Method for the fermentative production of L-lysine using <i>C. glutamicum </i>strains with a mutated kup transporter
10717999 ยท 2020-07-21
Assignee
Inventors
- Thomas Bekel (Halle, DE)
- Kornelia Voss (Steinhagen, DE)
- Georg Thierbach (Bielefeld, DE)
- Frank Schneider (Halle, DE)
Cpc classification
C12N9/1217
CHEMISTRY; METALLURGY
International classification
C12P13/08
CHEMISTRY; METALLURGY
Abstract
A method is useful for the fermentative production of L-lysine using a C. glutamicum strain having a mutated Kup transporter.
Claims
1. A method for fermentative production of L-lysine, comprising: cultivating a bacterium of the species Corynebacterium glutamicum having an ability to excrete L-lysine and containing in the bacterium's chromosome a polynucleotide encoding a polypeptide, comprising the amino acid sequence of SEQ ID NO:2, wherein the amino acid glycine at position 344 is substituted by valine, wherein the cultivating of the bacterium proceeds in a suitable medium under suitable conditions, and accumulating L-lysine in the medium to form a L-lysine containing fermentation broth.
2. The method of claim 1, wherein, in the bacterium, the polynucleotide encoding said amino acid sequence comprises a nucleotide sequence of positions 40 to 1923 of SEQ ID NO: 1, wherein nucleobases at positions 1069 to 1071 are gtt, gtc, gta or gtg.
3. The method of claim 2, wherein the nucleobases at positions 1069 to 1071 are gtc.
4. The method of claim 1, wherein, in the bacterium, the polynucleotide encoding said amino acid sequence comprises a nucleotide sequence of positions 40 to 1926 of SEQ ID NO:1, wherein nucleobases at positions 1069 to 1071 are gtt, gtc, gta or gtg.
5. The method of claim 4, wherein the nucleobases at positions 1069 to 1071 are gtc.
6. The method of claim 1, wherein, in the bacterium, the polynucleotide encoding said amino acid sequence comprises a nucleotide sequence of SEQ ID NO: 1, wherein nucleobases at positions 1069 to 1071 are gtt, gtc, gta or gtg.
7. The method of claim 6, wherein the nucleobases at positions 1069 to 1071 are gtc.
8. The method as claimed in claim 1, further comprising manufacturing of a L-lysine containing product from the L-lysine containing fermentation broth.
9. The method as claimed in claim 8, wherein the manufacturing comprises a purification step.
10. The method of claim 9, wherein said purification step is at least one selected from the group consisting of treatment with activated carbon, ionic exchange, and crystallization.
11. The method as claimed in claim 1, wherein the bacterium contains at least one copy of a polynucleotide, coding for a feedback resistant aspartate kinase polypeptide variant, desensitized to inhibition by mixtures of L-lysine and L-threonine.
12. The method of claim 11, wherein an amino acid sequence of said feedback resistant aspartate kinase polypeptide comprises the amino acid sequence of SEQ ID NO:6, containing isoleucine instead of threonine at position 311.
Description
DETAILED DESCRIPTION OF THE INVENTION
(1) It has been found that modifying L-lysine excreting bacteria of the species Corynebacterium glutamicum by exchanging the amino acid glycine at position 344 of the encoded amino acid sequence of the polypeptide shown in SEQ ID NO:2 for a different proteinogenic amino acid, i.e. by L-valine, increased their ability to excrete L-lysine in a fermentative process as compared to the unmodified L-lysine producing bacterium.
(2) The present invention makes available a novel method for the fermentative production of L-lysine comprising the steps of providing a bacterium of the species Corynebacterium glutamicum, having the ability to excrete L-lysine, containing in its chromosome a polynucleotide encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:2, wherein the amino acid glycine at position 344 is substituted by valine, cultivating the bacterium in a suitable medium under suitable conditions, and accumulating the L-lysine in the medium to form an L-lysine containing fermentation broth. In such fermentative process the L-lysine production is increased compared to a method comprising the cultivation of an L-lysine secreting bacterium of the species to Corynebacterium glutamicum without such substitution.
(3) The amino acid sequence of SEQ ID NO:2, wherein the amino acid glycine at position 344 is substituted by valine, is shown in SEQ ID NO:4.
(4) It was found that the modified bacteria provided in the method according to the invention excreted L-lysine, into a suitable medium under suitable fermentation conditions in an increased manner.
(5) The method according to the invention thus contributes to the improvement of technical and economic aspects of the manufacturing of L-lysine or L-lysine containing products.
(6) In a preferred embodiment the bacterium provided in the method according to the invention contains in its chromosome a polynucleotide encoding an amino acid sequence of a polypeptide comprising the nucleotide sequence of positions 40 to 1923 of SEQ ID NO: 1 the nucleobases from position 1069 to 1071 being gtt, gtc, gta or gtg, preferably gtc.
(7) Particularly preferred is the nucleotide sequence of positions 40 to 1923 of SEQ ID NO: 1 the nucleobase at position 1070 being thymine (t).
(8) The nucleotide sequence of positions 40 to 1923 of SEQ ID NO:1 the nucleotides from positions 1069 to 1071 being gtc is identical to the nucleotide sequence of positions 40 to 1923 of SEQ ID NO:3.
(9) In another preferred embodiment the bacterium provided in the method according to the invention contains in its chromosome a polynucleotide encoding an amino acid sequence of a polypeptide comprising the nucleotide sequence of positions 40 to 1926 of SEQ ID NO: 1 the nucleobases from position 1069 to 1071 being gtt, gtc, gta or gtg, preferably gtc.
(10) Particularly preferred is the nucleotide sequence of positions 40 to 1926 of SEQ ID NO: 1 the nucleobase at position 1070 being thymine (t).
