Flavone derivatives for the treatment and prophylaxis of hepatitis B virus disease

11708344 · 2023-07-25

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention provides novel compounds having the general formula (Formula I): wherein R.sup.1 to R.sup.6, G.sub.1, G.sub.2, A.sub.1 to A.sub.4 and m are as described herein, compositions including the compounds and methods of using the compounds. ##STR00001##

Claims

1. A compound of formula (I), ##STR00683## wherein: R.sup.1 is selected from halogen and haloC.sub.1-6alkyl; R.sup.2 is selected from H, halogen, C.sub.1-6alkyl, C.sub.1-6alkoxy, C.sub.3-7cycloalkyl and haloC.sub.1-6alkyl; R.sup.3 is selected from H, halogen and C.sub.1-6alkoxy; R.sup.4 is selected from H, hydroxy and haloC.sub.1-6alkyl; R.sup.5 is selected from H, halogen, C.sub.1-6alkyl, C.sub.1-6alkoxy and hydroxy; R.sup.6 is selected from carboxy, C.sub.1-6alkoxycarbonyl, carboxyC.sub.1-6alkoxycarbonyl, carboxyC.sub.3-7cycloalkylaminocarbonyl, carboxyheterocyclylcarbonyl, C.sub.3-7cycloalkylsulfonylaminocarbonyl, hydroxyC.sub.1-6alkylaminocarbonyl, C.sub.1-6alkylsulfonylheterocyclylcarbonyl, heterocyclylcarbonyl, hydroxyheterocyclylcarbonyl, (hydroxy).sub.2heterocyclylcarbonyl, C.sub.1-6alkylsulfonylaminocarbonylheterocyclylcarbonyl, C.sub.1-6alkylsulfonylaminocarbonyl, cyano, (C.sub.1-6alkyl).sub.2aminosulfonyl, aminocarbonyl, aminosulfonyl, C.sub.3-7cycloalkylaminocarbonylcarbonyl and C.sub.3-7cycloalkylaminocarbonyl; A.sub.1 is selected from N and CR.sup.7, wherein R.sup.7 is selected from H, halogen and haloC.sub.1-6alkyl; A.sub.2 is selected from N and CR.sup.8, wherein R.sup.8 is selected from H, halogen, hydroxy, C.sub.1-6alkyl, C.sub.1-6alkoxy, C.sub.3-7cycloalkyl, haloC.sub.1-6alkyl, haloC.sub.1-6alkoxy, haloC.sub.1-6alkylC.sub.1-6alkoxy, C.sub.1-6alkylsulfanyl, C.sub.1-6alkylsulfonyl, C.sub.3-7cycloalkylC.sub.1-6alkoxy and heterocyclyl, wherein heterocyclyl is unsubstituted or substituted one or two or three times by oxo; A.sub.3 is selected from N and CR.sup.9, wherein R.sup.9 is selected from H, amino, halogen, hydroxy, C.sub.1-6alkyl, C.sub.1-6alkoxy, haloC.sub.1-6alkyl, haloC.sub.1-6alkoxy, haloC.sub.1-6alkylC.sub.1-6alkoxy and C.sub.3-7cycloalkylC.sub.1-6alkoxy; or R.sup.8 and R.sup.9, together with the atoms to which they are attached, form a heterocyclyl ring, wherein the heterocyclyl ring is unsubstituted or substituted by one or two or three or four substituents independently selected from halogen, C.sub.1-6alkyl and oxo; A.sub.4 is selected from N and CR.sup.10, wherein R.sup.10 is selected from H and halogen; G.sub.1 is selected from C.sub.1-6alkyl, C.sub.3-7cycloalkyl, C.sub.3-7cycloalkylC.sub.1-6alkyl, phenylC.sub.1-6alkyl, C.sub.1-6alkylC.sub.3-7cycloalkylC.sub.1-6alkyl and heterocyclyl, wherein G.sub.1 is unsubstituted or substituted by one or two or three substituents independently selected from hydroxy, amino, C.sub.3-7cycloalkylsulfonylamino, C.sub.1-6alkylphenylsulfonylamino, phenylsulfonyl, C.sub.3-7cycloalkylsulfonyl, C.sub.1-6alkoxyphenylsulfonyl, phenylcarbonyl, phenylcarbonylamino, C.sub.1-6alkylcarbonylamino, C.sub.1-6alkylaminosulfonylamino, aminocarbonyamino, (C.sub.1-6alkoxy).sub.2phenylaminosulfonylamino, C.sub.1-6alkoxycarbonylcarbonylamino, (C.sub.1-6alkyl).sub.2aminosulfonylamino, C.sub.1-6alkylaminocarbonylamino, C.sub.1-6alkylaminosulfonyl, aminosulfonylamino, C.sub.3-7cycloalkylaminosulfonylamino and phenylC.sub.1-6alkylaminosulfonylamino; G.sub.2 is selected from C.sub.1-6alkyl, C.sub.3-7cycloalkyl and phenyl; and m is selected from 0 and 1; or a pharmaceutically acceptable salt thereof.

2. A compound according to claim 1, wherein: R.sup.6 is selected from carboxy, C.sub.1-6alkoxycarbonyl, carboxyC.sub.1-6alkoxycarbonyl, carboxyC.sub.3-7cycloalkylaminocarbonyl, carboxypyrrolidinylcarbonyl, C.sub.3-7cycloalkylsulfonylaminocarbonyl, hydroxyC.sub.1-6alkylaminocarbonyl, C.sub.1-6alkylsulfonylpyrrolidinylcarbonyl, morpholinylcarbonyl, hydroxypyrrolidinylcarbonyl, (hydroxy).sub.2pyrrolidinylcarbonyl, C.sub.1-6alkylsulfonylaminocarbonylpyrrolidinylcarbonyl, C.sub.1-6alkylsulfonylaminocarbonyl, cyano, (C.sub.1-6alkyl).sub.2aminosulfonyl, aminocarbonyl, aminosulfonyl, C.sub.3-7cycloalkylaminocarbonylcarbonyl and C.sub.3-7cycloalkylaminocarbonyl; A.sub.2 is selected from N and CR.sup.8; wherein R.sup.8 is selected from H, halogen, hydroxy, C.sub.1-6alkyl, C.sub.1-6alkoxy, C.sub.3-7cycloalkyl, haloC.sub.1-6alkyl, haloC.sub.1-6alkoxy, haloC.sub.1-6alkylC.sub.1-6alkoxy, C.sub.1-6alkylsulfanyl, C.sub.1-6alkylsulfonyl, C.sub.3-7cycloalkylC.sub.1-6alkoxy, thiazolyl, morpholinyl, pyrrolidinyl and oxazolidinyl, wherein pyrrolidinyl and oxazolidinyl are unsubstituted or substituted by one or two or three times by oxo; or R.sup.8 and R.sup.9, together with the atoms to which they are attached, form a 5- or 6-membered heterocyclyl ring, wherein the 5- or 6-membered heterocyclyl ring is unsubstituted or substituted by one or two or three or four substituents independently selected from halogen, C.sub.1-6alkyl and oxo; and G.sub.1 is selected from C.sub.1-6alkyl, C.sub.3-7cycloalkyl, C.sub.3-7cycloalkylC.sub.1-6alkyl, phenylC.sub.1-6alkyl, C.sub.1-6alkylC.sub.3-7cycloalkylC.sub.1-6alkyl and pyrrolidinyl, wherein G.sub.1 is unsubstituted or substituted by one or two or three substituents independently selected from hydroxy, amino, C.sub.3-7cycloalkylsulfonylamino, C.sub.1-6alkylphenylsulfonylamino, phenylsulfonyl, C.sub.3-7cycloalkylsulfonyl, C.sub.1-6alkoxyphenylsulfonyl, phenylcarbonyl, phenylcarbonylamino, C.sub.1-6alkylcarbonylamino, C.sub.1-6alkylaminosulfonylamino, aminocarbonyamino, (C.sub.1-6alkoxy).sub.2phenylaminosulfonylamino, C.sub.1-6alkoxycarbonylcarbonylamino, (C.sub.1-6alkyl).sub.2aminosulfonylamino, C.sub.1-6alkylaminocarbonylamino, C.sub.1-6alkylaminosulfonyl, aminosulfonylamino, C.sub.3-7cycloalkylaminosulfonylamino and phenylC.sub.1-6alkylaminosulfonylamino; or a pharmaceutically acceptable salt thereof.

3. A compound according to claim 1, wherein: R.sup.1 is selected from F, Cl, Br and CF.sub.3; R.sup.2 is selected from H, F, Cl, Br, methyl, methoxy, CF.sub.3 and cyclopropyl; R.sup.3 is selected from H, F and methoxy; R.sup.4 is selected from H, hydroxy and CF.sub.3; R.sup.5 is selected from H, hydroxy, methyl and methoxy; R.sup.6 is selected from carboxy, methoxycarbonyl, carboxyisopropoxycarbonyl, carboxycyclobutylaminocarbonyl, carboxypyrrolidinylcarbonyl, cyclopropylsulfonylaminocarbonyl, hydroxyethylaminocarbonyl, methylsulfonylpyrrolidinylcarbonyl, hydroxypyrrolidinylcarbonyl, (hydroxy).sub.2pyrrolidinylcarbonyl, morpholinylcarbonyl, methylsulfonylaminocarbonylpyrrolidinylcarbonyl, methylsulfonylaminocarbonyl, cyano, (methyl).sub.2aminosulfonyl, aminocarbonyl, aminosulfonyl, cyclopropylaminocarbonylcarbonyl and cyclopropylaminocarbonyl; A.sub.1 is selected from N and CR.sup.7, wherein R.sup.7 is selected from H, F, Cl, Br and CF.sub.3; A.sub.2 is selected from N and CR.sup.8, wherein R.sup.8 is selected from H, F, Cl, Br, CF.sub.3, hydroxy, methyl, ethyl, isopropyl, methoxy, ethoxy, propoxy, cyclopropyl, trifluoromethoxy, difluoromethoxy, trifluoromethylmethoxy, methylsulfonyl, methylsulfanyl, cyclopropylmethoxy, thiazolyl, morpholinyl, pyrrolidinyl and oxazolidinyl; wherein pyrrolidinyl and oxazolidinyl are unsubstituted or substituted one or two or three times independently by oxo; A.sub.3 is selected from N and CR.sup.9; wherein R.sup.9 is selected from H, amino, hydroxy, F, Cl, Br, CF.sub.3, methyl, methoxy, ethoxy, difluoromethoxy, trifluoromethoxy, trifluoromethylmethoxy, difluoromethyl and cyclopropylmethoxy; or R.sup.8 and R.sup.9, together with the atoms to which they are attached, form a 5- or 6-membered heterocyclyl ring, wherein the 5- or 6-membered heterocyclyl ring is unsubstituted or substituted by one or two or three or four substituents independently selected from F, methyl and oxo; A.sub.4 is selected from N and CR.sup.10; wherein R.sup.10 is selected from H and F; G.sub.1 is selected from methyl, ethyl, propyl, isopropyl, butyl, isobutyl, neopentyl, hexyl, isohexyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclobutylmethyl, phenylmethyl, methylcyclopropylmethyl and pyrrolidinyl, wherein G.sub.1 is unsubstituted or substituted by one or two or three substituents independently selected from hydroxy, amino, cyclopropylsulfonylamino, methylphenylsulfonylamino, phenylsulfonyl, cyclopropylsulfonyl, methoxyphenylsulfonyl, phenylcarbonyl, phenylcarbonylamino, methylcarbonylamino, ethylaminosulfonylamino, aminocarbonylamino, (methoxy).sub.2phenylcarbamoylamino, ethyoxycarbonylcarbonylamino, dimethylaminosulfonylamino, ethylaminocarbonylamino, ethylaminosulfonyl, aminosulfonylamino, methylaminosulfonylamino, isopropylaminosulfonylamino, cyclopropylaminosulfonylamino and phenylmethylaminosulfonylamino; and G.sub.2 is selected from methyl, isopropyl, cyclobutyl, cyclopentyl and phenyl; or a pharmaceutically acceptable salt thereof.

4. A compound according to claim 1, or a pharmaceutically acceptable salt thereof, wherein: R.sup.1 is halogen; R.sup.2 is selected from H, halogen, C.sub.1-6alkoxy and C.sub.3-7cycloalkyl; R.sup.4 is selected from H and hydroxy; R.sup.s is selected from H, C.sub.1-6alkyl, C.sub.1-6alkoxy and hydroxy; R.sup.6 is selected from carboxy, C.sub.1-6alkoxycarbonyl, carboxyC.sub.1-6alkoxycarbonyl, carboxyC.sub.3-7cycloalkylaminocarbonyl, carboxypyrrolidinylcarbonyl, C.sub.3-7cycloalkylsulfonylaminocarbonyl, hydroxyC.sub.1-6alkylaminocarbonyl, C.sub.1-6alkylsulfonylpyrrolidinylcarbonyl, morpholinylcarbonyl, hydroxypyrrolidinylcarbonyl, (hydroxy).sub.2pyrrolidinylcarbonyl, C.sub.1-6alkylsulfonylaminocarbonylpyrrolidinylcarbonyl, (C.sub.1-6alkyl).sub.2aminosulfonyl and aminosulfonyl; A.sub.1 is CR.sup.7, wherein R.sup.7 is selected from H and halogen; A.sub.2 is CR.sup.8, wherein R.sup.8 is selected from H, hydroxy, halogen, C.sub.1-6alkyl, C.sub.1-6alkoxy, haloC.sub.1-6alkyl, haloC.sub.1-6alkoxy and haloC.sub.1-6alkylC.sub.1-6alkoxy; A.sub.3 is selected from N and CR.sup.9, wherein R.sup.9 is selected from H, halogen, hydroxy, C.sub.1-6alkyl, C.sub.1-6alkoxy and haloC.sub.1-6alkoxy; or R.sup.8 and R.sup.9, together with the atoms to which they are attached, form a 5-membered heterocyclyl ring; G.sub.1 is selected from C.sub.1-6alkyl and C.sub.1-6alkylC.sub.3-7cycloalkylC.sub.1-6alkyl; wherein C.sub.1-6alkyl is unsubstituted or substituted by one or two or three substituents independently selected from hydroxy, amino, C.sub.3-7cycloalkylsulfonylamino, C.sub.1-6alkylphenylsulfonylamino and C.sub.1-6alkylaminosulfonylamino; and m is 0; or a pharmaceutically acceptable salt thereof.

5. A compound according to claim 4, wherein: R.sup.1 is selected from F, Cl and Br; R.sup.2 is selected from H, F, Cl, Br, methoxy and CF.sub.3; R.sup.3 is selected from H, F and methoxy; R.sup.5 is selected from H and hydroxy; R.sup.6 is selected from carboxy, methoxycarbonyl, carboxyisopropoxycarbonyl, carboxycyclobutylaminocarbonyl, carboxypyrrolidinylcarbonyl, cyclopropylsulfonylaminocarbonyl, hydroxyethylaminocarbonyl, methylsulfonylpyrrolidinylcarbonyl, hydroxypyrrolidinylcarbonyl, (hydroxy).sub.2pyrrolidinylcarbonyl, morpholinylcarbonyl, methylsulfonylaminocarbonylpyrrolidinylcarbonyl, (methyl).sub.2aminosulfonyl and aminosulfonyl; A.sub.1 is CR.sup.7, wherein R.sup.7 is selected from H, F, Cl and Br; A.sub.2 is CR.sup.8, wherein R.sup.8 is selected from H, F, Cl, Br, CF.sub.3, hydroxy, methyl, methoxy, trifluoromethoxy and trifluoromethylmethoxy; A.sub.3 is CR.sup.9, wherein R.sup.9 is selected from H, hydroxy, F, Cl, Br, methyl, methoxy and trifluoromethoxy; or R.sup.8 and R.sup.9, together with the atoms to which they are attached, form a 5-membered heterocyclyl ring; A.sub.4 is selected from N and CR.sup.10, wherein R.sup.10 is selected from H and F; and G.sub.1 is selected from methyl, ethyl, propyl, isopropyl, butyl, isobutyl, neopentyl, hexyl, isohexyl and methylcyclopropylmethyl; wherein ethyl is unsubstituted or substituted by one or two or three substituents independently selected from hydroxy, amino, cyclopropylsulfonylamino, methylphenylsulfonylamino and ethylaminosulfonylamino; or a pharmaceutically acceptable salt thereof.

6. A compound according to claim 4, wherein: R.sup.2 is H; R.sup.3 is H; R.sup.4 is H; R.sup.s is H; R.sup.6 is selected from carboxy and C.sub.1-6alkoxycarbonyl; A.sub.1 is CH; A.sub.2 is CR.sup.8, wherein R.sup.8 is selected from halogen, C.sub.1-6alkoxy, haloC.sub.1-6alkyl and haloC.sub.1-6 alkoxy; A.sub.3 is CR.sup.9, wherein R.sup.9 is selected from H, methyl and methoxy; A.sub.4 is CH; and G.sub.1 is C.sub.1-6alkyl; wherein C.sub.1-6alkyl is unsubstituted or substituted by one substituent independently selected from C.sub.3-7cycloalkylsulfonylamino and C.sub.1-6alkylaminosulfonylamino; or a pharmaceutically acceptable salt thereof.

7. A compound according to claim 6, wherein: R.sup.1 is selected from Cl and Br; R.sup.6 is selected from carboxy and methoxycarbonyl; A.sub.2 is CR.sup.8, wherein R.sup.8 is selected from Cl, Br, CF.sub.3, methoxy and trifluoromethoxy; and G.sub.1 is ethyl; wherein ethyl is unsubstituted or substituted by one substituent independently selected from cyclopropylsulfonylamino and ethylaminosulfonylamino; or a pharmaceutically acceptable salt thereof.

