of distilled water. Turks Island Salts 4 was composed of 112 g of NaCl, 2.68 g of KCl, 22 g of MgCl.sub.2.6 H.sub.2O, 27.7 g of MgSO.sub.4.7 H.sub.2O, 5.8 g of CaCl.sub.2.2 H.sub.2O, and 1000 ml of distilled water. ASNIII medium and Tursk Island Salts 4 were autoclaved at 120 C. for 20 minutes, respectively and then mixed at a ratio of 1:1 (v/v).

(31) 5 ml of the above culture medium was added to a test tube, and 2 or 10 M of Tiafenacil was added thereto or not. The seed-cultured Halothece sp. PCC 7418 strain was added to each test tube at an equal volume and growth of the strain was examined for 8 days. As a result, growth of Halothece sp. PCC 7418 strain was maintained even at 8 days after treatment of 10 M of Tiafenacil, indicating that this strain has herbicide resistance (FIG. 1).

Example 3. Test of Herbicide Resistance of CyPPO2, CyPPO4, CyPPO8 and CyPPO12 in PPO-Deficient E. coli (Agar Medium)

(32) To test herbicide resistance of CyPPO2, CyPPO4, CyPPO8 and CyPPO12 isolated in Example 1, PPO-deficient BT3 E. coli [hereinafter, referred to as BT3(PPO)] was transformed with CyPPO2, CyPPO4, CyPPO8 or CyPPO12 gene, respectively and then cultured in the presence of herbicides to examine growth inhibition of the transformed E. coli. As a negative control, Arabidopsis thaliana-derived wild-type PPO (wild-type AtPPO1) was used, and wild-type AtPPO1 has sensitivity to PPO-based herbicides and its sequence information is available in GeneBank accession no. AX084732 (a nucleotide sequence of the gene is represented by SEQ ID NO: 10, and an amino acid sequence thereof is represented by SEQ ID NO: 9). As a positive control, Mutant AtPPO1 was used, in which amino acid replacements of Y426M (replacement of tyrosine by methionine at position 426) and 5305L (replacement of serine by leucine at position 305) occur in the amino acid sequence of the wild-type AtPPO1 (an amino acid sequence is represented by SEQ ID NO: 11) (Li X, Volrath S L., N D B. G., Chilcott C E, Johnson M A, Ward E R, Law M D (2003) Development of protoporphyrinogen oxidase as an efficient selection marker for Agrobacterium tumefaciens-mediated transformation of maize. Plant physiology 133:736-747).

(33) BT3(PPO) strain was provided by Hokkaido University (Japan) and it is an E. coli strain which is deficient in hemG-type PPO and has Kanamycin resistance (Watanabe et al., (2001) Dual targeting of spinach protoporphyrinogen oxidase II to mitochondria and chloroplasts by alternative use of two in-frame inhibition codons. JBC 2047420481).

3-1. Preparation of Experimental Materials and Instruments

(34) HVE-50 autoclave from Hirayama, HS2100A electronic scale from Hansung Instrument, CB-30V clean bench from Jeio Tech, JSI-200CL incubator from JSR, 1210 type UV-visible spectrophotometer from Thermo Fisher Scientific, MQ-200 photometer from Apogee, and Bio-Rad MyCycler as PCR machine were used. The autoclave was used under conditions of 121 C. and 15 minutes, and the incubator was used at 37 C. with lighting of 160200 mol m.sup.2 s.sup.1 for a culture time of 1420 hours. LB medium (10 g/L of Bacto-Tryptone, 5 g/L of Yeast extract, 10 g/L of sodium chloride, 15 g/L of Bacto agar) and an antibiotic Chloramphenicol (Duchefa) were used. The herbicides used in the experiment are given in the following Table.

(35) TABLE-US-00002 TABLE 2 Herbicide Chemical family (original name) Manufacturer/Supplier Pyrimidinedione Tiafenacil Dongbu Farm Hannong Co., Ltd./Dongbu Farm Hannong Co., Ltd. Saflufenacil BASF/Sigma Butafenacil Syngenta/Sigma Diphenyl ether Fomesafen Syngenta/Sigma Acifluorfen United Phosphorus/Supelco Oxyfluorfen Dow/Sigma N-phenylphthalimides Flumioxazin Sumitomo/Sigma Triazolinones Sulfentrazone FMC/Waka Oxazolidinediones Pentoxazone Kaken/Sigma Phenylpyrazoles Pyraflufen-ethyl Nihon Nohyaky/Sigma Others Pyraclonil Kyoyu Agri/Sigma Oxadiazoles Oxadiazon Bayer/Sigma Thiadiazoles Fluthiacet-methyl FMC/Sigma

3-2. Experimental Method

(36) To clone each of the CyPPO2, CyPPO4, CyPPO8 and CyPPO12 genes isolated and amplified in Example 1 into pACBB (its structure is shown in FIG. 2), 10 l of a solution containing 4 l of each PPO gene, 3.5 l of pACBB vector, 1 l of 10 buffer A, 1 l of 10 buffer B, 1 l of ligase (RBC, 3 unit/l) was prepared and allowed to react at 22 C. for 30 minutes. The reaction solution was added to 100 l of DH5 alpha competent cells, and allowed to react on ice for 20 minutes and then left at 42 C. for 40 seconds. Thereafter, the cells were left on ice for 2 minutes, and then 1 ml of LB broth was added thereto, followed by incubation with shaking at 37 C. for 1 hour. The strains having each gene insert in the culture medium were harvested, and then cultured on LB agar medium containing chloramphenicol.

