HIGHLY POLYMORPHIC AND MODULAR EXTRAGENIC (H.P.M.E.) MARKERS WITHIN SPECIFIC TAXA OF MICROORGANISMS AND USE THEREOF FOR THEIR DIFFERENTIATION, IDENTIFICATION AND QUANTIFICATION
20200224248 ยท 2020-07-16
Assignee
Inventors
- Fabio Fracchetti (SOMMACAMPAGNA, IT)
- Sandra Torriani (PIACENZA, IT)
- Antonio Del Casale (VASTO, IT)
- Giovanna Felis (VERONA, IT)
Cpc classification
C12Q2525/15
CHEMISTRY; METALLURGY
C12Q2525/15
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention concerns the field of nucleic acid based methods suitable for the generation of tools for biomedical research and biotechnological applications, which allow to differentiate, identify and quantify microorganisms and viruses.
Claims
1. A Highly Polymorphic and Modular Extragenic (H.P.M.E.) marker, said H.P.M.E. being a microbial genome nucleotide sequence having a length of less than or equal to 2000 bp, and said HPME comprising at least one primary protein encoding gene and a secondary flanking extragenic region, wherein when said H.P.M.E. is aligned with two or more nucleotide sequences to obtain a sequence alignment, said sequence alignment has: a percentage of similarity lower or equal to than 78% in pairwise alignment, and three or more stretches from 9 to 30 bp having at least a 97% sequence identity in all the aligned sequences and one or more stretches are not in the protein coding region; the insertion or the deletion of 1 or more nucleotides in the extragenic region, even when the percentage similarity is higher than 78% in pairwise alignment; or a percentage of similarity lower or equal to 78% in pairwise alignment, and three stretches of from 9 to 30 bp having at least a 97% sequence identity in all the aligned sequences and at least one sequence variation due to insertion/deletion of one or more nucleotides in the extragenic region.
2. The marker according to claim 1, wherein said microbial genome nucleotide sequence is a prokaryotic sequence or an eukaryotic sequence.
3. The marker according to claim 1, wherein said microbial genome nucleotide sequence is a prokaryotic or an eukaryotic sequence, and wherein said prokaryotic or an eukaryotic sequence belongs to a microorganism of the genus chosen from the group consisting of Oenococcus, Lactobacillus, Lactococcus, Leuconostoc, Pediococcus, Streptococcus, Fructobacillus, Weisella, Enterococcus, Bifidobacterium, Bacillus, Paenibacillus, Streptomyces, Gluconobacter, Acetobacter, Gluconacetobacter, Komagataeibacter, Saccharomyces, Zygosaccharomyces, Schizosaccharomyces Candida, Penicillium, and Aspergillus,
4. The marker according to claim 1, wherein said microbial genome nucleotide sequence is a bacterial sequence, and wherein bacterial sequence belongs to a bacterium of the genus chosen from the group consisting of Lactobacillus, Leuconostoc and Pediococcus Streptococcus, Enterococcus, Bifidobacterium and Bacillus Streptomyces, Saccharomyces.
5. The marker according to claim 1, wherein said flanking extragenic region is in a non coding region.
6. The marker according to claim 1, wherein said secondary flanking region is a gene coding for a gene regulatory protein and said gene coding for a gene regulatory protein is: oriented in the same direction of the primary gene; oriented in the opposite direction of the primary gene.
7. The marker according to claim 1, wherein said secondary flanking region is a gene coding for a gene regulatory protein belonging to the lysR-type transcriptional regulator family and to the HrcA family according the PFAM nomenclature.
8. The H.P.M.E. marker according to claim 1, wherein the said primary protein encoding gene and a secondary flanking extragenic region are respectively: the gene mleA coding for the Malolactic enzyme and the gene mleR coding for the mleA transcriptional regulator, belonging to the LysR-type transcriptional regulator family, namely H.P.M.E. mleA-mleR marker, for the identification and quantification of microorganisms within the Lactobacillales order; the gene tkt coding for the Transketolase enzyme and the gene hrcA coding for the HrcA transcriptional regulator, namely H.P.M.E. tkt-hrcA marker, for the identification and quantification of microorganisms within the Bifidobacterium genus; the gene grpE coding for the Heat Shock Protein GrpE and the gene hrcA coding for the HrcA transcriptional regulator, namely H.P.M.E. hrcA-grpE marker, for the identification and quantification of microorganisms within the Bacillus genus.
9. Method for the identification of the genus and/or the species and/or subspecies or any of the Operational Taxonomic Unit (OTU) of a microorganism with the Highly Polymorphic and Modular Extragenic (HPME) marker according to claim 1.
10. Method for designing primers and probes and adaptors for the generation of tools for biomedical research and biotechnological applications with the Highly Polymorphic and Modular Extragenic (HPME) marker according to claim 1.
11. The method according to claim 10, wherein said designing primers and probes and adapters are for PCR, rtPCR, qPCR, LAMP-PCR, Next Generation Sequencing, molecular applications mediated by hybridization, preferably qPCR, cytofluorimetry, citofluorimetry and cell sorting, Fluorescent In Situ Hybridization (FISH), FISH-FLOW.
12. Method for the identification and quantification of a target microorganisms with the Highly Polymorphic and Modular Extragenic (HPME) marker according to claim 1.
13. The method according to claim 12, wherein said identification and quantification of microorganisms is carried out with: a target marker consisting of the nonamer sequence TTTGACTAT within the H.P.M.E. mleA-mleR marker, for the Lactobacillales order; the target markers consisting of the sequences ACAAGCCGG, GAGTGCTAAT (SEQ ID NO: 25), AACACGCCAAA (SEQ ID NO: 23), ATTGGAAGGAAAGTA (SEQ ID NO:24), ATTGTATTAGCACTC (SEQ ID NO: 26), within the H.P.M.E. tkt-hrcA marker, for the Bifidobacterium genus; the target markers consisting of the sequence TTTGTTTTTCTTCT, TGTGTTCACCTCCCT within the H.P.M.E. hrcA-grpE marker; for the Bacillus genus.
14. The method according to claim 13, wherein the microorganism is a bacterium and is chosen from the group consisting of the genera Lactobacillus, Leuconostoc and Pediococcus Streptococcus, Enterococcus, Bifidobacterium and Bacillus.
15. The marker according to claim 5, wherein said flanking extragenic region is a conserved tRNA, rRNA or a pseudogene region.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0047] The characteristics and advantages of the invention will now be described in detail from the detailed description which follows, from the Examples given for illustrative and non-limiting purposes, and in reference to the annexed
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054] The alignment is displayed in similarity mode, therefore in the second and third sequence, the common nucleotides with the first sequence are shown as a dot, whereas the SNPs are shown as a nucleotide. The start codon of the mleR and mleA genes are included in an empty arrow showing the orientation of the gene, therefore the H.P.M.E. mleA-mleR marker is one preferred representation of one H.P.M.E. marker in the Configuration A (
[0055]
[0056]
[0057] The sample list is as follows: M) size marker O'GeneRuler DNA Ladder Mix, Ready-to-Use 100 to 10.000 bp (Thermo Scientific); 1) O. oeni DSM 20477; 2) O. oeni DSM 20477 digested with Hae III; 3) O. kitaharae DSM 17330; 4) O. kitaharae DSM 17330 digested with Hae III; 5) O. alcoholitolerans LMG 27599; 6) O. alcoholitolerans LMG 27599 digested with Hae III; 7) O. oeni DSM 20477 and O. kitaharae DSM 17330; 8) O. oeni DSM 20477 and O. kitaharae DSM 17330 digested with Hae III; 9) O. oeni DSM 20477 and O. alcoholitolerans LMG 27599; 10) O. oeni DSM 20477 and O. alcoholitolerans LMG 27599 digested with Hae III; 11) O. kitaharae DSM 17330 O. alcoholitolerans LMG 27599; 12) O. kitaharae DSM 17330 O. alcoholitolerans LMG 27599 digested with Hae III; 13) O. oeni DSM 20477, O. kitaharae DSM 17330 and O. alcoholitolerans LMG 27599; 14) O. oeni DSM 20477, O. kitaharae DSM 17330 and O. alcoholitolerans LMG 27599 digested with Hae III;
[0058]
[0059] The sample list is as follows: O. oeni DSM 20477; 2) O. kitaharae DSM 17330; 3) O. alcoholitolerans LMG 27599; 4) O. oeni DSM 20477 and O. kitaharae DSM 17330; 5) O. oeni DSM 20477 and O. alcoholitolerans LMG 27599; 6) O. kitaharae DSM 17330 O. alcoholitolerans LMG 27599; 7) O. oeni DSM 20477, O. kitaharae DSM 17330 and O. alcoholitolerans LMG 27599
[0060]
[0061]
[0062]
[0063]
[0064]
[0065] The sample list is: M) size marker O'GeneRuler DNA Ladder Mix, Ready-to-Use 100 to 10.000 bp (Thermo Scientific); 1) L. casei DSM 20011, 2) L. paracasei subsp. paracasei DSM 5622; 3) L. paracasei subsp. tolerans DSM 20258; 4) L. rhamnosus DSM 20021.
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072] The alignment is displayed in similarity mode, therefore in the sequence from the second to the sixth, the common nucleotides with the first sequence are shown as a dot, whereas the SNPs are shown as a nucleotide. The start codon of the hrcA and tkt genes are included in an empty arrow showing the orientation of the gene, therefore the H.P.M.E. tkt-hrcA marker is another preferred representation of one H.P.M.E. marker in the Configuration A (
[0073]
[0074]
[0075] shows the alignment of the H.P.M.E. mleA-mleR marker, constituted by the partial sequence of the mleR gene and the complete sequence of the mleA gene and the of the promoter from Oenococcus oeni, Oenococcus kitaharae and Oenococcus alcoholitolerans.
[0076] The alignment is displayed in similarity mode, therefore in the sequences other than the first (O. oeni PSU-1), the common nucleotides with the first sequence are shown as a dot, whereas the SNPs are shown as a nucleotide. The start codon of the mleR and mleA genes are included in an empty arrow showing the orientation of the gene. The gaps in the promoter region which allow to differentiate the three species by length polymorphism are marked in light grey. The regions that have been used to design the primers (OeX_mleR_68-F1, OeX_mleA_01-R1, OeX_mleA_244-RN) to be applied in different protocols and procedure are located within of the full black arrows. The conserved sequence TTTGACTAT of the alignment and surrounded by a grey frame it is known to be shared also by other Lactic Acid Bacteria, e.g. Lactobacillus, Leuconostoc and Pediococcus, and corresponds to the Stretch_1 of the
[0077]
[0078] shows the configuration of the H.P.M.E. mleA-mleR marker, constituted by the partial sequence of the mleA gene and the mleR gene and the complete sequence of the gene promoter from Oenococcus oeni PSU-1 Oenococcus kitaharae DSM 17330 and Oenococcus alcoholitolerans LMG 27599. The genes mleR and mleA are oriented in opposite directions on the two complementary strands of the DNA. In the promoter region the Stretch_1 corresponding to the conserved sequence TTTGACTAT is comprised in the PCR product obtained with the primer pair OeX_mleR_68-F1 and OeX_mleA_01-R1 and with the primer pair OeX_mleR_68-F1 and OeX_mleA_244-RN, but it is not comprised in any other PCR product reported in the prior art and obtained with primers targeting only mleA gene.
[0079] Moreover both the primer pair OeX_mleR_68-F1/OeX_mleA_01-R1 and OeX_mleR_68-F1/OeX_mleA_244-RN allow to differentiate the three species O. oeni, 0 kitaharae and O. alcoholitolerans both by sequence polymorphisms (SNPs) and by length polymorphisms (insertion/deletion).
[0080]
[0081]
[0082]
[0083] The electrophoresis migration clearly shows not specific products when the primers are applied to amplify O. kitaharae and O. alcoholitolerans.
[0084]
[0085] The electrophoresis migration clearly shows not specific products when the primers are applied to amplify O. kitaharae, while O. alcoholitolerans gives no result.
[0086]
[0087] The electrophoresis migration clearly shows that only O. oeni gives results both when the DNA is present singly and when it is in a mixed solution.
[0088]
[0089] These two H.P.M.E. markers allow to differentiate Rickettsiella grylli and Candidatus Rickettsiella isopodorum on the basis of the in-silico comparative analysis of the three available genome sequences for this genus.
[0090] More in detail, it is possible to differentiate the two species thanks to the H.P.M.E. rsmD-ftsY marker by analyzing the region comprised within the primer Rck_rsmD-33-FN and Rck_ftsY-01-R1 or within the primer Rck_rsmD-33-FN and Rck_ftsY-85-RN. The regions defined by these two primer pairs are indeed variable both considering the nucleotide sequence and the size, because of the presence of insertion/deletion nucleotide sites.
[0091] Analogously it is possible to differentiate Rickettsiella grylli and Candidatus Rickettsiella isopodorum on the basis of both the sequence and the size, thanks to the H.P.M.E. ftsY-rubA marker by analyzing the region comprised within the primer pair comprising one of the following three oligonucleotides as the forward primer: Rck_ftsY-834-F1, Rck_ftsY-942-FN or Rck_ftsY-947-FN and one of the two following oligonucleotides as the reverse primer: Rck_rubA_145-RN; Rck_rubA-23-RN. It is not possible to predict the size of the PCR product given by the primer pair ftsY fwd/ftsY rev according Ieclerque et al., (2011) by in-silico analysis.
[0092]
[0093] The genes hrcA and grpE are oriented in the same direction. In the promoter region the the conserved sequences corresponding to Stretch_1 and Stretch_2, corresponding respectively to BcX_hrcA-grpE_1095-F1 and BcX_hrcA-grpE_1120-R1 are comprised in the PCR product obtained with the primer pair constituted by BcX_hrcA_991-FN2 or BcX_hrcA_991-FN1, as forward primer, and BcX_hrpE_1311-RN1 or BcX_hrpE_1311-RN2, as reverse primer. In both the cases species belonging to the Bacillus genus can be differentiated both by sequence polymorphisms (SNPs) and by length polymorphisms (insertion/deletion).
[0094]
[0095]
DETAILED DESCRIPTION OF THE INVENTION
[0096] The present invention therefore concerns a Highly Polymorphic and Modular Extragenic (HPME) marker, said HPME being a microbial genome (prokaryotic sequence or an eukaryotic sequence) nucleotide sequence having a length of less than or equal to 2000 bp, and said HPME comprising at least one primary protein encoding gene and a secondary flanking extragenic region,
wherein when said HPME is aligned with two or more nucleotide sequences to obtain a sequence alignment, said sequence alignment has: [0097] a percentage of similarity lower or equal to than 78% in pairwise alignment, and three or more stretches from 9 to 30 bp having at least a 97% sequence identity in all the aligned sequences and one or more stretches are not in the protein coding region; [0098] the insertion or the deletion of 1 or more nucleotides in the extragenic region, even when the percentage similarity is higher than 78% in pairwise alignment; or [0099] a percentage of similarity lower or equal to 78% in pairwise alignment, and three stretches of from 9 to 30 bp having at least a 97% sequence identity in all the aligned sequences and at least one sequence variation due to insertion/deletion of one or more nucleotides in the extragenic region.
[0100] The HPME of the present invention has the advantages of being a very robust new marker for use in nucleic acid based methods suitable for the generation of tools for biomedical research and biotechnological applications.
[0101] The present invention relates to the use of nucleotide sequences (HPME target sequences) comprising two genetic elements (loci), at least one of which is a predicted Open Reading Frame coding for a protein, a hypothetical protein, or a pseudogene, to differentiate identify and quantify microorganisms, such as eubacteria archea, fungi, and viruses.
[0102] The two genetic elements in the target sequences are divided by noncoding nucleotide sequence, that in some embodiments of the inventions correspond to the promoter region of one Open Reading Frame coding for a protein or for an hypothetical protein.