8. A compound according to claim 1, selected from: 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoic acid; methyl 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoate; 3-[2-(8-chloro-6-fluoro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoic acid; 3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]propanoic acid; 3-[5-chloro-2-(8-chloro-4-oxo-chromen-2-yl)-4-methyl-phenoxy]propanoic acid; 3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-4-methyl-phenoxy]propanoic acid; 3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-4-methoxy-phenoxy]propanoic acid; 3-[5-chloro-2-(8-chloro-4-oxo-chromen-2-yl)-4-methoxy-phenoxy]propanoic acid; 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethoxy)phenoxy]propanoic acid; 3-[2-(8-chloro-4-oxo-chromen-2-yl)-4,5-dimethoxy-phenoxy]propanoic acid; 3-[[6-(8-chloro-4-oxo-chromen-2-yl)-1,3-benzodioxol-5-yl]oxy]propanoic acid; 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methoxy-4-methyl-phenoxy]propanoic acid; 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methyl-phenoxy]propanoic acid; 3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-4-(trifluoromethoxy)phenoxy]propanoic acid; 3-[2-(8-chloro-4-oxo-chromen-2-yl)-4-methoxy-5-methyl-phenoxy]propanoic acid; 3-[4-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethoxy)phenoxy]propanoic acid; 3-[2-(8-chloro-4-oxo-chromen-2-yl)-4-methyl-5-(trifluoromethoxy)phenoxy]propanoic acid; 3-[2-bromo-6-(8-chloro-4-oxo-chromen-2-yl)-4-methyl-phenoxy]propanoic acid; 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methyl-4-(trifluoromethoxy)phenoxy]propanoic acid; 3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-3-fluoro-phenoxy]propanoic acid; 3-[2-(8-chloro-4-oxo-chromen-2-yl)-3-fluoro-5-methyl-phenoxy]propanoic acid; 3-[2-(8-bromo-4-oxo-chromen-2-yl)-5-(trifluoromethoxy)phenoxy]propanoic acid; 3-[2-(7-bromo-8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethoxy)phenoxy]propanoic acid; 3-[2-(8-bromo-4-oxo-chromen-2-yl)-5-methyl-phenoxy]propanoic acid; 3-[2-(8-bromo-4-oxo-chromen-2-yl)-5-chloro-4-methyl-phenoxy]propanoic acid; 3-[[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-3-pyridyl]oxy]propanoic acid; 3-[2-(8-chloro-7-fluoro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoic acid; 3-[2-(8-chloro-7-methoxy-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoic acid; 3-[2-(8-chloro-6-methoxy-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoic acid; 3-[2-(8-chloro-3-methyl-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoic acid; methyl 3-[5-chloro-2-(8-chloro-4-oxo-chromen-2-yl)-4-methyl-phenoxy]propanoate; 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]butanoic acid; 3-[3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]butanoyloxy]butanoic acid; 3-[2-(8-chloro-4-oxo-chromen-2-yl)-4-methoxy-5-(2,2,2-trifluoroethoxy)phenoxy]propanoic acid; 3-[2-[8-chloro-4-oxo-7-(trifluoromethyl)chromen-2-yl]-5-(trifluoromethoxy)phenoxy]-propanoic acid; 3-[2-(8-chloro-4-oxo-chromen-2-yl)-4-methoxy-5-(trifluoromethyl)phenoxy]propanoic acid; 3-[2-(8-chloro-4-oxo-chromen-2-yl)-4-methyl-5-(trifluoromethyl)phenoxy]propanoic acid; 3-[2-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoic acid; 3-[2-(8-chloro-3-hydroxy-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoic acid; 3-[2-(8-chloro-3-methoxy-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoic acid; 2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethoxy)phenoxy]acetic acid; 2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methyl-phenoxy]acetic acid; 2-[2-(8-chloro-4-oxo-chromen-2-yl)-4,5-dimethoxy-phenoxy]acetic acid; 2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]acetic acid; 4-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]butanoic acid; 4-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethoxy)phenoxy]butanoic acid; 4-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-4-methyl-phenoxy]butanoic acid; 4-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]butanoic acid; 4-[2-(8-chloro-4-oxo-chromen-2-yl)-4,5-dimethoxy-phenoxy]butanoic acid 4-[5-chloro-2-(8-chloro-4-oxo-chromen-2-yl)-4-methyl-phenoxy]butanoic acid 4-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-4-methoxy-phenoxy]butanoic acid 4-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methyl-phenoxy]butanoic acid 4-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methoxy-4-methyl-phenoxy]butanoic acid; 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethoxy)phenoxy]-2,2-dimethyl-propanoic acid; 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-2,2-dimethyl-propanoic acid; 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methyl-phenoxy]-2,2-dimethyl-propanoic acid; 3-[5-chloro-2-(8-chloro-4-oxo-chromen-2-yl)-4-methyl-phenoxy]-2,2-dimethyl-propanoic acid; 5-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]pentanoic acid; 7-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]heptanoic acid; 2-[1-[[2-(8-chloro-4-oxo-chromen-2-yl)-4,5-dimethoxy-phenoxy]methyl]cyclopropyl]acetic acid; 2-[1-[[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-4-methyl-phenoxy]methyl]cyclopropyl]acetic acid; 2-[1-[[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]methyl]cyclopropyl]acetic acid; 2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-2-methyl-propanoic acid; 5-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethoxy)phenoxy]-2,2-dimethyl-pentanoic acid; 2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-4-methyl-phenoxy]acetic acid; 3-[[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]acetyl]amino]cyclobutanecarboxylic acid; (2R)-1-[3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]propanoyl]pyrrolidine-2-carboxylic acid; (2S)-1-[3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]propanoyl]pyrrolidine-2-carboxylic acid; (2R)-1-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methyl-phenoxy]acetyl]pyrrolidine-2-carboxylic acid; (2S)-1-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methyl-phenoxy]acetyl]pyrrolidine-2-carboxylic acid; (2R)-1-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-4-methyl-phenoxy]acetyl]pyrrolidine-2-carboxylic acid; (2S)-1-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-4-methyl-phenoxy]acetyl]pyrrolidine-2-carboxylic acid; (2R)-1-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]acetyl]pyrrolidine-2-carboxylic acid; (2S)-1-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]acetyl]pyrrolidine-2-carboxylic acid; (3S)-1-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]acetyl]pyrrolidine-3-carboxylic acid; 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-N-cyclopropylsulfonyl-propanamide; 3-[2-(8-chloro-4-oxo-chromen-2-yl)-4,5-dimethoxy-phenoxy]-N-cyclopropylsulfonyl-propanamide; 2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-N-(2-hydroxyethyl)acetamide; 8-chloro-2-[2-[2-(3-methylsulfonylpyrrolidin-1-yl)-2-oxo-ethoxy]-4-(trifluoromethyl)phenyl]chromen-4-one; 2-[4-bromo-2-[2-[(3S)-3-hydroxypyrrolidin-1-yl]-2-oxo-ethoxy]-5-methyl-phenyl]-8-chloro-chromen-4-one; 2-[4-bromo-2-[2-[(3R)-3-hydroxypyrrolidin-1-yl]-2-oxo-ethoxy]-5-methyl-phenyl]-8-chloro-chromen-4-one; 2-[4-bromo-5-methyl-2-[2-oxo-2-[rac-(3S,4R)-3,4-dihydroxypyrrolidin-1-yl]ethoxy]phenyl]-8-chloro-chromen-4-one; 2-[2-(8-chloro-4-oxo-chromen-2-yl)-4,5-dimethoxy-phenoxy]-N-cyclopropylsulfonyl-acetamide; 8-chloro-2-[2-(2-morpholino-2-oxo-ethoxy)-4-(trifluoromethyl)phenyl]chromen-4-one; (2S)-1-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methyl-phenoxy]acetyl]-N-methylsulfonyl-pyrrolidine-2-carboxamide; (2R)-1-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methyl-phenoxy]acetyl]-N-methylsulfonyl-pyrrolidine-2-carboxamide; (2S)-2-amino-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoic acid; (2S)-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-2-(cyclopropylsulfonylamino)propanoic acid; (2S)-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-2-(p-tolylsulfonylamino)propanoic acid; methyl (2S)-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-2-(ethylsulfamoylamino)propanoate; (2S)-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-2-(ethylsulfamoylamino)propanoic acid; 4-[2-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]butanoic acid; 3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-N,N-dimethyl-propane-1-sulfonamide; 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propane-1-sulfonamide; and 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-2-hydroxy-propanoic acid; or a pharmaceutically acceptable salt thereof.

9. A compound according to claim 1, wherein: R.sup.1 is halogen; R.sup.2 is H; R.sup.3 is H; R.sup.4 is selected from H and hydroxy; R.sup.s is H; R.sup.6 is selected from carboxy, C.sub.3-7cycloalkylsulfonylaminocarbonyl and C.sub.1-6alkylsulfonylaminocarbonyl; A.sub.1 is CH; A.sub.2 is CR.sup.8, wherein R.sup.8 is selected from H, halogen, C.sub.1-6alkyl, C.sub.1-6alkoxy, C.sub.3-7cycloalkyl, haloC.sub.1-6alkyl and haloC.sub.1-6alkoxy; A.sub.3 is CR.sup.9, wherein R.sup.9 is selected from H, halogen, C.sub.1-6alkyl, C.sub.1-6alkoxy and haloC.sub.1-6alkyl; or R.sup.8 and R.sup.9, together with the atoms to which they are attached, form a 5-membered heterocyclyl ring; A.sub.4 is CH; G.sub.1 is selected from C.sub.3-7cycloalkyl, C.sub.3-7cycloalkylC.sub.1-6alkyl, phenylC.sub.1-6alkyl and pyrrolidinyl; wherein pyrrolidinyl is unsubstituted or substituted by one or two or three substituents independently selected from phenylsulfonyl, C.sub.3-7cycloalkylsulfonyl, C.sub.1-6alkoxyphenylsulfonyl and phenylcarbonyl; and m is 0; or a pharmaceutically acceptable salt thereof.

10. A compound according to claim 9, wherein: R.sup.6 is selected from carboxy and C.sub.3-7cycloalkylsulfonylaminocarbonyl; A.sub.2 is CR.sup.8, wherein R.sup.8 is selected from halogen and haloC.sub.1-6alkyl; A.sub.3 is CR.sup.9, wherein R.sup.9 is selected from H and C.sub.1-6alkyl; and G.sub.1 is selected from C.sub.3-7cycloalkyl and pyrrolidinyl; wherein pyrrolidinyl is substituted one time by phenylsulfonyl; or a pharmaceutically acceptable salt thereof.

11. A compound according to claim 1, selected from: 3-[[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]methyl]benzoic acid; 3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]cyclobutanecarboxylic acid; cis-3-[2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]cyclobutanecarboxylic acid; trans-3-[2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]cyclobutanecarboxylic acid; 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]cyclobutanecarboxylic acid; 3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-4-methoxy-phenoxy]cyclobutanecarboxylic acid; 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethoxy)phenoxy]cyclobutanecarboxylic acid; 3-[2-(8-chloro-4-oxo-chromen-2-yl)-4,5-dimethoxy-phenoxy]cyclobutanecarboxylic acid; 3-[4-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethoxy)phenoxy]cyclobutanecarboxylic acid; 3-[2-bromo-6-(8-chloro-4-oxo-chromen-2-yl)-4-methyl-phenoxy]cyclobutanecarboxylic acid; 4-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]cyclohexanecarboxylic acid; cis-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methoxy-phenoxy]cyclobutanecarboxylic acid; trans-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methoxy-phenoxy]cyclobutanecarboxylic acid; cis-3-[5-chloro-2-(8-chloro-4-oxo-chromen-2-yl)-4-methyl-phenoxy]cyclobutanecarboxylic acid; trans-3-[5-chloro-2-(8-chloro-4-oxo-chromen-2-yl)-4-methyl-phenoxy]cyclobutanecarboxylic acid; cis-3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-4-methyl-phenoxy]cyclobutanecarboxylic acid; trans-3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-4-methyl-phenoxy]cyclobutanecarboxylic acid; trans-3-[4-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-5-methoxy-phenoxy]cyclobutanecarboxylic acid; cis-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethoxy)phenoxy]cyclobutanecarboxylic acid; cis-3-[2-(8-chloro-4-oxo-chromen-2-yl)-4-methyl-phenoxy]cyclobutanecarboxylic acid trans-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methoxy-4-methyl-phenoxy]cyclobutanecarboxylic acid; cis-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methyl-phenoxy]cyclobutanecarboxylic acid; trans-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methyl-phenoxy]cyclobutanecarboxylic acid; cis-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-ethyl-phenoxy]cyclobutanecarboxylic acid; trans-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-ethyl-phenoxy]cyclobutanecarboxylic acid; cis-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-isopropyl-phenoxy]cyclobutanecarboxylic acid; trans-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-isopropyl-phenoxy]cyclobutanecarboxylic acid; trans-3-[2-(8-chloro-4-oxo-chromen-2-yl)-4-methoxy-phenoxy]cyclobutanecarboxylic acid; trans-3-[2-(8-bromo-4-oxo-chromen-2-yl)phenoxy]cyclobutanecarboxylic acid; cis-3-[2-(8-bromo-4-oxo-chromen-2-yl)phenoxy]cyclobutanecarboxylic acid; trans-3-[[6-(8-chloro-4-oxo-chromen-2-yl)-2,3-dihydrobenzofuran-5-yl]oxy]cyclobutanecarboxylic acid; trans-3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-4-(trifluoromethyl)phenoxy]cyclobutanecarboxylic acid; cis-3-[[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]methyl]cyclobutanecarboxylic acid; trans-3-[[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]methyl]cyclobutanecarboxylic acid; cis-3-[[2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]methyl]cyclobutanecarboxylic acid; trans-3-[[2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]methyl]cyclobutanecarboxylic acid; cis-3-[[2-(8-chloro-4-oxo-chromen-2-yl)-4-methoxy-phenoxy]methyl]cyclobutanecarboxylic acid; trans-3-[[2-(8-chloro-4-oxo-chromen-2-yl)-4-methoxy-phenoxy]methyl]cyclobutanecarboxylic acid; cis-3-[5-bromo-2-8-chloro-4-oxo-chromen-2-yl)phenoxy]cyclopentanecarboxylic acid; trans-3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]cyclopentanecarboxylic acid; trans-3-[[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-3-pyridyl]oxy]cyclobutanecarboxylic acid; cis-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-cyclopropyl-phenoxy]cyclobutanecarboxylic acid; trans-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-cyclopropyl-phenoxy]cyclobutanecarboxylic acid; cis-3-[5-bromo-2-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)phenoxy]cyclobutanecarboxylic acid; cis-3-[2-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)-5-methyl-phenoxy]cyclobutanecarboxylic acid; trans-3-[2-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)-5-methyl-phenoxy]cyclobutanecarboxylic acid; trans-3-[5-bromo-2-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)phenoxy]cyclobutanecarboxylic acid; cis-3-[2-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]cyclobutanecarboxylic acid; trans-3-[2-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]cyclobutanecarboxylic acid; cis-3-[2-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)-5-ethoxy-phenoxy]cyclobutanecarboxylic acid; trans-3-[2-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)-5-ethoxy-phenoxy]cyclobutanecarboxylic acid; cis-3-[5-bromo-2-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)-4-methyl-phenoxy]cyclobutanecarboxylic acid; trans-3-[5-bromo-2-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)-4-methyl-phenoxy]cyclobutanecarboxylic acid; 3-[2-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)-4,5-dimethoxy-phenoxy]cyclobutanecarboxylic acid; cis-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-N-cyclopropylsulfonyl-cyclobutanecarboxamide; trans-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-N-cyclopropylsulfonyl-cyclobutanecarboxamide; cis-3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-N-methylsulfonyl-cyclobutanecarboxamide; trans-3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-N-methylsulfonyl-cyclobutanecarboxamide; cis-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethoxy)phenoxy]-N-methylsulfonyl-cyclobutanecarboxamide; trans-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethoxy)phenoxy]-N-methylsulfonyl-cyclobutanecarboxamide; cis-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-N-methylsulfonyl-cyclobutanecarboxamide; trans-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-N-methylsulfonyl-cyclobutanecarboxamide; cis-3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-4-methyl-phenoxy]-N-methylsulfonyl-cyclobutanecarboxamide; trans-3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-4-methyl-phenoxy]-N-methylsulfonyl-cyclobutanecarboxamide; cis-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methoxy-4-methyl-phenoxy]-N-methylsulfonyl-cyclobutanecarboxamide; trans-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methoxy-4-methyl-phenoxy]-N-methylsulfonyl-cyclobutanecarboxamide; cis-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methyl-phenoxy]-N-methylsulfonyl-cyclobutanecarboxamide; trans-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methyl-phenoxy]-N-methylsulfonyl-cyclobutanecarboxamide; cis-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methyl-phenoxy]-N-cyclopropylsulfonyl-cyclobutanecarboxamide; trans-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methyl-phenoxy]-N-cyclopropylsulfonyl-cyclobutanecarboxamide; cis-3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-4-methoxy-phenoxy]-N-methylsulfonyl-cyclobutanecarboxamide; trans-3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-4-methoxy-phenoxy]-N-methylsulfonyl-cyclobutanecarboxamide; cis-3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-4-methoxy-phenoxy]-N-cyclopropylsulfonyl-cyclobutanecarboxamide; cis-3-[4-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-5-methoxy-phenoxy]-N-methylsulfonyl-cyclobutanecarboxamide; trans-3-[4-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-5-methoxy-phenoxy]-N-methylsulfonyl-cyclobutanecarboxamide; cis-3-[4-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-5-methoxy-phenoxy]-N-cyclopropylsulfonyl-cyclobutanecarboxamide; 3-[2-(8-chloro-4-oxo-chromen-2-yl)-4,5-dimethoxy-phenoxy]-N-methylsulfonyl-cyclobutanecarboxamide; 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]cyclobutanecarbonitrile; (2S,4S)-4-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]pyrrolidine-2-carboxylic acid; (2S,4R)-1-(benzenesulfonyl)-4-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]pyrrolidine-2-carboxylic acid; (2S,4R)-4-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-1-cyclopropylsulfonyl-pyrrolidine-2-carboxylic acid; (2S,4S)-4-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-1-cyclopropylsulfonyl-pyrrolidine-2-carboxylic acid; (2S,4S)-4-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-1-(3-methoxyphenyl)sulfonyl-pyrrolidine-2-carboxylic acid; (2S,4S)-1-(benzenesulfonyl)-4-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]pyrrolidine-2-carboxylic acid; (2S,4S)-1-(benzenesulfonyl)-4-[2-(8-chloro-4-oxo-chromen-2-yl)-4,5-dimethoxy-phenoxy]pyrrolidine-2-carboxylic acid; (2S,4S)-1-(benzenesulfonyl)-4-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]pyrrolidine-2-carboxylic acid; (2S,4S)-4-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-1-cyclopropylsulfonyl-pyrrolidine-2-carboxylic acid; (2S,4S)-1-(benzenesulfonyl)-4-[5-chloro-2-(8-chloro-4-oxo-chromen-2-yl)-4-methyl-phenoxy]pyrrolidine-2-carboxylic acid; (2S,4S)-1-(benzenesulfonyl)-4-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethoxy)phenoxy]pyrrolidine-2-carboxylic acid; (2S,4S)-1-benzoyl-4-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]pyrrolidine-2-carboxylic acid; (2R,4S)-1-(benzenesulfonyl)-4-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]pyrrolidine-2-carboxylic acid; and (2R,4R)-1-(benzenesulfonyl)-4-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]pyrrolidine-2-carboxylic acid; or a pharmaceutically acceptable salt thereof.

12. A compound according to claim 1, wherein: R.sup.2 is selected from H, halogen, C.sub.1-6alkyl, C.sub.3-7cycloalkyl and haloC.sub.1-6alkyl; R.sup.3 is selected from H and halogen; R.sup.5 is selected from H and C.sub.1-6alkoxy; R.sup.6 is selected from carboxy, C.sub.1-6alkoxycarbonyl, carboxypyrrolidinylcarbonyl, C.sub.3-7cycloalkylsulfonylaminocarbonyl, hydroxypyrrolidinylcarbonyl, C.sub.1-6alkylsulfonylaminocarbonyl and aminocarbonyl; A.sub.1 is CR.sup.7, wherein R.sup.7 is selected from H and halogen; A.sub.2 is selected from N and CR.sup.8, wherein R.sup.8 is selected from H, halogen, hydroxy, C.sub.1-6alkyl, C.sub.1-6alkoxy, C.sub.3-7cycloalkyl, haloC.sub.1-6alkyl, haloC.sub.1-6alkoxy, C.sub.1-6alkylsulfanyl, C.sub.1-6alkylsulfonyl, C.sub.3-7cycloalkylC.sub.1-6alkoxy, thiazolyl, morpholinyl, pyrrolidinyl and oxazolidinyl, wherein pyrrolidinyl and oxazolidinyl are unsubstituted or substituted one or two or three times by oxo; A.sub.3 is CR.sup.9; wherein R.sup.9 is selected from H, amino, halogen, hydroxy, C.sub.1-6alkyl, C.sub.1-6alkoxy, haloC.sub.1-6alkyl, haloC.sub.1-6alkoxy, haloC.sub.1-6alkylC.sub.1-6alkoxy and C.sub.3-7cycloalkylC.sub.1-6alkoxy; or R.sup.8 and R.sup.9, together with the atoms to which they are attached, form a 5- or 6-membered heterocyclyl ring; wherein 5- or 6-membered heterocyclyl ring is unsubstituted or substituted by one or two or three or four substituents independently selected from halogen, C.sub.1-6alkyl and oxo; G.sub.1 is C.sub.1-6alkyl; wherein C.sub.1-6alkyl is unsubstituted or substituted one or two or three times by hydroxy; and m is 1; or a pharmaceutically acceptable salt thereof.

13. A compound according to claim 12, wherein: R.sup.1 is selected from F, Cl, Br and CF.sub.3; R.sup.2 is selected from H, F, Cl, Br, methyl, CF.sub.3 and cyclopropyl; R.sup.3 is selected from H and F; R.sup.4 is selected from H, hydroxy and CF.sub.3; R.sup.s is selected from H and methoxy; R.sup.6 is selected from carboxy, methoxycarbonyl, carboxypyrrolidinylcarbonyl, cyclopropylsulfonylaminocarbonyl, hydroxypyrrolidinylcarbonyl, methylsulfonylaminocarbonyl and aminocarbonyl; A.sub.1 is CR.sup.7, wherein R.sup.7 is selected from H, F, Cl and Br; A.sub.2 is selected from N and CR.sup.8, wherein R.sup.8 is selected from H, F, Cl, Br, CF.sub.3, hydroxy, methyl, methoxy, ethoxy, propoxy, cyclopropyl, trifluoromethoxy, difluoromethoxy, trifluoromethylmethoxy, methylsulfonyl, methylsulfanyl, cyclopropylmethoxy, thiazolyl, morpholinyl, pyrrolidinyl and oxazolidinyl; wherein pyrrolidinyl and oxazolidinyl are unsubstituted or substituted one or two or three times independently by oxo; A.sub.3 is CR.sup.9, wherein R.sup.9 is selected from H, amino, hydroxy, F, Cl, Br, CF.sub.3, methyl, methoxy, ethoxy, difluoromethoxy, trifluoromethoxy, trifluoromethylmethoxy, difluoromethyl and cyclopropylmethoxy; or R.sup.8 and R.sup.9, together with the atoms to which they are attached, form a 5- or 6-membered heterocyclyl ring; wherein 5- or 6-membered heterocyclyl ring is unsubstituted or substituted by one or two or three or four substituents independently selected from F, methyl and oxo; A.sub.4 is selected from N and CR.sup.10, wherein R.sup.10 is selected from H and F; G.sub.1 is selected from ethyl, propyl, butyl and neopentyl, wherein propyl is unsubstituted or substituted one or two or three times by hydroxy; and G.sub.2 is selected from methyl, isopropyl, cyclobutyl, cyclopentyl and phenyl; or a pharmaceutically acceptable salt thereof.

14. A compound according to claim 12, wherein: R.sup.1 is halogen; R.sup.2 is H; R.sup.3 is H; R.sup.4 is H; R.sup.s is H; R.sup.6 is carboxy; A.sub.1 is CH; A.sub.2 is CR.sup.8, wherein R.sup.8 is selected from halogen, C.sub.1-6alkyl, C.sub.1-6alkoxy and haloC.sub.1-6 alkyl; A.sub.3 is CR.sup.9, wherein R.sup.9 is selected from H, C.sub.1-6alkyl and C.sub.1-6alkoxy; A.sub.4 is CH; G.sub.1 is C.sub.1-6alkyl; and G.sub.2 is selected from C.sub.1-6alkyl and C.sub.3-7cycloalkyl; or a pharmaceutically acceptable salt thereof.