(37) For seed culture of E. coli transformed with respective genes, single colonies thereof were cultured in 3 ml of LB broth containing chloramphenicol overnight, and each 100 l thereof was sub-cultured in 3 ml of fresh LB broth until absorbance (OD.sub.600) reached 0.51. They were diluted with LB broth to absorbance (OD.sub.600) of 0.5. 10-fold dilution of this diluted solution was performed with LB broth five times. Next, 10 l of the diluted solution of the transformed E. coli culture was dropped on LB agar medium (petri dish) containing chloramphenicol and a variety of herbicide stocks at different concentrations (0400 M). The LB agar plates were incubated at 37 C. At 1620 hours after culture, growth inhibition was examined with the naked eye. Further, growth inhibition of the strains cultured in a medium containing Tiafenacil was examined under light (lighting of 169 mol m.sup.2 s.sup.1) and dark conditions.

3-3. Experimental Result

(38) FIGS. 4 to 6 show the results of examining herbicide resistance of CyPPO2, CyPPO4 and CyPPO8, and FIGS. 7 and 8 show the results of examining herbicide resistance of CyPPO12.

(39) As shown in FIG. 3, growth of the strain transformed with the wild-type AtPPO1 was inhibited in the medium containing Tiafenacil under light and dark conditions, and stronger growth inhibition was observed under light condition than dark condition. For example, growth of the strain transformed with the wild-type AtPPO1 was almost completely inhibited at 1 M of Tiafenacil under light condition, but its growth was rather maintained under dark condition. However, growth was completely inhibited at 5 M or higher of Tiafenacil under both light and dark conditions. As such, growth of the strain transformed with the wild-type AtPPO1 was inhibited in a Tiafenacil concentration-dependent manner, indicating herbicide sensitivity. Growth inhibition of the strain transformed with the mutant AtPPO1 was not observed even at 25 M of Tiafenacil, indicating herbicide resistance.

(40) Therefore, the wild-type AtPPO1 was employed as a reference for herbicide-sensitive PPO, and the mutant AtPPO1 was employed as a reference for herbicide-resistant PPO, and herbicide resistance of CyPPO2, CyPPO4 or CyPPO8 against the representative PPO families was examined.

(41) FIG. 4 shows the results after treatment with varying concentrations of representative pyrimidinedione-based PPO herbicides, Tiafenacil, Saflufenacil and Butafenacil, and a representative N-phenylphthalimide-based PPO herbicide, Flumioxazin. Upon treatment of Tiafenacil and Saflufenacil, growth inhibitions of the strain transformed with the mutant AtPPO1, the strain transformed with CyPPO2, the strain transformed with CyPPO4, and the strain transformed with CyPPO8 were hardly observed even at 25 M of Tiafenacil or Saflufenacil. Upon treatment of Butafenacil, growth inhibitions of the strain transformed with the mutant AtPPO1, the strain transformed with CyPPO2, and the strain transformed with CyPPO8 were hardly observed even at 25 M of Butafenacil. Upon treatment of Flumioxazin, growth inhibitions of the strain transformed with CyPPO2, the strain transformed with CyPPO4, and the strain transformed with CyPPO8 were hardly observed even at 25 M of Flumioxazin. Upon treatment of each of the four herbicides, growth inhibition of the strain transformed with the wild-type AtPPO1 began at 0.5 M and it hardly grew at 5 M or higher.

(42) FIG. 5 shows the results after treatment with varying concentrations of representative diphenyl ether-based PPO herbicides, Fomesafen, Acifluorfen and Oxyfluorfen. Upon treatment of Fomesafen, no growth inhibition of the strain transformed with the mutant AtPPO1 was observed by 25 M, and growth inhibitions of the strain transformed with CyPPO2, the strain transformed with CyPPO4, and the strain transformed with CyPPO8 were hardly observed even at 400 M of Fomesafen. Upon treatment of Acifluorfen, growth inhibitions of the strain transformed with CyPPO2, the strain transformed with CyPPO4, and the strain transformed with CyPPO8 were hardly observed even at 400 M of Acifluorfen. Upon treatment of Oxyfluorfen, growth inhibitions of the strain transformed with CyPPO2, the strain transformed with CyPPO4, and the strain transformed with CyPPO8 were hardly observed even at 400 M of Oxyfluorfen. Upon treatment of each of the three herbicides, the strain transformed with the wild-type AtPPO1 hardly grew at 5 M or higher.

(43) FIG. 6 shows the results after treatment with varying concentrations of a representative triazolinone-based PPO herbicide Sulfentrazone, a representative oxazolidinedione-based PPO herbicide Pentoxazone, a representative phenylpyrazole-based PPO herbicide Pyraflufen-ethyl, a representative oxadiazole-based PPO herbicide Oxadiazon, a representative thiadiazole-based PPO herbicide Fluthiacet-methyl, and other PPO herbicide Pyraclonil. Upon treatment of Sulfentrazone, growth inhibitions of the strain transformed with CyPPO2, the strain transformed with CyPPO4, and the strain transformed with CyPPO8 were hardly observed even at 400 M of Sulfentrazone. Upon treatment of Pentoxazone, Pyraflufen-ethyl, Oxadiazon, Fluthiacet-methyl, and Pyraclonil, growth inhibitions of the strain transformed with CyPPO2 and the strain transformed with CyPPO8 were hardly observed even at 400 M of Oxyfluorfen. Upon treatment of each of the seven herbicides, the strain transformed with the wild-type AtPPO1 hardly grew at 5 M or higher.

(44) FIG. 7 shows the results of examining herbicide resistance of CyPPO12 upon treatment of Tiafenacil, Saflufenacil, Flumioxazin, Fomesafen and Oxyfluorfen. Growth inhibition of the strain transformed with CyPPO12 was hardly observed even at each 25 M of Tiafenacil, Saflufenacil, Flumioxazin, Fomesafen and Oxyfluorfen, and growth inhibition thereof was hardly observed even at 400 M of Fomesafen or Oxyfluorfen. Upon treatment of Oxyfluorfen, growth inhibition of the strain transformed with the mutant AtPPO1 began at 5 M. Growth inhibition thereof was hardly observed even at 25 M of other herbicides. In contrast, growth inhibition of the strain transformed with the wild-type AtPPO1 began at each 0.5 M of the four herbicides excluding Fomesafen, and it hardly grew at 5 M or higher. Upon treatment of Fomesafen, growth inhibition of the strain transformed with the wild-type AtPPO1 was observed at 5 M.