(11) The nucleotide sequence of positions 40 to 1926 of SEQ ID NO: 1 the nucleotides from to positions 1069 to 1071 being gtc is identical to the nucleotide sequence of positions 40 to 1926 of SEQ ID NO:3.
(12) In another preferred embodiment the bacterium provided in the method according to the invention contains in its chromosome a polynucleotide encoding an amino acid sequence of a polypeptide comprising the nucleotide sequence of SEQ ID NO: 1 the nucleobases from position 1069 to 1071 being gtt, gtc, gta or gtg, preferably gtc.
(13) Particularly preferred is the nucleotide sequence of SEQ ID NO: 1 the nucleobase at position 1070 being thymine (t).
(14) The nucleotide sequence of SEQ ID NO: 1 the nucleotides from positions 1069 to 1071 being gtc is identical to the nucleotide sequence of SEQ ID NO:3.
(15) The term L-lysine, where mentioned herein, in particular in the context of product formation, also comprises their ionic forms and salts, for example L-lysine mono hydrochloride or L-lysine sulfate.
(16) For practicing the present invention bacteria of the species Corynebacterium glutamicum are used. Suitable bacteria for the method of this invention are L-lysine excreting strains of Corynebacterium glutamicum, for example L-lysine excreting strains obtained by one or several steps of strain development from strain ATCC13032 and the like and modified as described in this invention.
(17) Strain ATCC13032 (also available as DSM20300) is the taxonomic type strain of the species Corynebacterium glutamicum. A taxonomic study of this group of bacteria based on DNA-DNA hybridization was done by Liebl et al. (International Journal of Systematic Bacteriology 41(2), 255-260, 1991). A comparative analysis of various strains of the species Corynebacterium glutamicum based on genome sequence analysis was provided by Yang and Yang (BMC Genomics 18(1):940).
(18) A multitude of L-lysine excreting strains of the genus Corynebacterium, in particular of the species Corynebacterium glutamicum were obtained in the art during the past decades to starting from strains such as ATCC13032, ATCC14067, ATCC13869 and the like. They were obtained as a result of strain development programs using inter alia methods like classical mutagenesis, selection for antimetabolite resistance as well as amplification and promotor modification of genes of the biosynthetic pathway of the L-lysine by genetic engineering methods.
(19) L-lysine excreting strains of the species Corynebacterium glutamicum are widely known in the art and can be modified as described in the present invention. For example, U.S. Pat. No. 7,338,790 B2 describes strain DM1797. It is deposited at the DSMZ (Braunschweig, Germany) under accession number DSM16833. DM1797 is an aminoethylcystein resistant mutant of strain ATCC13032 obtained after N-methyl-N-nitro-nitrosoguanidine mutagenesis. For example, Blombach et al. (Applied and Environmental Microbiology 75(2), 419-427, 2009) describe strain DM1933, which is deposited under accession number DSM25442. Strain DM1933 was obtained from ATCC13032 by several steps of strain development. Furthermore L-lysine excreting Corynebacterium glutamicum strain DM2031, deposited at the DSMZ (Braunschweig, Germany) under the accession number DSM32514 may be used. Strain DM2031 is a further developed derivative of DM1933 having enhanced L-lysine excretion ability. Other L-lysine excreting Corynebacterium glutamicum strains are e.g. described in WO2008033001 A1 and EP0841395 A1.
(20) L-lysine excreting strains of the species Corynebacterium glutamicum typically contain a polynucleotide coding for a feedback resistant aspartate kinase polypeptide variant. A feedback resistant aspartate kinase polypeptide variant means an aspartate kinase which is less sensitive, or desensitized, to inhibition by mixtures of L-lysine and L-threonine, e.g. 10 mM each, or mixtures of the L-lysine analogue S-(2-aminoethyl)-L-cysteine and L-threonine, e.g. 50 mM S-(2-aminoethyl)-L-cysteine and 10 mM L-threonine, when compared to the wild form of the enzyme, which is contained in wild strains like for example ATCC13032. ATCC14067 and ATCC13869. The EC number for aspartate kinase is EC 2.7.2.4. Descriptions of polynucleotides of Corynebacterium glutamicum encoding a feedback resistant aspartate kinase polypeptide variant are for example given in U.S. Pat. Nos. 5,688,671, 6,844,176 and 6,893,848. A summarizing list can be found inter alia in WO2009141330 A1. The symbol used in the art for a gene coding for an aspartate kinase polypeptide is lysC. The abbreviation ask is also found. In case the gene codes for a to feedback resistant polypeptide variant the art typically uses symbols like lysC.sup.fbr with fbr indicating feedback resistance. The art also uses the term aspartokinase for aspartate kinase.
(21) Accordingly, said L-lysine excreting strains of the species Corynebacterium glutamicum modified as described in the present invention preferably contain at least one copy of a polynucleotide coding for a feedback resistant aspartate kinase polypeptide variant desensitized to inhibition by mixtures of L-lysine and L-threonine.
(22) Said polynucleotide encoding said aspartate kinase polypeptide variant can be expressed by its natural promoter, i.e. the promoter contained in strain ATCC13032, or any other suitable promoter known in the art.
(23) SEQ ID NO:5 shows the nucleotide sequence of the coding sequence of the aspartate kinase polypeptide of strain ATCC13032 and SEQ ID NO:6 the amino acid sequence of the encoded polypeptide. It is known in the art (see U.S. Pat. No. 6,893,848) that exchange of the amino acid Thr at position 311 of SEQ ID NO:6 for Ile imparts the enzyme feedback resistance to inhibition by mixtures of L-lysine and L-threonine.
(24) Accordingly, it is preferred that the amino acid sequence of said feedback resistant aspartate kinase polypeptide comprises the amino acid sequence of SEQ ID NO:6 containing isoleucine instead of threonine at position 311.
