METHOD FOR PRODUCING TETRAHYDROPYRIMIDINE BY FERMENTING RECOMBINANT CORYNEBACTERIUM GLUTAMICUM

20200224233 ยท 2020-07-16

    Inventors

    Cpc classification

    International classification

    Abstract

    A method for producing ectoine by fermenting recombinant Corynebacterium glutamicum. The recombinant Corynebacterium glutamicum is obtained by overexpressing, in Corynebacterium glutamicum, an aspartokinase gene lysC of which feedback inhibition is relieved, then replacing the promoter of the dihydrodipicolinate synthase in the recombinant bacterium to attenuate the activity of the dihydropyrimidine dicarboxylic acid synthase, and then transforming the recombinant bacterium with the ectoine synthetic path related gene ectABC. The recombinant Corynebacterium glutamicum can be fermented using different cheap raw materials under a low salt condition to produce ectoine, and use cheap corn slurry instead of expensive yeast powder as a nutritional component, so as to further reduce the costs of the raw materials. In addition, the recombinant Corynebacterium glutamicum solves the biosafety problem, simplifies the post-extraction process, and has a good market application prospect.

    Claims

    1. A recombinant Corynebacterium glutamicum, characterized in that it comprises a mutated lysC gene and promoter, a mutated dapA gene and promoter and an ectABC gene; wherein the sequence of the mutated lysC gene and promoter is set forth in SEQ ID NO: 1; the sequence of the mutated dapA gene and promoter is set forth in SEQ ID NO: 2; and the sequence of the ectABC gene is set forth in SEQ ID NO: 3.

    2. The recombinant Corynebacterium glutamicum according to claim 1, characterized in that it is prepared by the following method comprising: (1) ligating an aspartokinase gene lysC of which the feedback inhibition is relieved and a strong promoter fragment P1 to a suicide plasmid to obtain a recombinant plasmid, and electro-transforming Corynebacterium glutamicum with the obtained recombinant plasmid to obtain a recombinant bacterium C. glutamicum lysC-P1-298; (2) attenuating the expression of the dihydrodipicolinate synthase gene dapA in the recombinant bacterium C. glutamicum lysC-PJ-298 by promoter replacement to obtain a recombinant bacterium C. glutamicum lysC-dap; (3) transforming the recombinant bacterium C. glutamicum lysC-dap with an expression vector capable of overexpressing the ectoine synthesis pathway related gene ectABC, to construct a recombinant bacterium C. glutamicum lysC-dap-ectABC.

    3. The recombinant Corynebacterium glutamicum according to claim 2, characterized in that, in step (1), lysC1, lysC2, lysC3 and the strong promoter fragment P1 are ligated to the suicide plasmid, wherein the lysC1, lysC2 and lysC3 are obtained by PCR amplification with primer pairs of SEQ ID NOs: 5-6, SEQ ID NOs: 7-8, and SEQ ID NOs: 9-10, respectively, and using the genome of Corynebacterium glutamicum as a template.

    4. The recombinant Corynebacterium glutamicum according to claim 2, characterized in that the strong promoter fragment P1 has the sequence as set forth in SEQ ID NO: 4, and the suicide plasmid is pK18mobsacB.

    5. The recombinant Corynebacterium glutamicum according to claim 2, characterized in that, in the step (2), dap1 and dap2 fragments are ligated to the suicide plasmid to obtain a recombinant plasmid; wherein the dap1 and dap2 fragments are obtained by PCR amplification with primer pairs of SEQ ID NOs: 11-12 and SEQ ID NOs: 13-14, respectively and using the genome of Corynebacterium glutamicum as a template.

    6. The recombinant Corynebacterium glutamicum according to claim 2, characterized in that, in the step (3), the ectABC gene is ligated to the expression vector pXMJ19 to obtain a recombinant plasmid named as pXMJ-ectABC, and the recombinant plasmid is electro-transformed the recombinant C. glutamicum lysC-dap of the step (2); wherein the ectABC gene is obtained by PCR amplification with the primer pair of SEQ ID NOs: 15-16 and using the genome of Halomonas elongata DSM 2581 as a template.

    7. A medium for the recombinant Corynebacterium glutamicum according to claim 1, characterized in that, it comprises chloramphenicol.