15. A compound according to claim 14, wherein: R.sup.1 is selected from Cl and Br; A.sub.2 is CR.sup.8, wherein R.sup.8 is selected from Cl, CF.sub.3, methyl and methoxy; A.sub.3 is CR.sup.9, wherein R.sup.9 is selected from H, methyl and methoxy; G.sub.1 is selected from ethyl and propyl; and G.sub.2 is selected from methyl and cyclobutyl; or a pharmaceutically acceptable salt thereof.

16. A compound according to claim 12, selected from: 2-[3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propoxy]acetic acid; 2-[3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methyl-phenoxy]propoxy]acetic acid; methyl 3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate; cis-3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; trans-3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; 3-[2-[5-chloro-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; 2-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]ethoxy]acetic acid; 2-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]acetic acid; 2-[3-[5-chloro-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]propoxy]acetic acid; 2-[3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]propoxy]acetic acid; 2-[3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-4-methyl-phenoxy]propoxy]acetic acid; 2-[3-[2-(8-chloro-4-oxo-chromen-2-yl)-4,5-dimethoxy-phenoxy]propoxy]acetic acid; 2-[3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-4-methoxy-phenoxy]propoxy]acetic acid; 2-[3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethoxy)phenoxy]propoxy]acetic acid; 2-[3-[[6-(8-chloro-4-oxo-chromen-2-yl)-1,3-benzodioxol-5-yl]oxy]propoxy]acetic acid; 2-[3-[5-chloro-2-(8-chloro-4-oxo-chromen-2-yl)-4-methoxy-phenoxy]propoxy]acetic acid; 2-[3-[2-(8-bromo-4-oxo-chromen-2-yl)-5-methyl-phenoxy]propoxy]acetic acid; 2-[3-[2-(8-bromo-4-oxo-chromen-2-yl)-5-chloro-4-methyl-phenoxy]propoxy]acetic acid; 2-[3-[5-chloro-2-(8-chloro-4-oxo-chromen-2-yl)-4-methyl-phenoxy]propoxy]acetic acid; 2-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-4-methoxy-phenoxy]ethoxy]acetic acid; 2-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-4-methyl-phenoxy]ethoxy]acetic acid; 2-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4,5-dimethoxy-phenoxy]ethoxy]acetic acid; 2-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethoxy)phenoxy]ethoxy]acetic acid; 2-[3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]butoxy]acetic acid; cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; trans-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]ethoxy]cyclobutanecarboxylic acid; trans-3-[2-[[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-3-pyridyl]oxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[5-bromo-2-(8-chloro-6-fluoro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-(8-chloro-7-methyl-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; trans-3-[2-[2-(8-chloro-7-methyl-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[5-bromo-2-(8-chloro-7-fluoro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; trans-3-[2-[5-bromo-2-(8-chloro-7-fluoro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-4-methyl-phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[4-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-5-fluoro-phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4-fluoro-phenoxy]ethoxy]cyclobutanecarboxylic acid; trans-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4-fluoro-phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-fluoro-phenoxy]ethoxy]cyclobutanecarboxylic acid; trans-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-fluoro-phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-ethoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid; trans-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-ethoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-(8-chloro-6-fluoro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; trans-3-[2-[2-(8-chloro-6-fluoro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-6-fluoro-phenoxy]ethoxy]cyclobutanecarboxylic acid; trans-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-6-fluoro-phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methyl-phenoxy]ethoxy]cyclobutanecarboxylic acid; trans-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methyl-phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid; trans-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[4-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-5-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid; trans-3-[2-[4-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-5-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methoxy-4-methyl-phenoxy]ethoxy]cyclobutanecarboxylic acid; trans-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methoxy-4-methyl-phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-4-(trifluoromethyl)phenoxy]ethoxy]cyclobutanecarboxylic acid; trans-3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-4-(trifluoromethyl)phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[[6-(8-chloro-4-oxo-chromen-2-yl)-1,3-benzodioxol-5-yl]oxy]ethoxy]cyclobutanecarboxylic acid; trans-3-[2-[[6-(8-chloro-4-oxo-chromen-2-yl)-1,3-benzodioxol-5-yl]oxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-4-fluoro-phenoxy]ethoxy]cyclobutanecarboxylic acid; trans-3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-4-fluoro-phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-(8-chloro-6-fluoro-4-oxo-chromen-2-yl)-5-fluoro-phenoxy]ethoxy]cyclobutanecarboxylic acid; trans-3-[2-[2-(8-chloro-6-fluoro-4-oxo-chromen-2-yl)-5-fluoro-phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-(8-bromo-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; trans-3-[2-[2-(8-bromo-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-[4-oxo-8-(trifluoromethyl)chromen-2-yl]phenoxy]ethoxy]cyclobutanecarboxylic acid; trans-3-[2-[2-[4-oxo-8-(trifluoromethyl)chromen-2-yl]phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[5-bromo-2-[8-chloro-4-oxo-7-(trifluoromethyl)chromen-2-yl]phenoxy]ethoxy]cyclobutanecarboxylic acid; trans-3-[2-[5-bromo-2-[8-chloro-4-oxo-7-(trifluoromethyl)chromen-2-yl]phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[5-bromo-2-[8-chloro-4-oxo-5-(trifluoromethyl)chromen-2-yl]phenoxy]ethoxy]cyclobutanecarboxylic acid; trans-3-[2-[5-bromo-2-[8-chloro-4-oxo-5-(trifluoromethyl)chromen-2-yl]phenoxy]ethoxy]cyclobutanecarboxylic acid; 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4-methyl-phenoxy]ethoxy]cyclobutanecarboxylic acid; trans-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4-methyl-phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4-ethoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid; trans-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4-ethoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethoxy)phenoxy]ethoxy]cyclobutanecarboxylic acid; trans-3-[2-[4-bromo-2-(8-chloro-6-fluoro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-(8-chloro-7-fluoro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[5-chloro-2-(8-chloro-4-oxo-chromen-2-yl)-4-methyl-phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]propoxy]cyclobutanecarboxylic acid; trans-3-[3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]propoxy]cyclobutanecarboxylic acid; cis-3-[2-[5-bromo-4-chloro-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-(8-chloro-7-cyclopropyl-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid; 3-[2-[[4-(8-chloro-4-oxo-chromen-2-yl)-3-pyridyl]oxy]ethoxy]cyclobutanecarboxylic acid 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(2-oxooxazolidin-3-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; methyl 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(2-oxooxazolidin-3-yl)phenoxy]ethoxy]cyclobutanecarboxylate; cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(2-oxopyrrolidin-1-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; trans-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(2-oxopyrrolidin-1-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methylsulfanyl-phenoxy]ethoxy]cyclobutanecarboxylic acid; trans-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methylsulfanyl-phenoxy]ethoxy]cyclobutanecarboxylic acid; trans-methyl 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methylsulfonyl-phenoxy]ethoxy]cyclobutanecarboxylate; cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-thiazol-2-yl-phenoxy]ethoxy]cyclobutanecarboxylic acid; trans-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-thiazol-2-yl-phenoxy]ethoxy]cyclobutanecarboxylic acid; trans-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-morpholino-phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-pyrrolidin-1-yl-phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-cyclopropyl-phenoxy]ethoxy]cyclobutanecarboxylic acid; trans-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-cyclopropyl-phenoxy]ethoxy]cyclobutanecarboxylic acid; 3-[2-[2-bromo-6-(8-chloro-6-fluoro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-3-fluoro-phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4,5-dimethoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-4-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid; 3-[2-[[7-(8-chloro-4-oxo-chromen-2-yl)-2,3-dihydro-1,4-benzodioxin-6-yl]oxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4-(difluoromethyl)-5-methyl-phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-hydroxy-4-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4-methoxy-5-propoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-ethoxy-4-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(cyclopropylmethoxy)-4-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4-methoxy-5-(2,2,2-trifluoroethoxy)phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(difluoromethoxy)-4-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4-(cyclopropylmethoxy)-5-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4-hydroxy-5-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4-ethoxy-5-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methoxy-4-(2,2,2-trifluoroethoxy)phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4-(difluoromethoxy)-5-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4,5-bis(difluoromethoxy)phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4,5-diethoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methoxy-4-(trifluoromethoxy)phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-hydroxy-4-(trifluoromethoxy)phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[6-(8-chloro-4-oxo-chromen-2-yl)-2-oxo-indolin-5-yl]oxyethoxy]cyclobutanecarboxylic acid; cis-3-[2-[6-(8-chloro-4-oxo-chromen-2-yl)-3,3-dimethyl-2-oxo-indolin-5-yl]oxyethoxy]cyclobutanecarboxylic acid; cis-3-[2-[6-(8-chloro-4-oxo-chromen-2-yl)-1,3,3-trimethyl-2-oxo-indolin-5-yl]oxyethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-[8-chloro-4-oxo-5-(trifluoromethyl)chromen-2-yl]phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-[8-chloro-4-oxo-5-(trifluoromethyl)chromen-2-yl]-5-ethoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-[8-chloro-4-oxo-5-(trifluoromethyl)chromen-2-yl]-4,5-dimethoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid; 3-[2-[2-[8-chloro-4-oxo-7-(trifluoromethyl)chromen-2-yl]-5-ethoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)-4,5-dimethoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[2-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]ethoxy]cyclobutanecarboxylic acid; 2-[3-[2-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propoxy]acetic acid; cis-3-[2-[5-bromo-2-(8-chloro-3-methoxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid; cis-3-[2-[[6-(8-chloro-4-oxo-chromen-2-yl)-2,2-difluoro-1,3-benzodioxol-5-yl]oxy]ethoxy]cyclobutanecarboxylic acid; 3-[3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propoxy]cyclobutanecarboxylic acid; 3-[3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propoxy]cyclopentanecarboxylic acid; 3-[3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]propoxy]cyclopentanecarboxylic acid; 3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclopentanecarboxylic acid; 4-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]benzoic acid; 3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]benzoic acid; 2-[3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propoxy]-2-methyl-propanoic acid; cis-3-[3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-2,2-dimethyl-propoxy]cyclobutanecarboxylic acid; trans-3-[3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-2,2-dimethyl-propoxy]cyclobutanecarboxylic acid; (3R)-1-[2-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]acetyl]pyrrolidine-3-carboxylic acid; (3S)-1-[2-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]acetyl]pyrrolidine-3-carboxylic acid; 2-[3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-2-hydroxy-propoxy]acetic acid; 2-[3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-2-hydroxy-propoxy]acetamide; 2-[3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-2-hydroxy-propoxy]acetic acid; 2-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]-N-cyclopropylsulfonyl-acetamide; 2-[3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propoxy]-N-cyclopropylsulfonyl-acetamide; 2-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]ethoxy]-N-cyclopropylsulfonyl-acetamide; cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4,5-dimethoxy-phenoxy]ethoxy]-N-cyclopropylsulfonyl-cyclobutanecarboxamide; 2-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]ethoxy]-N-methylsulfonyl-acetamide; cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]ethoxy]-N-methylsulfonyl-cyclobutanecarboxamide; cis-3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]-N-methylsulfonyl-cyclobutanecarboxamide; trans-3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]-N-methylsulfonyl-cyclobutanecarboxamide; 3-[3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propoxy]-N-methylsulfonyl-cycloheptanecarboxamide; cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4,5-dimethoxy-phenoxy]ethoxy]-N-methylsulfonyl-cyclobutanecarboxamide; and 2-[4-bromo-2-[2-[2-(3-hydroxypyrrolidin-1-yl)-2-oxo-ethoxy]ethoxy]phenyl]-8-chloro-chromen-4-one; or a pharmaceutically acceptable salt thereof.

17. A pharmaceutical composition comprising a compound in accordance with claim 1 and a therapeutically inert carrier.

18. A compound according to claim 4, or a pharmaceutically acceptable salt thereof, wherein R.sup.1 is halogen.

19. A compound according to claim 5, or a pharmaceutically acceptable salt thereof, wherein R.sup.8 is selected from Cl and Br.

20. A compound according to claim 5, or a pharmaceutically acceptable salt thereof, wherein R.sup.6 is selected from carboxy and C.sub.1-6alkoxycarbonyl.

21. A compound according to claim 20, or a pharmaceutically acceptable salt thereof, wherein R.sup.6 is selected from carboxy and methoxycarbonyl.

22. A compound according to claim 1, or a pharmaceutically acceptable salt thereof, wherein A.sub.3 is CR.sup.9, wherein R.sup.9 is selected from H, C.sub.1-6alkyl and C.sub.1-6alkoxy.

23. A compound according to claim 22, or a pharmaceutically acceptable salt thereof, wherein A.sub.3 is CR.sup.9, wherein R.sup.9 is selected from H, methyl and methoxy.

24. A compound according to claim 23, or a pharmaceutically acceptable salt thereof, wherein G.sub.1 is C.sub.1-6alkyl, wherein C.sub.1-6alkyl is unsubstituted or substituted by one substituent independently selected from C.sub.3-7cycloalkylsulfonylamino and C.sub.1-6 alkylaminosulfonylamino.

25. A compound according to claim 24, or a pharmaceutically acceptable salt thereof, wherein G.sub.1 is ethyl, wherein ethyl is unsubstituted or substituted by one substituent independently selected from cyclopropylsulfonylamino and ethylaminosulfonylamino.

26. A pharmaceutical composition comprising a compound in accordance with claim 18 and a therapeutically inert carrier.

27. A pharmaceutical composition comprising a compound in accordance with claim 8 and a therapeutically inert carrier.

28. A pharmaceutical composition comprising a compound in accordance with claim 11 and a therapeutically inert carrier.

29. A pharmaceutical composition comprising a compound in accordance with claim 16 and a therapeutically inert carrier.

Description

BRIEF DESCRIPTION OF THE FIGURES(S)

(1) FIG. 1: the result of BIO-Example 3 in cccDNA Southern Blot assay, it indicates that C003-A dose-dependently reduced cccDNA level in HepDES19 cells.

EXAMPLES

(2) The invention will be more fully understood by reference to the following examples. They should not, however, be construed as limiting the scope of the invention.

(3) Abbreviations used herein are as follows: ACN: acetonitrile BBr.sub.3: boron tribromide DMAP: 4-dimethylaminopyridine DMF: N,N-dimethylformamide IC.sub.50: the molar concentration of an inhibitor, which produces 50% of the maximum possible response for that inhibitor. FBS: fetal bovine serum H.sub.2O.sub.2: hydrogen peroxide HPLC: high performance liquid chromatography MS (ESI): mass spectroscopy (electron spray ionization) Ms: methylsulfonyl obsd.: observed PE: petroleum ether EtOAc: ethyl acetate AcOH; acetic acid DIBAL: diisobutylaluminium hydride THF: tetrahydrofuran LiHMDS: lithium bis(trimethylsilyl)amide LiAlH.sub.4: lithium aluminium hydride TFA: trifluoro acetic acid MnO.sub.2: manganese dioxide DIPEA: N,N-Diisopropylethylamine HATU: 1-[Bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxid hexafluorophosphate DIAD: Diisopropyl azodicarboxylate DABCO: 1,4-Diazabicyclo[2.2.2]octane m-CPBA: 3-Chlorobenzene-1-carboperoxoic acid DAST: Diethylaminosulfur trifluoride RuPhos Pd G2: Chloro(2-dicyclohexylphosphino-2′, 6′-diisopropoxy-1,1′-biphenyl)[2-(2′-amino-1,1′-biphenyl)]palladium(II) Ts: p-tolylsulfonyl δ: chemical shift

GENERAL EXPERIMENTAL CONDITIONS

(4) Intermediates and final compounds were purified by flash chromatography using one of the following instruments: i) Biotage SP1 system and the Quad 12/25 Cartridge module, ii) column chromatography on silica gel combi-flash chromatography instmment. Silica gel Brand and pore size: i) KP-SIL 60 Å, particle size: 40-60 μm; ii) CAS registry NO: Silica Gel: 63231-67-4, particle size: 47-60 micron silica gel; iii) ZCX from Qingdao Haiyang Chemical Co., Ltd, pore: 200-300 or 300-400.

(5) Intermediates and final compounds were purified by preparative HPLC on reversed phase column using X Bridge™ Perp C.sub.18 (5 μm, OBD™ 30×100 mm) column or SunFire™ Perp C.sub.18 (5 μm, OBD™ 30×100 mm) column.

(6) LC/MS spectra were obtained using a Waters UPLC-SQD Mass. Standard LC/MS conditions were as follows (running time 3 minutes): Acidic condition: A: 0.1% formic acid and 1% acetonitrile in H.sub.2O; B: 0.1% formic acid in acetonitrile;

(7) Basic condition: A: 0.05% NH.sub.3—H.sub.2O in H.sub.2O; B: acetonitrile.

(8) Mass spectra (MS): generally only ions which indicate the parent mass are reported, and unless otherwise stated the mass ion quoted is the positive mass ion (M+H).sup.+.

(9) NMR Spectra were obtained using Bruker Avance 400 MHz.

(10) All reactions involving air-sensitive reagents were performed under an argon atmosphere. Reagents were used as received from commercial suppliers without further purification unless otherwise noted.

PREPARATIVE EXAMPLES

Intermediate 1: 8-chloro-2-[2-hydroxy-4-(trifluoromethyl)phenyl]chromen-4-one

(11) ##STR00039##

Step 1: Preparation of (E)-1-(3-chloro-2-hydroxy-phenyl)-3-[2-methoxy-4-(trifluoromethyl)phenyl]prop-2-en-1-one

(12) ##STR00040##

(13) A mixture of 1-(3-chloro-2-hydroxy-phenyl)ethanone (CAS #: 3226-34-4, Cat. #: BD11027, from Bide Pharmatech, 2.5 g, 14.7 mmol), 2-methoxy-4-(trifluoromethyl)benzaldehyde (CAS #: 132927-09-4, Cat. #: H26797, from Alfa Aesar, 2 g, 14.7 mmol) and KOH (1.64 g, 29.3 mmol) in EtOH (25 mL) was stirred at 100° C. for 3 hours. After the reaction was completed, the mixture was then adjusted to pH ˜4 by addition of 2N HCl and the resulting suspension was filtered. The solid was collected and dried in vacuo to give the crude (E)-1-(3-chloro-2-hydroxy-phenyl)-3-[2-methoxy-4-(trifluoromethyl)phenyl]prop-2-en-1-one (3.3 g, 78%) as a yellow solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]:357.2.

Step 2: Preparation of 8-chloro-2-[2-methoxy-4-(trifluoromethyl)phenyl]chromen-4-one

(14) ##STR00041##

(15) To a solution of (E)-1-(3-chloro-2-hydroxy-phenyl)-3-[2-methoxy-4-(trifluoromethyl)phenyl]prop-2-en-1-one (5.3 g, 18.4 mmol) in DMSO (60 mL) was added I.sub.2 (466 mg, 1.84 mmol) and then the mixture was stirred at 140° C. for 3 hours. After the reaction was completed, the mixture was cooled to room temperature, quenched with saturated NaHSO.sub.3 solution (10 mL). The mixture was diluted with water (100 mL) and the resulting suspension was filtered. The solid was collected and dried in vacuo to give the 8-chloro-2-[2-methoxy-4-(trifluoromethyl)phenyl]chromen-4-one (5 g, 95% yield) as a yellow solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 355.1.

Step 3: Preparation of 8-chloro-2-[2-hydroxy-4-(trifluoromethyl)phenyl]chromen-4-one

(16) ##STR00042##

(17) To a solution of 8-chloro-2-[2-methoxy-4-(trifluoromethyl)phenyl]chromen-4-one (5 g, 14.0 mmol) in dichloromethane (40 mL) was added BBr.sub.3 (1 M solution in dichloromethane, 69.8 mL, 69.8 mmol) at room temperature. The mixture was stirred at room temperature overnight. After the reaction was completed, the mixture was concentrated in vacuo and the residue was suspended in saturated NH.sub.4Cl solution (30 mL). The solid was collected by filtration and dried in vacuo to give the crude 8-chloro-2-[2-hydroxy-4-(trifluoromethyl)phenyl]chromen-4-one (4.1 g, 85.9% yield) as a yellow solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 341.2.

Intermediate 2: 8-chloro-2-(2-hydroxy-4-methyl-phenyl)chromen-4-one

(18) ##STR00043##

(19) Int-2 was prepared in analogy to the procedure described for the preparation of compound Int-1 by using 2-methoxy-4-methyl-benzaldehyde as the starting material instead of 2-methoxy-4-(trifluoromethyl)benzaldehyde in Step 1. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 287.1.

Intermediate 3: 8-chloro-2-(2-hydroxyphenyl)chromen-4-one

(20) ##STR00044##

(21) Int-3 was prepared in analogy to the procedure described for the preparation of compound Int-1 by using 2-hydroxybenzaldehyde as the starting material instead of 2-methoxy-4-(trifluoromethyl)benzaldehyde in Step 1. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 273.2.