[0103] The target sequences are characterized by both conserved and variable nucleotide stretches within specific taxa of microorganisms and viruses and they represent the key information that is exploited to develop new protocols for the differentiation, identification and the quantification of the microorganisms and viruses themselves. The target sequences are characterized by two levels of polymorphism within the same taxon: sequence polymorphism and length polymorphism. The number of the possible sequence targets and their characteristics guarantees the flexibility required to be applied on different technological platform and with different protocols, as well as two possible levels of specificity to check the robustness of the results.
[0104] In one aspect of the invention the genetic elements comprised in the target sequences are divided by a sequence stretch of zero nucleotides, They are therefore united, but this does not hinder to differentiate microorganisms and viruses from other microorganisms and viruses within the same taxon, divided by a longer stretch of nucleotides.
[0105] In one aspect of the invention the two genetic elements are oriented in opposite directions on the two complementary strands of the DNA.
[0106] In another aspect of the invention the two genetic elements are oriented in the same direction on the same strand of DNA.
[0107] All above considered, the target sequences previously defined guarantee the flexibility required to be applied on different technological platform and with different protocols, as well as two possible level of specificity to check the robustness of the results.
[0108] In a preferred aspect, the HPME marker according to the present invention is a bacterial sequence such as eubacteria archea, fungi or a viral sequence.
[0109] In a more preferred aspect, the HPME marker according to the present invention is a bacterial sequence, which belongs to a bacterium of the genus chosen from the group consisting of Oenococcus, Lactobacillus, Lactococcus, Leuconostoc, Pediococcus, Streptococcus, Fructobacillus, Weisella, Enterococcus, Bifidobacterium, Bacillus, Paenibacillus, Streptomyces, Gluconobacter, Acetobacter, Gluconacetobacter, Komagataeibacter, Saccharomyces, Zygosaccharomyces, Schizosaccharomyces Candida, Penicillium, and Aspergillus,
[0110] In a still more preferred aspect, the HPME marker according to the present invention is a bacterial sequence belonging to a bacterium of the genus chosen from the group consisting of Lactobacillus, Leuconostoc and Pediococcus Streptococcus, Enterococcus, Bifidobacterium and Bacillus.
[0111] A further aspect of the invention relates to an HPME marker whose flanking extragenic region is in a non coding region, preferably a conserved tRNA, rRNA or a pseudogene region.
[0112] A still further aspect of the invention relates to an HPME marker wherein said secondary flanking region is a gene coding for a gene regulatory protein and said gene coding for a gene regulatory protein is: [0113] oriented in the same direction of the primary gene; [0114] oriented in the opposite direction of the primary gene.
[0115] A still further aspect of the invention relates to an HPME marker wherein said secondary flanking region is a gene coding for a gene regulatory protein belonging to the lysR-type transcriptional regulator family and to the HrcA family according the PFAM nomenclature. According to one aspect, the described invention provides a H.P.M.E. marker, wherein the said primary protein encoding gene and a secondary flanking extragenic region are respectively: [0116] the gene mleA coding for the Malolactic enzyme and the gene mleR coding for the mleA transcriptional regulator, belonging to the LysR-type transcriptional regulator family, namely H.P.M.E. mleA-mleR marker, for the identification and quantification of microorganisms within the Lactobacillales order; [0117] the gene tkt coding for the Transketolase enzyme and the gene hrcA coding for the HrcA transcriptional regulator, namely H.P.M.E. tkt-hrcA marker, for the identification and quantification of microorganisms within the Bifidobacterium genus; [0118] the gene grpE coding for the Heat Shock Protein GrpE and the gene hrcA coding for the HrcA transcriptional regulator, namely H.P.M.E. hrcA-grpE marker, for the identification and quantification of microorganisms within the Bacillus genus.
[0119] The present invention also relates to the use of the HPME marker, for the identification of the genus and/or the species and/or subspecies or any of the Operational Taxonomic Unit (OTU) of a microorganism.
[0120] According to one aspect, the described invention provides a use of the HPME marker, for designing primers and probes and adaptors for the generation of tools for biomedical research and biotechnological applications.
[0121] In a preferred aspect the invention provides a use of the HPME marker, wherein said primers and probes are for molecular biology techniques such as for example: PCR, rtPCR, qPCR, LAMP-PCR, Next Generation Sequencing, molecular applications mediated by hybridization, preferably qPCR, cytofluorimetry, citofluorimetry and cell sorting, Fluorescent In Situ Hybridization (FISH), FISH-FLOW.
[0122] In a further aspect the invention provides a use of the HPME marker for the identification and quantification of a target microorganisms.
[0123] In a preferred aspect the invention provides a use of the HPME marker, wherein said identification and quantification of microorganisms is carried out with: [0124] a target marker consisting of the nonamer sequence TTTGACTAT within the H.P.M.E. mleA-mleR marker, for the Lactobacillales order; [0125] the target markers consisting of the sequences ACAAGCCGG, GAGTGCTAAT (SEQ ID NO: 25), AACACGCCAAA (SEQ ID NO: 23), ATTGGAAGGAAAGTA (SEQ ID NO:24), ATTGTATTAGCACTC (SEQ ID NO: 26), within the H.P.M.E. tkt-hrcA marker, for the Bifidobacterium genus; [0126] the target markers consisting of the sequence TTTGTTTTTCTTCT, TGTGTTCACCTCCCT within the H.P.M.E. hrcA-grpE marker; for the Bacillus genus. A further aspect of the present invention is a target marker consisting of the nonamer sequence TTTGACTAT.
[0127] A still further aspect of the present invention is the use of the nonamer sequence TTTGACTAT for the identification and the quantification of the genus and the species of microorganism.
[0128] In a preferred aspect the invention provides a use of the nonamer sequence, wherein the microorganism is a bacterium, a fungus or a virus, and wherein the microorganism is preferably a bacterium and is chosen from the group consisting of the genera Oenococcus, Lactobacillus, Lactococcus, Leuconostoc, Pediococcus, Streptococcus, Fructobacillus, Weisella, Enterococcus, Bifidobacterium, Bacillus, Paenibacillus, Gluconobacter, Acetobacter, Gluconacetobacter, and Komagataeibacter.
[0129] In a more preferred aspect the microorganism is a bacterium and is chosen from the group consisting of the genera Lactobacillus, Leuconostoc and Pediococcus Streptococcus, Enterococcus, Bifidobacterium and Bacillus.
[0130] The possible applications and uses to differentiate, identify and quantify microorganism and viruses thanks to the information contained in the precise configuration of variable and conserved sequence stretches of the HPME target sequences, are: [0131] i) oligonucleotides to be applied as primers in Polymerase Chain Reaction (PCR) and quantitative PCR (qPCR), both characterized by thermal cycling amplifications; [0132] ii) oligonucleotides or xeno-nucleic acid aptamers such as Locked Nucleic Acid (LNA) oligos to be applied as primers in isothermal amplification (e.g. Loop mediated isothermal amplification); [0133] iii) oligonucleotides or xeno-nucleic acid aptamers such as Locked Nucleic Acid (LNA) oligos to be used as a probe marked with a reporter molecule for colorimetric assays mediated by hybridization (e.g. Horseradish Peroxidase mediated); [0134] iv) oligonucleotides to be used as a probe marked with a reporter molecule for chemiluminescence assays mediated by hybridization; [0135] v) oligonucleotides or xeno-nucleic acid aptamers such as Locked Nucleic Acid (LNA) oligos to be used as a probe marked with a reporter molecule (e.g. Fluorescein, FAM, HEX, NED, TAMRA, R6G, JOE, VIC, Cyanine dyes, AlexaFluor dyes, quantum dots) for fluorescence molecular applications mediated by hybridization such as qPCR, cytofluorimetry, citofluorimetry and cell sorting, Fluorescent In Situ Hybridization (FISH), FISH-FLOW; [0136] vi) polypeptides such as Restriction Enzymes (RE), modified restriction enzymes, specific DNA sequence target antibodies; [0137] vii) any method whereby is possible to detect and report a specific nucleotide sequence or a specific configuration of nucleotide sequences.
[0138] In a preferred embodiment, the HPME marker can have a target sequence which is specific for the microbial genera (prokaryote or eukaryote) which are to be identified. For example, for the identification of the Oenococcus genus and the Lactobacillus genus, the mleA-mleR target sequence is used.
[0139] mleA-mleR target sequence for the Oenococcus genus and the Lactobacillus genus identification can be chosen from the following:
TABLE-US-00001 Oenococcus_alcoholitolerans_LMG_27599_mleA-mleR SEQIDNO:1 TGATCGATCTCGTCGTGAGCGGCCAAAATCTGCGTAAGGATCCTTTCT GTGTACTTTTCGAGGATCTTACCGGCTTTCGTCAATTGAACGCGGCCA TGCGAATGATTCCTGGTAACTAATTCTTGTTTAAATTCTTTTTCCAAT CGCTGGATGGCATAAGAAATAGTTGGTTGGCTGACATTGAAAAAAGCT GCCGTTTGTGAAAACGACTCCACTTTGGCCAGGCGCTGAAAATACTCT AAATCAGTGAATTTCATATAAATTTATTTTATCTCTTTTGCAGCTTTT GACTATATCAGCTGCGATAAAATATCCTGAATCTGTTTGTTTATTAGG AGAGAGAAATGACAGATCCAGTAGATATTTTAAACGATCCCTTTAAAA ACAAAGGAACCGCTTTTACTCAAGAAGAACGCAAAGCACTGGGCTTGC AGGGACTTTTGCCCTCATGTGTGCAAACTATTGATCAGCAAGCTGCAC AAGCCTATGCTCAATTTCAAAGCAAAGCTGATAATCTAGAAAAAAGAC TTTTCTTGATGGAACTTTTCAACACCAACCACGTGCTGTTCTATAAGC TTTTTTCACAACACGTCGTTGAATTCATGCCGATCGTCTATGATCCGA CTATCGCTGATACGATTGAAAATTATTCTGAACTTTTCGTTGAAACAC AGGGAGCTGCTTTTTTGGATATCCAGCATCCAGAAAACATCGAAGCCA GTTTGAAAAATGCCGCTGACGGTCGTGACATAAAATTGATCGTCGTCA CTGATGCTGAGGGCATTTTAGGTATCGGCGACTGGGGTGTTCAAGGGG TCGATATCGCCGTTGGAAAATTGATGGTCTACACCGTGGCTGCAGGAC TTGATCCAAAGAGTGTCTTGCCGGTCGTGATCGATGCCGGAACCAATA ATCAAAAACTTTTAAACGATCCTTTGTATTTAGGAAACCGTTTTAACC GTGTTCGCGGTCAAGCTTATGATGATTTTATCGATACTTTTGTTGAAA AATCGGAAAATCTTTTTCCAGATATGTATTTGCATTGGGAAGACTTTG GGCGTTTGAATGCCGCAAATATTTGAATAGA Lactobacillus_brevis_LMG11989_mleA-mleR SEQIDNO:2 CCATACAGAGCCGCCCTCAACAGTTTGCAGTCCTTCCAGCAGATTCTC AGCCTGCAATCGTGCGGCAATTCGTGGAAAATAATAATTTTCGATAAT TGGTGGCAACCCCAGCGTGGTTTGGCGAGCAGCTAAATGGGCTAGTTC TTGGTGGGCTAGCGTTAATTCACTGAGGACGACTTGGGCGTGAATGGC TAATTGCTCACCGCTCGGGGTAATTTGAATATCATTGTGTACCCGATC CCGGATGACTAATTTGGTTTCAAATTCGGTCTCTAATCGTTTGATAGC CGTGGTGATCGTGGGCTGAGTCACACCGAArAAGGCTGCTACCTTAGA AAAATTTTTTTGTAGAATAAGCTGCTGGAAATAATCCAAATCTTTTGT ATTCATATTTTCTCCTGTCAAATCAAGGCTGATTACTACATTATAAAA TAATTTTATAACAATCGCTACGTTTGACTATAAAATTTTCAGGGCGTT ATAGTGCAATATGTAAATAAGAGCTATCCAAATTGGAGGAAAATCATG ATGACGCAAACAGCAGATACGATTTTAAATAACCCCTTCTTAAATAAA GGAACCGCGTTCACACAAGCAGAACGGCGGGAACTTGGCTTGGTTGGG ACATTGCCAGCCCAAGTTCAAACGATTGATGAACAAGCCACTCAGGCC TATGCCCAATACCAAAGCAAGCCAAGTGACCTGGAAAAGCGGATTTTC