(45) FIG. 8 shows the results of examining herbicide resistance of CyPPO12 upon treatment of Pyraflufen-ethyl, Oxadiazon, Sulfentrazone, Pentoxazone and Pyraclonil. No growth inhibitions of the strain transformed with the mutant AtPPO1 and the strain transformed with CyPPO12 were observed even at 25 M, and no growth inhibitions thereof were also observed even at each 400 M of the four herbicides excluding Sulfentrazone. In contrast, upon treatment of Pyraflufen-ethyl, Oxadiazon, Sulfentrazone, or Pyraclonil, growth inhibition of the strain transformed with the wild-type AtPPO1 began at 0.5 M. Upon treatment of Pyraclonil, growth inhibition thereof began at 5 M and it hardly grew at 25 M.

Example 4. Test of Herbicide Resistance of CyPPO2, CyPPO4 and CyPPO8 in PPO-Deficient E. coli (LB Broth Medium)

(46) In Example 3, herbicide resistance of respective BT3(PPO) strains transformed with the wild-type AtPPO1, mutant AtPPO1, CyPPO2, CyPPO4 or CyPPO8 gene was investigated on agar media containing different herbicides, and in this Example, herbicide resistance of the strains was investigated in LB liquid media containing different herbicides.

4-1. Preparation of Experimental Materials and Instruments

(47) HV-50 autoclave from Hirayama, HS2100A electronic scale from Hansung Instrument, CB-30V clean bench from Jeio Tech, JSI-200CL incubator from JSR, MQ-200 photometer from Apogee, and 1210 type UV-visible spectrophotometer from Thermo Fisher Scientific were used. The autoclave was used under conditions of 121 C. and 15 minutes, and the incubator was used at 37 C. with lighting of 160200 mol m.sup.2 s.sup.1 for a culture time of 13.5 hours. The UV-visible spectrophotometer was used at 600 nm.

(48) Tiafenacil (M.W. 511.87 g/mol), Saflufenacil (M.W. 500.85 g/mol), and Fomesafen (M.W. 438.76 g/mol) used in the experiment were purchased from Dongbu Farm Hannong Co., Ltd, Sigma, and Sigma, respectively. These drugs were prepared at 200 mM concentration in 100% acetone, and stored at 20 C., respectively. Luria-Bertani (LB) medium (10 g/L of Bacto-Tryptone, 5 g/L of Yeast extract, 10 g/L of sodium chloride) and an antibiotic Chloramphenicol (Duchefa) were used.

4-2. Experimental Method

(49) For seed culture of E. coli transformed with respective genes, single colonies thereof were cultured in 3 ml of LB broth containing chloramphenicol for 12 hours, and they were diluted with LB broth to absorbance (OD.sub.600) of 1.5. Next, chloramphenicol and 500 l of the seed culture of the transformed E. coli were added to 250 ml of LB liquid medium, and 50 ml of the culture was added to each 250 ml-flask. Each flask was treated with varying concentrations (0, 10 M, 50 M, 100 M) of herbicide stocks (Tiafenacil, Saflufenacil, Fomesafen), and then incubated at 37 C. and 200 rpm. Absorbance (OD.sub.600) was measured using a spectrophotometer every 1.5 hours. The experiment was repeated three times, and mean values thereof were given in a graph. Error bars represent standard error of three repeats.

4-3. Experimental Result

(50) The wild-type AtPPO1 was employed as a reference for herbicide-sensitive PPO, and the mutant AtPPO1 was employed as a reference for herbicide-resistant PPO.

(51) The result of Tiafenacil treatment is shown in FIG. 9.

(52) The strain transformed with the wild-type AtPPO1 hardly grew at 10 M of Tiafenacil or higher, whereas the strain transformed with the mutant AtPPO1 grew at 10 M of Tiafenacil, but growth inhibition thereof was observed at 50 M of Tiafenacil or higher. Further, the strain transformed with CyPPO2 and the strain transformed with CyPPO4 normally grew by 100 M of Tiafenacil.

(53) The result of Saflufenacil treatment is shown in FIG. 10.

(54) In all the transformed strains, the presence or absence of resistance was similar to the result of Tiafenacil treatment, but high resistance was observed in the strains treated with Saflufenacil, compared to those treated with Tiafenacil. The strain transformed with the wild-type AtPPO1 hardly grew at 10 M of Saflufenacil or higher, whereas the strain transformed with the mutant AtPPO1, the strain transformed with CyPPO2, the strain transformed with CyPPO4, and the strain transformed with CyPPO8 normally grew by 100 m.

(55) The result of Fomesafen treatment is shown in FIG. 11.

(56) Growth inhibition of the strain transformed with the wild-type AtPPO1 began at 50 M, whereas the strain transformed with the mutant AtPPO1, the strain transformed with CyPPO2, the strain transformed with CyPPO4, and the strain transformed with CyPPO8 normally grew by 100 M.

Example 5. Expression of CyPPO2, CyPPO4 and CyPPO8 in Plant

(57) Experiments were performed to express CyPPO2, CyPPO4 and CyPPO8 in plants, of which resistance against various PPO herbicides had been demonstrated in Examples 3 and 4, and fluorescent protein (yellow fluorescent protein, YFP) was used to confirm expressions of the PPO proteins.