(25) Said amino exchange can be achieved by exchanging the nucleobase cytosine (c) at position 932 of SEQ ID NO:5 to give thymine (t). The acc codon for threonine is thus altered to the atc codon for isoleucine.
(26) It is further known in the art that exchange of the gtg start codon of the coding sequence for the aspartate kinase polypeptide for atg enhances expression of the polypeptide (see e.g. EP2796555 A2).
(27) Accordingly, it is preferred that the sequence coding for a feedback resistant aspartate kinase polypeptide begins with an atg start codon.
(28) The term DSM denotes the depository Deutsche Sammlung fiir Mikroorganismen und Zellkulturen (DSMZ) located in Braunschweig, Germany. The term ATCC denotes the depository American Type Culture Collection located in Manassas, Va. US.
(29) Corynebacterium glutamicum, in particular strain ATCC13032 and L-lysine excreting strains obtained therefrom during a strain development program, contain in their chromosome a, in particular one, gene encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:2. The coding sequence may contain silent mutations which do not alter the amino acid sequence of the polypeptide. This context is also known as degeneracy of the genetic code in the art.
(30) During the work for the present invention it was found that modifying L-lysine excreting bacteria of the species Corynebacterium glutamicum by exchanging the amino acid glycine at position 344 of the encoded amino acid sequence of the polypeptide shown in SEQ ID NO:2 for a different proteinogenic amino acid, i.e. by valine, increased their ability to excrete L-lysine in a fermentative process as compared to the unmodified bacterium.
(31) The skilled artisan is aware of a number of methods of mutagenesis how to achieve said modification in the Corynebacterium glutamicum.
(32) A mutant bacterium according to the invention can be obtained by classical in vivo mutagenesis executed with cell populations of strains of Corynebacterium glutamicum using mutagenic substances, e.g. N-methyl-N-nitro-N-nitrosoguanidine, or ultra violet light.
(33) The nucleotide sequence comprising the site of mutagenesis within the gene can be amplified by PCR using primers selected from SEQ ID NO: 1 or SEQ ID NO:3. By sequencing the PCR product the desired mutants are identified. Details concerning this approach can be found inter alia in U.S. Pat. No. 7,754,446. Real-time PCR in combination with FRET hybridization probes may also be used for mutation detection. The term FRET is the abbreviation for fluorescence resonance energy transfer. Cyril D S Mamotte (The Clinical to Biochemist Reviews 27, 63-75 (2006)) reviews the identification of single nucleotide substitutions using this method.
(34) Another common method of mutating genes of Corynebacterium glutamicum is the method of gene replacement described by Schwarzer and Phler (Bio/Technology 9, 84-87 (1991)) and further elaborated by Schafler et al. (Gene 145, 69-73 (1994)).
(35) Peters-Wendisch et al. (Microbiology 144, 915-927 (1998)) used the gene replacement method to inactivate the pyc gene of Corynebacterium glutamicum encoding pyruvate carboxylase. In U.S. Pat. No. 7,585,650 the method was applied to the zwf gene to realize an amino acid exchange at position 321 of the amino acid sequence of the Zwf sub-unit of the glucose 6-phosphate dehydrogenase. In U.S. Pat. No. 7,754,446 the method was applied to the rel gene to realize an amino acid exchange at position 38 of the amino acid sequence of the GTP-pyrophosphate kinase polypeptide.
(36) In the gene replacement method, a mutation, for example, a deletion, insertion or substitution of at least one nucleobase, is provided by an isolated polynucleotide comprising the nucleotide sequence of the gene in question or a part thereof containing the mutation.
(37) In the context of the present invention the nucleotide sequence of the gene in question is the gene identified by NCgl0682 also known as kup gene in the art.
(38) In the context of the present invention the mutation is a substitution of at least one nucleobase located in the codon specifying the amino acid glycine at position 344 of the encoded amino acid sequence (see SEQ ID NO: 1 and SEQ ID NO:2) of the polypeptide.
(39) As a consequence of said mutation the codon specifies a proteinogenic amino acid different from glycine, preferably leucine, isoleucine or valine, particularly preferred valine. The codons specifying valine are gtt, gtc, gta and gtg. The codon gtc is preferred.
(40) The codon for the amino acid at position 344 has the position from 1069 to 1071 in SEQ ID NO: 1 or SEQ ID NO:3. The nucleotide sequence from position 1069 to 1071, in particular the nucleotide at position 1070, may also be referred to as site of mutation.
(41) The mutated nucleotide sequence of the gene in question or a part thereof containing the mutation comprises i) a nucleotide sequence at the 5-end of the site of mutation, which is also referred to as 5-flanking sequence or upstream sequence in the art, ii) a nucleotide sequence at the 3-end of the site of mutation, which is also referred to as 3-flanking sequence or downstream sequence in the art, and iii) the nucleotide sequence of the site of mutation between i) and ii).
(42) Said 5-flanking sequence and 3-flanking sequence required for homologous recombination typically have a length of at least 200 bp, at least 400 bp, at least 600 bp or at least 800 bp. The maximum length typically is 1000 bp, 1500 bp or 2000 bp.
(43) An example of a polynucleotide comprising a mutated nucleotide sequence in the context of the present invention is shown in SEQ ID NO:7. The nucleotide sequence of SEQ ID NO:7 from positions 9 to 1724 corresponds to SEQ ID NO:3 from positions 213 to 1928. The polynucleotide shown in SEQ ID NO:7 contains at its 5- and 3-end recognition sites for the restriction endonuclease XbaI useful for cloning purposes. SEQ ID NO:7 contains part of the coding sequence of the variant of the NCgl0682 polypeptide described in this invention. The 5-flanking sequence consists of the nucleotide sequence from positions 9 to 865 of SEQ ID NO:7. The 3-flanking sequence consists of the nucleotide sequence from positions 867 to 1724 of SEQ ID NO:7. The site of mutation is at position 866 of SEQ ID NO:7.