TTAATGAATCTCTTTAACGAAAACCGGACATTATTCTTCCATTTAATG GATGAACACGTGGTTGAATT Lactobacillus_brevis_LMG_25561_mleA-mleR SEQIDNO:3 CCATACAGAGCCGCCCTCAACAGTTTGCAGTCCTTCCAGCAGATTCTC AGCCTGCAATCGTGCGGCAATTCGTGGAAAATAATAATTTTCGATAAT TGGTGGCAACCCCAGCGTGGTTTGGCGAGCAGCTAAATGGGCTAGTTC TTGGTGGGCTAGCGTTAATTCACTGAGGACGACTTGGGCGTGAATGGC TAATTGCTCACCGCTCGGGGTAATTTGAATATCATTGTGTACCCGATC CCGGATGACTAATTTGGTTTCAAATTCGGTCTCTAATCGTTTGATAGC CGTGGTGATCGTGGGCTGAGTCACACCGAAGAAGGCTGCTACCTTAGA AAAATTTTTTTGTAGAATAAGCTGCTGGAAATAATCCAAATCTTTTGT ATTCATATTTTCTCCTGTCAAATCAAGGCTGATTACTACATTATAAAA TAATTTTATAACAATCGCTACGTTTGACTATAAAATTTTCAGGGCGTT ATAGTGCAATATGTAAATAAGAGCTATCCAAATTGGAGGAAAATCATG ATGACGCAAACAGCAGATACGATTTTAAATAACCCCTTCTTAAATAAA GGAACCGCGTTCACACAAGCAGAACGGCGGGAACTTGGCTTGGTTGGG ACATTGCCAGCCCAAGTTCAAACGATTGATGAACAAGCCACTCAGGCC TATGCCCAATACCAAAGCAAGCCAAGTGACCTGGAAAAGCGGATTTTC TTAATGAATCTCTTTAACGAAAACCGGACATTATTCTTCCATTTAATG GATGAACACGTGGTTGAATT, Lactobacillus_brevis_LMG_18022_mleA-mleR SEQIDNO:4 CCATACAGAGCCGCCCTCGACAGTTTGCAGTCCTTCCAGCAGATTCTC AGCCTGCAATCGTGCGGCAATTCGTGGAAAATAATAATTTTCGATAAT TGGTGGCAACCCCAGCGTGGTTTGGCGAGCAGCTAAATGTGCTAGTTC TTGGTGGGCTAGCGTTAATTCACTGAGGACGACTTGGGCGTGAATGGC TAGTTGCTCACCGCTCGGGGTAATTTGAATATCATTGTGTACCCGATC CCGGATGACTAATTTGGTTTCAAATTCGGTCTCTAATCGTTTGATAGC CGTGGTGATCGTGGGCTGAGTCACACCGAAGAAGGTTGCTACCTTAGA AAAATTTTTTTGTAGAATAAGCTGCTGGAAATAATCCAAATATTTTGT ATTCATATTTTCTCCTGTCAAATCAAGGCTGATTGCTACATTATAAAA TAATTTTATAACAATCGCTACATTTGACTATAAAATTTCCAGGGCGTT ATAGTGCAATATGTAAATAAGAGCTATCCAAATTGGAGGAAAATCATG ATGACGCAAACAGCAGATACGATTTTAAATAACCCCTTCTTAAATAAA GGAACCGCGTTCACACAAGCAGAACGGCGGGAACTTGGCTTGGTTGGG ACATTGCCAGCCCAAGTTCAAACGATTGATGAACAAGCCACTCAGGCC TATGCCCAATACCAAAGCAAGCCAAGTGACCTGGAAAAGCGGATTTTC TTAATGAATCTCTTTAACGAAAACCGGACATTATTCTTCCATTTAATG GATGAACACGTGGTTGAATT Lactobacillus_brevis_JCM_17312_mleA-mleR SEQIDNO:5 CCATACAGAGCCGCCCTCAACAGTTTGCAGTCCTTCCAGCAGATTCTC AGCCTGCAATCGTGCGGCAATTCGTGGAAAATAATAATTTTCGATAAT TGGTGGCAACCCCAGCGTGGTTTGGCGAGCAGCTAAATGGGCTAGTTC TTGGTGGGCTAGCGTTAATTCACTGAGGACGACTTGGGCGTGAATGGC TAATTGCTCACCGCTCGGGGTAATTTGAATATCATTGTGTACCCGATC CCGGATGACTAATTTGGTTTCAAATTCGGTCTCTAATCGTTTGATAGC CGTGGTGATCGTGGGCTGAGTCACACCGAAGAAGGCTGCTACCTTAGA AAAATTTTTTTGTAGAATAAGCTGCTGGAAATAATCCAAATCTTTTGT ATTCATATTTTCTCCTGTCAAATCAAGGCTGATTACTACATTATAAAA TAATTTTATAACAATCGCTACGTTTGACTATAAAATTTTCAGGGCGTT ATAGTGCAATATGTAAATAAGAGCTATCCAAATTGGAGGAAAATCATG ATGACGCAAACAGCAGATACGATTTTAAATAACCCCTTCTTAAATAAA GGAACCGCGTTCACACAAGCAGAACGGCGGGAACTTGGCTTGGTTGGG ACATTGCCAGCCCAAGTTCAAACGATTGATGAACAAGCCACTCAGGCC TATGCCCAATACCAAAGCAAGCCAAGTGACCTGGAGAAGCGGATTTTC TTAATGAATCTCTTTAACGAAAACCGGACATTATTCTTCCATTTAATG GATGAACACGTGGTTGAATT Lactobacillus_brevis_LMG_11998_mleA-mleR SEQIDNO:6 CCATACAGAGCCACCCTCAACCGTTTGCAGTCCTTCCAGCAGATTCTC AGCCTGCAATCGTGCGGCAATTCGTGGAAAATAATAATTTTCGATAAT TGGTGGCAACCCCAGCGTGGTTTGGCGAGCAGCTAAATGTGCTAGTTC TTGGTGGGCTAGCGTTAATTCACTGAGGACGACTTGGGCGTGAATGGC TAGTTGCTCACCGCTCGGGGTAATTTGAATATCATTGTGTACCCGATC CCGGATGACTAATTTGGTTTCAAATTCGGTCTCTAATCGTTTGATAGC CGTGGTGATCGTGGGCTGAGTCACACCGAAGAAGGTTGCTACCTTAGA AAAATTTTTTTGTAGAATAAGCTGCTGGAAATAATCCAAATCTTTTGT ATTCATATTTTCTCCTGTCAAATCAAGGCTGATTGCTACATTATAAAA TAATTTTATAACAATCGCTACATTTGACTATAAAATTTCCAGGGCGTT ATAGTGCAATATGTAAATAAGAGCTATCCAAATTGGAGGAAAATCATG ATGACGCAAACAGCAGATACGATTTTAAATAACCCCTTCTTAAATAAA GGAACCGCGTTCACACAAGCAGAACGGCGGGAACTTGGCTTGGTTGGG ACATTGCCAGCCCAAGTTCAAACGATTGATGAACAAGCCACTCAGGCC TATGCCCAATACCAAAGCAAGCCAAGTGACCTGGAAAAGCGGATTTTC TTAATGAATCTCTTTAACGAAAACCGGACATTATTCTTCCATTTAATG GATGAACACGTGGTTGAATT Lactobacillus_brevis_LMG_11435_mleA-mleR SEQIDNO:7 CCATACAGAGCCGCCCTCAACAGTTTGCAGTCCTTCCAGCAGATTCTC AGCCTGCAATCGTGCGGCAATTCGTGGAAAATAATAATTTTCGATAAT TGGTGGCAACCCCAGCGTGGTTTGGCGAGCAGCTAAATGGGCTAGTTC TTGGTGGGCTAGCGTTAATTCACTGAGGACGACTTGGGCGTGAATGGC TAATTGCTCACCGCTCGGGGTAATTTGAATATCATTGTGTACCCGATC TCGGATGACTAATTTGGTTTCAAATTCGGTCTCTAATCGTTTGATAGC CGTGGTGATCGTGGGCTGAGTCACACCGAAGAAGGCTGCTACCTTAGA AAAATTTTTTTGTAGAATAAGCTGCTGGAAATAATCCAAATCTTTTGT ATTCATATTTTCTCCTGTCAAATCAAGGCTGATTACTACATTATAAAA TAATTTTATAACAATCGCTACGTTTGACTATAAAATTTTCAGGGCGTT ATAGTGCAATATGTAAATAAGAGCTATCCAAATTGGAGGAAAATCATG ATGACGCAAACAGCAGATACGATTTTAAATAACCCCTTCTTAAATAAA GGAACCGCGTTCACACAAGCAGAACGGCGGGAACTTGGCTTGGTTGGG ACATTGCCAGCCCAAGTTCAAACGATTGATGAACAAGCCACTCAGGCC TATGCCCAATACCAAAGCAAGCCAAGTGACCTGGAAAAGCGGATTTTC TTAATGAATCTCTTTAACGAAAACCGGACATTATTCTTCCATTTAATG GATGAACACGTGGTTGAATT Lactobacillus_brevis_LMG_11434_mleA-mleR SEQIDNO:8 CCATACAGAGCCACCCTCAACCGTTTGCAGTCCTTCCAGCAGATTCTC AGCCTGCAATCGTGCGGCAATTCGTGGAAAATAATAATTTTCGATAAT TGGTGGCAACCCCAGCGTGGTTTGGCGAGCAGCTAAATGTGCTAGTTC TTGGTGGGCTAGCGTTAATTCACTGAGGACGACTTGGGCGTGAATGGC TAGTTGCTCACCGCTCGGGGTAATTTGAATATCATTGTGTACCCGATC CCGGATGACTAATTTGGTTTCAAATTCGGTCTCTAATCGTTTGATAGC CGTGGTGATCGTGGGCTGAGTCACACCGAAGAAGGTTGCTACCTTAGA AAAATTTTTTTGTAGAATAAGCTGCTGGAAATAATCCAAATCTTTTGT ATTCATATTTTCTCCTGTCAAATCAAGGCTGATTGCTACATTATAAAA TAATTTTATAACAATCGCTACATTTGACTATAAAATTTCCAGGGCGTT ATAGTGCAATATGTAAATAAGAGCTATCCAAATTGGAGGAAAATCATG ATGACGCAAACAGCAGATACGATTTTAAATAACCCCTTCTTAAATAAA GGAACCGCGTTCACACAAGCAGAACGGCGGGAACTTGGCTTGGTTGGG ACATTGCCAGCCCAAGTTCAAACGATTGATGAACAAGCCACTCAGGCC TATGCCCAATACCAAAGCAAGCCAAGTGACCTGGAGAAGCGGATTTTC TTAATGAATCTCTTTAACGAAAACCGGACATTATTCTTCCATTTAATG GATGAACACGTGGTTGAATT Lactobacillus_brevis_LMG_11401_mleA-mleR SEQIDNO:9 CCATACAGAGCCGCCCTCAACAGTTTGCAGTCCTTCCAGCAGATTCTC AGCCTGCAATCGTGCGGCAATTCGTGGAAAATAATAGTTTTCGATAAT TGGTGGCAACCCCAGCGTGGTTTGGCGAGCAGCTAAATGGGCTAGTTC TTGGTGGGCTAGCGTTAATTCACTAAGGACGACTTGGGCGTGAATGGC TAATTGCTCACCGCTCGGGGTAATTTGAATATCATTGTGTACCCGATC CCGGATGACTAATTTGGTTTCAAATTCGGTCTCTAATCGTTTGATAGC CGTGGTGATCGTGGGCTGAGTCACACCGAAGAAGGCTGCTACCTTAGA AAAATTTTTTTGTAGAATAAGCTGCTGGAAATAATCCAAATCTTTTGT ATTCATATTTTCTCCTGTCAAATCAAGGCTAATTGCTACATTATAAAA TAATTTTATAACAATCGCTACATTTGACTATAAAATTTCCAGGGCGTT ATAGTGCAATATGTAAATAAGAGCTATCCAAATTGGAGGAAAATCATG ATGACGCAAACAGCAGATACGATTTTAAATAACCCCTTCTTAAATAAA GGAACCGCGTTCACGCAAGCAGAACGGCGGGAACTTGGCTTGGTTGGG ACATTGCCAGCCCAAGTTCAAACGATTGATGAACAAGCCACTCAGGCC TATGCTCAATACCAAAGCAAGCCAAGTGACCTGGAGAAGCGGATTTTC TTAATGAATCTCTTTAACGAAAACCGGACATTATTCTTCCATTTAATG GATGAACATGTGGTTGAATT Lactobacilllus_brevis_LMG_6906_mleA-mleR SEQIDNO:10 CCATACAGAGCCGCCCTCAACAGTTTGCAGTCCTTCCAGCAGATTCTC AGCCTGCAATCGTGCGGCAATTCGTGGAAAATAATAATTTTCGATAAT TGGTGGCAACCCCAGCGTTGTTTGGCGAGCAGCTAAATGGGCTAGTTC TTGGTGGGCTAGCGTTAATTCACTGAGGACGACTTGGGCGTGAATGGC TAATTGCTCACCGCTCGGGGTAATTTGAATATCATTGTGTACCCGATC CCGGATGACTAATTTGGTTTCAAATTCGGTCTCTAATCGTTTGATAGC CGTGGTGATCGTGGGCTGAGTCACACCGAAGAAGGCTGCTACCTTAGA AAAATTTTTTTGTAGAATAAGCTGCTGGAAATAATCCAAATCTTTTGT ATTCATATTTTCTCCTGTCAAATCAAGGCTGATTGCTACATTATAAAA TAATTTTATAACAATCGCTACATTTGACTATAAAATTTCCAGGGCGTT ATAGTGCAATATGTAAATAAGAGCTATCCAAATTGGAGGAAAATCATG ATGACGCAAACAGCAGATACGATTTTAAATAACCCCTTCTTAAATAAA GGAACCGCGTTCACACAAGCAGAACGGCGGGAACTTGGCTTGGTTGGG ACATTGCCAGCCCAAGTTCAAACGATTGATGAACAAGCCACTCAGGCC TATGCCCAATACCAAAGCAAGCCAAGTGACCTGGAGAAGCGGATTTTC TTAATGAACCTCTTTAACGAAAACCGGACATTATTCTTCCATTTAATG GATGAACATGTGGTTGAATT Lactobacillus_brevis_LMG_12023_mleA-mleR SEQIDNO:11 CATACAGAGCCGCCCTCAACAGTTTGCAGTCCTTCCAGCAGATTCTCA GCCTGCAATCGTGCGGCAATTCGTGGAAAATAATAATTTTCGATAATT GGTGGCAACCCCAGCGTGGTTTGGCGAGCAGCTAAATGGGCTAGTTCT TGGTGGGCTAGCGTTAATTCACTGAGGACGACTTGGGCGTGAATGGCT AATTGCTCACCGCTCGGGGTAATTTGAATATCATTGTGTACCCGATCT CGGATGACTAATTTGGTTTCAAATTCGGTCTCTAATCGTTTGATAGCC GTGGTGATCGTGGGCTGAGTCACACCGAAGAAGGCTGCTACCTTAGAA AAATTTTTTTGTAGAATAAGCTGCTGGAAATAATCCAAATCTTTTGTA TTCATATTTTCTCCTGTCAAATCAAGGCTGATTACTACATTATAAAAT AATTTTATAACAATCGCTACGTTTGACTATAAAATTTTCAGGGCGTTA TAGTGCAATATGTAAATAAGAGCTATCCAAATTGGAGGAAAATCATGA TGACGCAAACAGCAGATACGATTTTAAATAACCCCTTCTTAAATAAAG GAACCGCGTTCACACAAGCAGAACGGCGGGAACTTGGCTTGGTTGGGA CATTGCCAGCCCAAGTTCAAACGATTGATGAACAAGCCACTCAGGCCT ATGCCCAATACCAAAGCAAGCCAAGTGACCTGGAAAAGCGGATTTTCT TAATGAATCTCTTTAACGAAAACCGGACATTATTCTTCCATTTAATGG ATGAACACGTGGTTGAATT
[0140] For the identification of the Bacillus genus, the nucB-sigK HPME marker is used.
nucB-sigK and ycgS-ycgT- and H.P.M.E. Marker for the Bacillus Genus
[0141] Bacillus subtilis subsp. subtilis str. NCIB 3610 chromosome, whole genome shotgun sequence, NCBI Accession number gi|223666305:2651588-2652664
[0142] Bacillus subtilis DNA, 283 Kb region containing skin element gi|2627063:66148-67224
[0143] Bacillus subtilis subsp. subtilis str. OH 131.1, complete genome, NCBI Accession number gb|CP007409.1|:2505351-2506295
[0144] Bacillus subtilis strain SG6, complete genome, NCBI Accession number gb|CP009796.1|:2530873-2531818
[0145] >Bacillus subtilis strain T30, complete genome, NCBI Accession number gb|CP011051.1|:453835-454784
[0146] Bacillus tequilensis KCTC 13622 contig34, whole genome shotgun sequence, NCBI Accession number gb|AYTO01000034.1|:238817-239821
[0147] Bacillus tequilensis strain FJAT-14262a Scaffold3, whole genome shotgun sequence, NCBI Accession number gb|LGRW01000003.1|:526637-527582
[0148] Bacillus vallismortis strain B4144_201601 NODE_52, whole genome shotgun sequence, NCBI Accession number gb|LQYR01000021.1|:335392-335821
[0149] Bacillus vallismortis DV1-F-3 scf7180000000938_1, whole genome shotgun sequence, NCBI Accession number gb|AFSH01000080.1|:61061-62135
[0150] Bacillus subtilis subsp. spizizenii str. W23, complete genome, NCBI Accession number gb|CP002183.1|:2508422-2509371
[0151] Bacillus subtilis subsp. spizizenii strain NRS 231, complete genome, NCBI Accession number gb|CP010434.1|:2508413-2509362
[0152] Bacillus subtilis subsp. spizizenii TU-B-10, complete genome, NCBI Accession number gb|CP002905.1|:2633479-2634424
[0153] Bacillus subtilis subsp. inaquosorum KCTC 13429 14.BSI.1_2, whole genome shotgun sequence, NCBI Accession number gb|AMXN01000002.1|:219554-220502
[0154] Bacillus atrophaeus 1942, complete genome, NCBI Accession number gb|CP002207.1|:2171410-2171836
[0155] Bacillus atrophaeus strain NRS 1221A, complete genome, NCBI Accession number gb|CP010778.1|:2096769-2097195
[0156] Bacillus atrophaeus UCMB-5137 genome, NCBI Accession number gb|CP011802.1|:2146753-2147182
[0157] Bacillus siamensis strain SRCM100169 contig00001, whole genome shotgun sequence, NCBI Accession number gb|LYUE01000001.1|:378573-379007
[0158] Bacillus siamensis KCTC 13613 contig41, whole genome shotgun sequence, NCBI Accession number gb|AJVF01000041.1|:425488-425922
[0159] Bacillus cereus genome assembly Bacillus JRS1, contig contig000619, whole genome shotgun sequence, NCBI Accession number gi|924105349:1135-2083
[0160] Bacillus mojavensis RRC 101 contig_72, whole genome shotgun sequence, NCBI Accession number gb|ASJT01000072.1|:62201-63276
[0161] Bacillus siamensis strain SRCM100169 contig00001, whole genome shotgun sequence, NCBI Accession number gb|LYUE01000001.1|:377399-378922
[0162] Bacillus amyloliquefaciens strain JJC33M contig_2, whole genome shotgun sequence, NCBI Accession number gb|JTJG01000002.1|:175026-176555
[0163] Bacillus amyloliquefaciens subsp. plantarum str. FZB42, complete genome, NCBI Accession number gi|154684518:116761-117992
[0164] Bacillus licheniformis ATCC 14580, complete genome, NCBI Accession number gi|163119169:2425104-2426659
[0165] Bacillus subtilis subsp. subtilis str. 168 chromosome, complete genome, NCBI Accession number gi|255767013:351842-353868
[0166] The tkt-hrcA target sequence is used for the identification of the Bifidobacteria genus.