5-1. Experimental Method

(58) To prepare Agrobacterium competent cells, Agrobacterium tumefaciens GV3101 strain (Korea Research Institute of Bioscience & Biotechnology) was cultured in 5 ml of LB media at 30 C. and 200 rpm for 12 hours. This culture broth was added to 200 ml of LB media, and then cultured at 30 C. and 200 rpm for 34 hours, followed by centrifugation at 3000 g, 4 C. for 20 minutes. The pellet was washed with sterile distilled water, and then resuspended in 20 ml LB media. 200 L of aliquot thereof was snap-frozen in liquid nitrogen, and then stored in a deep freezer.

(59) To prepare respective vectors which were cloned with the wild-type AtPPO1, CyPPO2, CyPPO4 and CyPPO8 genes, a vector containing a CaMV 35S promoter, YFP and NOS terminator was treated with XbaI and XhoI restriction enzymes, and a transit peptide gene (SEQ ID NO: 26) amplified by PCR was treated with XbaI and XhoI restriction enzymes, and then the vector and the transit peptide gene were ligated with each other to insert the transit peptide which is involved in transition of the chloroplast into the vector. Further, XhoI and BamHI restriction enzymes were used to digest respective PPO genes (wild-type AtPPO1, CyPPO2, CyPPO4 and CyPPO8 genes) and the vector, and then ligated with each other to insert the respective PPO genes into the vector. As a result, the transit peptide was linked to 5-end of the PPO gene and YFP gene was linked to 3-end thereof. A schematic diagram of the final vector is shown in FIG. 12.

(60) Next, for Agrobacterium-mediated transformation, Agrobacterium competent cells prepared the above were thawed on ice, and then mixed with 35 L of the vectors harboring the respective PPO genes, followed by snap freezing in liquid nitrogen for 23 minutes. Thereafter, the cells were thawed at 37 C. for 5 minutes, 1 ml of LB medium was added thereto, and incubated at 30 C. for 2 hours. Each resulting culture was plated on LB/spectinomycin medium and incubated at 30 C. for 2 days.

(61) To inoculate tobacco leaves with Agrobacterium, Agrobacterium single colonies transformed with respective PPO-inserted vectors were cultured in LB/spectinomycin media at 30 C., 200 rpm for 12 hours, and centrifuged at 7000 rpm for 2 minutes. The resulting pellets were resuspended in 10 mM MgCl.sub.2, respectively. After their absorbance (OD.sub.600) was adjusted to 0.5, 200 M acetosyringone was added and stored at room temperature for 2 hours. Agrobacterium was infiltrated into tobacco leaves normally grown using a 1 ml-syringe, and cultured for 2-5 days.

(62) Next, to isolate protoplasts of tobacco leaves, an enzyme solution was prepared as in the composition of Table 3 or 5.

(63) TABLE-US-00003 TABLE 3 Composition Content CPW stock A (100x) 5 ml CPW stock B (10x) 50 ml Mannitol 45 g MES 533 mg Viscozyme (Novozymes; KWN00019; 5 ml 700 EGU/g Cellulase) Celluclast (Novozymes; CCN03123; 2.5 ml 100 FBG/g Beta-glucanase) pectinEX (Novozymes; KJN01013) 2.5 ml DDW up to 500 ml

(64) pH of the above solution was adjusted to 5.8, and sterilized using a filter having a 0.22 m-pore size.

(65) TABLE-US-00004 TABLE 4 CPW stock A (100x) CaCl.sub.22H.sub.2O 1460 mg/L CPW stock B (10x) KH.sub.2PO.sub.4 27.2 mg/L KNO.sub.3 101 mg/L MgSO.sub.47H.sub.2O 246 mg/L KI 0.16 mg/L CuSO.sub.45H.sub.2O 0.025 mg/L pH 5.8

(66) TABLE-US-00005 TABLE 5 Composition Content Mannitol 1 g 200 mM MES (pH 5.7) 150 L viscozyme 100 L celluclast 50 L pectinEX 50 L 1M CaCl.sub.2 70 L DDW up to 10 ml

(67) The tobacco leaves were cut into strips with a razor blade, and the leaf strips were suspended in the prepared enzyme solution, and covered with aluminum foil and stirred at room temperature at 40-50 rpm for 3-5 hours. A microscope (Carl Zeiss Observer Z1) and a biomaterial correlation analysis system (Zeiss LSM710) were used to examine protoplast cells with three types of filters, DIC, YFP and rhodamine. Images were captured using an imaging tool, and then processed using a ZEN lite 2012 (Carl Zeiss) program.

(68) Fluorescent protein (YFP) expressed with the CyPPO2, CyPPO4 or CyPPO8 protein was examined by Western blotting. To this end, the samples were frozen and stored in liquid nitrogen, and then disrupted using a micropestle. IP buffer[50 mM Tris-Cl(pH7.5), 75 mM NaCl, 5 mM EDTA, 1% Triton X-100, 1 mM DTT, 1 protease inhibitor] (40 L for large well) was added and vortexed, and then left on ice for 10 minutes or longer. After centrifugation at 4 C. for 10 minutes, the supernatant was transferred to a new 1.5 ml-tube. A protein loading dye was added thereto, boiled at 100 C. for 5 minutes, and then left on ice. After centrifugation, the supernatant was used. For electrophoresis, a protein extract solution was loaded on a 7.5% SDS-PAGE gel, and proteins were separated at 100 V for a stacking gel and at 150 V for a separating gel. The electrophoresed proteins were transferred onto a PVDF (polyvinylidene fluoride) membrane, and blocked with a blocking buffer (4% skim milk powder, 10 mM sodium phosphate, 0.15M NaCl, 0.05% Tween-20, pH 7.5) for 1 hour. Then, anti-GFP antibody (HRP-conjugated) (SantaCruz) was added at 1/2000 dilution, and reacted at room temperature for 2 hours. After antibody reaction, the membrane was washed with PBS-T (phosphate buffered saline-Tween) buffer for 10 minutes three times, and 500 L of ECL (electrochemiluminescence) solution (buffer composition or supplier: Bio-Rad) was sprayed thereon and left for 1 minute. The membrane was covered with an OHP film, exposed to X-ray film, and then the film was developed.