(44) The mutated nucleotide sequence provided is cloned into a plasmid vector, e.g. pK18mobsacB described by Schafer et al. (Gene 145, 69-73 (1994)), that is not capable of autonomous replication in Corynebacterium glutamicum. Said plasmid vector comprising said mutated nucleotide sequence is subsequently transferred into the desired strain of Corynebacterium glutamicum by transformation using electroporation or conjugation. After two events of homologous recombination comprising a recombination event within the 5-flanking sequence provided by the plasmid vector with the homologous sequence of the Corynebacterium glutamicum chromosome and a recombination event within the 3-flanking sequence provided by the plasmid vector with the homologous sequence of the Corynebacterium glutamicum chromosome, one effecting integration and one effecting excision of said plasmid vector, the mutation is incorporated in the Corynebacterium glutamicum chromosome. Thus the nucleotide sequence of the gene in question contained in the chromosome of said desired strain is replaced by the mutated nucleotide sequence. The presence of the mutation in the desired strain is then confirmed e.g. by analysis of the nucleotide sequence or real-time PCR using FRET as described above.
(45) An event of homologous recombination may also be referred to as crossing over.
(46) It is preferred that the L-lysine excreting Corynebacterium glutamicum strains provided for the method of the present invention have the ability to excrete 0.25 g/l, preferably 0.5 g/l, particularly preferred 1.0 g/l, very particularly preferred 2.0 g/l of L-lysine in a suitable medium under suitable conditions.
(47) In a fermentative process according to the invention a Corynebacterium glutamicum modified in accordance with the present invention and having the ability to excrete L-lysine is cultivated in a suitable medium under suitable conditions. Due to said ability to excrete said L-lysine the concentration of the L-lysine increases and accumulates in the medium during the fermentative process and the L-lysine is thus produced.
(48) A suitable medium used for the production of L-lysine by a fermentative process contains a carbon source, a nitrogen source, a phosphorus source, inorganic ions and other organic compounds as required.
(49) Suitable carbon sources include glucose, fructose, sucrose as well as the corresponding raw materials like starch hydrolysate, molasses or high fructose corn syrup.
(50) As nitrogen source organic nitrogen-containing compounds such as peptones, meat extract, soy bean hydrolysates or urea, or inorganic compounds such as ammonium sulphate, ammonium chloride, ammonium phosphate, ammonium carbonate, ammonium nitrate, ammonium gas or aqueous ammonia can be used.
(51) As phosphorus source, phosphoric acid, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts can be used.
(52) Inorganic ions like potassium, sodium, magnesium, calcium, iron and further trace elements etc. are supplied as salts of sulfuric acid, phosphoric acid or hydrochloric acid.
(53) Other organic compounds mean essential growth factors like vitamins e. g. thiamine or biotin or L-amino acids e.g. L-homoserine.
(54) The media components may be added to the culture in form of a single batch or be fed in during the cultivation in a suitable manner.
(55) During the fermentative process, the pH of the culture can be controlled by employing basic compounds such as sodium hydroxide, potassium hydroxide, ammonia or aqueous ammonia, or acidic compounds such as phosphoric acid or sulphuric acid in a suitable manner. The pH is generally adjusted to a value of from 6.0 to 8.5, preferably 6.5 to 8.0. To control foaming, it is possible to employ antifoam agents such as, for example, fatty acid polyglycol esters. To maintain the stability of plasmids, it is possible to add to the medium suitable selective substances such as, for example, antibiotics. The fermentative process is preferably carried out under aerobic conditions. In order to maintain these conditions, oxygen or oxygen-containing gas mixtures such as, for example air are introduced into the culture. The fermentative process is carried out, where appropriate, at elevated pressure, for example at an elevated pressure of 0.03 to 0.2 MPa. The temperature of the culture is normally from 25 C. to 40 C., preferably from 30 C. to 37 C. In a discontinuous process, the cultivation is continued until an amount of the L-lysine sufficient for being recovered has been formed. The cultivation is then completed. This aim is normally achieved within 10 hours to 160 hours. In continuous processes, longer cultivation times are possible.
(56) Examples of suitable media and culture conditions can be found inter alia in L. Eggeling and M. Bott (Handbook of Corynebacterium glutamicum, CRC Press, 2005).
(57) Thus, the fermentative process results in a fermentation broth which contains the desired to L-lysine.
(58) A product containing the L-lysine is then recovered or manufactured in liquid or solid from the fermentation broth.
(59) A fermentation broth means a medium in which a Corynebacterium glutamicum described in the invention has been cultivated for a certain time and under certain conditions.
(60) When the fermentative process is completed, the resulting fermentation broth accordingly comprises: a) the biomass (cell mass) of the Corynebacterium glutamicum of the invention, said biomass having been produced due to propagation of the cells of said Corynebacterium glutamicum, b) the desired L-lysine accumulated during the fermentative process, c) the organic by-products accumulated during the fermentative process, and d) the components of the medium employed which have not been consumed in the fermentative process.
(61) The organic by-products include compounds which may be formed by the Corynebacterium glutamicum during the fermentative process according to the present invention in addition to production of the L-lysine.
(62) The fermentation broth is removed from the culture vessel or fermentation tank, collected where appropriate, and used for providing a product containing the L-lysine, in liquid or solid form. The expression recovering the L-lysine-containing product is also used for this. In the simplest case, the L-lysine-containing fermentation broth itself, which has been removed from the fermentation tank, constitutes the recovered product.