TkthrcA H.P.M.E. Marker for the Bifidobacterium Genus
[0167] Bifidobacterium animalis subsp. animalis ATCC 25527, NCBI Accession number gb|CP002567.1|:975534-978937
[0168] Bifidobacterium animalis subsp. lactis DSM 10140, NCBI Accession number gb|CP001606.1|:964067-967480
[0169] Bifidobacterium breve DSM 20213=JCM 1192, NCBI Accession number gi|781874447:1141916-1145382 DNA
[0170] Bifidobacterium longum subsp. infantis ATCC 15697, NCBI Accession number gb|CP001095.1|:c1287218-1283617
[0171] Bifidobacterium longum subsp. longum JCM 1217 DN, NCBI Accession number gi|320455049:1275719-1279320 A
[0172] Bifidobacterium longum subsp. suis strain LMG 21814 Contig32, NCBI Accession number gb|JGZA01000032.1|:c3691-90
[0173] The mleA-mleR/mleS-yjcA/mae-citR target sequences are used for the identification of respectively the Oenococcus genus, the Lactobacillus genus and the Streptococcus genus, Enterococcus genus, the Pediococcus genus, the Lactococcus genus, the Fructobacillus genus, the Leuconostoc genus, and the Weissella genus.
mleA-mleR and mleS-yjcA and Mae-citR H.P.M.E. Markers for Lactic Acid Bacteria
[0174] Oenococcus oeni mleR, mleA, mleP genes for malolactic regulator, malolactic enzyme, malate permease, complete cds, strain: ATCC 39401, NCBI Accession number gi|75755624:147-2748
[0175] Oenococcus oeni PSU-1, complete genome, NCBI Accession number gill 16490126:1481086-1483687
[0176] Oenococcus oeni strain L7 malolactic enzyme gene, partial sequence, NCBI Accession number gb|HM101476.1|:8-950
[0177] Oenococcus kitaharae DSM 17330 chromosome, whole genome shotgun sequence, NCBI Accession number gi|372325750:114550-117167
[0178] Oenococcus alcoholitolerans strain UFRJ-M7.2.18 contig00329, whole genome shotgun sequence, NCBI Accession number gb|AXCV01000329.1|:57-486
[0179] Oenococcus alcoholitolerans strain UFRJ-M7.2.18 contig00674, whole genome shotgun sequence, NCBI Accession number gb|AXCV01000674.1|:4-514
[0180] Lactobacillus plantarum strain HFC8, complete genome, NCBI Accession number gb|CP012650.1|:2763364-2764968
[0181] Lactobacillus acidophilus strain ATCC 4356 scaffold12, whole genome shotgun sequence, NCBI Accession number gb|JRUT01000012.1|:40982-42345
[0182] Lactobacillus brevis ATCC 367, complete genome, NCBI Accession number gi|116332681:2167769-2170426
[0183] Lactobacillus sakei subsp. sakei DSM 20017=JCM 1157 DNA, contig: JCM1157.contig00016, whole genome shotgun sequence, NCBI Accession number gi|602598706:22115-23744
[0184] Lactobacillus sakei subsp. carnosus DSM 15831 NODE_99, whole genome shotgun sequence, NCBI Accession number gb|AZFG01000065.1|:3788-5579
[0185] Lactobacillus curvatus JCM 1096=DSM 20019 Scaffold76, whole genome shotgun sequence, NCBI Accession number gb|AZDL01000076.1|:2749-4554
[0186] Lactobacillus reuteri ATCC 53608, WGS project CACS02000000 data, strain ATCC 53608, contig00039, whole genome shotgun sequence, NCBI Accession number gi|332795655:20606-21850
[0187] Streptococcus salivarius strain 140_SSAL 1318_7248_129091_927_,567+, whole genome shotgun sequence, NCBI Accession number gb|JVSQ01000113.1|:2755-4031
[0188] Streptococcus infantarius subsp. infantarius ATCC BAA-102 S_infantarius-2.0.1_Cont294, whole genome shotgun sequence, NCBI Accession number gb|ABJK02000006.1|:3337-9360
[0189] Lactobacillus casei ATCC 334, complete genome, NCBI Accession number gb|CP000423.1|:736033-739024
[0190] Lactobacillus casei DSM 20011=JCM 1134 strain DSM 20011 Scaffold4, whole genome shotgun sequence, NCBI Accession number gb|AZCO01000004.1|:131693-134684
[0191] Lactobacillus paracasei subsp. paracasei ATCC 25302 contig00157, whole genome shotgun sequence, NCBI Accession number gb|ACGY01000115.1|:13771-16764
[0192] Lactobacillus paracasei subsp. tolerans DSM 20258 Scaffold70, whole genome shotgun sequence, NCBI Accession number gb|AYYJ01000070.1|:3517-6357
[0193] Lactobacillus rhamnosus DSM 20021=JCM 1136=NBRC 3425 strain DSM 20021 Scaffold19, whole genome shotgun sequence, NCBI Accession number gb|AZCQ01000019.1|:42815-45783
[0194] Enterococcus faecium PC4.1 contig00071, whole genome shotgun sequence, NCBI Accession number gb|ADMM01000043.1|:33742-35015
[0195] Pediococcus damnosus LMG 28219 R50501_77, whole genome shotgun sequence, NCBI Accession number gb|JANK01000077.1|:2123-3916
[0196] Streptococcus salivarius strain 918_SSAL 573_13617_118049, whole genome shotgun sequence, NCBI Accession number gb|JUNV01000175.1|:10189-11803
[0197] Streptococcus infantarius subsp. infantarius CJ18, complete genome gb|CP003295.1|:1775490-1777111
[0198] Lactococcus lactis subsp. lactis 111403, complete genome, NCBI Accession number gb|AE005176.1|:919808-923388
[0199] Lactococcus lactis subsp. cremoris SK11, complete genome, NCBI Accession number gb|CP000425.1|:916691-920278
[0200] Lactococcus lactis subsp. cremoris NZ9000, complete genome, NCBI Accession number gb|CP002094.1|:1616128-1619715
[0201] Lactococcus lactis subsp. cremoris UC509.9, complete genome, NCBI Accession number gb|CP003157.1|:926472-930058
[0202] Lactococcus lactis subsp. cremoris A76, complete genome, NCBI Accession number gb|CP003132.1|:1521201-1524788
[0203] Lactococcus lactis subsp. cremoris KW2, complete genome, NCBI Accession number gb|CP004884.1|:891400-894986
[0204] Fructobacillus ficulneus DNA, contig: contig024, strain: JCM 12225, whole genome shotgun sequence, NCBI Accession number gi|850933810:24923-26399
[0205] Fructobacillus tropaeoli DNA, contig: contig019, strain: F214-1, whole genome shotgun sequence, NCBI Accession number gi|850934400:64455-65931
[0206] Fructobacillus fructosus KCTC 3544 strain DSM 20349 Scaffold5, whole genome shotgun sequence, NCBI Accession number gb|JQBH01000005.1|:29797-31268
[0207] Pediococcus damnosus strain TMW 2.1534 plasmid pL21534-4, complete sequence, NCBI Accession number gb|CP012287.1|:3965-6514
[0208] Leuconostoc mesenteroides DNA, contig: LMDMO_40, strain: 213M0, whole genome shotgun sequence, NCBI Accession number gi|953966517:15883-17346
[0209] Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293, complete genome, NCBI Accession number gb|CP000414.1|:1004431-1005894
[0210] Weissella koreensis KACC 15510, complete genome, NCBI Accession number gb|CP002899.1|:1390746-1392204
[0211] Enterococcus faecium strain ATCC 700221, complete genome, NCBI Accession number gb|CP014449.1|:2071582-2073044
[0212] Oenococcus oeni PSU-1, complete genome, NCBI Accession number gill 16490126:402339-404605
[0213] Lactobacillus casei ATCC 334, complete genome, NCBI Accession number gb|CP000423.1|:2847899-2852959
[0214] Lactobacillus casei DSM 20011=JCM 1134 strain DSM 20011 Scaffold40, whole genome shotgun sequence, NCBI Accession number gb|AZCO01000040.1|:6211-11271
[0215] Lactobacillus paracasei subsp. paracasei ATCC 25302 contig00006, whole genome shotgun sequence, NCBI Accession number gb|ACGY01000003.1|:1-3751
[0216] Lactobacillus rhamnosus DSM 20021=JCM 1136=NBRC 3425 strain DSM 20021 Scaffold17, whole genome shotgun sequence, NCBI Accession number gb|AZCQ01000017.1|:1057-5965
H.P.M.E. hrcA-grpE Marker for the Bacillus Genus
[0217] Bacillus subtilis strain NCIB 3610, NCBI Accession number NZ_CP020102.1:c2629658-2627992
[0218] Bacillus subtilis subsp. spizizenii TU-B-10, NCBI Accession number CP002905.1:2608986-2610652
[0219] Bacillus subtilis subsp. inaquosorum KCTC 13429, NCBI Accession number AMXN01000002.1:195028-196694
[0220] Bacillus amyloliquefaciens subsp. plantarum str. FZB42, NCBI Accession number CP000560.1:2497484-2499150
[0221] Bacillus licheniformis ATCC 14580, NCBI Accession number NC_006270.3:2636182-2637876
[0222] Bacillus megaterium NBRC 15308=ATCC 14581 strain NBRC 15308, NCBI Accession number NZ_BCVB01000008.1:62018-63712
[0223] Bacillus mojavensis RO-H-1=KCTC 3706 contig30, NCBI Accession number gi|5656237311gb|AYTL01000030.1|:510964-512631
[0224] Bacillus vallismortis DV1-F-3 scf7180000000938_1, NCBI Accession number gi|3739587551gb|AFSH01000080.1|:37469-39135
[0225] Bacillus cereus ATCC 14579 chromosome, NCBI Accession number NC 004722.1:4255895-4257592
H.P.M.E. TkthrcA Marker for the Bifidobacterium Genus
[0226] Bifidobacterium bifidum ATCC 29521=JCM 1255=DSM 20456 strain ATCC 29521 B_bifidumBIFBIF-1.0_Cont48.4, NCBI Accession number AWSW01000046.1:33043-36754
H.P.M.E. rsmD-ftsY Marker for the Rickettsiella Genus
[0227] Rickettsiella grylli gcontig_637, whole genome shotgun sequence, NCBI Accession number AA0J02000001.1:605954-607684
[0228] Rickettsiella grylli strain TrM1 contig_822, NCBI Accession number MCRF01000441.1:2072-3802
[0229] Candidatus Rickettsiella isopodorum strain RCFS May 2013 383, NCBI Accession number LUKY01000027.1:36370-38097
H.P.M.E. ftsY-rubA Marker for the Rickettsiella Genus
[0230] Rickettsiella grylli gcontig_637, NCBI Accession number AAQJ02000001.1:606695-607975
[0231] Rickettsiella grylli strain TrM1 contig_822, NCBI Accession number MCRF01000441.1:1872-3094
[0232] Candidatus Rickettsiella isopodorum strain RCFS May 2013 383, NCBI Accession number LUKY01000027.1:37144-38097
[0233] According to a one aspect of the invention, the target sequence comprising the genes coding for Malolactic Enzyme (known as mleA or mleS) and the Malolactic Enzyme Regulator, a lysR-type transcriptional regulator (mleR), shortened to mleA-mleR target, oriented on opposite direction on two DNA strands, is applied to detect, to differentiate and to identify all the bacterial species within a genus thanks to the sequence polymorphism.
[0234] According to yet another aspect of the invention, a nucleotide stretch comprised in the target sequence including the mleA (mleS) and mleR genes and conserved in at least three species of the Oenococcus genus, i.e. Oenococcus oeni, Oenococcus kitaharae and Oenococcus alcoholitolerans, is used to design one genus-specific oligonucleotides. More in detail two DNA sequences conserved in the genus Oenococcus are used to design a primer pair with degenerated nucleotides according IUPAC nomenclature for the amplification of about 1 100 bp PCR product for further Sanger sequencing using the same primers singly.
[0235] According to yet another aspect of the invention, two nucleotide stretches comprised in the mleA-mleR target and conserved in the three species of the Oenococcus genus, i.e. Oenococcus oeni, Oenococcus kitaharae and Oenococcus alcoholitolerans, is used to design genus-specific oligonucleotide pairs to be used as primers in PCR-based techniques for ecological/population studies both culture-dependent and culture-independent. In three different PCR-based protocols, the length polymorphism of the mleA-mleR target is used to differentiate and to identify all the three species belonging to the Oenococcus genus. In the fourth PCR-based protocols, the sequence polymorphism of the mleA-mleR target is mainly used to differentiate and to identify all the three species belonging to the Oenococcus genus.
[0236] More in detail, in the first protocol based on length polymorphism of the mleA-mleR target within the Oenococcus genus, the PCR products is obtained by amplifying with a primer pair, possibly with degenerate nucleotides according IUPAC nomenclature, and one of which is fluorescent marked, i.e. FAM marked forward primer. Genomic DNA purified from both pure cultures and from a mixture of strains can be used as template in the PCR reaction. Fluorescent marked PCR products are separated and detected by means of capillary electrophoresis thus allowing the identification of each pure culture and of the components of the mixture of different species.
[0237] In the second protocol based on length polymorphism of the mleA-mleR target within the Oenococcus genus, the PCR products is obtained by amplifying with a primer pair, possibly with degenerate nucleotides according IUPAC nomenclature. Genomic DNA purified from both pure cultures and from a mixture of different strains can be used as template in the PCR reaction. PCR products are digested by a specific restriction enzyme (RE), i.e. Hae III, and the resulting products are separated and detected by agarose gel electrophoresis, thus allowing the identification of each pure culture and the identification of the components in the mixture of different species thanks to the comparison with the profile of each pure culture.
[0238] In the third protocol based on length polymorphism of the mleA-mleR target within the Oenococcus genus, a combination of the previous two protocols is applied, as the PCR products obtained by amplifying with a primer pair, possibly with degenerate nucleotides according IUPAC nomenclature, and one of which is fluorescent marked are digested by a specific restriction enzyme (RE), i.e. Hae III. Fluorescent marked PCR products, digested by the RE are separated and detected by means of capillary electrophoresis thus allowing the identification of each pure culture and of the components of the mixture of different species.
[0239] In the fourth PCR-based protocol sequence polymorphisms of the mleA-mleR target within the Oenococcus genus are detected, as the obtained PCR products are further analyzed by Denaturing Gradient Gel Electrophoresis (DGEE) in a Polyacrylamide gel containing a formamide gradient which denature and differentiate the PCR products depending on their sequence. The primers applied in this protocol must not to show degenerate nucleotides according IUPAC nomenclature, otherwise artifacts are generated because also sequence polymorphisms in the primer region affect PCR product denaturation in formamide gradient. Genomic DNA purified from both pure cultures and from a mixture of strains can be used as template in the PCR reaction, thus allowing the identification of each pure culture and of the components of the mixture of different species.