5-2. Experimental Result

(69) The results of examining expressions of respective wild-type AtPPO1, CyPPO2, CyPPO4 and CyPPO8 genes after introduction into plants are shown in FIG. 13. Formation of Agrobacterium colonies was observed in the respective plants transformed with the PPO genes. Targeting of the negative control YFP protein to chloroplasts was not observed and expression thereof was observed in the cytoplasm and nucleus. The merged image of the PPO protein and chlorophyll autofluorescence showed that fluorescence signals were overlapped with each other, indicating that targeting to chloroplasts occurs by cTP (chloroplast transit peptide) which is linked to N-terminus for the purpose of targeting to the chloroplast.

Example 6. Preparation of Plant Transformation Vector and Transformant

(70) For plant transformation selection, a binary vector harboring ORF of BAR gene (glufosinate resistance gene) and ORF of respective CyPPO2, CyPPO4 or CyPPO8 gene was prepared and used. BAR gene was used to examine cross-treatment effects of other herbicides which have different mechanism of action from that of the PPO-based herbicides. This gene was also used to examine whether stable inheritance occurred in the next generation. To express BAR gene, a NOS promoter was used, and an E9 terminator was used to terminate transcription. Meanwhile, for expression induction of CyPPO2, CyPPO4 and CyPPO8 in plants, a CaMV35S promoter was used, and for targeting of the proteins to chloroplasts, a transit peptide (TP) region of AtPPO1 gene was inserted using XbaI and XhoI restriction enzymes. Further, to confirm the expressed proteins, hemagglutinin (HA) tag was inserted into 3-end using BamHI and SacI restriction enzymes. The transit peptide region inserted into the vector is represented by SEQ ID NO: 27 and the inserted HA tag sequence is represented by SEQ ID NO: 28. The CyPPO2 and CyPPO8 genes were inserted between the transit peptide and HA tag using XhoI and BamHI restriction enzymes, and the NOS terminator was inserted behind HA tag to induce transcription termination of PPO gene. A schematic diagram showing the structure of the plant transformation binary vector is shown in FIG. 14.

(71) Meanwhile, the plant transformant was prepared as follows. First, transformed Agrobacterium was selected in an antibiotic medium and then colonies were cultured in a liquid medium. Agrobacterium cells were harvested and suspended in a solution containing 5% sucrose and 0.05% Silwet L-77. Absorbance (OD.sub.600) was adjusted to 0.8, and then a floral organ of Arabidopsis thaliana grown for about 5-6 weeks was put in the Agrobacterium solution. To maintain humidity, the pot was covered with a plastic bag, and left for a day in the dark. Arabidopsis thaliana inoculated with Agrobacterium was further grown for 1-2 months, and seeds were matured, and then harvested. Because seeds harvested from the transformed plant were a mixture of transformed and non-transformed seeds, a process of selecting transformed seeds from the harvested seeds is required.

(72) Accordingly, BAR gene which was inserted for selection of transformed individuals during the vector preparation was used to select transformants (transformants were selected using glufosinate), which were transplanted to soil and grown to obtain a T1 plant.

(73) To examine resistance of the transplanted T1 plants against PPO-based herbicides, the plants were grown for about 3-4 weeks, and then treated with herbicides prior to flower stalk elongation. Arabidopsis thaliana ecotype Col-0 was found to be killed when treated with 2-3 ml of 1 M tiafenacil (+0.05% Silwet L-77) per plant. Therefore, 1 M tiafenacil was evenly applied at an amount proper for the number of plant individuals. After 7 days, resistance of the transformants against PPO-based herbicides was examined. The plants that showed resistance and thus survived were continuously grown, and their seeds (T2 seed) were harvested, and the T2 seeds were cultured in 1/2 MS medium for a week, and then transplanted to soil to obtain a T2 plant.

Example 7. Germination Test

(74) To examine tiafenacil resistance of T2 generation seeds which survived under treatment of 1 M tiafenacil, among the CyPPO2 and CyPPO8 transformants, Arabidopsis thaliana seeds were sown in 1/2 MS medium (1.125 g/L of MS salt, 10 g/L of sucrose, 7 g/L of Agar) containing 70 nM tiafenacil. The wild-type Arabidopsis thaliana (Col-0; Columbia-0 ecotype) showed a reduced seed germination in 1/2 MS medium containing 50 nM tiafenacil, and Col-0 showed no normal seed germination and was killed in 1/2 MS medium containing 70 nM tiafenacil. Therefore, survival under 70 nM tiafenacil means that a plant has resistance against tiafenacil.

(75) As a result, as shown in FIG. 5, no. 1 and 49 among T2 generation lines of the CyPPO2 transformants showed germination, and no. 6, 16 and 40 among T2 generation lines of the CyPPO8 transformants showed germination in 1/2 MS medium containing 70 nM tiafenacil. Further, the wild-type Arabidopsis thaliana(Col-0) seed used as a negative control showed no germination in 1/2 MS medium containing 70 nM tiafenacil. The mutant AtPPO1 transformant used as a positive control showed germination even in 1/2 MS medium containing 70 nM tiafenacil.

Example 8. Inheritance Test

8-1. Examination of Segregation Ratio of T2 Generation Seed

(76) The herbicide resistance trait was observed in the next generation of the transformed Arabidopsis thaliana, and therefore, in order to determine inheritance, segregation ratios of BAR gene-resistant and sensitive T2 seeds were determined in each line.