(63) The fermentation broth can subsequently be subjected to extracting or substantially eliminating water from said fermentation broth. In particular at least 40% (w/w), preferred at least 90% (w/w), more preferred at least 95% (w/w) water are extracted from the to fermentation broth.
(64) Removal of the biomass can be achieved inter alia by centrifugation, filtration or decantation or a combination thereof.
(65) Manufacturing of an L-lysine product may also comprise a purification step. preferably selected from the group consisting ion exchange chromatography, treatment with activated carbon or crystallization.
(66) Thus e. g. a product containing L-lysineHCl, preferably containing 80% L-lysineHCl, particularly preferred 90% L-lysineHCl or 95% L-lysineHCl can be obtained.
(67) Analysis of L-lysine to determine its concentration at one or more time(s) during the fermentation can take place by separating the L-lysine by means of ion exchange chromatography, preferably cation exchange chromatography, with subsequent post-column derivatization using ninhydrin, as described in Spackman et al. (Analytical Chemistry 30: 1190-1206 (1958)). It is also possible to employ ortho-phthalaldehyde rather than ninhydrin for post-column derivatization. An overview article on ion exchange chromatography can be found in Pickering (LC.GC (Magazine of Chromatographic Science 7(6):484-487 (1989)). It is likewise possible to carry out a pre-column derivatization, for example using ortho-phthalaldehyde or phenyl isothiocyanate, and to fractionate the resulting amino acid derivates by reversed-phase chromatography (RP), preferably in the form of high-performance liquid chromatography (HPLC). A method of this type is described, for example, in Lindroth et al. (Analytical Chemistry 51:1167-1174 (1979)). Detection is carried out photometrically (absorption, fluorescence).
EXPERIMENTAL SECTION
A) Materials and Methods
(68) The molecular biology kits, primers and chemicals used and some details of the methods applied are briefly described herewith.
(69) 1. Antibiotics and chemicals
(70) a. Kanamycin: Kanamycin solution from Streptomyces kanamyceticus from Sigma Aldrich (St. Louis, USA, Cat. no. K0254).
(71) b. Nalidixic acid: Nalidixic acid sodium salt from Sigma Aldrich (St. Louis, USA, Cat. no. N4382).
(72) c. If not stated otherwise, all chemicals were purchased analytically pure from Merck (Darmstadt, Germany), Sigma Aldrich (St. Louis, USA) or Carl-Roth (Karlsruhe, Germany).
(73) 2. Cultivation
(74) If not stated otherwise, all cultivation/incubation procedures were performed as follows herewith:
(75) a. LB broth (MILLER) from Merck (Darmstadt, Germany; Cat. no. 110285) was used to cultivate E. coli strains in liquid medium. The liquid cultures (10 ml liquid medium per 100 ml Erlenmeyer flask with 3 baffles) were incubated in the Infors HT Multitron standard incubator shaker from Infors GmbH (Einsbach, Germany) at 37 C. and 200 rpm.
(76) b. LB agar (MILLER) from Merck (Darmstadt, Germany Cat. no. 110283) was used for cultivation of E. coli strains on agar plates. The agar plates were incubated at 37 C. in an INCU-Line mini incubator from VWR (Radnor, USA).
(77) c. Brain heart infusion broth (BHI) from Merck (Darmstadt, Germany; Cat. no. 110493) was used to cultivate C. glutamicum strains in liquid medium. The liquid cultures (10 ml liquid medium per 100 ml Erlenmeyer flask with 3 baffles) were incubated in the Infors HT Multitron standard incubator shaker from Infors GmbH (Einsbach, Germany) at 33 C. and 200 rpm.
(78) d. Brain heart agar (BHI-agar) from Merck (Darmstadt, Germany; Cat. no. 113825) was used for cultivation of C. glutamicum strains on agar plates. The agar plates were incubated at 33 C. in an incubator from Heraeus Instruments with Kelvitron temperature controller (Hanau, Germany).
(79) 3. Determining Optical Density
(80) a. The optical density of bacterial suspensions in shake flask cultures was determined at 600 nm (OD600) using the BioPhotometer from Eppendorf AG (Hamburg, Germany).
(81) b. The optical density of bacterial suspensions produced in the Wouter Duetz (WDS) micro fermentation system (24-Well Plates) was determined at 660 nm (OD660) with the GENios plate reader from Tecan Group AG (Mannedorf, Switzerland).
(82) 4. Centrifugation
(83) a. Benchtop centrifuge for reaction tubes with a volume up to 2 ml Bacterial suspensions with a maximum volume of 2 ml were caused to sediment using 1 ml or 2 ml reaction tubes (e.g. Eppendorf Tubes 3810X) using an Eppendorf 5417 R centrifuge (5 min. at 13.000 rpm).
(84) b. Benchtop centrifuge for tubes with a volume up to 50 ml
(85) Bacterial suspensions with a maximum volume of 50 ml were caused to sediment using 15 ml or 50 ml centrifuge tubes (e.g. Falcon 50 ml Conical Centrifuge Tubes) using an Eppendorf 5810 R centrifuge for 10 min. at 4.000 rpm.
(86) 5. Detection of Mutations Using FRET
(87) The presence of a given mutation, e.g. a nucleobase exchange, was detected by real-time PCR in combination with FRET hybridization probes. The term FRET is the abbreviation for fluorescence resonance energy transfer. As real-time PCR instrument a Lightcycler from Roche Diagnostics was used (see below).
(88) This method was e. g. used by M. J. Lay and C. T. Wittwer (Clinical Chemistry 42 (12), 2262-2267 (1997)) for the genotyping of factor V Leiden. Cyril DS Mamotte (The Clinical Biochemist Reviews 27, 63-75 (2006) reviews the genotyping of single nucleotide substitutions using this method.