Intermediate 4: 2-(4-bromo-2-hydroxy-phenyl)-8-chloro-chromen-4-one

(22) ##STR00045##

(23) Int-4 was prepared in analogy to the procedure described for the preparation of compound Int-1 by using 4-bromo-2-hydroxy-benzaldehyde as the starting material instead of 2-methoxy-4-(trifluoromethyl)benzaldehyde in Step 1. MS obsd. (ESI.sup.+) [(M+H).sup.+]:351.2.

Intermediate 5: 8-chloro-2-(4-chloro-2-hydroxy-5-methyl-phenyl)chromen-4-one

(24) ##STR00046##

Step 1: Preparation of 4-chloro-2-hydroxy-5-methyl-benzaldehyde

(25) ##STR00047##

(26) To a solution of 3-chloro-4-methyl-phenol (10.0 g, 70.1 mmol) in ACN (200 mL) were added formaldehyde (8.42 g, 280.54 mmol), TEA (39.1 mL, 280.5 mmol) and magnesium chloride (27.0 mL, 210.4 mmol) and the mixture was stirred at 80° C. for 16 hours. After the reaction was completed, the reaction was quenched with 1M HCl (500 mL) and extracted with EtOAc (150 mL) three times. The combined organic layer was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo to give the crude 4-chloro-2-hydroxy-5-methyl-benzaldehyde (11.3 g, 66.24 mmol, 94.45% yield) as brown oil, which was used in the next step directly without further purification.

Step 2: Preparation of 4-chloro-2-(methoxymethoxy)-5-methyl-benzaldehyde

(27) ##STR00048##

(28) To a solution of 4-chloro-2-hydroxy-5-methyl-benzaldehyde (9.6 g, 56.28 mmol, in THE (100 mL) cooled at 0° C. was added sodium hydride (3.38 g, 84.41 mmol) in portions. After addition, the mixture was stirred at 0° C. for 30 minutes and then to the resulting mixture was added bromomethyl methyl ether (10.55 g, 84.41 mmol) dropwise. The reaction mixture was stirred at 0° C. for another 2 hours. After the reaction was complete, the mixture was poured into ice-water (200 ml) slowly and extracted with EtOAc (80 mL) three times. The combined organic layer was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo to give the crude 4-chloro-2-(methoxymethoxy)-5-methyl-benzaldehyde (12 g 99.34% yield) as a white solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 215.1.

Step 3: Preparation of (E)-1-(3-chloro-2-hydroxy-phenyl)-3-[4-chloro-2-(methoxymethoxy)-5-methyl-phenyl]prop-2-en-1-one

(29) ##STR00049##

(30) To a solution of 4-chloro-2-(methoxymethoxy)-5-methyl-benzaldehyde (6.0 g, 27.95 mmol), 1-(3-chloro-2-hydroxy-phenyl)ethanone (4.77 g, 27.95 mmol) in EtOH (300 mL) was added KOH (15.68 g, 279.52 mmol) and the mixture was then stirred at 35° C. for 16 hours. After the reaction was completed, the mixture was poured into 0.5 M HCl (200 mL) and the resulting suspension was then filtered. The solid was collected and then dried under vacuum to give the crude (E)-1-(3-chloro-2-hydroxy-phenyl)-3-[4-chloro-2-(methoxymethoxy)-5-methyl-phenyl]prop-2-en-1-one (10 g, 27.23 mmol, 97.42% yield) as a yellow solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 367.0.

Step 4: Preparation of 8-chloro-2-[4-chloro-2-(methoxymethoxy)-5-methyl-phenyl]chromen-4-one

(31) ##STR00050##

(32) To a solution of (E)-1-(3-chloro-2-hydroxy-phenyl)-3-[4-chloro-2-(methoxymethoxy)-5-methyl-phenyl]prop-2-en-1-one (10.0 g, 27.23 mmol, 1 eq) in DMSO (250 mL) was added iodine (345.58 mg, 1.36 mmol, 0.050 eq) and the mixture was then stirred at 140° C. under N.sub.2 for 2 hours. After the reaction was complete, the mixture was poured into ice-water and the resulting suspension was filtered. The solid was washed with water and then collected to give the crude 8-chloro-2-[4-chloro-2-(methoxymethoxy)-5-methyl-phenyl]chromen-4-one (8.7 g, 23.82 mmol, 87.48% yield) as a yellow solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 365.0.

Step 5: Preparation of 8-chloro-2-(4-chloro-2-hydroxy-5-methyl-phenyl)chromen-4-one

(33) ##STR00051##

(34) To a solution of 8-chloro-2-[4-chloro-2-(methoxymethoxy)-5-methyl-phenyl]chromen-4-one (3.4 g, 9.31 mmol, 1 eq) in dichloromethane (10 mL) was added trifluoroacetic acid (10.0 mL, 129.8 mmol, 13.94 eq). The reaction mixture was then stirred at room temperature for 16 hours. After the reaction was completed, The reaction mixture was concentrated in vacuo to give the crude 8-chloro-2-(4-chloro-2-hydroxy-5-methyl-phenyl)chromen-4-one (2.7 g, 8.41 mmol, 90.31% yield) as a brown solid, which was used in the next step directly. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 320.9.

Intermediate 6: 2-(4-bromo-2-hydroxy-5-methyl-phenyl)-8-chloro-chromen-4-one

(35) ##STR00052##

Step 1: Preparation of 4-bromo-2-hydroxy-5-methyl-benzaldehyde

(36) ##STR00053##

(37) Int-6a was prepared in analogy to the procedure described for the preparation of compound Int-5a by using 3-bromo-4-methyl-phenol as the starting material instead of 3-chloro-4-methyl-phenol in Step 1.

Step 2: Preparation of 2-(4-bromo-2-hydroxy-5-methyl-phenyl)-8-chloro-chromen-4-one

(38) ##STR00054##

(39) Int-6 was prepared in analogy to the procedure described for the preparation of compound Int-5 by using 4-bromo-2-hydroxy-5-methyl-benzaldehyde as the starting material instead of 4-chloro-2-hydroxy-5-methyl-benzaldehyde in Step 2. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 341.0.

Intermediate 7: 2-(4-bromo-2-hydroxy-5-methoxy-phenyl)-8-chloro-chromen-4-one

(40) ##STR00055##

(41) Int-7 was prepared in analogy to the procedure described for the preparation of compound Int-5 by using 4-bromo-2-hydroxy-5-methoxy-benzaldehyde (CAS #: 63272-66-2, Cat. #: SY025557, from Accela ChemBio Inc.) as the starting material instead of 4-chloro-2-hydroxy-5-methyl-benzaldehyde in Step 2. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 381.1.

Intermediate 8: 8-chloro-2-(4-chloro-2-hydroxy-5-methoxy-phenyl)chromen-4-one

(42) ##STR00056##

Step 1: Preparation of 4-chloro-2-hydroxy-5-methoxy-benzaldehyde

(43) ##STR00057##

(44) Int-8a was prepared in analogy to the procedure described for the preparation of compound Int-5a by using 3-chloro-4-methoxy-phenol as the starting material instead of 3-chloro-4-methyl-phenol in Step 1.

Step 2: Preparation of 8-chloro-2-(4-chloro-2-hydroxy-5-methoxy-phenyl)chromen-4-one

(45) ##STR00058##

(46) Int-8 was prepared in analogy to the procedure described for the preparation of compound Int-5 by using 4-chloro-2-hydroxy-5-methoxy-benzaldehyde as the starting material instead of 4-chloro-2-hydroxy-5-methyl-benzaldehyde in Step 2. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 337.2. Intermediate 9: 8-chloro-2-[2-hydroxy-4-(trifluoromethoxy)phenyl]chromen-4-one

(47) ##STR00059##

(48) Int-9 was prepared in analogy to the procedure described for the preparation of compound Int-1 by using 2-methoxy-4-(trifluoromethoxy)benzaldehyde (CAS #: 886500-13-6, Cat. #: BD188719, from Bepharm) as the starting material instead of 2-methoxy-4-(trifluoromethyl)benzaldehyde in Step 1. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 357.1.

Intermediate 10: 8-chloro-2-(2-hydroxy-4,5-dimethoxy-phenyl)chromen-4-one

(49) ##STR00060##

(50) Int-10 was prepared in analogy to the procedure described for the preparation of compound Int-5 by using 2-hydroxy-4,5-dimethoxy-benzaldehyde (CAS #: 14382-91-3, Cat. #: SY025559, from Accela ChemBio Inc.) as the starting material instead of 4-chloro-2-hydroxy-5-methyl-benzaldehyde in Step 2. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 333.2.

Intermediate 11: 8-chloro-2-(6-hydroxy-1,3-benzodioxol-5-yl)chromen-4-one

(51) ##STR00061##

(52) Int-11 was prepared in analogy to the procedure described for the preparation of compound Int-5 by using 1,3-benzodioxol-5-ol (CAS #: 533-31-3, Cat. #: SY015819, from Accela ChemBio Inc.) as the starting material instead of 3-chloro-4-methyl-phenol in Step 1. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 317.3.

Intermediate 12: 8-chloro-2-(2-hydroxy-4-methoxy-5-methyl-phenyl)chromen-4-one

(53) ##STR00062##

Step 1: Preparation of 2-hydroxy-4-methoxy-5-methyl-benzaldehyde

(54) ##STR00063##

(55) Int-12a was prepared in analogy to the procedure described for the preparation of compound Int-5a by using 3-methoxy-4-methyl-phenol as the starting material instead of 3-chloro-4-methyl-phenol in Step 1.

Step 2: Preparation of 8-chloro-2-(2-hydroxy-4-methoxy-5-methyl-phenyl)chromen-4-one

(56) ##STR00064##

(57) Int-12 was prepared in analogy to the procedure described for the preparation of compound Int-5 by using 2-hydroxy-4-methoxy-5-methyl-benzaldehyde (Int-12a) as the starting material instead of 4-chloro-2-hydroxy-5-methyl-benzaldehyde in Step 2. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 317.1.

Intermediate 13: 8-chloro-2-(2-hydroxy-4-methoxy-phenyl)chromen-4-one

(58) ##STR00065##

(59) Int-13 was prepared in analogy to the procedure described for the preparation of compound Int-5 by using 2-hydroxy-4-methoxy-benzaldehyde (CAS #: 673-22-3, Cat. #: SY012912, from Accela ChemBio Inc.) as the starting material instead of 4-chloro-2-hydroxy-5-methyl-benzaldehyde in Step 2. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 302.9.

Intermediate 14: 2-[4-bromo-2-hydroxy-5-(trifluoromethoxy)phenyl]-8-chloro-chromen-4-one

(60) ##STR00066##

Step 1: Preparation of 2-bromo-4-methoxy-1-(trifluoromethoxy)benzene

(61) ##STR00067##

(62) To a solution of 3-bromo-4-(trifluoromethoxy)phenol (CAS #: 886496-88-4, Cat. #: SY024383, from Accela ChemBio Inc., 2000.0 mg, 7.9 mmol) and K.sub.2CO.sub.3 (2151.0 mg, 15.8 mmol) in acetone (50 mL) were added iodomethane (2.2 g, 15.6 mmol) and the mixture was stirred at room temperature for 18 hours. After the reaction was completed, the mixture was filtered and the filtrate was concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluent with PE:EtOAc=10:1 to 3:1) to give 2-bromo-4-methoxy-1-(trifluoromethoxy)benzene (1800 mg, yield 85.3%) as a yellow solid. MS obsd. (ESI.sup.+) [(M+Na)].sup.+: 294.0.

Step 2: Preparation of 4-bromo-2-methoxy-5-(trifluoromethoxy)benzaldehyde

(63) ##STR00068##

(64) To a solution of 2-bromo-4-methoxy-1-(trifluoromethoxy)benzene (2000 mg, 7.4 mmol) in DCM (20 mL) cooled at 78° C. was added TiCl.sub.4 (1680 mg, 8.86 mmol) and the mixture was stirred at −78° C. for 30 minutes. To the resulting solution was added 1,1-dichlorodimethyl ether (1866 mg, 16.3 mmol). The reaction was then warmed to room temperature and stirred at room temperature for 2 hours. After the reaction was completed, the reaction was quenched by NH.sub.4Cl solution (30 mL) and extracted with DCM (20 mL) three times. The combined organic layer was dried over MgSO.sub.4 and concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluent with PE:EtOAc 100:1 to 3:1) to give 4-bromo-2-methoxy-5-(trifluoromethoxy)benzaldehyde (500 mg, 22.7% yield) as a white solid. .sup.1H NMR (CDCl.sub.3, 400 MHz): δ ppm 10.30 (s, 1H), 7.69 (d, J=1.3 Hz, 1H), 7.22 (s, 1H), 3.90 (s, 3H).

Step 3: Preparation of 2-[4-bromo-2-hydroxy-5-(trifluoromethoxy)phenyl]-8-chloro-chromen-4-one

(65) ##STR00069##

(66) Int-14 was prepared in analogy to the procedure described for the preparation of compound Int-1 by using 4-bromo-2-methoxy-5-(trifluoromethoxy)benzaldehyde as the starting material instead of 2-methoxy-4-(trifluoromethyl)benzaldehyde in Step 1. MS obsd. (ESI.sup.+) [(M+H)].sup.+: 436.0.

Intermediate 15: 8-chloro-2-(2-hydroxy-5-methoxy-4-methyl-phenyl)chromen-4-one

(67) ##STR00070##

Step 1: Preparation of 2-hydroxy-5-methoxy-4-methyl-benzaldehyde

(68) ##STR00071##

(69) Int-15a was prepared in analogy to the procedure described for the preparation of compound Int-5a by using 4-methoxy-3-methyl-phenol as the starting material instead of 3-chloro-4-methyl-phenol in Step 1.

Step 2: Preparation of 8-chloro-2-(2-hydroxy-5-methoxy-4-methyl-phenyl)chromen-4-one

(70) ##STR00072##

(71) Int-15 was prepared in analogy to the procedure described for the preparation of compound Int-5 by using 2-hydroxy-5-methoxy-4-methyl-benzaldehyde (Int-15a) as the starting material instead of 4-chloro-2-hydroxy-5-methyl-benzaldehyde in Step 2. MS obsd. (ESI.sup.+) [(M+H)].sup.+: 317.2.

Intermediate 16: 2-[5-bromo-2-hydroxy-4-(trifluoromethoxy)phenyl]-8-chloro-chromen-4-one

(72) ##STR00073##

Step 1: Preparation of 5-bromo-2-hydroxy-4-(trifluoromethoxy)benzaldehyde

(73) ##STR00074##

(74) Int-16a was prepared in analogy to the procedure described for the preparation of compound Int-5a by using 4-bromo-3-(trifluoromethoxy)phenol (CAS #: 886499-93-0, Cat. #: BD217660, from Bide Pharmtach) as the starting material instead of 3-chloro-4-methy 1-phenol in Step 1.

Step 2: Preparation of 5-bromo-2-(methoxymethoxy)-4-(trifluoromethoxy)benzaldehyde

(75) ##STR00075##

(76) Int-16b was prepared in analogy to the procedure described for the preparation of compound Int-5b by using 5-bromo-2-hydroxy-4-(trifluoromethoxy)benzaldehyde as the starting material instead of 4-chloro-2-hydroxy-5-methyl-benzaldehyde in Step 2.

Step 3: Preparation of 2-[5-bromo-2-hydroxy-4-(trifluoromethoxy)phenyl]-8-chloro-chromen-4-one

(77) ##STR00076##

(78) Int-16 was prepared in analogy to the procedure described for the preparation of compound Int-5 by using 5-bromo-2-(methoxymethoxy)-4-(trifluoromethoxy)benzaldehyde as the starting material instead of 4-chloro-2-(methoxymethoxy)-5-methyl-benzaldehyde in Step 3. MS obsd. (ESI.sup.+) [(M+H)].sup.+: 435.1.

Intermediate 17: 8-chloro-2-[2-hydroxy-5-methyl-4-(trifluoromethoxy)phenyl]chromen-4-one

(79) ##STR00077##

Step 1: Preparation of 2-(methoxymethoxy)-5-methyl-4-(trifluoromethoxy)benzaldehyde

(80) ##STR00078##

(81) To a solution of 5-bromo-2-(methoxymethoxy)-4-(trifluoromethoxy)benzaldehyde (Int-16b, 500 mg, 1.52 mmol), trimethylboroxine (381 mg, 3.02 mmol), K.sub.2CO.sub.3 (630 mg, 4.56 mmol) in dioxane (10 mL) under N.sub.2 was added Pd(dppf).sub.2C.sub.1-2 (111.1 mg, 0.1 mmol) and the mixture was then stirred at 110° C. under N.sub.2 for 1 hour. After the reaction was completed, the mixture was cooled to room temperature and concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluent with PE/EtOAc=100:1 to 2:1) to give 2-(methoxymethoxy)-5-methyl-4-(trifluoromethoxy)benzaldehyde (310 mg, 77.2% yield) as an off-white solid.

Step 2: Preparation of 8-chloro-2-[2-hydroxy-5-methyl-4-(trifluoromethoxy)phenyl]chromen-4-one

(82) ##STR00079##

(83) Int-17 was prepared in analogy to the procedure described for the preparation of compound Int-5 by using 2-(methoxymethoxy)-5-methyl-4-(trifluoromethoxy)benzaldehyde as the starting material instead of 4-chloro-2-(methoxymethoxy)-5-methyl-benzaldehyde in Step 3. MS obsd. (ESI.sup.+) [(M+H)].sup.+: 371.2.

Intermediate 18: 2-(3-bromo-2-hydroxy-5-methyl-phenyl)-8-chloro-chromen-4-one

(84) ##STR00080##

Step 1: Preparation of 3-bromo-2-hydroxy-5-methyl-benzaldehyde

(85) ##STR00081##

(86) Int-18a was prepared in analogy to the procedure described for the preparation of compound Int-5a by using 2-bromo-4-methyl-phenol as the starting material instead of 3-chloro-4-methyl-phenol in Step 1.

Step 2: Preparation of 2-(3-bromo-2-hydroxy-5-methyl-phenyl)-8-chloro-chromen-4-one

(87) ##STR00082##

(88) Int-18 was prepared in analogy to the procedure described for the preparation of compound Int-5 by using 3-bromo-2-hydroxy-5-methyl-benzaldehyde as the starting material instead of 4-chloro-2-hydroxy-5-methyl-benzaldehyde in Step 2. MS obsd. (ESI.sup.+) [(M+H)].sup.+: 365.1.

Intermediate 19: 8-chloro-2-[2-hydroxy-4-methyl-5-(trifluoromethoxy)phenyl]chromen-4-one

(89) ##STR00083##

Step 1: Preparation of 4-bromo-2-hydroxy-5-(trifluoromethoxy)benzaldehyde

(90) ##STR00084##

(91) To a solution of 4-bromo-2-methoxy-5-(trifluoromethoxy)benzaldehyde (Int-14b, 2 g, 4.7 mmol) in DCM (30 mL) cooled at −78° C. under N.sub.2 atmosphere was added BBr.sub.3 (3.35 g, 13.6 mmol). After completion of addition, the solution was stirred at −78° C. for additional 30 minutes. After the reaction was completed, the solution was poured into ice-water (50 mL) and the resulting suspension was extracted with EtOAc (100 mL) three times. The combined organic layer was concentrated in vacuo and the residue was purified by column chromatography on silica gel (eluent with PE:DCM=1:1) to give the 4-bromo-2-hydroxy-5-(trifluoromethoxy)benzaldehyde (1.7 g, 75.8%) as a brown solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 285.0.

Step 2: Preparation of 4-bromo-2-(methoxymethoxy)-5-(trifluoromethoxy)benzaldehyde

(92) ##STR00085##

(93) Int-19b was prepared in analogy to the procedure described for the preparation of compound Int-5b by using 4-bromo-2-hydroxy-5-(trifluoromethoxy)benzaldehyde as the starting material instead of 4-chloro-2-hydroxy-5-methyl-benzaldehyde in Step 2.

Step 3: Preparation of 2-(methoxymethoxy)-4-methyl-5-(trifluoromethoxy)benzaldehyde

(94) ##STR00086##

(95) Int-19c was prepared in analogy to the procedure described for the preparation of compound Int-17a by using 4-bromo-2-(methoxymethoxy)-5-(trifluoromethoxy)benzaldehyde as the starting material instead of 5-bromo-2-(methoxymethoxy)-4-(trifluoromethoxy)benzaldehyde in Step 1.

Step 4: Preparation of 8-chloro-2-[2-hydroxy-4-methyl-5-(trifluoromethoxy)phenyl]chromen-4-one

(96) ##STR00087##

(97) Int-19 was prepared in analogy to the procedure described for the preparation of compound Int-5 by using 2-(methoxymethoxy)-4-methyl-5-(trifluoromethoxy)benzaldehyde as the starting material instead of 4-chloro-2-(methoxymethoxy)-5-methyl-benzaldehyde in Step 3. MS obsd. (ESI.sup.+) [(M+H)].sup.+: 371.1.