[0240] According to yet another aspect of the invention, a nucleotide stretch comprised in the mleA-mleR target and conserved in at least three species of the Oenococcus genus, i.e. Oenococcus oeni, Oenococcus kitaharae and Oenococcus alcoholitolerans, is used to design one genus-specific oligonucleotides or a xeno-nucleic acid aptamers to be applied as a probe for the quantification with different technologies such as qPCR, FISH, flow-cytofluorimetry, FISH-FLOW.
[0241] According to yet another aspect of the invention, the Oenococcus genus-specific probe is a oligonucleotide or xeno-nucleic acid aptamer modified with a fluorescent molecule and optionally also with a quencher molecule to be applied together with species-specific primer pairs designed in variable regions, to quantify each species by separately qPCR, but using only one probe.
[0242] According to yet another aspect of the invention a genus-specific primer pair probe is coupled with species-specific oligonucleotides or xeno-nucleic acid aptamers modified with a fluorescent molecule and optionally also with a quencher molecule to be applied together to quantify each species thanks to a multiplexed qPCR.
[0243] According to yet another aspect of the invention, the length polymorphism of the mleA-mleR target showed to be a suitable and robust characteristic to differentiate and identify species belonging to the Lactobacillus casei group, i.e. Lactobacillus casei, Lactobacillus paracasei subsp. paracasei, Lactobacillus paracasei subsp. tolerans, Lactobacillus rhamnosus, that are very related from a phylogenetical view-point, and for this reason the methods based on the ribosomal RNA operon sequence analysis are poorly discriminatory, especially when they are mix together. More in detail, a newly design degenerate primer pair allow to differentiate and identify L. casei, L. paracasei and L. rhamnosus by means of an agarose gel electrophoresis. The two subspecies of L. paracasei show the same PCR product dimension.
[0244] According to a one aspect of the invention, the target sequence comprising the genes coding for Malolactic Enzyme (known as mleA or mleS) and the Malolactic Enzyme Regulator, a lysR-type transcriptional regulator (mleR) is applied to detect, to differentiate and to identify bacterial species belonging to different Lactic Acid Bacteria genus such as Lactobacillus, Lactococcus, Leuconostoc, Oenococcus, Pediococcus, Streptococcus.
[0245] According to yet another aspect of the invention, a nucleotide stretch conserved in at least two different genus, such as the nonamer TTTGACTAT that is comprised in the previously defined mleA (mleS) and mleR target sequence and it is located in the inter-genic region corresponding to the promoter of the mleA gene, is used to design oligonucleotide or xeno-nucleic acid aptamer, such as an LNA oligonucleotide, and applied as an universal probe together with species-specific primer pairs to detect and quantify several Lactic Acid Bacteria species.
[0246] According to yet another aspect of the invention, the target sequence including the mleA (mleS) and mleR genes can be Sanger sequenced, aligned and analyzed to differentiate strains belonging to the same species, such as Oenococcus oeni and Lactobacillus brevis. The target sequence including mleA and mleR genes, therefore become a DNA barcode for strain typing and/or one additional locus for MultiLocus Sequence Analysis (MLSA) and/or MultiLocus Sequence Typing (MLST).
[0247] In another aspect of the invention, the target sequence comprising the Citrate Lyase gene cluster and especially the gene coding for Oxaloacetate Decarboxylase which is related to soluble Malate Decarboxylase (known as mae) and transcriptional regulator (citR), shortened to mae-citR target, oriented on opposite direction on two DNA strands, is applied to detect, to differentiate and to identify bacterial species thanks both to the sequence polymorphism and length polymorphism.
[0248] According to yet another aspect of the invention the mae-citR target sequence is used to differentiate, to identify and to quantify Leuconostoc mesenteroides subsp. cremoris and Leuconostoc mesenteroides subsp. dextranicum.
[0249] According to yet another aspect of the invention, the mae-citR target and mleA-mleR target are used together in multiplexed protocols to differentiate, to identify and to quantify bacteria, such as cocci from dairy products, from wine-related environment, from pharmaceutical products and from dietary-suppliers belonging to the genus Lactococcus, Leuconostoc, Oenococcus, Pediococcus Streptococcus.
[0250] In another aspect of the invention, the target sequence comprising the genes coding for Transketolase (known as tkt) and the Heat-inducible Transcription Repressor (hrcA), shortened to tkt-hrcA target, oriented on opposite direction on two DNA strands, is applied to detect, to differentiate and to identify bifidobacteria thanks to both the sequence polymorphism and length polymorphism.
[0251] According to yet another aspect of the invention the tkt-hrcA target sequence is applied to differentiate, identify and quantify the species Bifidobacterium animalis subsp. animalis, Bifidobacterium animalis subsp. lactis, Bifidobacterium breve, Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis and Bifidobacterium longum subsp. suis.
[0252] According to yet another aspect of the invention the tkt-hrcA target sequence is applied to differentiate and identify the subspecies Bifidobacterium animalis subsp. animalis, Bifidobacterium animalis subsp. lactis, thanks to length polymorphism, due to a difference of 12 nucleotides in the region in-between the tkt and hrcA corresponding to the gene promoter.
[0253] According to yet another aspect of the invention, a nucleotide stretch conserved in at least three different species of the Bifidobacterium genus, i.e. Bifidobacterium animalis subsp. animalis, Bifidobacterium animalis subsp. lactis, Bifidobacterium breve, Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis and Bifidobacterium longum subsp. suis such as the 9-mer ACAAGCCGG, GAGTGCTAAT (SEQ ID NO: 25) the 11-mer AACACGCCAAA (SEQ ID NO: 23) and the two 15-mer ATTGGAAGGAAAGTA (SEQ ID NO:24) ATTGTATTAGCACTC (SEQ ID NO: 26) that is comprised in the previously defined tkt-hrcA target sequence and it is located in the inter-genic region corresponding to the promoter of the tkt gene, is used to design oligonucleotide or xeno-nucleic acid aptamer, such as an LNA oligonucleotide, and it is applied as an Bifidobacterium-specific probe together with species-specific primer pairs to detect and quantify bifidobacteria.
[0254] In another aspect of the invention, the target sequence comprising the genes coding for the Extracellular Nuclease involved in Sporulation and Transcriptional Sigma Factor 70, shortened to ens-sf70 target, oriented on opposite direction on two DNA strands, is applied to detect, to differentiate and to identify bacterial species within the Bacillus genus thanks to the sequence polymorphism and length polymorphism.
[0255] In another aspect of the invention, the target sequence comprising the genes coding for the Primase and NAD(P) Tranhydrogenase subunit Alpha oriented on opposite direction on two DNA strands, is applied to detect, to differentiate and to identify bacterial species within the Acetic Acid Bacteria and especially those belonging to the genus Gluconobacter thanks to the sequence polymorphism and length polymorphism. According to yet another aspect of the invention the above cited target sequences are applied together in multiplexed protocols and applications in order to enhance the capacity to differentiate to identify and the quantify different Taxa from different sources, such as environmental samples, water samples, soil samples, plant-related samples, dairy products, wine-related environment, dough, sourdough, fermented food, fermented beverage, fecal samples, pharmaceutical products and dietary-suppliers.
[0256] The characteristics of the invention is dramatically distinct from known markers applied for the differentiation, identification and quantification of microorganisms and viruses. The method to use genetic markers invented here guarantee indeed both specificity and also robustness. Two levels of specificity allow to use the molecular markers gene for identification and quantification of related species also in mixture, avoiding mis-identifications and false-positive results, even using primers and probes designed on conserved sequences in phylogenetically far related microorganisms such as those belonging to Lactococcus and Oenococcus genus.
[0257] Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.
EXAMPLES
[0258] Reference is now made to the following examples, which together with the above descriptions illustrate some embodiments of the invention.
Example 1
Example 1: Sanger Sequencing of the H.P.M.E. Marker, Preferably Represented in the Oenococcus Genus by the H.P.M.E. mleA-mleR Marker, Followed by the Alignment and the Comparison with the Homologous H.P.M.E. mleA-mleR Marker of Oenococcus oeni Oenococcus kitaharae and Oenococcus alcoholitolerans
[0259] One preferred form of the H.P.M.E. marker is represented in the Oenococcus genus by a target sequence comprising: a) the mleA gene coding for Malolactic Enzyme; b) the mleR gene coding for the Malolactic Enzyme Regulator. i.e. a lysR family transcriptional regulator, oriented in opposite direction from the mleA gene on the complementary strand of the DNA; c) the region corresponding to the gene trascriptional promoter that is between the mleA gene and the mleR gene previously described.
[0260] The H.P.M.E. mleA-mleR marker for the species Oenococcus oeni is represented in the preferred form by the sequence of the strain Oenococcus oeni PSU-1 (gi|116490126:1481086-1483687) and for the species Oenocococcus kitaharae is represented in the preferred form by Oenococcus kitaharae DSM 17330 (gi|372325750:114550-117167).
[0261] The H.P.M.E. mleA-mleR marker for the species O. alcoholitolerans was obtained by Sanger sequencing with one of the four primers applied in two possible PCRs, one of which is characterized by the use of primers with degenerated nucleotide sites, according the IUPAC nomenclature.
[0262] The first PCR is applied with the primer OEX_mleR_F1_seq, which sequence is AAATAATAATTACCAATGATTTGCGG (SEQ ID NO: 12) and OEX_mle-R1_seq, which sequence is ATACCAGTTCCCTGAATATCATC (SEQ ID NO: 13);
[0263] The second PCR is characterized by the use of primers with degenerated nucleotide sites according the IUPAC nomenclature: OEX_mleR_FN_seq, which sequence is AARTAAWAATTWCCRATDATYTGCGG (SEQ ID NO: 14); and OEX_mle-RN_seq, which sequence is ATWCCDGTDCCYTGRATATCATC (SEQ ID NO: 15).
[0264] The conditions were same for both the PCRs: the reaction was performed in 20 l volume using 1 U of DNA polymerase GoTaq (Promega) in 1 buffer with addition of magnesium chloride (MgCl.sub.2) at the final concentration of 1.5 mM and tri-phosphate nucleotides (dNTPs) at the final concentration of 0.2 mM each. The concentration of the primer was 1 M each. Amplification was in the Nexus Mastercycler Gradient instrument (Eppendorf) with a thermal program consisting of an initial denaturation step at 94 C. for 5 minutes followed by one cycle at 94 C. for 30 seconds, 54 C. for 30 seconds and 72 C. for 60 seconds, repeated 35 times, followed by a final extension step at 72 C. for 10 minutes. About 20 ng of purified genomic DNA from the strain Oenococcus alcoholitolerans LMG 27599 was applied as template DNA in the PCR. The PCR product was purified and sequenced according Sanger reaction protocol.
[0265] The resulting sequence of the H.P.M.E. mleA-mleR marker for the species O. alcoholitolerans was aligned and compared with the homologous region of the H.P.M.E. mleA-mleR marker of O. oeni and O. kitaharae (
[0266] The sequence similarity between O. oeni and O. kitaharae is 72.04%, the sequence similarity between O. oeni and O. alcoholitolerans is 71.04% and the sequence similarity between O. kitaharae and O. alcoholitolerans is 71.69%.
[0267] The analysis of the alignment (
Example 2: Differentiation and Identification of the Species within the Oenococcus Genus by Capillary Electrophoresis of Labelled PCR Products, Obtained with Primers Designed on the H.P.M.E. mleA-mleR Marker, Comprising Insertions/Deletions in the Promoter Region
[0268] The DNA extracted from the pure cultures of O. oeni, O. kitaharae and O. alcoholitolerans was amplified with two different PCR protocols.
[0269] The PCR was carried out with the primer OeX_mleR_68-F2, which sequence is GTCGGTTGGCTGACATTGAAAAAA (SEQ ID NO:16) and OeX_mleA_01-R1, which sequence is TTTAAAATACCTACTGGATCTGTCAT (SEQ ID NO:17) and it was modified with the addition of FAM fluorescent dye.
[0270] The reaction was performed in 20 l volume using 1 U of DNA polymerase GoTaq (Promega) in 1 buffer with addition of magnesium chloride (MgCl.sub.2) at the final concentration of 1.5 mM and tri-phosphate nucleotides (dNTPs) at the final concentration of 0.2 mM each. The concentration of the primer was 1 M each. Amplification was in the Nexus Mastercycler Gradient instrument (Eppendorf) with a thermal program consisting of an initial denaturation step at 94 C. for 5 minutes followed by one cycle at 94 C. for 30 seconds, 59 C. for 30 seconds and 72 C. for 45 seconds, repeated 35 times, followed by a final extension step at 72 C. for 10 minutes.
[0271] The same protocol was repeated also with the DNA purified from mixed culture of O. oeni and O. kitaharae, O. oeni and O. alcoholitolerans, O. kitaharae and O. alcoholitolerans, and finally the mixed culture of all the three species belonging to the genus Oenococcus. The amplification was followed by separation and detection of the PCR products by capillary electrophoresis using the filter D: and ROX as an internal reference. The profile analysis in the capillary was performed with the Peak Scanner 2.0 software with the following parameters: size standard: GS500 (250) and analysis method: default sizingNPP. The results of the detection are reported in Table 1 and clearly show that the three species are characterized by different size of the amplified region, as expected by in-silico analysis (
[0272] The three peaks specific for O. oeni O. kitaharae and O. alcoholitolerans were clearly detected also in the mixed culture of all the three species together (
[0273] This example show that the stretches of conserved sequences found in the H.P.M.E. mleA-mleR marker can be used to design primers that successfully amplify all the target samples. Moreover the insertion or the deletion observed in the region of the H.P.M.E. mleA-mleR marker corresponding to the gene promoter can be successfully applied in a detection method to differentiate and identify Oenococcus spp. strains both in pure and in mixed cultures on the basis of length polymorphism.
TABLE-US-00002 TABLE 1 Results obtained by capillary electrophoresis for the labelled PCR products from pure cultures and mixed cultures of species belonging to Oenococcus genus. PCR1 product Sample size (bp) O. oeni DSM 20252 199 O. kitaharae DSM 17330 200 O. alcoholitolerans LMG 27599 204 O. oeni DSM 20252 and O. kitaharae DSM 17330 199, 200 O. oeni DSM 20252 and O. alcoholitolerans LMG 27599 199, 204 O. kitaharae DSM 17330 and O. alcoholitolerans 200, 204 LMG 27599 O. oeni DSM 20252, O. kitaharae DSM 17330 and 199, 200, 204 O. alcoholitolerans LMG 27599
Example 3: Differentiation and Identification of the Species within the Oenococcus Genus by PCR-RFLP by Agarose Gel Electrophoresis, Obtained with Primers Designed on the H.P.M.E. mleA-mleR Marker
[0274] PCR-RFLP is a molecular biology technique developed to differentiate and to compare different samples on the basis of the differences in nucleotide sequence of a specific and variable genetic target, which is amplified by PCR. The differences in the nucleotide sequence between the samples are detected indirectly thanks to a digestion with a Restriction Enzyme that recognize and cut the PCR product in specific short palindromic sequences. The target sequence of the Restriction Enzyme Hae III, used in this example, is GGCC. PCR products characterized by different sequences and a different number of target sequence, show different profiles after the digestion with the same enzyme
[0275] The DNA extracted from the pure cultures of O. oeni, O. kitaharae and O. alcoholitolerans was amplified with two different PCR protocols.
[0276] The PCR was carried out with the primer OeX_mleR_68-F2, which sequence is GTCGGTTGGCTGACATTGAAAAAA (SEQ ID NO:16) and OeX_mleA_244-RN, which sequence is CRATYGGCATRAATTCAACMACRTG (SEQ ID NO:18) and it is characterized by the presence of degenerated nucleotides according the IUPAC nomenclature.