(89) The FRET hybridization donor probe was labelled with the fluorescent dye fluorescein and the acceptor probe with the fluorescent dye LC-Red640. In essence the detection method comprised three steps: colony PCR, probe hybridization and subsequent melting curve analysis. The method is simply referred to as real-time PCR herewith.
(90) a. Primers and Probes
(91) The oligonucleotides used were synthesized by eurofins genomics GmbH (Ebersberg, Germany).
(92) b. Template
(93) As PCR template the total DNA contained in a colony was used. It was prepared by taking cell material with a toothpick from a colony on an agar plate and placing the cell material to directly into the PCR reaction tube. The cell material was heated for 10 sec. with 800 W in a microwave oven type Mikrowave & Grill from SEVERIN Elektrogerate GmbH (Sundem, Germany) and then the PCR reagents were added to the template in the PCR reaction tube.
(94) b. Reaction Mix
(95) The Type-it Fast SNP probe PCR Kit (Type-it Kit) from Qiagen (Hilden, Germany, Cat.No. 206045) was used for real-time detection of the mutations. Therefore 2.5 l of the Qiagen Fast SNP Puffer (2) was mixed with 0.5 l of each of the LC-PCR-Primers [10 M] and 0.5 l of each of the 1:500 diluted acceptor and donor probe [100 pmol/l] to get the mastermix for the real-time PCR.
(96) TABLE-US-00001 TABLE 1 Thermocycling conditions for PCR with the LightCycler (step 1-3) and melting curve analysis (step 4-6). PCR-program Time T Step [sec.] [ C.] Description 1 15 95 Denaturation step (and Activation of HotStarTaq DNA polymerase) 2 05 55 Annealing step 3 30 Elongation step Repeat step 1 to 3: 50 4 10 95 Denaturation step 5 30 40 Probe hybridisation 6 40-80 Melting curve analysis 7 80-40 Cooling
(97) c. PCR Cycler
(98) The reactions were carried out in a LightCycler) 2.0 Instrument and analysed with LightCycler Software 4.1 of Roche Diagnostics (Rotkreuz, Switzerland).
(99) 6. Chemical Transformation of E. coli
(100) E. coli K-12 strain S17-1 was used as donor for conjugational transfer of plasmids based on pK18mobsacB from E. coli to C. glutamicum. Strain S17-1 is described by Simon. R. et al. (Bio/Technology 1, 784-794, 1983). It is available from the American Type Culture Collection under the access number ATCC47055.
(101) Chemically competent E. coli S 17-1 cells were made as follows: A preculture of 10 ml LB medium (10 ml liquid medium per 100 ml Erlenmeyer flask with 3 baffles) was inoculated with 100 l bacterial suspension of strain S17-1 and the culture was incubated overnight for about 18 h at 37 C. and 250 rpm. The main culture (70 ml LB contained in a 250 ml Erlenmeyer flask with 3 baffles) was inoculated with 300 l of the preculture and incubated up to an OD600 of 0.5-0.8 at 37 C. The culture was centrifuged for 6 min. at 4 C. and 4000 rpm and the supernatant were discarded. The cell pellet was resuspended in 20 ml sterile, ice-cold 50 mM CaCl.sub.2 solution and incubated on ice for 30 min. After another centrifugation step, the pellet was resuspended in 5 ml ice-cold 50 mM CaCl.sub.2 solution and the suspension incubated on ice for 30 min. The cell suspension was then adjusted to a final concentration of 20% glycerol (v/v) with 85% (v/v) sterile ice-cold glycerol. The suspension was divided into 50 l aliquots and stored at 80 C. To transform S17-1 cells, the protocol according to Tang et al. (Nucleic Acids Res. 22(14), 2857-2858, 1994) with a heat shock of 45 sec. was used.
(102) 7. Conjugation of C. glutamicum
(103) The pK18mobsacB plasmid system described by Schafer et al. (Gene 145, 69-73, 1994) was used to integrate desired DNA fragments into the chromosome of C. glutamicum. A modified conjugation method of Schafer et al. (Journal of Bacteriology 172, 1663-1666, 1990) was used to transfer the respective plasmid into the desired C. glutamicum recipient strain.
(104) Liquid cultures of the C. glutamicum strains were carried out in BHI medium at 33 C. The heat shock was carried out at 48.5 C. for 9 min. Transconjugants were selected by plating the conjugation batch on EM8 agar (Table 2), which was supplemented with 25 mg/l kanamycin and 50 mg/l nalidixic acid. The EM8 agar plates were incubated for 72 h at 33 C.
(105) TABLE-US-00002 TABLE 2 Composition of the EM8 agar Components Concentration (g/l) Glucose (sterile-filtered) 23 CSL (com steep liquor; Roquette; solid 30 content 48 2% w/w) Peptone from soymeal (Merck, Germany) 40 (NH.sub.4).sub.2SO.sub.4 8 Urea 3 KH.sub.2PO.sub.4 4 MgSO.sub.47H.sub.2O 0.5 FeSO.sub.47H.sub.2O 0.01 CuSO.sub.45H.sub.2O 0.001 ZnSO.sub.47H.sub.2O 0.01 Calcium pantothenate, D(+) 0.01 Thiamine 0.001 Inositol 0.1 Nicotinic acid 0.001 Biotin (sterile-filtered) 0.005 CaCO.sub.3 (autoclaved separately) 1.6 Agar-Agar (Merck, Germany) 14
(106) Sterile toothpicks were used to transfer the transconjugants onto BHI agar, which was supplemented with 25 mg/l kanamycin and 50 mg/l nalidixic acid. The agar plates were incubated for 20 h at 33 C. The cultures of the respective transconjugants produced in this manner were then propagated further for 24 h at 33 C. in 10 ml BHI medium contained in 100 ml Erlenmeyer flasks with 3 baffles. An aliquot was taken from the liquid culture suitably diluted and plated (typically 100 to 200 l) on BHI agar which was supplemented with 10% sucrose. The agar plates were incubated for 48 h at 33 C. The colonies growing on the sucrose containing agar plates were then examined for the phenotype kanamycin sensitivity. To do so a toothpick was used to remove cell material from the colony and to transfer it onto BHI agar containing 25 mg/l kanamycin and onto BHI agar containing 10% sucrose. The agar plates were incubated for 60 h at 33 C. Clones that proved to be sensitive to kanamycin and resistant to sucrose were examined for integration of the desired DNA fragment by means of real-time PCR.