Intermediate 20: 2-(4-bromo-2-fluoro-6-hydroxy-phenyl)-8-chloro-chromen-4-one

(98) ##STR00088##

Step 1: Preparation of 2-(4-bromo-2-fluoro-6-methoxy-phenyl)-8-chloro-chromen-4-one

(99) ##STR00089##

(100) Int-20a was prepared in analogy to the procedure described for the preparation of compound Int-1b by using 4-bromo-2-fluoro-6-methoxybenzaldehyde (CAS #: 856767-09-4, Cat. #: BD259901, from Bide Pharmatech) as the starting material instead of 2-methoxy-4-(trifluoromethyl)benzaldehyde in Step 1.

Step 2: Preparation of 2-(4-bromo-2-fluoro-6-hydroxy-phenyl)-8-chloro-chromen-4-one

(101) ##STR00090##

(102) Int-20 was prepared in analogy to the procedure described for the preparation of compound Int-1 by using 2-(4-bromo-2-fluoro-6-methoxy-phenyl)-8-chloro-chromen-4-one as the starting material instead of 8-chloro-2-[2-methoxy-4-(trifluoromethyl)phenyl]chromen-4-one in Step 3. MS obsd. (ESI.sup.+) [(M+H)].sup.+: 369.2.

Intermediate 21: 8-chloro-2-(2-fluoro-6-hydroxy-4-methyl-phenyl)chromen-4-one

(103) ##STR00091##

Step 1: Preparation of 8-chloro-2-(2-fluoro-6-methoxy-4-methyl-phenyl)chromen-4-one

(104) ##STR00092##

(105) To a solution of 2-(4-bromo-2-fluoro-6-methoxy-phenyl)-8-chloro-chromen-4-one (Int-22a, 300.0 mg, 0.8 mmol), trimethylboroxine (196.4 mg, 1.56 mmol), K.sub.2CO.sub.3 (324.3 mg, 2.35 mmol) in dioxane (10 mL) under N.sub.2 was added Pd(dppf).sub.2C.sub.1-2 (57.8 mg, 0.08 mmol) and the mixture was then stirred at 110° C. under N.sub.2 for 1 hour. After the reaction was completed, the mixture was cooled to room temperature and concentrated in vacuo, the residue was purified by column chromatography on silica gel (eluent with PE/EtOAc=100:1 to 2:1) to give 8-chloro-2-(2-fluoro-6-methoxy-4-methyl-phenyl)chromen-4-one (150 mg, 57.2% yield) as an off-white solid.

Step 2: Preparation of 8-chloro-2-(2-fluoro-6-hydroxy-4-methyl-phenyl)chromen-4-one

(106) ##STR00093##

(107) Int-21 was prepared in analogy to the procedure described for the preparation of compound Int-1 by using 8-chloro-2-(2-fluoro-6-methoxy-4-methyl-phenyl)chromen-4-one as the starting material instead of 8-chloro-2-[2-methoxy-4-(trifluoromethyl)phenyl]chromen-4-one in Step 3. MS obsd. (ESI.sup.+) [(M+H)].sup.+: 305.0.

Intermediate 22: 8-bromo-2-[2-hydroxy-4-(trifluoromethoxy)phenyl]chromen-4-one

(108) ##STR00094##

(109) Int-22 was prepared in analogy to the procedure described for the preparation of compound Int-1 by using 1-(3-bromo-2-hydroxy-phenyl)ethanone (CAS #: 1836-05-1, Cat. #: BD50461, from Bide Pharmatech) and 2-methoxy-4-(trifluoromethoxy)benzaldehyde as the starting materials instead of 1-(3-chloro-2-hydroxy-phenyl)ethanone and 2-methoxy-4-(trifluoromethyl)benzaldehyde in Step 1. MS obsd. (ESI.sup.+) [(M+H)].sup.+: 401.2.

Intermediate 23: 7-bromo-8-chloro-2-[2-hydroxy-4-(trifluoromethoxy)phenyl]chromen-4-one

(110) ##STR00095##

Step 1: Preparation of (3-bromo-2-chloro-phenyl) acetate

(111) ##STR00096##

(112) To a mixture of 3-bromo-2-chloro-phenol (10.0 g, 68.24 mmol) and TEA (7.6 g, 75.06 mmol) in dichloromethane (150 mL) was added acetyl chloride (5.36 g, 68.24 mmol) at 0° C. and the mixture was then stirred at room temperature for 16 hours. After the reaction was completed, the mixture was poured into water (30 mL) and extracted with dichloromethane (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was then purified by column chromatography on silica gel (elution with PE:EtOAc=50:1-20:1) to give (3-bromo-2-chloro-phenyl) acetate (10.0 g, 75%) as colorless oil. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 247.9.

Step 2: Preparation of 1-(4-bromo-3-chloro-2-hydroxy-phenyl)ethanone

(113) ##STR00097##

(114) A mixture of (3-bromo-2-chloro-phenyl) acetate (10.0 g, 53.03 mmol) and AlCl.sub.3 (7.07 g, 53.03 mmol) was stirred at 150° C. for 5 hours. After the reaction was completed, the mixture was poured into water (100 mL) and extracted with EtOAc (250 mL) twice. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was then purified by column chromatography on silica gel (elution with PE:EtOAc=50:1-20:1) to give 1-(4-bromo-3-chloro-2-hydroxy-phenyl)ethanone (3.0 g, 30.0%) as a white solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 247.9.

Step 3: Preparation of 7-bromo-8-chloro-2-[2-hydroxy-4-(trifluoromethoxy)phenyl]chromen-4-one

(115) ##STR00098##

(116) Int-23 was prepared in analogy to the procedure described for the preparation of compound Int-1 by using 1-(4-bromo-3-chloro-2-hydroxy-phenyl)ethanone and 2-methoxy-4-(trifluoromethoxy)benzaldehyde as the starting materials instead of 1-(3-chloro-2-hydroxy-phenyl)ethanone and 2-methoxy-4-(trifluoromethyl)benzaldehyde in Step 1. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 435.1.

Intermediate 24: 8-bromo-2-(2-hydroxy-4-methyl-phenyl)chromen-4-one

(117) ##STR00099##

(118) Int-24 was prepared in analogy to the procedure described for the preparation of compound Int-1 by using 1-(3-bromo-2-hydroxy-phenyl)ethanone and 2-methoxy-4-methyl-benzaldehyde as the starting materials instead of 1-(3-chloro-2-hydroxy-phenyl)ethanone and 2-methoxy-4-(trifluoromethyl)benzaldehyde in Step 1. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 331.1.

Intermediate 25: 8-bromo-2-(4-chloro-2-hydroxy-5-methyl-phenyl)chromen-4-one

(119) ##STR00100##

(120) Int-25 was prepared in analogy to the procedure described for the preparation of compound Int-5 by using 1-(3-bromo-2-hydroxy-phenyl)ethanone as the starting material instead of 1-(3-chloro-2-hydroxy-phenyl)ethanone in Step 3. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 365.0.

Intermediate 26: 2-(5-bromo-3-hydroxy-2-pyridyl)-8-chloro-chromen-4-one

(121) ##STR00101##

Step 1: Preparation of 5-bromo-3-methoxy-pyridine-2-carboxylic acid

(122) ##STR00102##

(123) To a solution of 5-bromo-3-methoxy-pyridine-2-carbonitrile (CAS #: 36057-46-2, Cat. #: SY162901, from Accela ChemBio Inc, 3.2 g, 15.02 mmol) in THF (80 mL) was added 5N NaOH solution (15 mL, 75 mmol) and the mixture was stirred at 110° C. for 6 hours. The mixture was then cooled to room temperature and adjusted to pH˜3 by addition of 6N HCl. The resulting mixture was diluted with EtOAc (150 mL), washed with water (30 mL) twice, brine (30 mL), dried over MgSO.sub.4 and concentrated in vacuo to give 5-bromo-3-methoxy-pyridine-2-carboxylic acid (2.5 g, 71.73% yield) as a white solid. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm: 13.27 (br s, 1H), 8.29 (d, J=1.7 Hz, 1H), 7.92 (d, J=1.7 Hz, 1H), 3.88 (s, 3H). MS obsd. (ESI.sup.+)[(M+H).sup.+]: 232.0.

Step 2: Preparation of 5-bromo-3-methoxy-pyridine-2-carbonyl chloride

(124) ##STR00103##

(125) To a solution of 5-bromo-3-methoxy-pyridine-2-carboxylic acid (1.5 g, 6.46 mmol) in DCM (60 mL) was added oxalyl chloride (4.1 g, 32.32 mmol, 5 eq) at 0° C. and the mixture was stirred at room temperature for 2 hours. The resulting mixture was concentrated in vacuo to give 5-bromo-3-methoxy-pyridine-2-carbonyl chloride (1.61 g, 99.43% yield) as dark brown oil, which was used in the next step directly without further purification.

Step 3: Preparation of (2-acetyl-6-chloro-phenyl) 5-bromo-3-methoxy-pyridine-2-carboxylate

(126) ##STR00104##

(127) To a solution of 1-(3-chloro-2-hydroxy-phenyl)ethanone (1.1 g, 6.47 mmol) and TEA (4.51 mL, 32.34 mmol) in DCM (40 mL) was added 5-bromo-3-methoxy-pyridine-2-carbonyl chloride solution (1.62 g, 6.47 mmol, dissolved in DCM (15 mL)) at 0° C. The mixture was stirred at room temperature for 2 hours. The mixture was then concentrated in vacuo and the residue was redissolved in EtOAc (150 mL). The resulting solution was washed with water (30 mL) twice, brine (50 mL), dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was then purified by column chromatography (eluted with PE/EtOAc=100:1 to 2:1) to give (2-acetyl-6-chloro-phenyl) 5-bromo-3-methoxy-pyridine-2-carboxylate (1.0 g, 40.2% yield) as a red solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 383.9.

Step 4: Preparation of 2-(5-bromo-3-methoxy-2-pyridyl)-8-chloro-chromen-4-one

(128) ##STR00105##

(129) To a solution of (2-acetyl-6-chloro-phenyl) 5-bromo-3-methoxy-pyridine-2-carboxylate (1.0 g, 2.6 mmol) in pyridine (15 mL) was added KOH (218.8 mg, 3.9 mmol) and the mixture was stirred at 50° C. for 30 minutes. The mixture was poured into 4N HCl (50 mL) and the mixture was adjusted to pH˜9 by addition of saturated Na.sub.2CO.sub.3 solution. The mixture was extracted with CHCl.sub.3 (50 mL) four times. The combined organic layer was washed with H.sub.2O (100 mL), brine, dried over MgSO.sub.4, filtered and the filtrate was concentrated in vacuo. The residue was dissolved in AcOH (20 mL) and to the resulting solution was added H.sub.2SO.sub.4 (0.26 g, 2.6 mmol). The mixture was stirred at 100° C. for 2 hours and the mixture was concentrated in vacuo. The residue was diluted with water (30 mL) and adjusted to pH˜9 by addition of saturated Na.sub.2CO.sub.3. The resulting mixture was extracted with CHCl.sub.3 (50 mL) four times. The combined organic layer was washed with H.sub.2O (100 mL), brine, dried over MgSO.sub.4, filtered and the filtrate was concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluent with PE/EtOAc=3:1) to give 2-(5-bromo-3-methoxy-2-pyridyl)-8-chloro-chromen-4-one (420 mg, 44.06% yield) as a red solid. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 366.0.

Step 5: Preparation of 2-(5-bromo-3-hydroxy-2-pyridyl)-8-chloro-chromen-4-one

(130) ##STR00106##

(131) To a solution of 2-(5-bromo-3-methoxy-2-pyridyl)-8-chloro-chromen-4-one (200.0 mg, 0.550 mmol) in chloroform (20 mL) was added BBr.sub.3 (25.0 mL) at 0° C. and the mixture was stirred at 50° C. for 48 hours. Then to the resulting solution was added MeOH (10 mL) and the mixture was concentrated in vacuo. The residue was triturated with solvent (eluted with PE:EtOAc=20:1, 15 mL) and the mixture was then filtered to give 2-(5-bromo-3-hydroxy-2-pyridyl)-8-chloro-chromen-4-one (150 mg, 77.98% yield) as a brown solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 351.9.

Intermediate 27: 2-[4-bromo-2-hydroxy-5-(trifluoromethyl)phenyl]-8-chloro-chromen-4-one

(132) ##STR00107##

Step 1: Preparation of methyl 4-amino-5-iodo-2-methoxy-benzoate

(133) ##STR00108##

(134) To a solution of methyl 4-amino-2-methoxybenzoate (CAS #: 27492-84-8, Cat. #: SY007291, from Accela ChemBio Inc, 20.0 g, 110.38 mmol) in 1,4-dioxane (80 mL) and pyridine (80 mL) was added iodine (56.0 g, 220.76 mmol) at room temperature. The resulting mixture was heated at 50° C. for 3 hours. After the reaction was completed, the mixture was cooled to room temperature and quenched by 2M Na.sub.2SO.sub.3 solution (200 mL). The resulting solution was extracted with EtOAc (50 mL) three times. The combined organic layer was washed with water, brine, dried over Na.sub.2SO.sub.4 and then concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluted with PE:EtOAc=2/1) to give methyl 4-amino-5-iodo-2-methoxy-benzoate (21.0 g, 68.38 mmol, 57.62% yield, purity 93.78%) as a light yellow solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 308.0.

Step 2: Preparation of methyl 4-bromo-5-iodo-2-methoxy-benzoate

(135) ##STR00109##

(136) To a mixture of methyl 4-amino-5-iodo-2-methoxy-benzoate (2 g, 6.51 mmol) and copper (I) bromide (1.3 g, 9.12 mmol) in ACN (15 mL) cooled in an ice-water bath were added isoamyl nitrite (839.27 mg, 7.16 mmol). Then the mixture was stirred at 70° C. for 1 hour. After the reaction was completed, the reaction mixture was poured into water (40 mL) and the resulting suspension was extracted with EtOAc (30 mL) three times. The combined organic phase was washed with brine (20 mL), dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluted with PE/EtOAc=10/1) to give methyl 4-bromo-5-iodo-2-methoxy-benzoate (1.5 g, 4.04 mmol, 57.74% yield, purity 83.31%) as a light yellow solid.

Step 3: Preparation of methyl 4-bromo-2-methoxy-5-(trifluoromethyl)benzoate

(137) ##STR00110##

(138) To a solution of methyl 4-bromo-5-iodo-2-methoxy-benzoate (1.82 g, 4.91 mmol) in DMF (20 mL) were added methyl 2,2-difluoro-2-(fluorosulfonyl)acetate (1.88 g, 9.81 mmol) and iodocopper (1.86 g, 9.81 mmol) under N.sub.2 atmosphere. The mixture was then stirred at 85° C. for 6 hours. The reaction mixture was then filtered and the filtrate was diluted with water (100 mL). The resulting suspension was extracted with EtOAc (80 mL) three times. The combined organic layer was washed by brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluted with PE:EtOAc=4:1) to give methyl 4-bromo-2-methoxy-5-(trifluoromethyl)benzoate (1.20 mg, 3.83 mmol, 68.75% yield) as a light yellow solid. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 313.0.

Step 4: Preparation of [4-bromo-2-methoxy-5-(trifluoromethyl)phenyl]methanol

(139) ##STR00111##

(140) To a solution of methyl 4-bromo-2-methoxy-5-(trifluoromethyl)benzoate (1500.0 mg, 4.79 mmol) in THF (20 mL) was added DIBAL (2 mol/L in THF, 12 mL, 24 mmol) dropwise at −78° C. and the reaction was stirred at −78° C. for extra 2 hours after addition. After the reaction was completed, the reaction was quenched with NH.sub.4Cl solution (4 mL) and the resulting solution was stirred at room temperature for 10 minutes. The mixture was then diluted with water (40 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo to give [4-bromo-2-methoxy-5-(trifluoromethyl)phenyl]methanol (1100 mg, 72.49% yield) as a light yellow solid.

Step 5: Preparation of 4-bromo-2-methoxy-5-(trifluoromethyl)benzaldehyde

(141) ##STR00112##

(142) To a solution of [4-bromo-2-methoxy-5-(trifluoromethyl)phenyl]methanol (120.0 mg, 0.420 mmol) in DCM (5 mL) cooled in an ice-water bath was added Dess-Martin periodinane (214.26 mg, 0.510 mmol) and the resulting mixture was stirred at room temperature for another 0.5 hour. After the reaction was completed, the reaction mixture was quenched with water (20 mL) and then extracted with DCM (20 mL) three times, the combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give 4-bromo-2-methoxy-5-(trifluoromethyl)benzaldehyde (86 mg, 64.24% yield) as a light yellow solid. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 283.0.

Step 6: Preparation of 2-[4-bromo-2-hydroxy-5-(trifluoromethyl)phenyl]-8-chloro-chromen-4-one

(143) ##STR00113##

(144) Int-27 was prepared in analogy to the procedure described for the preparation of compound Int-1 by using 4-bromo-2-hydroxy-benzaldehyde as the starting material instead of 2-methoxy-4-(trifluoromethyl)benzaldehyde in Step 1. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 419.2.

Intermediate 28: 8-bromo-2-(2-hydroxyphenyl)chromen-4-one

(145) ##STR00114##

(146) Int-28 was prepared in analogy to the procedure described for the preparation of compound Int-1 by using 1-(3-bromo-2-hydroxy-phenyl)ethanone and 2-methoxybenzaldehyde as the starting materials instead of 1-(3-chloro-2-hydroxy-phenyl)ethanone and 2-methoxy-4-(trifluoromethyl)benzaldehyde in Step 1. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 317.1.

Intermediate 29: 8-chloro-2-(4-ethyl-2-hydroxy-phenyl)chromen-4-one

(147) ##STR00115##

(148) Int-29 was prepared in analogy to the procedure described for the preparation of compound Int-1 by using 4-ethyl-2-methoxy-benzaldehyde as the starting materials instead of 2-methoxy-4-(trifluoromethyl)benzaldehyde in Step 1. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 301.2.

Intermediate 30: 8-chloro-2-(2-hydroxy-4-isopropyl-phenyl)chromen-4-one

(149) ##STR00116##

(150) Int-30 was prepared in analogy to the procedure described for the preparation of compound Int-1 by using 4-isopropyl-2-methoxy-benzaldehyde as the starting materials instead of 2-methoxy-4-(trifluoromethyl)benzaldehyde in Step 1. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 315.1.

Intermediate 31: 8-chloro-2-(2-hydroxy-5-methyl-phenyl)chromen-4-one

(151) ##STR00117##

(152) Int-31 was prepared in analogy to the procedure described for the preparation of compound Int-1 by using 2-methoxy-5-methyl-benzaldehyde as the starting materials instead of 2-methoxy-4-(trifluoromethyl)benzaldehyde in Step 1. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 287.1.

Intermediate 32: 8-chloro-2-(2-hydroxy-5-methoxy-phenyl)chromen-4-one

(153) ##STR00118##

(154) Int-32 was prepared in analogy to the procedure described for the preparation of compound Int-5 by using 2-hydroxy-5-methoxy-benzaldehyde as the starting material instead of 4-chloro-2-hydroxy-5-methyl-benzaldehyde in Step 2. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 303.0.

Intermediate 33: 8-chloro-2-(5-hydroxy-2,3-dihydrobenzofuran-6-yl)chromen-4-one

(155) ##STR00119##

Step 1: Preparation of 5-hydroxy-2,3-dihydrobenzofuran-6-carbaldehyde

(156) ##STR00120##

(157) Int-33a was prepared in analogy to the procedure described for the preparation of compound Int-5a by using 2,3-dihydrobenzofuran-5-ol as the starting material instead of 3-chloro-4-methyl-phenol in Step 1.

Step 2: Preparation of 8-chloro-2-(5-hydroxy-2,3-dihydrobenzofuran-6-yl)chromen-4-one

(158) ##STR00121##

(159) Int-33 was prepared in analogy to the procedure described for the preparation of compound Int-5 by using 5-hydroxy-2,3-dihydrobenzofuran-6-carbaldehyde as the starting material instead of 4-chloro-2-hydroxy-5-methyl-benzaldehyde in Step 2. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 314.9.

Intermediate 34: 2-(5-bromo-2-hydroxy-4-methoxy-phenyl)-8-chloro-chromen-4-one

(160) ##STR00122##

(161) Int-34 was prepared in analogy to the procedure described for the preparation of compound Int-5 by using 5-bromo-2-hydroxy-4-methoxybenzaldehyde as the starting material instead of 4-chloro-2-hydroxy-5-methyl-benzaldehyde in Step 2. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 381.1.

Intermediate 35: 8-chloro-2-(4-chloro-2-hydroxy-phenyl)chromen-4-one

(162) ##STR00123##

(163) Int-35 was prepared in analogy to the procedure described for the preparation of compound Int-5 by using 4-chloro-2-hydroxy-benzaldehyde as the starting material instead of 4-chloro-2-hydroxy-5-methyl-benzaldehyde in Step 2. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 307.1.

Intermediate 36: 2-(5-bromo-2-hydroxy-phenyl)-8-chloro-chromen-4-one

(164) ##STR00124##

(165) Int-36 was prepared in analogy to the procedure described for the preparation of compound Int-5 by using 5-bromo-2-hydroxy-benzaldehyde as the starting material instead of 4-chloro-2-hydroxy-5-methyl-benzaldehyde in Step 2. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 351.0.