    8. A method for producing ectoine by fermentation using the recombinant Corynebacterium glutamicum according to claim 1, characterized in that, it comprises using a fermentable sugar-containing feedstock as a substrate, inoculating the recombinant Corynebacterium glutamicum according to claim 1, and fermenting at a temperature of 28-40 C., a pH of 5-8 and a dissolved oxygen value of 10%.

    9. The method according to claim 8, characterized in that the fermentable sugar-containing feedstock is selected from the group consisting of molasses, sucrose, glucose, starch hydrolyzate, corn syrup, xylose, mannose and glycerin; and the fermentation temperature is between 32 and 35 C., the pH is between 6 and 7, and IPTG is added at a final concentration of 0.01-1 mM 3-5 hours after fermentation.

    10. The method according to claim 8, characterized in that a carbon source is fed during the fermentation, and the fermentation medium contains thiamine and biotin.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0026] FIG. 1 shows the biosynthesis pathway of ectoine and a major modification site of the invention.

    DETAILED DESCRIPTION OF THE INVENTION

    [0027] The following embodiments are intended to illustrate the invention, but are not intended to limit the scope of the invention. Modifications or replacements to the methods, steps or conditions of the invention without departing from the spirit and essence of the invention are intended to be included within the scope of the invention.

    [0028] Unless otherwise specified, the chemical reagents used in the examples are conventional commercially available reagents, and the technical means used in the examples are conventional means well known to those skilled in the art.

    Example 1: Overexpression of the Aspartokinase Gene lysC with Feedback Inhibition Relieved

    [0029] The direct synthesis precursor of ectoine is aspartate, and the first enzyme, aspartokinase, in the synthesis pathway of aspartate to ectoine is feedback inhibited by lysine and threonine. Therefore, the present invention first relieved the feedback inhibition to the enzyme by lysine and threonine via introducing a site-directed mutation Q298G into the aspartokinase gene, and a strong promoter P1 was inserted before the gene (lysC) (the sequence is: 5-ggtgcacaaagCAAAAGCTGGGTACCTCTATCTGGTGCCCTAAACGGGGGAATATTAACGGGCCCAGGGTGGTCGCAC CTTGGTTGGTAGGAGTAGCATGGGATCC-3) (SEQ ID NO: 4) to enhance the expression of the gene. The specific process is as follows:

    [0030] PCR was performed by using the genome of Corynebacterium glutamicum MB001 (Baumgart M et al, Appl Environ Microbiol 79: 6006-15 (2013)) as a template and the primers lysC-1-F (aggaaacagctatgacatgattacgtttcgcccagaaccaagtagcc) and lysC-1-R (CCCAGCTTTTGctttgtgcacctttcgatctacgt), to obtain about 1.0 kb of the gene fragment lysC1 and the PCR product was purified. PCR was performed by using the genome of Corynebacterium glutamicum MB001 as a template and the primers lysC-2-F (CATGGGATCCatggccctggtcgtacagaa) and lysC-2-R (gagacgttgcccagaaccatgtcaatgttgatttctgca), to obtain about 0.9 kb of the gene fragment lysC2 and the PCR product was purified. PCR was performed by using the genome of Corynebacterium glutamicum MB001 as a template and the primers lysC-3-F (acatggttctgggcaacgtctcttctgtagaagacg) and lysC-3-R (tgcatgcctgcaggtcgactacataaggtccgacatcgcct), to obtain about 1.0 kb of the gene fragment lysC3 and the PCR product was purified. PCR was performed by using the plasmid pEC-yqhD-pduCDEGH constructed in our lab (Huang et al., Scientific Reports 7: 42246, 2017) as a template and the primers P1-F (ggtgcacaaagCAAAAGCTGGGTACCTCTATCTGGT) and P1-R (ccagggccatGGATCCCATGCTACTCCT), to obtain about 0.1 kb of the gene fragment P1 and the PCR product was purified. Corynebacterium glutamicum suicide plasmid pK18mobsacB (Journal of Biotechnology 104 (2003) 287-299) was digested with two enzymes EcoRI/XbaI, and the lysC1, lysC2, lysC3 and P1 fragments were ligated into pK18mobsacB by Gibson Assembly kit (NEB). The obtained recombinant plasmid was named as pK18-lysC. The pK18-lysC was electro-transformed Corynebacterium glutamicum MB001 using an electroporation instrument (Bole). The electric shock was at a voltage of 2.5 KV, a resistance of 200, a capacitance of 25 F (width of the electric shock cuvette is 2 mm). A recombinant strain was obtained through two screenings, one of which was on a LB plate containing 25 mg/L of kanamycin. The recombinant strain was further cultured overnight in a liquid LB culture medium, followed by a second screening on a LB plate containing 100 g/L of sucrose. Colony PCR was carried out with the primers P1-1-F and lysC-3-R, and a fragment of about 2 Kb could be cloned from the correct recombinant, which was named as C. glutamicum lysC-P1-298. A key feature of the recombinant strain is that it comprises a mutated lysC gene and promoter, as set forth in SEQ ID NO: 1, which contains a site-directed mutation Q298G at bases 998-1000 of the nucleic acid sequence. The recombinant strain can produce 18 g/L of lysine using 80 g/L of glucose, while the wild strain MB001 cannot produce lysine, indicating that in this example, the lysC gene was successfully modified, that is, glucose can flow to a metabolic branch common to lysine and ectoine. The specific fermentation process refers to the example 4.