(77) In the case of the CyPPO2 transformant, a segregation ratio close to 3:1 was obtained in line no. 10, 20, 38, and 40 among 10 lines, indicating that a single copy of transgene was integrated into the genome, and segregated and expressed according to the Mendelian. The remaining 6 lines showed no segregation ratio of 3:1, implying double copy or greater.

(78) In the case of the CyPPO8 transformant, a segregation ratio close to 3:1 was obtained in line no. 6, 16, and 40 among 5 lines, indicating that a single copy of transgene was integrated into the genome, and segregated and expressed according to the Mendelian. The remaining 2 lines showed a segregation ratio lower than 3:1.

(79) TABLE-US-00006 TABLE 6 CyPPO2-HA transformant (T2) Line no. Segregation ratio 1 4.56:1 8 1.56:1 10 2.85:1 20 2.70:1 23 1.5:1 30 1.7:1 35 2.03:1 38 2.57:1 40 3.17:1 49 2.41:1

(80) TABLE-US-00007 TABLE 7 CyPPO8-HA transformant (T2) Line no. Segregation ratio 6 2.57:1 16 2.85:1 23 2.23:1 38 2.03:1 40 2.85:1

8-2. Examination of CyPPO2 and CyPPO8 Protein Expressions in Herbicide-Resistant T2 Generation Seed

(81) To examine whether CyPPO2 and CyPPO8 protein expressions are maintained in the next generation, proteins were extracted from each T2 generation line of transformants, followed by Western blotting. To detect the amounts of HA-tagged PPO proteins, proteins were extracted from about 100 mg of Arabidopsis thaliana leaf, followed by electrophoresis. The proteins were transferred onto a PVDF membrane, and then Western blotting was performed using anti-HA antibody. 1 M tiafenacil was sprayed onto T1 generation plants. Plants that survived were classified as resistant, and plants that were killed were classified as sensitive.

(82) In the case of CyPPO2 transformant, PPO proteins were detected in line no. 8, 23, 30, 38, 40 and 49 which showed resistance upon spraying herbicides thereto, and not detected in sensitive lines (FIG. 16). In the case of CyPPO8 transformant, PPO proteins were detected in line no. 6, 23, 38, and 40 having herbicide resistance, and not detected in sensitive lines (FIG. 17). These results suggest that expressions of CyPPO2 and CyPPO8 proteins were maintained in the next generations of the resistant lines, providing resistance.

8-3. Examination of Stable Inheritance of Transgene Using BAR Gene

(83) Stable inheritance of the transgene to the next generation was investigated by examining integration of the transformed gene, BAR into the genome. Genomic DNAs were isolated from 100 mg of the leaves of CyPPO2 and CyPPO8 transformants, and then integration of BAR gene was examined by PCR. As a result, genome integration of BAR gene was observed in both tiafenacil-resistant and sensitive lines of the CyPPO2 transformant and CyPPO8 transformant, indicating stable inheritance of the transformed genes to the next generation.

Example 9. Examination of Herbicide Resistance of Transformed Arabidopsis thaliana

(84) To examine whether herbicide resistance traits are maintained in the next generations of plants, respective T2 generation plants of Arabidopsis thaliana which were transformed with CyPPO2, CyPPO4 and CyPPO8 genes were subjected to an herbicide resistance test. 23 ml of 0.5 M Tiafenacil, 1 M Saflufenacil, or 3 M Fomesafen was sprayed onto each Arabidopsis thaliana plant grown for about 4 weeks. At 7 days after spraying, the wild-type Col-0 plants were killed, whereas the positive control, mutant AtPPO1 transformant and the experimental groups, CyPPO2 transformant, CyPPO4 transformant and CyPPO8 transformant continued to grow without damage (FIGS. 18 and 19), indicating that herbicide resistance traits of T1 plants were maintained well to provide T2 generations with herbicide resistance.

Example 10. Cross Use Experiment of Plural Herbicides with Different Mechanism of Action

(85) In Arabidopsis thaliana transformant including CyPPO2 or CyPPO8 gene, which was obtained by transformation using the plant transformation vector prepared in Example 6, the PPO activity-inhibiting herbicide-resistant gene and glufosinate-resistant gene are expressed at the same time. Therefore, it was examined whether cross-treatment of Arabidopsis thaliana transformant with two herbicides, namely, PPO activity-inhibiting herbicide and glufosinate is effective for weed control. To this end, seeds of CyPPO2 and BAR gene-inserted Arabidopsis thaliana transformant, or CyPPO8 and BAR gene-inserted Arabidopsis thaliana transformant were sterilized and treated at low temperature of 4 C. for 2 days. The seeds were sown in a 1/2 MS medium (Duchefa), a 1/2MS medium containing 70 nM Tiafenacil, a 1/2MS medium containing 50 uM glufosinate, or a 1/2MS medium containing 70 nM Tiafenacil and 50 uM glufosinate, and grown at 23 C. under 16 hour-light/8 hour-dark conditions for 714 days. Arabidopsis thaliana on the herbicide media was CyPPO2 or CyPPO8-transformed seed and the wild-type Col0 as a control, respectively. The transformant and the control were cultured on herbicide media. After 2 weeks, they were examined. As a result, CyPPO2 and CyPPO8 normally grew on a glufosinate-added medium, a Tiafenacil-added medium, or a glufosinate and Tiafenacil-added medium, whereas the control Col0 was not germinated (see FIG. 20).

(86) These results show that when transformed plants are prepared by recombination of the PPO herbicide-resistant gene of the present invention and BAR gene in a binary vector, and cross- or double-treatment of these GM plants with herbicides having different mechanism of action is performed, undesired plants can be controlled.

(87) In this Example, BAR gene introduced as a recombinant gene, together with CyPPO gene, is illustrative only for a resistant gene, and there is no limitation in the type of the gene to be used in the present invention. It is apparent to those skilled in the art that when a resistant gene adequate for the purpose and CyPPO 2, 4, 8 or 12 are recombined with the binary vector, and herbicides to which respective genes are resistant are cross-treated, desired resistance can be obtained.