(107) 8. Glycerol Stocks of E. coli and C. glutamicum Strains
(108) For long time storage of E. coli- and C. glutamicum strains glycerol stocks were prepared. Selected E. coli clones were cultivated in 10 ml LB medium supplemented with 2 g/l glucose. Selected C. glutamicum clones were cultivated in twofold concentrated BHI medium supplemented with 2 g/l glucose. Cultures of plasmid containing E. coli strains were supplemented with 50 mg/l kanamycin. Cultures of plasmid containing C. glutamicum strains were supplemented with 25 mg/l kanamycin. The medium was contained in 100 ml Erlenmeyer flasks with 3 baffles. It was inoculated with a loop of cells taken from a colony and the culture incubated for about 18 h at 37 C. and 200 rpm in the case of E. coli and 33 C. and 200 rpm in the case of C. glutamicum. After said incubation period 1.2 ml 85% (v/v) sterile glycerol were added to the culture. The obtained glycerol containing cell suspension was then aliquoted in 2 ml portions and stored at 80 C.
(109) 9. Cultivation System According to Wouter Duetz (WDS)
(110) The millilitre-scale cultivation system according to Duetz (Trends Microbiol. 2007; 15(10):469-75) was used to investigate the performance of the C. glutamicum strains constructed. For this purpose, 24-deepwell microplates (24 well WDS plates) from EnzyScreen BV (Heemstede, Netherlands; Cat. no. CR1424), filled with 2.5 mL medium were used.
(111) Precultures of the strains were done in 10 ml twofold concentrated BHI medium. The medium was contained in a 100 ml Erlenmeyer flask with 3 baffles. It was inoculated with 100 l of a glycerol stock culture and the culture incubated for 24 h at 33 C. and 200 rpm.
(112) After said incubation period the optical densities OD600 of the precultures were determined.
(113) The main cultures were done by inoculating the 2.5 ml medium containing wells of the 24 Well WDS-Plate with an aliquot of the preculture to give an optical density OD600 of 0.1.
(114) As medium for the main culture CGXII medium was used. The composition of the CGXII medium is shown in table 3.
(115) TABLE-US-00003 TABLE 3 Composition of CGXII medium. Components Concentration (g/l) MOPS (3-(N-Morpholino)propanesulfonic acid) 42 (NH.sub.4).sub.2SO.sub.4 20 Urea 5 KH.sub.2PO.sub.4 1 K.sub.2HPO.sub.4 1 MgSO.sub.47H.sub.2O 0.25 CaCl.sub.2 0.01 FeSO.sub.47H.sub.2O 0.01 MnSO.sub.4 H.sub.2O 0.01 ZnSO.sub.47H.sub.2O 0.001 CuSO.sub.45H.sub.2O 0.0002 NiCl.sub.26H.sub.2O 0.00002 Biotin (sterile-filtered) 0.0002 Protocatechuic acid (sterile-filtered) 0.03 Carbon source (sterile-filtered) as needed adjust the pH to 7 with NaOH
(116) These main cultures were incubated for approximately 45 h at 33 C. and 300 rpm in an Infors HT Multitron standard incubator shaker from Infors GmbH (Bottmingen, Switzerland) until complete consumption of glucose.
(117) The glucose concentration in the suspension was analysed with the blood glucose-meter to OneTouch Vita from LifeScan (Johnson & Johnson Medical GmbH, Neuss, Germany). After cultivation the culture suspensions were transferred to a deep well microplate. A part of the culture suspension was suitably diluted to measure the OD600. Another part of the culture was centrifuged and the concentration of L-amino acids, in particular L-lysine, and residual glucose were analysed in the supernatant.
(118) 10. Amino Acid Analyser
(119) The concentration of L-lysine and other L-amino acids, e.g. L-valine, in the culture supematants was determined by ion exchange chromatography using a SYKAM S433 amino acid analyser from SYKAM Vertriebs GmbH (Firstenfeldbruck, Germany). As solid phase a column with spherical, polystyrene-based cation exchanger (Peek LCA N04/Na, dimension 1504.6 mm) from SYKAM was used. Depending on the L-amino acid the separation takes place in an isocratic run using a mixture of buffers A and B for elution or by gradient elution using said buffers. As buffer A an aqueous solution containing in 201 263 g trisodium citrate, 120 g citric acid, 1100 ml methanol, 100 ml 37% HCl and 2 ml octanoic acid (final pH 3.5) was used. As buffer B an aqueous solution containing in 20 l 392 g trisodium citrate, 100 g boric acid and 2 ml octanoic acid (final pH 10.2) was used. The free amino acids were coloured with ninhydrin through post-column derivatization and detected photometrically at 570 nm.
(120) 11. Glucose Determination with Continuous Flow System (CFS)
(121) A SANplus multi-channel continuous flow analyser from SKALAR analytic GmbH (Erkelenz, Germany) was used to determine the concentration of glucose in the supernatant. Glucose was detected with a coupled-enzyme assay (Hexokinase/Glucose-6-Phosphate-Dehydrogenase) via NADH formation.