    Example 2: Attenuating the Expression of Dihydropyrimidinedicarboxylate Synthase Gene dapA by Promoter Replacement

    [0031] Since the main fermentation product of the recombinant strain C. glutamicum lysC-P1-298 is lysine, in order to allow more substrates to be used in the synthesis of ectoine, the expression of the dihydropyrimidinedicarboxylate synthase gene dapA was further attenuated.

    [0032] PCR was performed by using the genome of Corynebacterium glutamicum MB001 as a template and the primers dap-1-F (ctatgacatgattacgaattcagatggttttcctgaccagctt) and dap-1-R (gggaagaaggaaaccttgaactctatgagcacagg), to obtain about 1.0 kb of the gene fragment dap1 and the PCR product was purified. PCR was performed by using the genome of Corynebacterium glutamicum MB001 as a template and the primers dap-2-F (ttcaaggtttccttcttccctcatttggggg) and dap-2-R (tgcctgcaggtcgactctagaggcctgtaaaggctcatttcag) to obtain about 1.0 kb of the gene fragment dap2 and the PCR product was purified. The Corynebacterium glutamicum suicide plasmid pK18mobsacB was digested with two enzymes EcoRI/XbaI, and the dap1 and dap2 fragments were ligated into the pK18mobsacB by Gibson Assembly kit (NEB). The obtained recombinant plasmid was named as pK18-dap. The pK18-dap was electro-transformed the C. glutamicum lysC-P1-298 using an electroporation instrument (Bole). The electric shock was at a voltage of 2.5 KV, a resistance of 200, a capacitance of 25 F (width of the electric shock cuvette is 2 mm). A recombinant strain was obtained through two screenings, in one of which the recombinant strain was screened on a LB plate containing 25 mg/L of kanamycin. The recombinant strain was further cultured overnight in a liquid LB culture medium, followed by a second screening on a LB plate containing 100 g/L of sucrose. Colony PCR was performed using the primers dap-1-F and dap-2-R and the sequencing was performed, and the correct recombinant strain was named as C. glutamicum lysC-dap. A key feature of the recombinant strain is that it includes a mutated dapA gene and promoter, whose sequence is set forth in SEQ ID NO: 2. The recombinant strain can produce 6 g/L of lysine and 2 g/L of glycine using 80 g/L of glucose. The specific fermentation process refers to the example 4.