Example 11. Cross Use Experiment of Plural PPO Herbicides

(88) In Example 9, it was confirmed that Arabidopsis thaliana transformant prepared in the present invention has resistance against the two PPO-based herbicides, Tiafenacil and Saflufenacil at the same time, and therefore, it was tested whether the cross-treatment of Arabidopsis thaliana transformant with Tiafenacil and Saflufenacil is effective for weed control. To this end, seeds of CyPPO2 or CyPPO8 gene-inserted Arabidopsis thaliana transformant were sterilized and treated at low temperature of 4 C. for 2 days. The seeds were sown in a 1/2 MS medium, a 1/2MS medium containing 70 nM Tiafenacil, a 1/2MS medium containing 70 nM Saflufenacil, or a 1/2MS medium containing 35 nM Tiafenacil and 35 nM Saflufenacil, and grown at 23 C. under 16 hour-light/8 hour-dark conditions for 714 days. Arabidopsis thaliana on the herbicide media was CyPPO2 or CyPPO8-transformed seed and the wild-type Col0 as a control, respectively. The transformant and the control were cultured on herbicide media. After 2 weeks, they were examined. As a result, CyPPO2 and CyPPO8 normally grew on a Tiafenacil-added medium, a Saflufenacil-added medium, or a Tiafenacil and Saflufenacil-added medium, whereas the control Col0 was not germinated (see FIG. 21).

(89) These results show that when GM plants are prepared using PPO herbicide-resistant genes of the present invention, and cross- or double-treatment of plural PPO-based herbicides as well as single treatment of PPO-based herbicides is performed, undesired plants can be controlled.

Example 12. Examination of Herbicide Resistance According to Amino Acid Sequence Homology of CyPPO2, CyPPO4 and CyPPO8

(90) To investigate amino acid sequence homology range of CyPPO2, CyPPO4 and CyPPO8 which maintain herbicide resistance, a part of the amino acid sequence of CyPPO2, CyPPO4 or CyPPO8 protein was replaced by a part of the amino acid sequence of NtPPO (tobacco-derived PPO gene). As a result, the amino acid sequence of the resulting CyPPO2 variant is represented by SEQ ID NO: 12, and its nucleotide sequence thereof is represented by SEQ ID NO: 13. The amino acid sequence and the nucleotide sequence of the CyPPO2 variant showed 98% sequence homology to those of CyPPO2, respectively. Further, the amino acid sequence of the CyPPO4 variant is represented by SEQ ID NO: 14, and its nucleotide sequence thereof is represented by SEQ ID NO: 15. The amino acid sequence and the nucleotide sequence of the CyPPO4 variant showed 98% sequence homology to those of CyPPO4, respectively. Further, the amino acid sequence of the CyPPO8 variant is represented by SEQ ID NO: 16, and its nucleotide sequence thereof is represented by SEQ ID NO: 17. The amino acid sequence and the nucleotide sequence of the CyPPO8 variant showed 98% sequence homology to those of CyPPO8, respectively.

(91) Herbicide resistance of the amino acid sequence variant of CyPPO2, the amino acid sequence variant of CyPPO4, and the amino acid sequence variant of CyPPO8 was investigated in PPO-deficient BT3 E. coli [BT3(PPO)], and a specific experimental method is similar to that of Example 3. In the same manner as in Example 3, as a negative control, the wild-type PPO (wild-type AtPPO1) of Arabidopsis thaliana was employed as a reference for herbicide-sensitivity. As a positive control, the mutant AtPPO1 which was prepared by amino acid replacement of Y426M and 5305L in the wild-type amino acid sequence was employed as a reference for herbicide-resistance.

12-1. Preparation of Experimental Materials and Instruments

(92) An autoclave was used under conditions of 121 C. and 15 minutes, and an incubator was used at 37 C. with lighting of 169 mol.sup.2s.sup.1 for a culture time of 1416 hours. A UV-visible spectrophotometer was used at 600 nm. PCR was performed under conditions of at 94 C. for 4 minutes, and 25 cycles (at 94 C. for 30 seconds, at 5660 C. for 30 seconds and at 72 C. for 3 minutes), at 72 C. for 5 minutes and at 4 C. for 5 minutes. The herbicides used in the experiment are given in the following Table 8. Respective herbicides were prepared at a concentration of 200 mM in DMSO, and stored at 20 C. Before use, the herbicides were diluted and added to LB broth medium (containing 34 mg/ml chloramphenicol).

(93) TABLE-US-00008 TABLE 8 Herbicide Chemical family (original name) Manufacturer/Supplier Pyrimidinedione Tiafenacil Dongbu Farm Hannong Co., Ltd./Dongbu Farm Hannong Co., Ltd. Saflufenacil BASF/Sigma Butafenacil Syngenta/Sigma Diphenyl ether Fomesafen Syngenta/Sigma Acifluorfen United Phosphorus/Supelco Oxyfluorfen Dow/Sigma N-phenylphthalimides Flumioxazin Sumitomo/Sigma Triazolinones Sulfentrazone FMC/Waka Oxizolidinediones Pentoxazone Kaken/Sigma Phenylpyrazoles Pyraflufen-ethyl Nihon Nohyaky/Sigma Others Pyraclonil Kyoyu Agri/Sigma Oxadiazoles Oxadiazon Bayer/Sigma Thiadiazoles Fluthiacet-methyl FMC/Sigma

12-2. Experimental Method

(94) Saturated cells were inoculated in 3 ml of LB liquid medium containing chloramphenicol, and then cultured at 37 C., 200 rpm for 5 hours. Density of the cultured cells was measured at 600 nm, and the transformants were diluted with LB liquid medium to have the same absorbance (OD.sub.600) per 1 ml thereof (OD.sub.600=0.5). Agar was added to LB liquid medium at a concentration of 1%, and then autoclaved. Chloramphenicol (34 g/ml) and herbicide were added and mixed. Cells diluted equally was diluted at a density of 10, 10.sup.1, 10.sup.2, 10.sup.3, 10.sup.4, and 10.sup.5. Each 10 l of the cells was dropped on 1% agar, LB solid medium, and cultured in a 37 C. incubator for 1416 hours (light condition: 169 mol m.sup.2 s.sup.1).