Intermediate 37: 2-(4-bromo-2-hydroxy-phenyl)-8-chloro-6-fluoro-chromen-4-one

(166) ##STR00125##

Step 1: Preparation of 1-(3-chloro-5-fluoro-2-hydroxy-phenyl)ethanone

(167) ##STR00126##

(168) Compound Int-37a was prepared in analogy to the procedure described for the preparation of compound Int-23b by using 2-chloro-4-fluoro-phenol as the starting materials instead of 3-bromo-2-chloro-phenol in Step 1.

Step 2: Preparation of 2-(4-bromo-2-hydroxy-phenyl)-8-chloro-6-fluoro-chromen-4-one

(169) ##STR00127##

(170) Int-37 was prepared in analogy to the procedure described for the preparation of compound Int-1 by using 1-(3-chloro-5-fluoro-2-hydroxy-phenyl)ethanone and 4-bromo-2-methoxy-benzaldehyde as the starting materials instead of 1-(3-chloro-2-hydroxy-phenyl)ethanone and 2-methoxy-4-(trifluoromethyl)benzaldehyde in Step 1. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 369.1.

Intermediate 38: 8-chloro-2-(2-hydroxyphenyl)-7-methyl-chromen-4-one

(171) ##STR00128##

Step 1: Preparation of 1-(3-chloro-2-hydroxy-4-methyl-phenyl)ethanone

(172) ##STR00129##

(173) To a solution of 1-(4-bromo-3-chloro-2-hydroxy-phenyl)ethanone (2.4 g, 9.62 mmol), trimethylboroxine (1449.06 mg, 11.54 mmol), potassium carbonate (3323.72 mg, 24.05 mmol) in 1,4-dioxane (30 mL) and water (2 mL) was added Pd(dppf).sub.2C.sub.1-2 (791.39 mg, 0.960 mmol) under N.sub.2 atmosphere. The mixture was stirred at 110° C. for 5 hours. The mixture was filtered and the filtrate was concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluent with PE:EtOAc=20:1 to 3:1) to give 1-(3-chloro-2-hydroxy-4-methyl-phenyl)ethanone (1.3 g, 69.5% yield) as an off-white solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 185.1.

Step 2: Preparation of 8-chloro-2-(2-hydroxyphenyl)-7-methyl-chromen-4-one

(174) ##STR00130##

(175) Int-38 was prepared in analogy to the procedure described for the preparation of compound Int-1 by using 1-(3-chloro-2-hydroxy-4-methyl-phenyl)ethanone and 2-methoxybenzaldehyde as the starting materials instead of 1-(3-chloro-2-hydroxy-phenyl)ethanone and 2-methoxy-4-(trifluoromethyl)benzaldehyde in Step 1. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 287.2.

Intermediate 39: 2-(4-bromo-2-hydroxy-phenyl)-8-chloro-7-fluoro-chromen-4-one

(176) ##STR00131##

Step 1: Preparation of 1-(3-chloro-4-fluoro-2-hydroxy-phenyl)ethanone

(177) ##STR00132##

(178) Compound Int-39a was prepared in analogy to the procedure described for the preparation of compound Int-23b by using 2-chloro-3-fluoro-phenol as the starting materials instead of 3-bromo-2-chloro-phenol in Step 1.

Step 2: Preparation of 2-(4-bromo-2-hydroxy-phenyl)-8-chloro-7-fluoro-chromen-4-one

(179) ##STR00133##

(180) Int-39 was prepared in analogy to the procedure described for the preparation of compound Int-1 by using 1-(3-chloro-4-fluoro-2-hydroxy-phenyl)ethanone and 4-bromo-2-methoxy-benzaldehyde as the starting materials instead of 1-(3-chloro-2-hydroxy-phenyl)ethanone and 2-methoxy-4-(trifluoromethyl)benzaldehyde in Step 1. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 369.2.

Intermediate 40: 2-(5-bromo-4-fluoro-2-hydroxy-phenyl)-8-chloro-chromen-4-one

(181) ##STR00134##

(182) Int-40 was prepared in analogy to the procedure described for the preparation of compound Int-5 by using 5-bromo-4-fluoro-2-hydroxybenzaldehyde as the starting material instead of 4-chloro-2-hydroxy-5-methyl-benzaldehyde in Step 2. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 369.2.

Intermediate 41: 8-chloro-2-(5-fluoro-2-hydroxy-phenyl)chromen-4-one

(183) ##STR00135##

(184) Int-41 was prepared in analogy to the procedure described for the preparation of compound Int-5 by using 5-fluoro-2-hydroxy-benzaldehyde as the starting material instead of 4-chloro-2-hydroxy-5-methyl-benzaldehyde in Step 2. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 291.1.

Intermediate 42: 8-chloro-2-(4-fluoro-2-hydroxy-phenyl)chromen-4-one

(185) ##STR00136##

(186) Int-42 was prepared in analogy to the procedure described for the preparation of compound Int-5 by using 4-fluoro-2-hydroxy-benzaldehyde as the starting material instead of 4-chloro-2-hydroxy-5-methyl-benzaldehyde in Step 2. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 291.1.

Intermediate 43: 8-chloro-2-(4-ethoxy-2-hydroxy-phenyl)chromen-4-one

(187) ##STR00137##

(188) Int-43 was prepared in analogy to the procedure described for the preparation of compound Int-5 by using 4-ethoxy-2-hydroxy-benzaldehyde as the starting material instead of 4-chloro-2-hydroxy-5-methyl-benzaldehyde in Step 2. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 317.2.

Intermediate 44: 8-chloro-6-fluoro-2-(2-hydroxyphenyl)chromen-4-one

(189) ##STR00138##

(190) Int-44 was prepared in analogy to the procedure described for the preparation of compound Int-1 by using 1-(3-chloro-5-fluoro-2-hydroxy-phenyl)ethanone and 2-methoxybenzaldehyde as the starting materials instead of 1-(3-chloro-2-hydroxy-phenyl)ethanone and 2-methoxy-4-(trifluoromethyl)benzaldehyde in Step 1. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 291.2.

Intermediate 45: 8-chloro-2-(3-fluoro-2-hydroxy-phenyl)chromen-4-one

(191) ##STR00139##

(192) Int-45 was prepared in analogy to the procedure described for the preparation of compound Int-5 by using 3-fluoro-2-hydroxy-benzaldehyde as the starting material instead of 4-chloro-2-hydroxy-5-methyl-benzaldehyde in Step 2. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 291.1.

Intermediate 46: 2-(4-bromo-5-fluoro-2-hydroxy-phenyl)-8-chloro-chromen-4-one

(193) ##STR00140##

(194) Int-46 was prepared in analogy to the procedure described for the preparation of compound Int-5 by using 4-bromo-5-fluoro-2-hydroxy-benzaldehyde as the starting material instead of 4-chloro-2-hydroxy-5-methyl-benzaldehyde in Step 2. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 369.2.

Intermediate 47: 8-chloro-6-fluoro-2-(4-fluoro-2-hydroxy-phenyl)chromen-4-one

(195) ##STR00141##

(196) Int-47 was prepared in analogy to the procedure described for the preparation of compound Int-5 by using 4-fluoro-2-hydroxy-benzaldehyde as the starting material instead of 4-chloro-2-hydroxy-5-methyl-benzaldehyde in Step 2 and using 1-(3-chloro-5-fluoro-2-hydroxy-phenyl)ethanone as the starting materials instead of 1-(3-chloro-2-hydroxy-phenyl)ethanone in Step 3. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 309.1.

Intermediate 48: 2-(2-hydroxyphenyl)-8-(trifluoromethyl)chromen-4-one

(197) ##STR00142##

Step 1: Preparation of 1-[2-fluoro-3-(trifluoromethyl)phenyl]-3-(2-methoxyphenyl)propane-1,3-dione

(198) ##STR00143##

(199) To a solution of 2-fluoro-3-(trifluoromethyl)benzoic acid (208 mg, 999 μmol) in DCM (15 ml) was added oxalyl chloride (254 mg, 175 μl, 2 mmol) and the mixture was then stirred at room temperature for 3 hours. The mixture was then concentrated in vacuo to give the crude 2-fluoro-3-(trifluoromethyl)benzoyl chloride, which was then dissolved in THF (2 mL).

(200) To a solution of 1-(2-methoxyphenyl)ethan-1-one (225 mg, 1.5 mmol) in THF (15 ml) cooled at 0° C. was added LiHMDS (3 ml, 3 mmol) and the mixture was stirred at room temperature for 30 minutes. Then to the resulting solution was added 2-fluoro-3-(trifluoromethyl)benzoyl chloride solution prepared above. The mixture was then stirred at room temperature. The mixture was concentrated in vacuo to give the crude 1-[2-fluoro-3-(trifluoromethyl)phenyl]-3-(2-methoxyphenyl)propane-1,3-dione (340 mg, 100% yield), which was used in the next step directly without further purification. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 341.1.

Step 2: Preparation of 2-(2-methoxyphenyl)-8-(trifluoromethyl)chromen-4-one

(201) ##STR00144##

(202) To a solution of 1-[2-fluoro-3-(trifluoromethyl)phenyl]-3-(2-methoxyphenyl)propane-1,3-dione (340 mg, 999 μmol) in DMF (3 mL) was added K.sub.2CO.sub.3 (414 mg, 3 mmol) and the mixture was then stirred at 100° C. under microwave condition for 30 minutes. The mixture was then quenched with 4N HCl (4 mL) and water (20 mL), the resulting mixture was extracted with EtOAc (30 mL) three times. The combined organic layer was concentrated in vacuo and the residue was purified by column chromatography on silica gel to give 2-(2-methoxyphenyl)-8-(trifluoromethyl)chromen-4-one (270 mg, 84.4% yield) as a yellow solid. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 321.2.

Step 3: Preparation of 2-(2-hydroxyphenyl)-8-(trifluoromethyl)chromen-4-one

(203) ##STR00145##

(204) Int-48 was prepared in analogy to the procedure described for the preparation of compound Int-1 by using 2-(2-methoxyphenyl)-8-(trifluoromethyl)chromen-4-one as the starting material instead of 8-chloro-2-[2-methoxy-4-(trifluoromethyl)phenyl]chromen-4-one in Step 3. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 307.1.

Intermediate 49: 2-(4-bromo-2-hydroxy-phenyl)-8-chloro-7-(trifluoromethyl)chromen-4-one

(205) ##STR00146##

Step 1: Preparation of 1-[4-bromo-3-chloro-2-[(4-methoxyphenyl)methoxy]phenyl]ethanone

(206) ##STR00147##

(207) To a solution of 1-(4-bromo-3-chloro-2-hydroxy-phenyl)ethanone (1800.0 mg, 7.21 mmol) in DMF (15 mL) were added potassium carbonate (2.16 mL, 18.04 mmol) and 4-methoxybenzylchloride (0.98 mL, 7.21 mmol) at room temperature. The mixture was stirred at 80° C. for 2 hours. The mixture was the quenched with water (50 mL) and extracted with EtOAc (150 mL) three times. The combined organic layer was washed with brine (80 mL), dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluent with PE:EtOAc 100:1 to 10:1) to give 1-[4-bromo-3-chloro-2-[(4-methoxyphenyl)methoxy]phenyl]ethanone (1800 mg, 67.5% yield) as a light yellow solid. MS obsd. (ESI.sup.+) [(M+Na).sup.+]: 391.0.

Step 2: Preparation of 1-[3-chloro-2-[(4-methoxyphenyl)methoxy]-4-(trifluoromethyl)phenyl]ethanone

(208) ##STR00148##

(209) To a solution of 1-[4-bromo-3-chloro-2-[(4-methoxyphenyl)methoxy]phenyl]ethanone (1500.0 mg, 4.06 mmol) in DMF (8 mL) were added CuI (3864.23 mg, 20.29 mmol) and methyl 2,2-difluoro-2-fluorosulfonyl-acetate (3573.27 mg, 20.29 mmol) at room temperature. The mixture was stirred at 110° C. for 18 hours. The mixture was then quenched with water (100 mL) and extracted with EtOAc (130 mL) three times. The combined organic layer was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluent with PE:EtOAc=100:1 to 15:1) to give 1-[3-chloro-2-[(4-methoxyphenyl)methoxy]-4-(trifluoromethyl)phenyl]ethanone (700 mg, 1.95 mmol) as a light yellow solid.

Step 3: Preparation of 1-[3-chloro-2-hydroxy-4-(trifluoromethyl)phenyl]ethanone

(210) ##STR00149##

(211) A solution of 1-[3-chloro-2-[(4-methoxyphenyl)methoxy]-4-(trifluoromethyl)phenyl]ethanone (700.0 mg, 1.95 mmol) in trifluoroacetic acid (2.8 mL, 36.34 mmol) was stirred at 120° C. for 1.5 hours. The mixture was then concentrated in vacuo and the residue was purified by column chromatography on silica gel (eluent with PE:EtOAc=100:1 to 4:1) to give 1-[3-chloro-2-hydroxy-4-(trifluoromethyl)phenyl]ethanone (360 mg, 75.78% yield) as colorless liquid. MS obsd. (EST)[(M−H).sup.−]: 236.9.

Step 4: Preparation of 2-(4-bromo-2-hydroxy-phenyl)-8-chloro-7-(trifluoromethyl)chromen-4-one

(212) ##STR00150##

(213) Int-49 was prepared in analogy to the procedure described for the preparation of compound Int-5 by using 4-bromo-2-hydroxy-benzaldehyde as the starting material instead of 4-chloro-2-hydroxy-5-methyl-benzaldehyde in Step 2 and using 1-[3-chloro-2-hydroxy-4-(trifluoromethyl)phenyl]ethanone as the starting materials instead of 1-(3-chloro-2-hydroxy-phenyl)ethanone in Step 3. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 419.1.

Intermediate 50: 2-(4-bromo-2-hydroxy-phenyl)-8-chloro-5-(trifluoromethyl)chromen-4-one

(214) ##STR00151##

Step 1: Preparation of 1-(6-bromo-3-chloro-2-hydroxy-phenyl)ethanone

(215) ##STR00152##

(216) Compound Int-50a was prepared in analogy to the procedure described for the preparation of compound Int-23b by using 5-bromo-2-chloro-phenol as the starting materials instead of 3-bromo-2-chloro-phenol in Step 1.

Step 2: Preparation of 1-[3-chloro-2-hydroxy-6-(trifluoromethyl)phenyl]ethanone

(217) ##STR00153##

(218) Compound Int-50b was prepared in analogy to the procedure described for the preparation of compound Int-49c by using 1-(6-bromo-3-chloro-2-hydroxy-phenyl)ethanone as the starting materials instead of 1-(4-bromo-3-chloro-2-hydroxy-phenyl)ethanone in Step 1.

Step 3: Preparation of 2-(4-bromo-2-hydroxy-phenyl)-8-chloro-5-(trifluoromethyl)chromen-4-one

(219) ##STR00154##

(220) Int-50 was prepared in analogy to the procedure described for the preparation of compound Int-5 by using 4-bromo-2-hydroxy-benzaldehyde as the starting material instead of 4-chloro-2-hydroxy-5-methyl-benzaldehyde in Step 2 and using 1-[3-chloro-2-hydroxy-6-(trifluoromethyl)phenyl]ethanone as the starting materials instead of 1-(3-chloro-2-hydroxy-phenyl)ethanone in Step 3. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 419.0.

Intermediate 51:8-chloro-2-(5-ethoxy-2-hydroxy-phenyl)chromen-4-one

(221) ##STR00155##

(222) Int-51 was prepared in analogy to the procedure described for the preparation of compound Int-5 by using 5-ethoxy-2-hydroxy-benzaldehyde as the starting material instead of 4-chloro-2-hydroxy-5-methyl-benzaldehyde in Step 2. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 317.2.

Intermediate 52: 2-(5-bromo-2-hydroxy-phenyl)-8-chloro-6-fluoro-chromen-4-one

(223) ##STR00156##

(224) Int-52 was prepared in analogy to the procedure described for the preparation of compound Int-5 by using 5-bromo-2-hydroxy-benzaldehyde as the starting material instead of 4-chloro-2-hydroxy-5-methyl-benzaldehyde in Step 2 and using 1-(3-chloro-5-fluoro-2-hydroxy-phenyl)ethanone as the starting materials instead of 1-(3-chloro-2-hydroxy-phenyl)ethanone in Step 3. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 369.1.

Intermediate 53: 2-(5-bromo-2-hydroxy-phenyl)-8-chloro-7-fluoro-chromen-4-one

(225) ##STR00157##

(226) Int-53 was prepared in analogy to the procedure described for the preparation of compound Int-5 by using 5-bromo-2-hydroxy-benzaldehyde as the starting material instead of 4-chloro-2-hydroxy-5-methyl-benzaldehyde in Step 2 and using 1-(3-chloro-4-fluoro-2-hydroxy-phenyl)ethanone as the starting materials instead of 1-(3-chloro-2-hydroxy-phenyl)ethanone in Step 3. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 369.1.

Intermediate 54: 2-(4-bromo-5-chloro-2-hydroxy-phenyl)-8-chloro-chromen-4-one

(227) ##STR00158##

Step 1: Preparation of methyl 4-amino-5-chloro-2-methoxy-benzoate

(228) ##STR00159##

(229) To a solution of 4-amino-5-chloro-2-methoxybenzoic acid (2.0 g, 9.92 mmol) in methanol (50 mL) was added SOCl.sub.2 (23.6 g, 198.4 mmol) dropwise and the resulting solution was stirred at 60° C. for 16 hours. The mixture was then concentrated in vacuo to give the crude methyl 4-amino-5-chloro-2-methoxy-benzoate (3.5 g, 98.17% yield) as a yellow solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 216.1.

Step 2: Preparation of methyl 4-bromo-5-chloro-2-methoxy-benzoate

(230) ##STR00160##

(231) To a solution of methyl 4-amino-5-chloro-2-methoxy-benzoate (3.3 g, 15.3 mmol) in hydrobromic acid (74.29 g, 918.24 mmol) cooled at 0° C. was added a solution of sodium nitrite (1.16 g, 16.83 mmol) in water (20 mL) slowly. After addition, the solution was stirred at 0° C. for 1 hour. To the resulting solution was added CuBr (3.07 g, 21.43 mmol) and the mixture was stirred at 25° C. for 2 hours. The mixture was then diluted with water (100 mL) and extracted with EtOAc (100 mL) twice. The combined organic phase was concentrated in vacuo and the residue was purified by column chromatography on silica gel (eluted with PE:EtOAc=4:1) to give methyl 4-bromo-5-chloro-2-methoxy-benzoate (1.8 g, 37.87% yield) as a yellow solid.

Step 3: Preparation of (4-bromo-5-chloro-2-methoxy-phenyl)methanol

(232) ##STR00161##

(233) To a solution of methyl 4-bromo-5-chloro-2-methoxy-benzoate (1.0 g, 3.58 mmol) in THF (20 mL) cooled at −78° C. was added LiAlH.sub.4 (271.89 mg, 7.16 mmol) and the mixture was stirred at −78° C. for 2 hours. After the reaction was completed, to the resulting mixture was added water (0.5 mL), 10% NaOH aqueous solution (0.5 mL) and water (1.5 mL) in sequence. The resulting mixture was filtered and the filtrate was concentrated in vacuo to give (4-bromo-5-chloro-2-methoxy-phenyl)methanol (1.5 g, 100% yield) as a yellow solid, which was used in the next step directly without further purification.

Step 4: Preparation of 4-bromo-5-chloro-2-methoxy-benzaldehyde

(234) ##STR00162##

(235) To a solution of (4-bromo-5-chloro-2-methoxy-phenyl)methanol (1.5 g, 5.96 mmol) in DCM (30 mL) was added MnO.sub.2 (5.19 g, 59.64 mmol, 10 eq) and the mixture was stirred at 25° C. for 16 hours. The mixture was then filtered and the filtrate was concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluent with PE:DCM=1:1) to give 4-bromo-5-chloro-2-methoxy-benzaldehyde (625 mg, 37.8% yield) as a white solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 249.0.

Step 5: Preparation of 2-(4-bromo-5-chloro-2-hydroxy-phenyl)-8-chloro-chromen-4-one

(236) ##STR00163##

(237) Int-54 was prepared in analogy to the procedure described for the preparation of compound Int-1 by using 4-bromo-5-chloro-2-methoxy-benzaldehyde as the starting material instead of 2-methoxy-4-(trifluoromethyl)benzaldehyde in Step 1. MS obsd. (ESI.sup.+) [(M+H).sup.+]:385.1.