    Example 3: Overexpression of the Ectoine Synthesis Pathway Related Gene ectABC

    [0033] To enhance the expression of the key gene in the ectoine synthesis pathway, the ectABC gene was artificially synthesized, whose sequence is set forth in SEQ ID NO: 3. PCR was performed on the genome of Halomonas elongata DSM 2581 with the primers ectABC-F (tgcatgcctgcaggtcgactAGGAGGCCCTTCAGatgaacg) and ectABC-R (ccgccaaaacagccaagctgttacagcggcttctggtcgt), to obtain about 2.5 kb of the gene fragment ectABC and the PCR product was purified. The Corynebacterium glutamicum expression plasmid pXMJ19 (purchased from addgene) was digested with two enzymes EcoRI/XbaI, and the ectABC fragment was further ligated into the pXMJ19 by Gibson Assembly kit (NEB). The obtained recombinant plasmid was named as pXMJ-ectABC. The pXMJ-ectABC was electro-transformed the C. glutamicum lysC-dap using an electroporation instrument (Bole). The electric shock was at a voltage of 2.5 KV, a resistance of 200, a capacitance of 25 F (width of the electric shock cup is 2 mm). A recombinant strain was screened on a LB plate containing 5 mg/L of chloramphenicol, which was named as C. glutamicum lysC-dap-ectABC. A key feature of the recombinant strain is that it includes ectABC gene, whose sequence is set forth in SEQ ID NO: 3. The recombinant strain can produce 12 g/L of ectoine by using 80 g/L of glucose, while none of the strains in examples 1 and 2 can produce ectoine. The specific fermentation process refers to the example 4.

    Example 4: Fermentation of the Recombinant C. glutamicum lysC-Dap-ectABC

    [0034] The wild type strain Corynebacterium glutamicum MB001 and recombinant strain C. glutamicum lysC-P1-298, C. glutamicum lysC-dap, C. glutamicum lysC-dap-ectABC were cultured overnight on LB plates. Single colonies from these fresh plates were inoculated into 250 ml baffled shake flasks containing 30 ml seed medium, and cultured at 32 C., 200 rpm for 12 hours.

    [0035] The formulation of the seed medium comprises (g/L): glucose 40, (NH.sub.4).sub.2SO.sub.4 5.0, K.sub.2HPO.sub.4 1.5, MgSO.sub.4 1.0, MnSO.sub.4 0.005, FeSO.sub.4 0.005, corn syrup 30. The culture medium of the C. glutamicum lysC-dap-ectABC was additionally added with 5 mg/L of chloramphenicol.

    [0036] The seed solution was inoculated into 2 L fermentation medium in an inoculation amount of 10%, and the fermentation was carried out in a 5 L fermenter. The temperature was controlled to be 320 C., the aeration rate was 1 vvm, and the rotation speed was adjusted to keep the dissolved oxygen level above 10%. The pH was controlled by feeding ammonia to be at about 7.0.

    [0037] The formulation of the fermentation medium comprises (g/L): glucose 80, (NH.sub.4).sub.2SO.sub.4 30.0, K.sub.2HPO.sub.4 2.5, MgSO.sub.4 1.0, MnSO.sub.4 0.010, FeSO.sub.4 0.010, corn syrup 15, biotin 0.0005, and thiamine hydrochloride 0.005. The culture medium of the C. glutamicum lysC-dap-ectABC was additionally added with 5 mg/L of chloramphenicol, and 1 mM IPTG was added in 3 hours after fermentation.

    [0038] The fermentation was carried out for 72 hours, and the product concentration was determined by liquid chromatography. The wild strain MB001 did not produce amino acids or ectoine, and the recombinant strain C. glutamicum lysC-P1-298 obtained in the example 1 produced 18 g/L of lysine but did not produce ectoine. The recombinant strain C. glutamicum lysC-dap obtained in the example 2 produced 6 g/L of lysine and 2 g/L of glycine but did not produce ectoine. The recombinant strain C. glutamicum lysC-dap-ectABC obtained in the example 3 produced 2 g/L of lysine and 12 g/L of ectoine.

    [0039] It can be seen that, based on examples 1 and 2 of the present application, the further constructed recombinant strain C. glutamicum lysC-dap-ectABC can ferment substrate to produce ectoine, and the amount of the produced ectoine is at the same level compared with other strains in the prior art. Since the recombinant strain C. glutamicum lysC-dap-ectABC of the present invention is food-safe and does not produce endotoxins, the cumbersome steps in the subsequent engineering for removing endotoxins and isolating and purifying the products are not necessary, which not only improves the safety of the product, but also greatly reduces the production cost.

    [0040] Although the present invention has been described in detail by the general description and the concrete embodiments, certain modification and amendments can be made based on the present invention, which will be apparent to those skilled in the art. Therefore, such modifications or amendments made without departing from the spirit of the invention are intended to be included within the patentable scope of the invention.