[0277] The reaction was performed in 20 l volume using 1 U of DNA polymerase GoTaq (Promega) in 1 buffer with addition of magnesium chloride (MgCl.sub.2) at the final concentration of 1.5 mM and tri-phosphate nucleotides (dNTPs) at the final concentration of 0.2 mM each. The concentration of the primer was 1 M each. Amplification was in the Nexus Mastercycler Gradient instrument (Eppendorf) with a thermal program consisting of an initial denaturation step at 94 C. for 5 minutes followed by one cycle at 94 C. for 30 seconds, 59 C. for 45 seconds and 72 C. for 60 seconds, repeated 30 times, followed by a final extension step at 72 C. for 10 minutes.
[0278] The same protocol was repeated also with the DNA purified from mixed culture of O. oeni and O. kitaharae, O. oeni and O. alcoholitolerans, O. kitaharae and O. alcoholitolerans, and finally the mixed culture of all the three species belonging to the genus Oenococcus. The amplification was followed by digestion with the Restriction Enzyme Hae III, according the instruction of the producer. The digested PCR products were analysed by electrophoresis on a 3% agarose gel. The result (
[0279] This example shows that nucleotide stretches in the H.P.M.E. mleA-mleR marker, that are characterized by low variability in the three species of the Oenococcus genus, can be used to design new primers with degenerate nucleotide according IUPAC nomenclature. In this specific case the new primer is OeX_mleA_244-RN which was combined with the previously tested OeX_mleR_68-F2 to successfully amplify all the target samples.
[0280] Moreover the high sequence variability shown by H.P.M.E. mleA-mleR marker (Example 1) was confirmed indirectly thanks to the digestion with the Restriction Enzyme and it was successfully applied to differentiate and identify Oenococcus spp. strains both in pure and in mixed cultures on the basis of sequence polymorphism.
Example 4: Differentiation of all the Species of the Oenococcus Genus Present in a Mixture by PCR-DGGE, a Metagenomics Technique for Culture-Independent Ecological Studies, Using a Primer Pair Designed on the H.P.M.E. mleA-mleR Marker, Adapted for this Purpose
[0281] Denaturing Gradient Gel Electrophoresis, known also as PCR-DGGE, is a molecular biology technique developed to differentiate bacterial species in a mixture on the basis of the nucleotide sequence of a specific target amplified by PCR, thanks to an electrophoresis migration in a denaturing gel containing a variable Formamide concentration. One primer is modified with addition of a GC clamp, i.e. a strand of DNA rich in Guanine and Cytosine that is long about 40 bp, which is not denatured by the working concentration of Formamide. PCR products loaded on the electrophoresis gel are denatured by Formamide, depending on their nucleotide composition. The GC-clamp blocks the migration of the PCR products whenever they have been denatured by Formamide, generating a profile of DNA bands that display the number of the microbial components of the initial sample that are amplified by PCR (usually the microbial components represented by less than 1% of the total microbial population are not detected).
[0282] The PCR has been carried out with the forward primer OeX_mleR_68-F2-GC, which sequence is GTCGGTTGGCTGACATTGAAAAAA (SEQ ID NO:16) and it was modified with the addition of a GC clamp rich in Guanine and Cytosine according Walter et al. (2000). The primer reverse was OeX_mleA_01-R, that is TTTAAAATACCTACTGGATCTGTCAT (SEQ ID NO:17).
[0283] The reaction was performed in 20 l volume using 1 U of DNA polymerase GoTaq (Promega) in 1 buffer with addition of magnesium chloride (MgCl.sub.2) at the final concentration of 1.5 mM and tri-phosphate nucleotides (dNTPs) at the final concentration of 0.2 mM each. The concentration of the primer was 1 M each.
[0284] Amplification was in the Nexus Mastercycler Gradient instrument (Eppendorf) with a thermal program consisting of an initial denaturation step at 94 C. for 5 minutes followed by one cycle at 94 C. for 30 seconds, 54 C. for 30 seconds and 72 C. for 45 seconds, repeated 30 times, followed by a final extension step at 72 C. for 5 minutes.
[0285] The Formamide concentration in the denaturing polyacrylamide gel was ranging from 20% to 40%, starting from stock solutions prepared according Walter et al. (2000). The electrophoretic run was carried out in a DCode system (BioRad) with a warm-up step at 90V for 10 minutes, followed by a run at 50V for 16 hours.
[0286] A the end of the run, DNA bands were stained with a UV-fluorescent DNA double helix intercalating molecule.
[0287] The gel picture in
[0288] Thanks to the specific mobility pattern, the three species are clearly differentiated and identified also when they are present together in a mixture.
[0289] This Example clearly shows that the H.P.M.E. mleA-mleR marker is a flexible marker that can be adapted to different technological platform and protocols. The primer pair applied for the PCR-DGGE are, indeed, the same applied in Example 2 for capillary electrophoresis, but with a different modification: the addition of the GC-clamp, instead of the FAM labelling.
[0290] Moreover Example 4 demonstrate that H.P.M.E. mleA-mleR marker is suitable and robust to be applied successfully in a case-study regarding a culture-independent ecological analysis, and analogously it would be adapted to support Next Generation Sequencing based Metagenomics.
Example 5: Improvement of a PCR-Based Protocol for the Identification of Lactobacillus casei, Lactobacillus Paracasei and Lactobacillus rhamnosus, Thanks to a Primer Pair Designed on the Sequences of the H.P.M.E. mleA-mleR Marker
[0291] The species of Lactic Acid Bacteria Lactobacillus casei, Lactobacillus paracasei subsp. paracasei, Lactobacillus paracasei subsp. tolerans and Lactobacillus rhamnosus are phylogenetically very related and belong to the Lactobacillus casei group.
[0292] One of the most applied and cited method to identify these four species is a PCR-based protocol developed by Ward and Timmins in 1999, which is characterized by three different PCR. One primer, namely primer Y2, is common for the three PCR, while specific primers, namely CASEI, PARA and RHAMN were specific respectively for the species Lactobacillus casei, Lactobacillus paracasei and Lactobacillus rhamnosus. The size of the three PCR products is similar, as they were designed on the homologous nucleotide positions Lactobacillus casei, Lactobacillus paracasei and Lactobacillus rhamnosus, within the variable region V1 of the 16S rRNA. For this reason they cannot be applied together to identify these species in a mixed culture, but in three distinct PCRs (
[0293] The new PCR developed here thanks to a thanks to a primer pair designed the homologous nucleotide positions within the sequences of the H.P.M.E. mleA-mleR marker for the species Lactobacillus casei, Lactobacillus paracasei and Lactobacillus rhamnosus allow to differentiate them on the basis of length polymorphism (
[0294] This example shows that the H.P.M.E. mleA-mleR marker can be used to design primers that successfully amplify the target samples also in the case of Lactobacillus genus. Moreover the insertion/deletion observed in the region of the H.P.M.E. mleA-mleR marker corresponding to the gene promoter can be successfully applied in a detection method to differentiate lactobacilli belonging to phylogenetically related species such as Lactobacillus casei, Lactobacillus paracasei and Lactobacillus rhamnosus improving the state of the art.
Example 6: Primers Designed on the H.P.M.E. mleA-mleR Marker to Sequence Phylogenetically Unrelated Lactobacilli have been Successfully Applied Also for Typing Different L. brevis Strains and Analysing the Intraspecific Variability
[0295] Lactobacillus brevis and Lactobacillus plantarum are widespread species involved also in many technological processes, ranging from agri-food to medical applications. Despite this common features and applications, they are phylogenetically unrelated species according Hammes and Vogel (1995), as L. brevis belongs to the Group C of obligately heterofermentative lactobacilli, whereas L. plantarum belongs to the Group B of facultative heterofermentative lactobacilli.
[0296] As they are fundamental lactobacilli from both and ecological and a technological view-point, a primer pair for amplification by PCR, sequencing and identification at the species level was developed on the H.P.M.E. mleA-mleR marker. More in detail, the sequences of the H.P.M.E. mleA-mleR marker already available in public databases for the strain L. brevis ATCC 367 (gill 16332681:2167769-2170426) and L. plantarum WCSF1 (gi|342240345:1014055-1016775) were aligned and analysed.
[0297] Despite the low percentage of similarity, i.e. 70.41% in pairwise alignment, and a deletion of 35 bp in the promoter region of L. brevis, two conserved DNA stretches have been found within the mleA and in mleR genes, as well as the conserved 9-mer TTTGACTAT in the extragenic sequence corresponding to the promoter region. The conserved DNA stretches on mleA and mleR genes have been used to design the primer Lb_br-pl_mleA-R1_seq, of which the sequence is TCATAAACGATTGGCATAAATTC (SEQ ID NO:21) and the primer Lb_br-pl_mleR-F1_seq, of which the sequence is characterized by some degenerated nucleotides according IU PAC nomenclature: CGRTCAAATTCTTCRGCAATCA (SEQ ID NO:22).
[0298] The PCR was successfully applied also to amplify ten different strains belonging to the species L. brevis, namely L. brevis strains LMG 6906; L. brevis JCM 17312; L. brevis 11401; L. brevis 11989; L. brevis 11435; L. brevis 12023; L. brevis 25561; L. brevis 11434; L. brevis LMG 11998; L. brevis LMG 18022.
[0299] More in detail, the reaction was performed in 20 l volume using 1 U of DNA polymerase GoTaq (Promega) in 1 buffer with addition of magnesium chloride (MgCl.sub.2) at the final concentration of 1.5 mM and tri-phosphate nucleotides (dNTPs) at the final concentration of 0.2 mM each. The concentration of the primer was 1 M each. Amplification was in the Nexus Mastercycler Gradient instrument (Eppendorf) with a thermal program consisting of an initial denaturation step at 94 C. for 5 minutes followed by one cycle at 94 C. for 30 seconds, 60 C. for 30 seconds and 72 C. for 60 seconds, repeated 30 times, followed by a final extension step at 72 C. for 5 minutes.
[0300] The PCR products obtained for the ten strains were purified and sequences according the Sanger's method. The ten sequences of the H.P.M.E. mleA-mleR marker were aligned and analysed to find the relationship between the ten strains. The dendrogram (
[0301] This Example clearly show that the H.P.M.E. mleA-mleR is a flexible marker to be used both for characterize phylogenetically unrelated species of the Lactobacillus genus, as well as for the typing of different strains belonging to the same species. This final application suggests that the H.P.M.E. mleA-mleR marker could be included in a MLST scheme for strain typing.
Example 7: Improvement of a PCR-Based Protocol for the Identification of Species Belonging to Bifidobacterium Genus, Thanks to the H.P.M.E. Tkt-hrcA Marker Constituted by the Partial Sequence of the Tkt Gene and the hrcA Gene and the Complete Sequence of the Gene Promoter
[0302] The species Bifidobacterium breve, Bifidobacterium animalis subsp. lactis and Bifidobacterium longum have been applied in many nutraceutical and medical products. Bifidobacterium animalis subsp. lactis is phylogenetically related with the subspecies Bifidobacterium animalis subsp. animalis, while the species Bifidobacterium longum is constituted by three subspecies: Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis and Bifidobacterium longum subsp. suis.
[0303] One of the most applied and cited method to identify Bifidobacterium breve is a PCR-based protocol developed by Matsuki et al. (1999), which target is 16S rRNA. Unfortunately the PCR protocol can give false positive results also for Bifidobacterium animalis subsp. animalis and Bifidobacterium animalis subsp. lactis (
[0304] The H.P.M.E. tkt-hrcA marker, constituted by the partial sequence of the tkt gene coding for Transketolase and the hrcA gene coding for the Heat-inducible Transcription Repressor, i.e. a gene regulator protein according PFAM nomenclature, and the complete sequence of the gene promoter is a suitable and reliable genetic marker for the differentiation, the identification and the quantification of Bifidobacterium breve, Bifidobacterium animalis subsp. animalis, Bifidobacterium animalis subsp. lactis, Bifidobacterium longum and Bifidobacterium bifidum (
[0305] More in detail, the extragenic region where also promoter is located, is characterized by insertion/deletion events which allow to differentiate the three species by length polymorphism. Moreover length polymorphism due to insertion/deletion differentiates also Bifidobacterium animalis subsp. animalis and Bifidobacterium animalis subsp. lactis (
[0306] TCRTTCGGATCRTGCTTGATG (SEQ ID NO: 66) and probes based on BfX_tkt-hrcA_Stretch_1 ACAAGCCGG, BfX_tkt-hrcA_Stretch_2 GAGTGCTAAT (SEQ ID NO: 25), BfX_tkt-hrcA_Stretch_3 AACACGCCAAA (SEQ ID NO: 23), BfX_tkt-hrcA_Stretch_4 ATTGGAAGGAAAGTA (SEQ ID NO:24), BfX_tkt-hrcA_Stretch_5 ATTGTATTAGCACTC (SEQ ID NO: 26) for different applications (
[0307] The PCR was carried out with the primer BfX_hrc_46-FN2 TARTCYTCYACVAYRGCSCGMAG (SEQ ID NO: 65) and BfX_tkt_170-RN2 TCRTTCGGATCRTGCTTGATG (SEQ ID NO: 66) characterized by the presence of degenerated nucleotides according the IUPAC nomenclature.
[0308] The reaction was performed in 20 l volume using 1 U of DNA polymerase GoTaq (Promega) in 1 buffer with addition of magnesium chloride (MgCl.sub.2) at the final concentration of 1.5 mM and tri-phosphate nucleotides (dNTPs) at the final concentration of 0.2 mM each. The concentration of the primer was 2 M each. Amplification was in the Nexus Mastercycler Gradient instrument (Eppendorf) with a thermal program consisting of an initial denaturation step at 94 C. for 5 minutes followed by one cycle at 94 C. for 30 seconds, 65 C. for 45 seconds and 72 C. for 60 seconds, repeated 30 times, followed by a final extension step at 72 C. for 10 minutes.
[0309] This example clearly show that the H.P.M.E. tkt-hrcA marker is the solution to improve the state of the art regarding the differentiation and the identification of Bifidobacterium breve, Bifidobatrium animalis Bifidobacterium longum and Bifidobacterium bifidum. Moreover this example represents the confirmation that the H.P.M.E. markers such as tkt-hrcA for bifidobacteria and mleA-mleR for Lactic Acid Bacteria is a very useful class of genetic markers to develop new protocols and applications for the differentiation and the identification of microorganisms.
Example 8: Technical Advantages in the Application of H.P.M.E. mleA-mleR Marker Compared with the Exploitation of the mleA Gene as a Target in PCR-Based Protocols and as a Marker within a Multilocus Sequence Typing (MLST) Scheme to Differentiate and Characterize the Three Species Belonging to the Oenococcus Genus and Different Strains within the Onococcus oeni Species
[0310] The genus Oenococcus is constituted by three species Oenococcus oeni, Oenococcus kitaharae and Oenococcus alcoholitolerans. O. oeni is undoubtedly the most important and the most studied mainly because it was isolated more frequently than the other two species and also because it has a fundamental role in leading the malolactic fermentation in red wine and cider. Nothing is known about the possible commercial application of O. kitaharae and O. alcoholitolerans.
[0311] Due to its ecological and also commercial significance, many O. oeni strains have been collected and characterized in the framework of by different private and public research projects.
[0312] The most applied and cited method to identify, quantify and to characterize different O. oeni strains are PCR/qPCR-based protocols developed by different authors such as Zapparoli et al. (1998), Groisillier et al., (1999); Divol et al. (2003), de las Rivas et al., (2004), Beltramo et al., (2006). The genetic marker targeted by all the above cited methods was the mleA (mleS) gene coding for Malolactic Enzyme.