(95) pACBB-CyPPO2, pACBB-CyPPO4 and pACBB-CyPPO8 were used as templates to prepare primers for the region to be replaced (Table 9), and PCR was performed to prepare pACBB-CyPPO2 variant, pACBB-CyPPO4 variant and pACBB-CyPPO8 variant vectors. 50 l of PCR reaction mixture was prepared by mixing 1 l of each template (pACBB-CyPPO2, pACBB-CyPPO4 and pACBB-CyPPO8 original), 5 l of 10 buffer, 1 l of dNTP mixture (each 10 mM), 1 l of a forward primer (10 M), 1 l of a reverse primer (10 M), 35 l of DDW, and 1 l of Pfu-X (Solgent, 2.5 unit/l), and amplification was performed under conditions of at 94 C. for 4 minutes, and 25 cycles (at 94 C. for 30 seconds, at 56 C. for 30 seconds and at 72 C. for 3 minutes), at 72 C. for 5 minutes and at 4 C. for 5 minutes.

(96) TABLE-US-00009 TABLE9 SEQID Strain Primer Sequence(forpACBBcloning) NO: Oscillatoria CyPPO2Nt98%_F ATCTGATCAAAAGCAATTTTCTGAGTTTTCCGG 29 nigro-viridis GGAAAC PCC7112 CyPPO2Nt98%_R CAATTGGATTTGAAGGTAA 30 CGGTTGCAGCTTATTTTCC Lyngbyasp. CyPPO4-Nt-98%_F ATCTGATCAAAAGCAATTTTTTAAGTCCTGGA 31 PCC8106 GGTAAACT CyPPO4-Nt-98%_R CAATTGGATTTGAAGGTAA 32 AGGCATGAGTTGACCATTC Halothecesp. CyPPO8_Nt98%-F ATCTGATCAAAAGCAATTTTCTGAGTCCAATC 33 PCC7418 GGGAAAC CyPPO8_Nt98%-R CAATTGGATTTGAAGGTAAAGGGCGCAGTTTC 34 CCCTCCC

(97) To prepare BT3(PPO) competent cells, BT3(PPO) strain was added to 5 ml of LB broth containing 50 g/ml kanamycin and 20 g/ml hematin, and cultured in a 37 C. shaking incubator for 12 hours in the dark. Thereafter, 5 ml of the culture was added to 100 ml of LB broth containing 20 g/ml hematin, and cultured in a 37 C. shaking incubator in the dark until OD.sub.600 reached 0.5. BT3(PPO) competent cells were prepared from the cultured E. coli using CaCl.sub.2 according to protocols for preparing competent cells. Next, to transform the BT3(PPO) strain with the respective vectors harboring the CyPPO2 variant, CyPPO4 variant and CyPPO8 variant, 5 l of the vector was added to 100 l of BT3(PPO) competent cells, and the mixture was mixed well, allowed to react on ice for 20 minutes, and then left at 42 C. for 40 seconds. After stabilization on ice for 2 minutes, 1 ml of LB broth was added to BT3(PPO), and cultured at 37 C. for 1 hour with shaking. The cells cultured in the medium were collected according to the type of the gene insert, and then spread on LB solid medium containing chloramphenicol (34 g/ml), and cultured at 37 C. for 12 hours or longer. Thereafter, single colonies thereof were cultured in LB liquid medium. Growth inhibition was measured according to herbicide treatment in the light, and compared with that of the BT3 transformed strain which was cultured on LB solid medium without herbicide, and growth of the BT3 transformed strain on LB solid medium with varying concentrations of herbicide was examined.

12-3. Experimental Result

(98) FIGS. 22 to 25 show the results of examining herbicide resistance of CyPPO2 variant, CyPPO4 variant and CyPPO8 variant genes having 98% sequence homology to the original sequences of CyPPO2, CyPPO4 and CyPPO8, respectively. As a negative control, the wild-type AtPPO1 was employed as a reference for herbicide-sensitivity. As a positive control, the mutant AtPPO1 was employed as a reference for herbicide-resistance. If a strain shows resistance similar to or higher than that of the strain transformed with the mutant AtPPO1, it was determined that the strain has herbicide resistance.

(99) As a result, respective BT3 strains transformed with CyPPO2 variant, CyPPO4 variant and CyPPO8 variant grew well in the light in all 13 types of herbicides from 9 families (Tiafenacil, Saflufenacil, Butafenacil, Fomesafen, Acifluorfen, Oxyfluorfen, Flumioxazin, Sulfentrazone, Pentoxazone, Pyraflufen-ethyl, Pyraclonil, Oxadiazon, Fluthiacet-methyl), and they showed herbicide resistance similar to or higher than that of the positive control mutant AtPPO1 (growth inhibitions thereof were hardly observed even at 25 M).

(100) Therefore, CyPPO2 variant, CyPPO4 variant and CyPPO8 variant having 98% sequence homology to CyPPO2, CyPPO4 and CyPPO8 also showed resistance similar to or higher than those of CyPPO2, CyPPO4 and CyPPO8, suggesting that although a part of the sequence of CyPPO2, CyPPO4 or CyPPO8 is altered, it maintains the PPO function and biological activity regarding herbicide resistance.