B) Experimental Results
Example 1
(122) Sequence of the Kup Gene of C. glutamicum Strain DM1933
(123) Strain DM1933 is an L-lysine producer described by Blombach et al. (Applied and Environmental Microbiology 75(2), 419-427, 2009). It can be obtained at the DSMZ under accession number DSM25442.
(124) The nucleotide sequence of the chromosome of strain DM1933 was determined by Illumina whole-genome sequencing technology (Illumina Inc., San Diego, Calif., US). See e.g. Benjak et al. (2015) Whole-Genome Sequencing for Comparative Genomics and De Novo Genome Assembly. In: Parish T., Roberts D. (eds) Mycobacteria Protocols. Methods in Molecular Biology, Vol 1285. Humana Press, NY, US) and Bennet, S. (Pharmacogenomics 5(4), 433-438, 2004).
(125) It was found that the nucleotide sequence of the kup coding sequence (locus_tag NCgl0682) of strain DM1933 including the nucleotide sequence upstream and downstream thereof is identical to that of ATCC13032 shown in SEQ ID NO: 1.
(126) DM1933 contains in its chromosome a variant of the aspartokinase gene encoding a feedback resistant aspartokinase polypeptide. Said feedback resistant aspartokinase polypeptide has the amino acid sequence of SEQ ID NO:6 of the sequence listing, wherein the amino acid threonine (Thr) at position 311 of the amino acid sequence is replaced by isoleucine (Ile). In U.S. Pat. No. 7,338,790 the abbreviation lysC T311I is used to indicate said exchange. Blombach et al. use the abbreviation lysC(T311I).
Example 2
(127) Construction of Plasmid pK18mobsacB_Kup_G344V
(128) Plasmid pK18mobsacB_kup_G344V was constructed to enable incorporation of the mutation causing the amino acid exchange G344V into the nucleotide sequence of the kup coding sequence of strain DM1933. The plasmid is based on the mobilizable vector pK18mobsacB described by Schafer et al. (Gene 145, 69-73, 1994). For the construction of pK18mobsacB_kup_G344V the kup_G344V polynucleotide according to SEQ ID NO:7 was synthesized and subcloned into pK18mobsacB by GeneArt (ThermoFisher Scientific (Waltham, USA)).
(129) To assemble the plasmid pK18mobsacB_kup_G344V the following steps were done by GeneArt: The two polynucleotides i.e. the vector pK18mobsacB and the polynucleotide kup_G344V were both treated with XbaI, ligated and the ligation mixture used to transform E. coli.
(130) DNA of plasmid pK18mobsacB_kup_G344V was isolated from a transformant.
Example 3
(131) Construction of Strain DM1933_kup_G344V
(132) The plasmid pK18mobsacB_kup_G344V obtained in example 2 was used to incorporate the mutation (see nucleotide position 1070 of SEQ ID NO: I and SEQ ID NO:3 and nucleotide position 866 of SEQ ID NO:7) leading to the amino acid exchange G344V (see nucleotide positions 1069-1071 of SEQ ID NO:1 and SEQ ID NO:3, amino acid position 344 of SEQ ID NO:2 and SEQ ID NO:4 and nucleotide positions 865-867 of SEQ ID NO:7) into the chromosome of the L-lysine producer DM1933.
(133) Chemically competent cells of E. coli strain S17-1 were transformed with plasmid DNA of pK18mobsacB_kup_G344V. The modified conjugation method of Schafer et al. (Journal of Bacteriology 172, 1663-1666, 1990) as described in materials and methods was used for conjugal transfer into the strain DM1933 and for selection of transconjugant clones by virtue of their sucrose resistance and kanamycin sensitivity phenotype.
(134) Transconjugant clones were analyzed by real-time PCR using the Type-it Kit and the primers LC-Ncgl0682_1 and LC-Ncgl0682_2 for PCR amplification and NCgl0682_344_C as acceptor probe and NCgl0682_G344V_A as donor probe for melting curve analysis (table 4).
(135) TABLE-US-00004 TABLE4 Listofprimersandprobesusedforreal-timePCR. name sequence LC-NCgl0682_1 ATCAGATACAGGACGCTGAC LC-NCgl0682_2 AGGTCTGCGGATTCCGTTGG NCgl0682_344_C.sup.1 TAGATCTGGACTTCCTCTTT NCgl0682_344_A.sup.2 CACGGATACAAACAGCAATCCATTAACCAGTGGCA .sup.1acceptor probe labelled with LC-Red640 at the 5-end and phosphorylated at the 3-end .sup.2donor probe labelled with fluorescein at the 3-end
(136) One of the transconjugant clones thus characterized was called DM1933_kup_G344V. A glycerol stock culture of the transconjugant clone was prepared and used as starting material for further investigations.
(137) Thus the kup gene of strain DM1933 was mutated with the effect that the amino acid glycine at position 344 of the amino acid sequence of the encoded Kup polypeptide was replaced by valine.
Example 4
(138) L-Lysine Production by Strain DM1933_Kup_G344V
(139) Strains DM1933 (reference) and DM1933_kup_G344V obtained in example 3 were analyzed for their ability to produce L-lysine from glucose by batch cultivation using the cultivation system according to Wouter Duetz.
(140) As medium CGXII containing 20 g/l glucose as carbon source was used. The cultures were incubated for 45 h until complete consumption of glucose as confirmed by glucose analysis using blood glucose-meter and the concentrations of L-lysine and the optical density OD660 were determined. The result of the experiment is presented in table 5.
(141) TABLE-US-00005 TABLE 5 L-lysine production by strain DM1933_kup_G344V. strain L-lysine.sup.1 (g/l) OD660 DM1933 3.7 9.5 DM1933_kup_G344V 4.0 9.2 .sup.1as L-lysine HCl
(142) The experiment shows that L-lysine production was increased in strain DM1933_kup_G344V as compared to the parent strain DM1933.