[0313] One preferred form of the H.P.M.E. marker is represented in the Oenococcus genus by a target sequence comprising: a) the mleA gene coding for Malolactic Enzyme; b) the mleR gene coding for the Malolactic Enzyme Regulator. i.e. a lysR family transcriptional regulator according PFAM nomenclature, oriented in opposite direction from the mleA gene on the complementary strand of the DNA; c) the region corresponding to the gene trascriptional promoter that is between the mleA gene and the mleR gene previously described.
[0314] The H.P.M.E. mleA-mleR marker for the species Oenococcus oeni, described above, is represented in the preferred form by the sequence of the strain Oenococcus oeni PSU-1 (gi|116490126:1481086-1483687); for the species Oenocococcus kitaharae is represented in the preferred form by Oenococcus kitaharae DSM 17330 (gi|372325750:114550-117167) and for the specie Oenococcus alcoholitolerans by the sequence of the strain O. alcoholitolerans LMG 27599.
[0315] Besides O. oeni PSU-1 and the Type Strain of the species O. kitaharae DSM 17330 and O. alcoholitolerans LMG 27599, three O. oeni strains, which have been reported to belong to different clusters within the O. oeni species, based on their own genotype, have been included in the dataset. More in detail Bilhre et al. (2009) thanks to Multilocus sequence typing of Oenococcus oeni discovered the presence of two subpopulations (Group A and B) shaped by intergenic recombination, and clustered in two different subgroups each (Group A1, A2 and Group B1, B2). Moreover, Dimopoulou at al. (2014) characterized a well-defined set of O. oeni strains which genomes were publicly available exploring their potential for exopolysaccharide (EPS) synthesis both by genome comparison and by analysing their phenotype. Dimopoulou at al. (2014) found two main clusters of strains within the species O. oeni: cluster A (EPS-A) and cluster B (EPS-B).
[0316] The four O. oeni strains included in the dataset besides O. kitaharae DSM 17330 and O. alcoholitolerans LMG27599 have been reported to show the following characteristics: [0317] O. oeni PSU-1, a commercial strain from red wine, belongs to the group A1 and EPS-A; [0318] O. oeni IOEB 9803 (gi|692709670|gb|AZKF01000023.1|:189036-191637), from red wine, belongs to the group A2 and EPS-B; [0319] O. oeni ATCC BAA-1163 (gill 18432235|gb|AAUV01000058.1|:96988-99589), from red wine, belong to the group B2 and EPS-B; [0320] O. oeni IOEB 9304 (gi|692713155|gb|AZK101000016.1|:53285-55886), from cider, belongs to the group B2 and EPS-B;
[0321] Contrarily to the protocols known up to the date, the H.P.M.E. mleA-mleR marker is not constituted only by mleA gene but also by the partial sequence of the mleR gene and the complete sequence of the gene promoter comprised in between the mleA and mleR genetic loci, according the Configuration A shown in
[0324] This example represents the confirmation that the H.P.M.E. markers, such as mleA-mleR for Lactic Acid Bacteria and tkt-hrcA for bifidobacteria, give a remarkable advantage compared to the known protocols up to the date in the differentiation and the identification of microorganisms by combining both highly variable sequence polymorphisms (SNPs) and length polymorphisms (IN/DEL).
TABLE-US-00003 TABLE 2 Summary of the results of both the in-silico analysis and the corresponding PCR assays (FIGS. 4, 5, 14A, 14B, 14C, 14D and 14E) regarding the technical advantages of the application of the primers designed on the H.P.M.E. mleA-mleR marker compared with the primers designed to amplify partially the mleA (mleS) gene, coding for Malolactic Enzyme. Single Nucleotide Insertions/ Targeted to Polymorphisms Deletions Oenococcus spp. .sup.a (SNPs) .sup.b (IN/DEL) .sup.c Primer pair: On1/On2; NO YES NO On3/On4 (Zapparoli et al., 1998) Primer pair: mleS sense/ NO YES NO mleS antisense. (Groisillier et al., 1999) Primer pair: OO1/OO2 NO YES NO (Divol et al. 2003, de las Rivas et al., 2004) Primer pair: mleA forward NO YES NO primer/mleA reverse primer (Beltramo et al., 2006) Primer pair: Oex_mleR_68-F1/ YES YES YES Oex_mleA_01-R1 (H.P.M.E. mleA-mleR marker) Primer pair: Oex_mleR_68-F1/ YES YES YES Oex_mleA_244-RN (H.P.M.E. mleA-mleR marker) Notes .sup.a : the primer pair is designed to anneal and amplify all the three species belonging to the Oenococcus genus, i.e. Oenococcus oeni, Oenococcus kitaharae; Oenococcus alcoholitolerans. .sup.b : different allelic forms, characterized by specific mutations in define nucleotide sites compared to homologous genetic loci, i.e. Single Nucleotide Polymorphisms (SNPs) have been reported and applied to differentiate strains belonging to the same species (e.g. Oenococcus oeni) and or different species (O. oeni, O. kitaharae; O. alcoholitolerans); .sup.c : length polymorphisms represented by insertion and/or deletion of, at least, one nucleotide site compared to homologous genetic loci have been detected and applied to differentiate species belonging to the same genus (e.g. O. oeni, O. kitaharae; O. alcoholitolerans)..
TABLE-US-00004 TABLE 3 Similarity percentage defined on the basis of the pairwise alignment of the H.P.M.E. mleA-mleR marker sequences in the region comprised within the primers Oex_mleR_68-F1 and Oex_mleA_244-RN. ATCC BAA- IOEB IOEB DSM LMG PSU-1 1163 9304 9803 17330 27599 O. oeni 100.00% 98.72% 98.47% 98.47% 72.08% 67.83% PSU-1 O. oeni 98.72% 100.00% 98.98% 98.72% 72.33% 68.09% ATCC BAA-1163 O. oeni 98.47% 98.98% 100.00% 99.49% 72.08% 68.34% IOEB 9304 O. oeni 98.47% 98.72% 99.49% 100.00% 72.58% 68.09% IOEB 9803 O. kitaharae 72.08% 72.33% 72.08% 72.58% 100.00% 68.59% DSM 17330 O. 67.83% 68.09% 68.34% 68.09% 68.59% 100.00% alcoholitolerans LMG 27599
TABLE-US-00005 TABLE 4 Similarity percentage defined on the basis of the pairwise alignment of the partial mleA gene sequences in the region comprised within the primers OO1 and OO2, according de las Rivas etal. (2004). ATCC BAA- IOEB IOEB DSM LMG PSU-1 1163 9304 9803 17330 27599 O. oeni 100.00% 100.00% 100.00% 100.00% not not PSU-1 amplified amplified O. oeni 100.00% 100.00% 100.00% 100.00% not not ATCC BAA-1163 amplified amplified O. oeni 100.00% 100.00% 100.00% 100.00% not not IOEB 9304 amplified amplified O. oeni 100.00% 100.00% 100.00% 100.00% not not IOEB 9803 amplified amplified O. kitaharae not not not not not not DSM 17330 amplified amplified amplified amplified amplified amplified O. alcoholitolerans not not not not not not LMG 27599 amplified amplified amplified amplified amplified amplified
Example 9: Technical Advantages in the Application of Both H.P.M.E. rsmD-ftsY Marker and H.P.M.E. ftsY-rubA Marker Compared with the Exploitation of the Only ftsY Genetic Locus Coding for the Protein FtsY as a Marker within a Multilocus Sequence Typing (MLST) Scheme to Differentiate and Characterize Entomopathogenic Bacteria Belonging to the Rickettsiella Genus and Different Pathovars within the Rickettsiella grylli Species
[0325] Bacteria belonging to the genus Rickettsiella are obligate intracellular pathogens of a wide range of arthropods. This genus is currently constituted by three recognized species, Rickettsiella popilliae, Rickettsiella grylli, and Rickettsiella chironomi, together with numerous further pathotypes or subjective synonyms. Moreover it is phylogenetically close to vertebrate pathogenic bacteria of the Legionella genus (Leclerque, 2008).
[0326] As there is no laboratory strain currently available in axenic media or cell culture, the characterization of the Rickettsiella obligate intracellular pathogens is mainly based on light and electron microscopic observations. These bacteria were initially classified mainly on the basis of morphologic criteria, including their intracellular location, their oval or rod-like to pleomorphic forms, the occurrence of a complex intravacuolar cycle and the occurrence of crystalline-like structures. The genome of Rickettsiella grylli is currently available in GenBank (Accession Number AAQJ00000000), though annotation was generated automatically without manual curation (Mediannikov et al., 2010). Based on the analysis of several genes, a separate taxonomic position was proposed for rickettsiellae (Leclerque, 2008).
[0327] In order to improve the characterization of these important entomopathogenic bacteria nine selected genes, i.e. the 16S and 23S rRNA genes and the protein-encoding genes dnaG, ftsY, gidA ksgA, rpoB, rpsA, and sucBwere evaluated for their potential as markers for the generic and infra-generic taxonomic classification of Rickettsiella-like bacteria and the development of a MLST scheme (Leclerque et al., 2011).
[0328] Among these genetic markers, the most interesting genetic marker besides its role in the MLST scheme is surely the ftsY gene, which encodes the bacterial homolog of the eukaryotic signal recognition particle receptor subunit alpha involved in protein translocation and has previously been identified as the most appropriate single gene marker for the estimation of the G+C content in prokaryotic genomes (Fournier et al., 2006), has recently been introduced as a phylogenetic marker for the characterization of Rickettsiella-like bacteria (Mediannikov et al., 2010).
[0329] As usual for the Multilocus Sequence Typing approach, a partial sequence constituted by 684 bp of the ftsY gene and its corresponding peptide sequence automatically translated by in-silico analysis (228 aminoacids) was considered for strains typing (Leclerque et al., 2011Table S2).
[0330] Remarkably the ftsY gene, when considered together with its flanking genes in two different H.P.M.E. markers represents a great improvement of the prior art, i.e. the MLST scheme (Leclerque et al., 2011).
[0331] The first case is represented by H.P.M.E. rsmD-ftsY marker, constituted by the partial sequence of the rsmD gene coding for 16S rRNA Methyltransferase, oriented in the opposite direction of ftsY, which is the gene coding for the signal recognition particle receptor subunit alpha involved in protein translocation. The H.P.M.E. rsmD-ftsY marker is characterized by the Configuration A according the definition in
[0332] These two H.P.M.E. markers allow to differentiate Rickettsiella grylli and Candidatus Rickettsiella isopodorum on the basis of the in-silico comparative analysis of the three available genome sequences for this genus.
[0333] More in detail, it is possible to differentiate the two species thanks to the H.P.M.E. rsmD-ftsY marker by analyzing the region comprised within the primer Rck_rsmD-33-FN GTTTTCTWCCKCGCCATTG (SEQ ID NO: 79) and Rck_ftsY-01-R1 GAGATTCTTTGCGTTTTAAAAATTTAAAC (SEQ ID NO: 74) or within the primer Rck_rsmD-33-FN GTTTTCTWCCKCGCCATTG (SEQ ID NO: 79) and Rck_ftsY-85-RN GTTTTYWGTAAACTATTTTTTATTCG (SEQ ID NO: 75). The regions defined by these two primer pairs are indeed variable both considering the nucleotide sequence and the size, because of the presence of insertion/deletion nucleotide sites (Table 5).
[0334] Analogously it is possible to differentiate Rickettsiella grylli and Candidatus Rickettsiella isopodorum on the basis of both the sequence and the size, thanks to the H.P.M.E. ftsY-rubA marker by analyzing the region comprised within the primer pair comprising one of the following three oligonucleotides as the forward primer: Rck_ftsY-834-F1
[0335] GCTGACTAAATTAGATGGGACTGCC (SEQ ID NO: 76); Rck_ftsY-942-FN TACABGTTTTYTCWGCAMAGGAATTTG (SEQ ID NO: 77) or Rck_ftsY-947-FN GTTTTYTCWGCAMAGGAATTTG (SEQ ID NO: 78) and one of the two following two oligonucleotides as the reverse primer: Rck_rubA_145-RN CAAAATCTTCTTTCATKGCACC (SEQ ID NO: 80); Rck_rubA-23-RN CACAMAGYARGCACATATATTTTC (SEQ ID NO: 81). It is not possible to predict the size of the PCR product given by the primer pair ftsY fwd/ftsY rev according Leclerque et al., (2011) by in-silico analysis.
TABLE-US-00006 TABLE 5 Summary of the results of the in-silico analysis and virtually corresponding PCR assays (FIG. 15) regarding the technical advantages of the application of the primers designed on the H.P.M.E. rsmD-ftsY marker and H.P.M.E. ftsY-rubA marker Single Nucleotide Insertions/ Targeted to Polymorphisms Deletions Rickettsiella spp. .sup.a (SNPs) .sup.b (IN/DEL) .sup.c H.P.M.E. rsmD-ftsY YES YES YES Primer pair: RcK_rsmD-33-F1/ Rck_ftsY-01-R1 H.P.M.E. rsmD-ftsY YES YES YES Primer pair: RcK_rsmD-33-F1/ Rck_ftsY-85-RN H.P.M.E. ftsY-rubA YES YES YES Primer pair: Rck_ftsY-834-F1/ Rck_rubA-145-RN H.P.M.E. ftsY-rubA YES YES YES Primer pair: Rck_ftsY-942-FN/ Rck_rubA-23-RN
Example 10: Technical Advantages in the Application of H.P.M.E. hrcA-grpE Marker to Differentiate and Characterize Species Bacteria Belonging to the Bacillus Genus
[0336] H.P.M.E. hrcA-grpE marker, constituted by the partial sequence of the hrcA gene and the grpE gene and the complete sequence of the gene promoter from Bacillus subtilis subsp. subtilis NCIB 3610; Bacillus subtilis subsp. spizizenii TU-B-10; Bacillus subtilis subsp. inaquosorum KCTC 13429; Bacillus velezensis FZB42 and Bacillus licheniformis ATCC 14580.
[0337] The genes hrcA and grpE are oriented in the same direction. In the promoter region the conserved sequencesStretch_1 and Stretch_2, corresponding respectively to BcX_hrcA-grpE_1095-F1 GAGGGAGGTGAACACAATGTC (SEQ ID NO: 72) and BcX_hrcA-grpE_1120-R1 GACATTGTGTTCACCTCCCTC (SEQ ID NO: 73) are comprised in the PCR product obtained with the primer pair constituted by BcX_hrcA_991-FN2 TCDGACTTGTCAAAAGCRYTVACAA (SEQ ID NO: 69) or BcX_hrcA_991-FN1 TCDGAYWTGTCWMAAGYRYTVACAA (SEQ ID NO: 68), as forward primer, and BcX_hrpE_1311-RN1 TTWTCRAARTCHGCYTGWASACG (SEQ ID NO: 70) or BcX_hrpE_1311-RN2 TTTTCAAAGTCYGCYTGAACACG (SEQ ID NO: 71), as reverse primer (
[0338] In both the cases species belonging to the Bacillus genus can be differentiated both by sequence polymorphisms (SNPs) and by length polymorphisms (insertion/deletion) as reported in
Example 11: Detection and Quantification of Microorganisms by Quantitative Real-Time PCR (qPCR) Combining Group-Specific TaqMan Probes or Group-Specific Short, Locked Nucleic Acid (LNA) TaqMan Probes and Species-Specific Primers Designed on the H.P.M.E. mleA-mleR Marker and H.P.M.E. Tkt-hrcA Marker and H.P.M.E. hrcA-grpE Marker
[0339] Quantitative real-time qPCR methods have been increasingly used as a rapid and sensitive technique for the detection of microorganisms. With the use of TaqMan probes, real-time PCR offers an advantage of rapid, sensitive and specific detection of the target microorganisms, while avoiding cross-contamination from other closely related bacteria.