Intermediate 55: 8-chloro-7-cyclopropyl-2-(2-hydroxyphenyl)chromen-4-one

(238) ##STR00164##

Step 1: Preparation of 1-(3-chloro-4-cyclopropyl-2-hydroxy-phenyl)ethanone

(239) ##STR00165##

(240) To a solution of 1-(4-bromo-3-chloro-2-hydroxy-phenyl)ethanone (1000.0 mg, 4.01 mmol), Cs.sub.2CO.sub.3 (2611.89 mg, 8.02 mmol), potassium cyclopropyltrifluoroborate (2372.52 mg, 16.03 mmol) in 1,4-dioxane (30 mL) and water (2 mL) was added Pd(dppf).sub.2C.sub.1-2 (2932.78 mg, 4.01 mmol) under N.sub.2 atmosphere. The mixture was stirred at 110° C. for 5 hours. The mixture was filtered and the filtrate was concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluted with PE:EtOAc=20:1 to 3:1) to give 1-(3-chloro-4-cyclopropyl-2-hydroxy-phenyl)ethanone (560 mg, 66.32% yield). MS obsd. (ESI.sup.+)[(M+H).sup.+]: 211.1.

Step 2: Preparation of 8-chloro-7-cyclopropyl-2-(2-hydroxyphenyl)chromen-4-one

(241) ##STR00166##

(242) Int-55 was prepared in analogy to the procedure described for the preparation of compound Int-1 by using 1-(3-chloro-4-cyclopropyl-2-hydroxy-phenyl)ethanone and 2-methoxybenzaldehyde as the starting materials instead of 1-(3-chloro-2-hydroxy-phenyl)ethanone and 2-methoxy-4-(trifluoromethyl)benzaldehyde in Step 1. MS obsd. (ESI.sup.+) [(M+H).sup.+]:313.2.

Intermediate A1: 1-(3-chloro-2-hydroxy-4-methoxy-phenyl)ethanone

(243) ##STR00167##

(244) Compound Int-A1 was prepared in analogy to the procedure described for the preparation of compound Int-23b by using 2-chloro-3-methoxy-phenol as the starting materials instead of 3-bromo-2-chloro-phenol in Step 1.

Intermediate A2: 1-(3-chloro-2-hydroxy-5-methoxy-phenyl)ethanone

(245) ##STR00168##

(246) Compound Int-A2 was prepared in analogy to the procedure described for the preparation of compound Int-23b by using 2-chloro-4-methoxy-phenol as the starting materials instead of 3-bromo-2-chloro-phenol in Step 1.

Intermediate T1: methyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate

(247) ##STR00169##

Step 1: Preparation of 2-benzyloxyethoxy(trimethyl)silane

(248) ##STR00170##

(249) To a solution of 2-benzyloxyethanol (20.0 g, 131.4 mmol) and TEA (20.0 g, 197.1 mmol) in dichloromethane (200 mL) cooled at 0° C. was added trimethylsilyl chloride (17.1 g, 157.7 mmol) and the mixture was then stirred at 25° C. for 16 hours. After the reaction was completed, the mixture was concentrated in vacuo and the residue was purified by column chromatography on silica gel (eluted with PE:EtOAc=50:1 to 10:1) to give the 2-benzyloxyethoxy(trimethyl)silane (25.0 g, 84.9%) as a colorless oil.

Step 2: Preparation of methyl 3-(2-benzyloxyethoxy)cyclobutanecarboxylate

(250) ##STR00171##

(251) To a solution of 2-benzyloxyethoxy(trimethyl)silane (25.0 g, 111.4 mmol) and methyl 3-oxocyclobutanecarboxylate (CAS #: 4934-99-0, Cat. #: PB01390, from PharmaBlock (NanJing) R&D Co. Ltd, 15.0 g, 117.0 mmol) in dichloro methane (200 mL) was added trimethylsilyl trifluoromethanesulfonate (12.4 g, 55.7 mmol) dropwise at −78° C. After addition, the mixture was stirred at −78° C. for additional 1 hour, then to the resulting mixture was added triethylsilane (14.25 g, 122.57 mmol). After addition, the resulting mixture was warmed to room temperature and stirred for additional 1 hour. After the reaction was completed, the mixture was washed with saturated NH.sub.4Cl solution, brine, dried over anhydrous sodium sulfate, and concentrated in vacuo. The residue was purified by column chromatography on silica gel (elution with PE/EtOAc=100:1˜50:1) to give methyl 3-(2-benzyloxyethoxy)cyclobutanecarboxylate (28 g, 95.1%) as a colorless oil. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 265.1.

Step 3: Preparation of methyl 3-(2-hydroxyethoxy)cyclobutanecarboxylate

(252) ##STR00172##

(253) To a solution of methyl 3-(2-benzyloxyethoxy)cyclobutanecarboxylate (28.0 g, 105.9 mmol) in MeOH (300.0 mL) was added Pd(OH).sub.2 (wet) (1.48 g, 10.6 mmol) at room temperature and the mixture was then hydrogenated under H.sub.2 atmosphere at room temperature overnight. After the reaction was completed, the reaction was filtered through silica gel pad and the filtrate was concentrated in vacuo to give 18 g crude methyl 3-(2-hydroxyethoxy)cyclobutanecarboxylate (18 g, 97.6%) as a colorless oil.

Step 4: Preparation of methyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate

(254) ##STR00173##

(255) To a solution of methyl 3-(2-hydroxyethoxy)cyclobutanecarboxylate (5 g, 28.7 mmol) and DMAP (5.26 g, 43.1 mmol) in dichloromethane (80 mL) was added 4-methylbenzene-1-sulfonyl chloride (6.02 g, 31.6 mmol) at room temperature and the mixture was then stirred at room temperature overnight. After the reaction was completed, the mixture was washed with 1N HCl (25 mL), water (15 mL), saturated NaHCO.sub.3 solution, brine and concentrated in vacuo to give the crude methyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate (8.1 g, 85.6%) as a colorless oil, which was used in next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 329.2.

Intermediate T2: methyl 3-[3-(p-tolylsulfonyloxy)propoxy]cyclobutanecarboxylate

(256) ##STR00174##

(257) Int-T2 was prepared in analogy to the procedure described for the preparation of compound Int-T1 by using 3-benzyloxypropan-1-ol as the starting material instead of 2-benzyloxyethanol in Step 1. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 343.1.

Intermediate T3: tert-butyl 2-[3-(p-tolylsulfonyloxy)propoxy]acetate

(258) ##STR00175##

Step 1: Preparation of tert-butyl 2-(3-(benzyloxy)propoxy)acetate

(259) ##STR00176##

(260) To a mixture of NaOH (10M, 300.0 ml), tert-butyl 2-bromoacetate (23.5 g, 120.3 mmol) and tetrabutylammonium iodide (8.8 g, 24.06 mmol) in DCM (300 mL) was added 3-benzyloxypropan-1-ol (12.99 mL, 120.32 mmol) at 30° C. and the mixture was stirred at 30° C. for 72 hours. After the reaction was completed, the organic phase was separated out and the aquatic phase was extracted with DCM (150 mL) twice. The combined organic layer was washed with brine, dried over MgSO.sub.4 and concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluent with PE:EtOAc=3:1) to give tert-butyl 2-(3-(benzyloxy)propoxy)acetate (21.3 g, 63.3% yield) as a colorless liquid. MS obsd. (ESI.sup.+) [(M+Na).sup.+]: 303.2.

Step 2: Preparation of tert-butyl 2-[3-(p-tolylsulfonyloxy)propoxy]acetate

(261) ##STR00177##

(262) Int-T3 was prepared in analogy to the procedure described for the preparation of compound Int-T1 by using tert-butyl 2-(3-(benzyloxy)propoxy)acetate as the starting material instead of methyl 3-(2-benzyloxyethoxy)cyclobutanecarboxylate in Step 3. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 345.0.

Intermediate T4: methyl 2-[2-(p-tolylsulfonyloxy)ethoxy]acetate

(263) ##STR00178##

(264) Int-T4 was prepared in analogy to the procedure described for the preparation of compound Int-T3 by using 2-benzyloxyethanol and methyl 2-bromoacetate as the starting material instead of 3-benzyloxypropan-1-ol and tert-butyl bromoacetate in Step 1. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 289.1.

Intermediate T5: methyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclopentanecarboxylate

(265) ##STR00179##

(266) Int-T5 was prepared in analogy to the procedure described for the preparation of compound Int-T1 by using methyl 3-oxocyclobutanecarboxylate as the starting material instead of methyl 3-oxocyclopentanecarboxylate in Step 2. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 343.0.

Intermediate T6: methyl 3-[3-(p-tolylsulfonyloxy)propoxy]cyclopentanecarboxylate

(267) ##STR00180##

(268) Int-T6 was prepared in analogy to the procedure described for the preparation of compound Int-T1 by using 3-benzyloxypropan-1-ol as the starting material instead of 2-benzyloxyethanol in Step 1 and using methyl 3-oxocyclobutanecarboxylate as the starting material instead of methyl 3-oxocyclopentanecarboxylate in Step 2. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 357.1.

Intermediate T7: methyl 2,2-dimethyl-3-(p-tolylsulfonyloxy)propanoate

(269) ##STR00181##

(270) Int-T7 was prepared in analogy to the procedure described for the preparation of compound Int-T1 by using methyl 3-hydroxy-2,2-dimethyl-propanoate as the starting material instead of methyl 3-(2-hydroxyethoxy)cyclobutanecarboxylate in Step 4. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 287.1.

Intermediate T8: methyl 3-(p-tolylsulfonyloxymethyl)cyclobutanecarboxylate

(271) ##STR00182##

(272) Int-T8 was prepared in analogy to the procedure described for the preparation of compound Int-T1 by using methyl 3-(hydroxymethyl)cyclobutanecarboxylate as the starting material instead of methyl 3-(2-hydroxyethoxy)cyclobutanecarboxylate in Step 4. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 299.2.

Intermediate T9: methyl 3-(p-tolylsulfonyloxy)cyclopentanecarboxylate

(273) ##STR00183##

(274) Int-T9 was prepared in analogy to the procedure described for the preparation of compound Int-T1 by using methyl 3-hydroxycyclopentanecarboxylate as the starting material instead of methyl 3-(2-hydroxyethoxy)cyclobutanecarboxylate in Step 4. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 299.2.

Intermediate T10: methyl 4-(p-tolylsulfonyloxy)cyclohexanecarboxylate

(275) ##STR00184##

(276) Int-T10 was prepared in analogy to the procedure described for the preparation of compound Int-T1 by using methyl 4-hydroxycyclohexanecarboxylate as the starting material instead of methyl 3-(2-hydroxyethoxy)cyclobutanecarboxylate in Step 4. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 313.1.

Intermediate T11: cis-tert-butyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate

(277) ##STR00185##

Step 1: Preparation of cis-tert-butyl 3-(2-benzyloxyethoxy)cyclobutanecarboxylate

(278) ##STR00186##

(279) To a solution of trifluoromethanesulfonic anhydride (27.8 g, 98.56 mmol) and 2,6-lutidine (11.48 mL, 98.56 mmol) in DCM (100 mL) cooled at −30° C. was added 2-(benzyloxy)ethanol (10.0 g, 65.71 mmol) and the reaction mixture was stirred at −30° C. for 1 hour. The reaction mixture was washed with brine (30 ml) twice and the organic layer was concentrated in vacuo to give the crude 2-(benzyloxy)ethyl trifluoromethanesulfonate (18.7 g) as yellow oil.

(280) To a solution of cis-tert-butyl 3-hydroxycyclobutanecarboxylate (CAS #: 939768-64-6, Cat. #: B253665, from BePharm Ltd., 11.3 g, 65.71 mmol) in THF (150 mL) cooled at 0° C. was added NaH (3942.44 mg, 98.56 mmol) and the mixture was stirred at room temperature for 1 hour. To the resulting solution was added 2-(benzyloxy)ethyl trifluoromethanesulfonate (18.7 g, previously prepared) and the mixture was stirred at room temperature for 2 hours. The reaction was then quenched with ice water (100 mL) and the resulting reaction was extracted with EtOAc (200 mL) twice. The combined organic layer was dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluent with PE:EtOAc 100:1 to 2:1) to give cis-tert-butyl 3-(2-benzyloxyethoxy)cyclobutanecarboxylate (10.0 g, 49.67% yield) as a yellow oil. .sup.1H NMR (CDCl.sub.3, 400 MHz): δ ppm 1.44 (s, 9H), 2.17 (m, 2H), 2.54-2.42 (m, 3H), 3.55-3.50 (m, 2H), 3.62-3.57 (m, 2H), 3.99-3.83 (m, 1H), 4.57 (s, 2H), 7.30-7.27 (m, 1H), 7.34 (d, J=4.3 Hz, 4H). MS obsd. (ESI.sup.+) [(M+Na).sup.+]: 329.1.

Step 2: Preparation of cis-tert-butyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate

(281) ##STR00187##

(282) Int-T11 was prepared in analogy to the procedure described for the preparation of compound Int-T1 by using cis-tert-butyl 3-(2-benzyloxyethoxy)cyclobutanecarboxylate as the starting material instead of methyl 3-(2-benzyloxyethoxy)cyclobutanecarboxylate in Step 3. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 371.2.

Intermediate Pro1: O1-tert-butyl O2-methyl (2S,4S)-4-(p-tolylsulfonyloxy)pyrrolidine-1,2-dicarboxylate

(283) ##STR00188##

(284) Int-Pro1 is commercially available from TCI Shanghai, CAS #: 88043-21-4, Cat. #: B5247.

Intermediate Pro2: O1-tert-butyl O2-methyl (2S,4S)-4-(p-tolylsulfonyloxy)pyrrolidine-1,2-dicarboxylate

(285) ##STR00189##

(286) Int-Pro2 was prepared in analogy to the procedure described for the preparation of compound Int-T1 by using O1-tert-butyl O2-methyl (2S,4S)-4-hydroxypyrrolidine-1,2-dicarboxylate (CAS #: 102195-79-9, Cat. #: PB02365, from PharmaBlock (Nanjing) R&D Co. Ltd) as the starting material instead of methyl 3-(2-hydroxyethoxy)cyclobutanecarboxylate in Step 4. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 400.1.

Intermediate Pro3: O1-tert-butyl O2-methyl (2R,4R)-4-(p-tolylsulfonyloxy)pyrrolidine-1,2-dicarboxylate

(287) ##STR00190##

(288) Int-Pro3 was prepared in analogy to the procedure described for the preparation of compound Int-T1 by using O1-tert-butyl O2-methyl (2R,4R)-4-hydroxypyrrolidine-1,2-dicarboxylate (CAS #: 114676-69-6, Cat. #: PB06230, from PharmaBlock (Nanjing) R&D Co. Ltd) as the starting material instead of methyl 3-(2-hydroxyethoxy)cyclobutanecarboxylate in Step 4. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 400.1.

Intermediate Pro4: O1-tert-butyl O2-methyl (2S,4S)-4-(p-tolylsulfonyloxy)pyrrolidine-1,2-dicarboxylate

(289) ##STR00191##

(290) Int-Pro4 was prepared in analogy to the procedure described for the preparation of compound Int-T1 by using O1-tert-butyl O2-methyl (2S,4R)-4-hydroxypyrrolidine-1,2-dicarboxylate (CAS #: 74844-91-0, Cat. #: PB02363, from PharmaBlock (Nanjing) R&D Co. Ltd) as the starting material instead of methyl 3-(2-hydroxyethoxy)cyclobutanecarboxylate in Step 4. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 400.1.

Example A001: 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoic acid

(291) ##STR00192##

Step 1: Preparation of 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoic acid

(292) ##STR00193##

(293) To a solution of 8-chloro-2-[2-hydroxy-4-(trifluoromethyl)phenyl]chromen-4-one (Int-1, 0.37 g, 1.09 mmol, as the “CORE” in Table 1) in DMF (8 mL) was added NaH (26.1 mg, 1.09 mmol) and the mixture was stirred at 60° C. for 10 minutes. Then to the resulting suspension was added oxetan-2-one (115 mg, 100 μl, 1.6 mmol) dropwise and the reaction mixture was stirred at 60° C. for 4 hours. After the reaction was completed, the reaction was adjusted to pH˜4 by addition of 4N HCl and extracted with EtOAc (30 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by Prep-HPLC to give 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoic acid (61 mg, 12.9% yield) as a yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.35-12.55 (m, 1H), 8.15 (d, J=7.9 Hz, 1H), 7.99-8.06 (m, 2H), 7.57-7.63 (m, 2H), 7.52 (t, J=7.9 Hz, 1H), 7.04-7.10 (m, 1H), 4.47 (t, J=5.8 Hz, 2H), 2.81 (t, J=5.8 Hz, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 413.1.

Example A002: methyl 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoate

(294) ##STR00194##

(295) To a solution of 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoic acid (9.0 g, 21.81 mmol, crude prepared above) in methanol (90 mL) was added thionyl chloride (4.75 mL, 65.42 mmol). Then the mixture was stirred at 40° C. for 2 hours. After the reaction was completed, the mixture was concentrated in vacuo and the residue was diluted with water (40 mL). The resulting suspension was extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine (50 mL), dried with MgSO.sub.4 and concentrated in vacuo. The residue was then purified by column chromatography on silica gel (eluted with PE:EtOAc=2:1) to give methyl 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoate (5.3 g, 56.95% yield) as a yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.15 (d, J=8.1 Hz, 1H), 7.99-8.05 (m, 2H), 7.57-7.64 (m, 2H), 7.52 (t, J=7.9 Hz, 1H), 6.96-7.01 (m, 1H), 4.50 (t, J=5.7 Hz, 2H), 3.62 (s, 3H), 2.89 (s, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 427.0.

Example A003: 3-[2-(8-chloro-6-fluoro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoic acid

(296) ##STR00195##

Step 1: Preparation of 3-[2-formyl-5-(trifluoromethyl)phenoxy]propanoic acid

(297) ##STR00196##

(298) To a solution of NaOH (315 mg, 7.9 mmol) in water (10 mL) was added 3-bromopropionic acid (1.27 g, 7.9 mmol) and the mixture was stirred at r.t. for 30 minutes. The resulting mixture was added into a mixture of 2-hydroxy-4-(trifluoromethyl)benzaldehyde (1500 mg, 7.9 mmol, as the “SM1” in Table 2) and NaOH (315 mg, 7.9 mmol) in water (10 mL) at 100° C. dropwise and the mixture was stirred at 100° C. for another 30 minutes. After the reaction was completed, the mixture was diluted with water (30 mL) and adjusted to pH˜2 by addition of 1N hydrochloric acid. The resulting solution was extracted with EtOAc (30 mL) three times. The combined organic layer was washed with brine (30 mL) twice, dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluent with PE:EtOAc=3:1) to give 3-[2-formyl-5-(trifluoromethyl)phenoxy]propanoic acid (600 mg, yield 29%) as a white solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]:263.1.

Step 2: Preparation of 3-[2-[(E)-3-(3-chloro-5-fluoro-2-hydroxy-phenyl)-3-oxo-prop-1-enyl]-5-(trifluoromethyl)phenoxy]propanoic acid

(299) ##STR00197##

(300) To a solution of 3-[2-formyl-5-(trifluoromethyl)phenoxy]propanoic acid (230.0 mg, 0.870 mmol) and 1-(3-chloro-5-fluoro-2-hydroxy-phenyl)ethanone (165.0 mg, 0.85 mmol, as the “SM2” in Table 2) in ethanol (10 mL) was added KOH (492.0 mg, 8.7 mmol). The mixture was stirred at 35° C. for 16 hours. After the reaction was completed, the reaction mixture was diluted with water (50 mL) and acidified to pH˜1.0 by addition of 1N HCl. The resulting suspension was filtered. The solid was collected and dried in vacuo to give the crude 3-[2-[(E)-3-(3-chloro-5-fluoro-2-hydroxy-phenyl)-3-oxo-prop-1-enyl]-5-(trifluoromethyl)phenoxy]propanoic acid (200.0 mg, 52.6% yield) as a yellow solid, which was used in the next step directly. MS obsd. (ESI.sup.+) [(M+H).sup.+]:433.0.

Step 3: Preparation of 3-[2-(8-chloro-6-fluoro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoic acid

(301) ##STR00198##

(302) To a solution of 3-[2-[(E)-3-(3-chloro-5-fluoro-2-hydroxy-phenyl)-3-oxo-prop-1-enyl]-5-(trifluoromethyl)phenoxy]propanoic acid (150.0 mg, 0.34 mmol) in DMSO (3 mL) was added iodine (4 mg, 0.05 mmol). Then the mixture was stirred at 140° C. for 3 hours. After the reaction was completed, the mixture was poured into water (50 mL). The resulting suspension was filtered and the filtered cake was washed with water (50 mL) twice. The filtered cake was then collected, triturated with EtOAc (20 mL) and the resulting suspension was then filtered to give 3-[2-(8-chloro-6-fluoro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoic acid (30.2 mg, 19.2% yield) as a yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.28-12.58 (m, 1H), 8.08-8.19 (m, 2H), 7.71-7.79 (m, 1H), 7.54-7.63 (m, 2H), 7.00-7.10 (m, 1H), 4.46 (t, J=5.9 Hz, 2H), 2.80 (t, J=5.7 Hz, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:431.0.