[0340] The TaqMan method depends on a DNA-based probe with a fluorescent reporter at one end and a quencher of fluorescence at opposite end of the probe. The close proximity of the reporter to the quencher prevents emission of its fluorescence, hydrolyzation of the probe by the 5 to 3 exonuclease activity of the Taq polymerase releases the reporter and thus allows emission of fluorescence. Therefore an increase of the product targeted by the reporter probe at each PCR cycle causes a proportional increase of fluorescence. Fluorescence is detected and measured in a real-time PCR machine.
[0341] An increasing number of alternative probe chemistries for quantitative real time PCR (qPCR) are being marketed besides TaqMan probes qPCR, such as minor groove binder (MGB), Molecular Beacon, Scorpion, locked nucleic acid (LNA) and Light Upon eXtension (LUX). The alternative probe technologies are based on different chemistries and claim to have some advantages compared with the conventional TaqMan DNA probes (Josefsen et al., 2009).
[0342] Incorporation of locked nucleic acids (LNA) molecules in the probe has further helped to increase the sensitivity of these assays. LNA are nucleic acid analogs containing a locked bicyclic furanose unit in an RNA-mimicking sugar conformation. These molecules allow for better base stacking and, therefore, show a higher stability and affinity towards LNA, DNA and RNA targets.
[0343] LNA TaqMan probes have certain nucleic bases substituted by LNA monomers, i.e. nucleic acid analogs containing a 20-0,40-C methylenebridge, restricting the flexibility of the ribofuranose ring and rendering the monomer in a rigid bicyclic formation. This enhances the hybridization performance of LNA containing probes compared to classical TaqMan probes, and allows shorter probe designs. The incorporation of LNA monomers will increase the thermal stability of a duplex complementary DNA significantly, i.e. up to 8 C. per substitution (Josefsen et al., 2009).
[0344] The application of qPCR protocols based on the LNA TaqMan probe technology, combining group-specific short LNA TaqMan probes and species-specific primers designed on the H.P.M.E. mleA-mleR marker and H.P.M.E. tkt-hrcA marker and H.P.M.E. hrcA-grpE marker gives several advantages such as the possibility to use the same probe to quantify closely related species in distinct reactions
TABLE-US-00007 TABLE6 qPCRprotocolsbasedontheLNATaqManprobetechnology,combiningshort LNATaqManprobetargetingmicroorganismsoftheLactobacillalesorderand species-specificprimersdesignedontheH.P.M.E.mleA-mleRmarker. Species-specific Groupspecific Species-specific Forwardprimer LNATaqManprobe Reverseprimer Targetspecies:Oenococcusoeni Oligonucleotidedesigned TTTGACTAT Oligonucleotidedesigned ontheO.oenimleR ontheO.oenimleA sequence sequence Targetspecies:Lactobacillusplantarum Oligonucleotidedesigned TTTGACTAT Oligonucleotidedesigned ontheL.plantarummleR ontheL.plantarummleA sequence sequence Targetspecies:Lactobacilluspentosus Oligonucleotidedesigned TTTGACTAT Oligonucleotidedesigned ontheL.pentosusmleR ontheL.pentosusmleA sequence sequence Targetspecies:Lactobacilluscasei Oligonucleotidedesigned TTTGACTAT Oligonucleotidedesigned ontheL.caseimleR ontheL.caseimleA sequence sequence Targetspecies:Lactobacillusparacasei Oligonucleotidedesigned TTTGACTAT Oligonucleotidedesigned ontheL.paracaseimleR ontheL.paracaseimleA sequence sequence Targetspecies:Lactobacillusrhamnosus Oligonucleotidedesigned TTTGACTAT Oligonucleotidedesigned ontheLrhamnosusmleR ontheLrhamnosusmleA sequence sequence Targetspecies:Lactobacillusacidophilus Oligonucleotidedesigned TTTGACTAT Oligonucleotidedesigned ontheL.acidophilusmleR ontheL.acidophilusmleA sequence sequence TTTGACTAT Targetspecies:Lactobacillusbrevis Oligonucleotidedesigned TTTGACTAT Oligonucleotidedesigned ontheL.brevismleR ontheL.brevismleA sequence sequence Targetspecies:Lactobacillusgasseri Oligonucleotidedesigned TTTGACTAT Oligonucleotidedesigned ontheLgasserimleR ontheL.gasserimleA sequence sequence Targetspecies:Lactobacillusreuteri Oligonucleotidedesigned TTTGACTAT Oligonucleotidedesigned ontheL.reuterimleR ontheL.reuterimleA sequence sequence Targetspecies:Lactobacillussakei Oligonucleotidedesigned TTTGACTAT Oligonucleotidedesigned ontheL.sakeimleR ontheL.sakeimleA sequence sequence Targetspecies:Lactobacilluscurvatus Oligonucleotidedesigned TTTGACTAT Oligonucleotidedesigned ontheL.curvatusmleR ontheL.curvatusmleA sequence sequence Targetspecies:Streptococcussalivariussubsp.thermophilus Oligonucleotidedesigned TTTGACTAT Oligonucleotidedesigned ontheS.salivariussubsp. ontheS.salivariussubsp. thermophilusmleR thermophilusmleA sequence sequence TargetspeciesLeuconostocmesenteroidessubsp.mesenteroides Oligonucleotidedesigned TTTGACTAT Oligonucleotidedesigned ontheL.mesenteroides onthe.mesenteroides subsp.mesenteroides subsp.mleRsequence mleRsequence Targetspecies:Pediococcusdamnosus Oligonucleotidedesigned TTTGACTAT Oligonucleotidedesigned ontheP.damnosusmleR ontheP.damnosusmleA sequence sequence
TABLE-US-00008 TABLE7 qPCRprotocolsbasedontheLNATaqManprobetechnology,combiningshort LNATaqManprobetargetingmicroorganismsoftheBifidobacteriumgenusand species-specificprimersdesignedontheH.P.M.E.tkt-hrcAmarker. Species-specific Groupspecific Species-specific Forwardprimer LNATaqManprobe Reverseprimer Bifidobacteriumlongumsubsp.longum Oligonucleotidedesigned ACAAGCCGG Oligonucleotidedesigned ontheB.longumsubsp. GAGTGCTAAT ontheB.longumsubsp. longumsequence (SEQIDNO:25) longumsequence AACACGCCAAA (SEQIDNO:23) ATTGGAAGGAAAGTA (SEQIDNO:24) ATTGTATTAGCACTC (SEQIDNO:26)
TABLE-US-00009 TABLE8 qPCRprotocolsbasedontheLNATaqManprobetechnology,combiningshort LNATaqManprobetargetingmicroorganismsoftheBacillusgenusandspecies- specificprimersdesignedontheH.P.M.E.hrcA-marker. Species-specific Groupspecific Species-specific Forwardprimer LNATaqManprobe Reverseprimer Targetspecies:Bacillussubtilissubsp.subtilis Oligonucleotidedesigned TTTGTTTTTCTTCT Oligonucleotidedesigned ontheB.subtilissubsp. TGTGTTCACCTCCCT ontheB.subtilissubsp. subtilissequence subtilissequence
[0345] The present invention therefore resolves the above-lamented problem with reference to the mentioned prior art, offering at the same time numerous other advantages, including making possible the development of methods capable of identifying and quantifying prokaryotic and eukaryotic microroganisms so to refine not only the diagnostics but above all direct the best therapeutic choice.
REFERENCES
[0346] Akopyanz N., Bukanov N. O., Westblom T. U., Kresovich S., Berg D. E. (1992) DNA diversity among clinical isolates of Helicobacter pylori detected by PCR-based RAPD fingerprinting. Nucleic Acids Research. 20: 5137-5142. [0347] Esteve-Zarzoso B., Belloch C., Uruburu F., Querol A. (1999). Identification of yeasts by RFLP analysis of the 5.8S rRNA gene and the two ribosomal internal transcribed spacers. Int J Syst Bacteriology. 49: 329-337. [0348] Ferrario C., Milani C., Mancabelli L., Lugli G. A., Turroni F., Duranti S., Mangifesta M., Viappiani A., Sinderen D. v., Ventura M. (2015). A genome-based identification approach for members of the genus Bifidobacterium. FEMS Microbiol Ecol. 91: 3. [0349] Glaeser S. P., Kampfer P. (2015). Multilocus sequence analysis (MLSA) in prokaryotic taxonomy. Syst Appl Microbiol 38: 237-245. [0350] Hammes W. P. & Vogel R. F. (1995). The genus Lactobacillus. Chapter 3 in The genera of Lactic acid Bacteria, Ed. by Wood and Holzapfel, pages: 19-54. [0351] Gil-Lamaignere C., Roilides E., Hacker J., Mller F. M. (2003). Molecular typing for fungia critical review of the possibilities and limitations of currently and future methods. Clin Microbiol Infect. 9: 172-185. [0352] Matsuki T., Watanabe K., Tanaka R., Fukuda M., Oyaizu H. (1999). Distribution of bifidobacterial species in human intestinal microflora examined with 16S rRNA-gene-targeted species-specific primers. Appl Environ Microbiol. 65: 4506-4512. [0353] Moore E. R., Mihaylova S. A., Vandamme P., Krichevsky M. I., Dijkshoorn L. (2010). Microbial systematics and taxonomy: relevance for a microbial commons. Res Microbiol. 161: 430-438. [0354] Shariat N., Kirchner M. K., Sandt C. H., Trees E., Barrangou R., Dudley E. G. (2013). Subtyping of Salmonella enterica serovar Newport outbreak isolates by CRISPR-MVLST and determination of the relationship between CRISPR-MVLST and PFGE results. J. Clin. Microbiol. 51: 2328-2336. [0355] Shaw G. (2013). Polymorphism and single nucleotide polymorphisms (SNPs). BJU Int. 112: 664-665. [0356] Thanh H. D., Park H. K., Kim W., Shin H. S. (2013). Development of a 16S-23S rRNA intergenic spacer-based quantitative PCR assay for improved detection and enumeration of Lactococcus garvieae. FEMS Microbiol Lett 339: 10-16. [0357] Walter J., Tannock G. W., Tilsala-Timisjarvi A., Rodtong S., Loach D. M., Munro K., Alatossava T. (2000) Detection and identification of gastrointestinal Lactobacillus species by using denaturing gradient gel electrophoresis and species-specific PCR primers. Appl Environ Microbiol. 66: 297-303. [0358] Ward L. J., Timmins M. J. (1999). Differentiation of Lactobacillus casei, Lactobacillus paracasei and Lactobacillus rhamnosus by polymerase chain reaction. Lett Appl. Microbiol. 29: 90-92. [0359] Beltramo C, Desroche N, Tourdot-Marchal R, Grandvalet C, Guzzo J. (2006). Real-time PCR for characterizing the stress response of Oenococcus oeni in a wine-like medium. Res Microbiol. 157(3):267-274. [0360] Bilhre E., Lucas P. M., Claisse O., Lonvaud-Funel A. (2009). Multilocus sequence typing of Oenococcus oeni: detection of two subpopulations shaped by intergenic recombination. Appl Environ Microbiol. 2009 March; 75(5):1291-300. [0361] de Las Rivas B., Marcobal A., Muoz R. (2004). Allelic diversity and population structure in Oenococcus oeni as determined from sequence analysis of housekeeping genes. Appl Environ Microbiol. 70(12):7210-7219. [0362] Dimopoulou M., Vuillemin M., Campbell-Sills H., Lucas P. M., Ballestra P., Miot-Sertier C., Favier M., Coulon J., Moine V., Doco T., Rogues M., Williams P., Petrel M., Gontier E., Moulis C., Remaud-Simeon M., Dols-Lafargue M. (2014). Exopolysaccharide (EPS) synthesis by Oenococcus oeni: from genes to phenotypes. PLoS One. 2014 Jun. 5; 9(6):e98898. [0363] Divol, B., T. Tonon, S. Morichon, E. Gindreau, and A. Lonvaud-Funel. 2003. Molecular characterization of Oenococcus oeni genes encoding proteins involved in arginine transport. J. Appl. Microbiol. 94:738-746. [0364] Groisillier A., Lonvaud-Funel A. (1999). Comparison of partial malolactic enzyme gene sequences for phylogenetic analysis of some lactic acid bacteria species and relationships with the malic enzyme. Int J Syst Bacteriol. 49:1417-1428. [0365] Zapparoli G., Torriani S., Pesente P., Dellaglio F. (1998). Design and evaluation of malolactic enzyme gene targeted primers for rapid identification and detection of Oenococcus oeni in wine. Lett Appl Microbiol. 27(5): 243-246. [0366] de Las Rivas B1, Marcobal A, Muoz R. (2004) Allelic diversity and population structure in Oenococcus oeni as determined from sequence analysis of housekeeping genes Appl Environ Microbiol. December; 70(12):7210-9 [0367] Leclerque A, Hartelt K, Schuster C, Jung K, Kleespies R G. (2011) Multilocus sequence typing (MLST) for the infra-generic taxonomic classification of entomopathogenic
[0368] Rickettsiella bacteria FEMS Microbiol Lett. November; 324(2):125-34. [0369] Fournier P. E., Suhre K., Fournous G., Raoult D. (2006). Estimation of prokaryote genomic DNA G+C content by sequencing universally conserved genes. Int J Syst Evol Microbiol 56: 1025-1029. [0370] Leclerque A. (2008). Whole genome-based assessment of the taxonomic position of the arthropod pathogenic bacterium Rickettsiella grylli. FEMS Microbiol 283:117-127. [0371] Mediannikov O., Sekeyova Z., Birg M. L., Raoult D. (2010). A novel obligate intracellular gamma-proteobacterium associated with ixodid ticks, Diplorickettsia massiliensis, Gen. November, Sp. November PLoS One. 5(7):e11478. [0372] Assis L. C. S. & Santos, L. M. (2014). Phylogenetics is not phylogenomics. Cladistics 30:8-9. [0373] Bustin S. A., Benes V., Garson J. A., Hellemans J., Huggett J., Kubista M., Mueller R., Nolan T., Pfaffl M. W., Shipley G. L., Vandesompele J., Wittwer C. T. (2009). The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem. 55(4): 611-622. [0374] Capella-Gutierrez S, Kauff F, Gabaldn T. (2014). A phylogenomics approach for selecting robust sets of phylogenetic markers. Nucleic Acids Res. 42(7):e54. [0375] Josefsen M H, Lfstrm C, Sommer H M, Hoorfar J. (2009). Diagnostic PCR: comparative sensitivity of four probe chemistries. Mol Cell Probes. 23:201-203. [0376] Jun S. R., Nookaew I., Hauser L., Gorin A. (2017). Assessment of genome annotation using gene function similarity within the gene neighborhood. BMC Bioinformatics. 18(1):345. [0377] Poptsova M. S., Gogarten J. P. (2010). Using comparative genome analysis to identify problems in annotated microbial genomes. Microbiology. 156:1909-1917. [0378] Rong & Huang (2014) Multilocus Sequence Analysis: Taking Prokaryotic Systematics to the Next Level. Chapter 11 in Methods in Microbiology 41:221-251. [0379] Schumann W. (2003). The Bacillus subtilis heat shock stimulon. Cell Stress Chaperones. Fall 8:207-217. [0380] Schaeffer R. D., Liao Y., Cheng H., Grishin N. V. (2017). ECOD: new developments in the evolutionary classification of domains. Nucleic Acid Research. 45: 296-302. [0381] Bateman A. & Finn R. D. (2007) SCOOP: simple method for identification of novel protein superfamily relationships. Bioinformatics. 2007; 23(7):809-814 [0382] Mistry J., Bateman A., Finn R. D. (2007). Predicting active site residue annotations in the Pfam database. BMC Bioinformatics. 8:298. [0383] Maddocks S. E., Oyston P. C. (2008). Structure and function of the LysR-type transcriptional regulator (LTTR) family proteins. Microbiology. 154:3609-3623.