(303) The following Example A004 to Example A026 were prepared in analogy to the procedure described for the preparation of Example A001, replacing 8-chloro-2-[2-hydroxy-4-(trifluoromethyl)phenyl]chromen-4-one (Int-1) with “CORE” by the reagent indicated in Table

(304) TABLE-US-00001 TABLE 1 Compounds synthesis and characterization Example No. Compounds Name and Structure Core .sup.1H NMR and (ESI.sup.+) A004 3-[5-bromo-2-(8-chloro-4-oxo- chromen-2- yl)phenoxy]propanoic acid embedded image Int-4 .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.38- 12.81 (br s, 1H), 7.95-8.06 (m, 2H), 7.84-7.93 (m, 1H), 7.36-7.57 (m, 3H), 7.04 (s, 1H), 4.25-4.48 (m, 2H), 2.69-2.79 (m, 2H). MS obsd. (ESI.sup.+)[(M + H).sup.+]: 423.0. A005 3-[5-chloro-2-(8-chloro-4-oxo- chromen-2-yl)-4-methyl- phenoxy]propanoic acid 00embedded image Int-5 .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.93-8.04 (m, 2H), 7.86-7.90 (m, 1H), 7.43-7.53 (m, 1H), 7.31-7.41 (m, 1H), 6.92-7.04 (m, 1H), 4.28-4.39 (m, 2H), 2.70-2.80 (m, 2H), 2.39 (s, 3H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 393.1. A006 3-[5-bromo-2-(8-chloro-4-oxo- chromen-2-yl)-4-methyl- phenoxy]propanoic acid 01embedded image Int-6 .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.35- 12.58 (m, 1H), 8.00 (td, J = 7.6, 1.3 Hz, 2H), 7.88 (s, 1H), 7.54 (s, 1H), 7.49 (t, J = 7.9 Hz, 1H), 6.99 (s, 1H), 4.36 (t, J = 5.8 Hz, 2H), 2.77 (t, J = 5.7 Hz, 2H), 2.39 (s, 3H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 437.0. A007 3-[5-bromo-2-(8-chloro-4-oxo- chromen-2-yl)-4-methoxy- phenoxy]propanoic acid 02embedded image Int-7 .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.91-8.03 (m, 2H), 7.60-7.68 (m, 1H), 7.45-7.56 (m, 2H), 7.07-7.14 (m, 1H), 4.25-4.35 (m, 2H), 3.92 (s, 3H), 2.58-2.62 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 453.1. A008 3-[5-chloro-2-(8-chloro-4-oxo- chromen-2-yl)-4-methoxy- phenoxy]propanoic acid 03embedded image Int-8 .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.93-8.05 (m, 2H), 7.68-7.73 (m, 1H), 7.49-7.55 (m, 1H), 7.42 (s, 1H), 7.18-7.23 (m, 1H), 4.27 (t, J = 6.9 Hz, 2H), 3.91 (s, 3H), 2.32 (t, J = 6.8 Hz, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 409.0. A009 3-[2-(8-chloro-4-oxo-chromen- 2-yl)-5- (trifluoromethoxy)phenoxy] propanoic acid 04embedded image Int-9 .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.50 (s, 1H), 8.05-8.11 (m, 1H), 7.96-8.04 (m, 2H), 7.47-7.54 (m, 1H), 7.31-7.36 (m, 1H), 7.21-7.29 (m, 1H), 6.99-7.05 (m, 1H), 4.34-4.45 (m, 2H), 2.76-2.83 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 429.1. A010 3-[2-(8-chloro-4-oxo-chromen- 2-yl)-4,5-dimethoxy- phenoxy]propanoic acid 05embedded image Int-10 .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.16- 12.44 (m, 1H), 7.89-8.06 (m, 2H), 7.55-7.62 (m, 1H), 7.47 (t, J = 7.9 Hz, 1H), 6.99-7.10 (m, 1H), 6.90 (s, 1H), 4.34- 4.43 (m, 2H), 3.92 (s, 3H), 3.81 (s, 3H), 2.74-2.88 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 405.0. A011 3-[[6-(8-chloro-4-oxo-chromen- 2-yl)-1,3-benzodioxol-5- yl]oxy]propanoic acid 06embedded image Int-11 .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.98 (dd, J = 11.2, 6.6 Hz, 2H), 7.48 (dd, J = 16.8, 8.6 Hz, 2H), 7.10 (s, 1H), 6.98 (s, 1H), 6.14 (s, 2H), 4.32 (t, J = 5.8 Hz, 2H), 2.76 (d, J = 5.4 Hz, 2H). . MS obsd. (ESI.sup.+) [(M + H).sup.+]: 389.1. A012 3-[2-(8-chloro-4-oxo-chromen- 2-yl)-5-methoxy-4-methyl- phenoxy]propanoic acid 07embedded image Int-12 .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.93-8.02 (m, 2H), 7.75-7.81 (m, 1H), 7.41-7.50 (m, 1H), 6.98-7.04 (m, 1H), 6.79-6.83 (m, 1H), 4.32-4.47 (m, 2H), −3.96 (s, 3H), 2.74-2.86 (m, 2H), 2.20 (s, 3H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 389.1. A013 3-[2-(8-chloro-4-oxo-chromen- 2-yl)-5-methyl- phenoxy]propanoic 08embedded image Int-13 .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.95-8.02 (m, 2H), 7.84-7.92 (m, 1H), 7.44-7.52 (m, 1H), 7.12-7.20 (m, 1H), 7.00-7.06 (m, 2H), 4.30-4.41 (m, 2H), 2.75-2.84 (m, 2H), 2.44 (s, 3H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 359.1.. A014 3-[5-bromo-2-(8-chloro-4-oxo- chromen-2-yl)-4- (trifluoromethoxy)phenoxy] propanoic acid 09embedded image Int-14 .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.93-8.06 (m, 3H), 7.72-7.80 (m, 1H), 7.48 (t, J = 7.9 Hz, 1H), 7.07 (s, 1H), 4.37-4.48 (m, 2H), 2.79 (t, J = 5.8 Hz, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 506.9. A015 3-[2-(8-chloro-4-oxo-chromen- 2-yl)-4-methoxy-5-methyl- phenoxy]propanoic acid 0embedded image Int-15 .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.27- 12.42 (m, 1H), 7.99-8.09 (m, 2H), 7.45-7.57 (m, 2H), 7.14-7.26 (m, 1H), 7.01-7.12 (m, 1H), 4.31 (br t, J = 5.5 Hz, 2H), 3.85 (s, 3H), 2.77 (br t, J = 5.7 Hz, 2H), 2.26 (s, 3H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 389.1. A016 3-[4-bromo-2-(8-chloro-4-oxo- chromen-2-yl)-5- (trifluoromethoxy)phenoxy] propanoic acid embedded image Int-16 .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.28- 12.57 (m, 1H), 8.27 (s, 1H), 8.01 (ddd, J = 9.9, 8.1, 1.4 Hz, 2H), 7.43-7.56 (m, 2H), 7.01 (s, 1H), 4.41 (t, J = 5.8 Hz, 2H), 2.73-2.86 (t, J = 5.8 Hz, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 507.0. A017 3-[2-(8-chloro-4-oxo-chromen- 2-yl)-4-methyl-5- (trifluoromethoxy)phenoxy] propanoic acid embedded image Int-17 .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.95-8.05 (m, 2H), 7.90-7.93 (m, 1H), 7.50 (t, J = 7.9 Hz, 1H), 7.19 (s, 1H), 7.13 (s, 1H), 4.29 (t, J = 6.9 Hz, 2H), 2.36 (t, J = 6.8 Hz, 2H), 2.30 (s, 3H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 443.0. A018 3-[2-bromo-6-(8-chloro-4-oxo- chromen-2-yl)-4-methyl- phenoxy]propanoic acid embedded image Int-18 .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.32 (s, 1H), 7.96-8.06 (m, 2H), 7.72-7.77 (m, 1H), 7.58-7.65 (m, 1H), 7.46-7.56 (m, 1H), 6.83 (s, 1H), 4.13-4.18 (m, 2H), 2.58-2.63 (m, 2H), 2.37 (s, 3H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 437.1. A019 3-[2-(8-chloro-4-oxo-chromen- 2-yl)-5-methyl-4- (trifluoromethoxy)phenoxy] propanoic acid embedded image Int-19 .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.94-8.02 (m, 2H), 7.90 (m, 1H), 7.43- 7.52 (m, 1H), 7.35 (m, 1H), 7.09 (s, 1H), 4.38 (tt, J = 5.6 Hz, 2H), 2.77 (t, J = 5.7 Hz, 2H), 2.36 (s, 3H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 443.0. A020 3-[5-bromo-2-(8-chloro-4-oxo- chromen-2-yl)-3-fluoro- phenoxy]propanoic acid embedded image Int-22 .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.95-8.07 (m, 2H), 7.53 (t, J = 7.9 Hz, 1H), 7.36-7.48 (m, 2H), 6.63 (s, 1H), 4.33 (t, J = 5.9 Hz, 2H), 2.65 (t, J = 5.9 Hz, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 441.1. A021 3-[2-(8-chloro-4-oxo-chromen- 2-yl)-3-fluoro-5-methyl- phenoxy]propanoic acid embedded image Int-21 .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.04- 12.63 (m, 1H), 7.94-8.07 (m, 2H), 7.51 (t, J = 7.9 Hz, 1H), 6.94-7.06 (m, 1H), 6.89 (br d, J = 10.6 Hz, 1H), 6.46- 6.60 (m, 1H), 4.28 (br t, J = 5.9 Hz, 2H), 2.65 (br t, J = 5.9 Hz, 2H), 2.40 (s, 3H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 377.1. A022 3-[2-(8-bromo-4-oxo-chromen- 2-yl)-5- (trifluoromethoxy)phenoxy] propanoic acid embedded image Int-22 .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.09-8.18 (m, 2H), 8.00-8.06 (m, 1H), 7.41-7.48 (m, 1H), 7.30-7.37 (m, 1H), 7.21-7.29 (m, 1H), 7.00-7.06 (m, 1H), 4.32-4.45 (m, 2H), 2.76-2.87 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 473.1. A023 3-[2-(7-bromo-8-chloro-4-oxo- chromen-2-yl)-5- (trifluoromethoxy)phenoxy] propanoic acid embedded image Int-23 .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.04-8.14 (m, 1H), 7.84-7.95 (m, 2H), 7.31-7.37 (m, 1H), 7.20-7.28 (m, 1H), 6.97-7.07 (m, 1H), 4.32-4.45 (m, 2H), 2.76-2.83 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 507.1. A024 3-[2-(8-bromo-4-oxo-chromen- 2-yl)-5-methyl- phenoxy]propanoic acid embedded image Int-24 .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.08-8.15 (m, 1H), 7.98-8.04 (m, 1H), 7.88-7.97 (m, 1H), 7.37-7.47 (m, 1H), 7.09-7.17 (m, 1H), 6.97-7.08 (m, 2H), 4.29-4.42 (m, 2H), 2.74-2.84 (m, 2H), 2.41 (s, 3H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 403.1. A025 3-[2-(8-bromo-4-oxo-chromen- 2-yl)-5-chloro-4-methyl- phenoxy]propanoic acid 0embedded image Int-25 .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.09-8.15 (m, 1H), 7.98-8.03 (m, 1H), 7.92-7.96 (m, 1H), 7.39-7.45 (m, 1H), 7.34-7.38 (m, 1H), 7.02 (s, 1H), 4.32-4.37 (m, 2H), 2.70-2.76 (m, 2H), 2.38 (s, 3H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 437.1. A026 3-[[5-bromo-2-(8-chloro-4-oxo- chromen-2-yl)-3- pyridyl]oxy]propanoic acid embedded image Int-26 .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.37- 12.52 (br s, 1H), 8.54 (d, J = 1.8 Hz, 1H), 8.13-8.21 (m, 1H), 7.95-8.06 (m, 2H), 7.41-7.58 (m, 1H), 6.90-6.99 (m, 1H), 4.44 (t, J = 5.9 Hz, 2H), 2.79 (t, J = 5.9 Hz, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 424.2.

(305) The following Example A031 to Example A040 were prepared in analogy to the procedure described for the preparation of Example A003, replacing 2-hydroxy-4-(trifluoromethyl)benzaldehyde with “SM1” in step 1, and replacing 1-(3-chloro-5-fluoro-2-hydroxy-phenyl)ethanone with “SM2” in step2. The “SM1” and “SM2” are the reagents indicated in Table 2.

(306) TABLE-US-00002 TABLE 2 Compounds synthesis and characterization Example No. Compounds Name and Structure SM1 and SM2 .sup.1H NMR and (ESI.sup.+) A031 3-[2-(8-chloro-7-fluoro-4-oxo- chromen-2-yl)-5- (trifluoromethyl)phenoxy] propanoic acid embedded image SM1: 2- hydroxy-4- (trifluoromethyl) benzaldehyde SM2: 1-(3- chloro-4- fluoro-2- hydroxy- phenyl)ethanone .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.19-12.59 (m, 1H), 8.11-8.19 (m, 1H), 8.02-8.11 (m, 1H), 7.56-7.64 (m, 3H), 7.03-7.09 (m, 1H), 4.33-4.52 (m, 2H), 2.75-2.83 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 431.0. A032 3-[2-(8-chloro-7-methoxy-4- oxo-chromen-2-yl)-5- (trifluoromethyl)phenoxy] propanoic acid embedded image SM1: 2- hydroxy-4- (trifluoromethyl) benzaldehyde SM2: 1-(3- chloro-2- hydroxy-4- methoxy- phenyl)ethanone (Int-A1) .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.42 (s, 1H), 8.14 (d, J = 8.0 Hz, 1H), 8.01 (d, J = 9.0 Hz, 1H), 7.58 (d, J = 10.2 Hz, 2H), 7.40 (d, J = 9.1 Hz, 1H), 6.99 (s, 1H), 4.46 (t, J = 5.8 Hz, 2H), 4.04 (s, 3H), 2.80 (t, J = 5.8 Hz, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 443.0. A033 3-[2-(8-chloro-6-methoxy-4- oxo-chromen-2-yl)-5- (trifluoromethyl)phenoxy] propanoic acid embedded image SM1: 2- hydroxy-4- (trifluoromethyl) benzaldehyde SM2: 1-(3- chloro-2- hydroxy-5- methoxy- phenyl)ethanone (Int-A2) .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.39-12.52 (m, 1H), 8.12 (d, J = 7.8 Hz, 1H), 7.68-7.75 (m, 1H), 7.55-7.62 (m, 2H), 7.40 (d, J = 2.9 Hz, 1H), 7.03 (s, 1H), 4.39-4.50 (m, 2H), 3.90 (s, 3H), 2.80 (t, J = 5.7 Hz, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 443.0. A034 3-[2-(8-chloro-3-methyl-4-oxo- chromen-2-yl)-5- (trifluoromethyl)phenoxy] propanoic acid embedded image SM1: 2- hydroxy-4- (trifluoromethyl) benzaldehyde SM2: 1-(3- chloro-2- hydroxy- phenyl)propan- 1-one (CAS #: 938-67-0, Cat. #: PB94453, from PharmaBlock (Nanjing)) .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm. 8.06 (dd, J = 7.9, 1.6 Hz, 1H), 7.99 (dd, J = 7.8, 1.5 Hz, 1H), 7.80 (d, J = 7.8 Hz, 1H), 7.57- 7.61 (m, 1H), 7.46- 7.55 (m, 2H), 4.36 (br t, J = 6.2 Hz, 2H), 2.53-2.57 (m, 2H), 1.79 (s, 3H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 427.0.

Example A038: methyl 3-[5-chloro-2-(8-chloro-4-oxo-chromen-2-yl)-4-methyl-phenoxy]propanoate

(307) ##STR00226##

(308) Example A038 was prepared in analogy to the procedure described for the preparation of Example A002 by using 3-[5-chloro-2-(8-chloro-4-oxo-chromen-2-yl)-4-methyl-phenoxy]propanoic acid (Example A005) as the starting material instead of 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoic acid (Example A001). .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm. 7.93-8.08 (m, 2H), 7.79-7.91 (m, 1H), 7.45-7.58 (m, 1H), 7.30-7.45 (m, 1H), 6.83-6.97 (m, 1H), 4.39 (m, 2H), 3.63 (s, 3H), 2.87 (m, 2H), 2.35 (s, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:407.0.

Example A039: 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]butanoic acid and Example A040: 3-[3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]butanoyloxy]butanoic acid

(309) ##STR00227##

(310) To a solution of 8-chloro-2-[2-hydroxy-4-(trifluoromethyl)phenyl]chromen-4-one (Int-1, 0.37 g, 1.09 mmol) in DMF (8 mL) was added NaH (26.1 mg, 1.09 mmol) and the mixture was stirred at 60° C. for 10 minutes. Then to the resulting suspension was dropwise added 4-methyloxetan-2-one (115 mg, 100 μl, 1.6 mmol) dropwise and the reaction mixture was stirred at 60° C. for 4 hours. After the reaction was completed, the reaction was adjusted to pH˜4 by addition of 4N HCl and extracted with EtOAc (30 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by Prep-HPLC to give 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]butanoic acid (15.8 mg, 2.4% yield) and 3-[3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]butanoyloxy]butanoic acid (5.5 mg, 0.7% yield) as yellow solid.

(311) Example A039: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm. 8.06-8.15 (m, 1H), 7.99-8.05 (m, 2H), 7.54-7.68 (m, 3H), 7.03 (s, 1H), 5.17 (q, 1H, J=6.2 Hz), 2.71 (d, 2H, J=6.2 Hz), 1.38 (d, 3H, J=6.1 Hz). MS obsd. (ESI.sup.+) [(M+H).sup.+]:427.4.

(312) Example A040: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.12 (d, J=7.7 Hz, 1H), 8.02 (dq, J=7.9, 1.3 Hz, 2H), 7.61-7.65 (m, 1H), 7.56 (d, J=8.2 Hz, 1H), 7.52 (t, J=7.9 Hz, 1H), 7.00 (s, 1H), 5.19 (br d, J=6.1 Hz, 1H), 5.04 (d, J=6.4 Hz, 1H), 2.75 (d, J=6.4 Hz, 2H), 2.43 (d, J=6.6 Hz, 2H), 1.38 (d, J=6.1 Hz, 3H), 1.05 (d, J=6.4 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:513.4.

Example A041: [2-(8-chloro-4-oxo-chromen-2-yl)-4-methoxy-5-(2,2,2-trifluoroethoxy)phenoxy]propanoic acid

(313) ##STR00228##

Step 1: Preparation of 2,4-dihydroxy-5-methoxy-benzaldehyde

(314) ##STR00229##

(315) Compound A041a was prepared in analogy to the procedure described for the preparation of compound Int-5a by using 4-methoxybenzene-1,3-diol as the starting material instead of 3-chloro-4-methyl-phenol in Step 1.

Step 2: Preparation of 2-hydroxy-5-methoxy-4-(2,2,2-trifluoroethoxy)benzaldehyde

(316) ##STR00230##

(317) To a solution of 2,4-dihydroxy-5-methoxy-benzaldehyde (1300.0 mg, 7.73 mmol) in DMF (15 mL) was added Sodium bicarbonate (779.4 mg, 9.28 mmol) and 2,2,2-trifluoroethyl trifluoromethanesulfonate (0.92 mL, 7.73 mmol) and the mixture was stirred at 85° C. for 24 hours. After the reaction was completed, the reaction mixture was quenched with water (100 mL) and the resulting mixture was extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine (50 mL) twice, dried over MgSO4 and then concentrated in vacuo. The residue was then purified by column chromatography on silica gel (eluent with PE:EtOAc=5:1) to give 2-hydroxy-5-methoxy-4-(2,2,2-trifluoroethoxy)benzaldehyde (880 mg, 45.5% yield) as a light yellow solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]:251.0.

Step 3: Preparation of 3-[2-formyl-4-methoxy-5-(2,2,2-trifluoroethoxy)phenoxy]propanoic acid

(318) ##STR00231##

(319) To a solution of 2-hydroxy-5-methoxy-4-(2,2,2-trifluoroethoxy)benzaldehyde (800.0 mg, 3.2 mmol) in DMF (10 mL) was added sodium hydride (84.42 mg, 3.52 mmol) and the mixture was stirred at 25° C. for 30 minutes. Then to the resulting solution was added beta-propiolactone (230.44 mg, 3.2 mmol) and the mixture was stirred at 25° C. for 16 hours. After the reaction was completed, the reaction was quenched with water (100 mL) and the resulting mixture was adjusted to pH˜2 with 1N hydrochloric acid. The resulting solution was then extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine (50 mL) twice, dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by Prep-HPLC to give 3-[2-formyl-4-methoxy-5-(2,2,2-trifluoroethoxy)phenoxy]propanoic acid (270 mg, 26.2% yield) as a white solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]:323.1.

Step 4: Preparation of 3-[2-[(E)-3-(3-chloro-2-hydroxy-phenyl)-3-oxo-prop-1-enyl]-4-methoxy-5-(2,2,2-trifluoroethoxy)phenoxy]propanoic acid

(320) ##STR00232##

(321) To a solution of 3-[2-formyl-4-methoxy-5-(2,2,2-trifluoroethoxy)phenoxy]propanoic acid (270.0 mg, 0.840 mmol) and 1-(3-chloro-2-hydroxy-phenyl)ethanone (142.94 mg, 0.840 mmol) in ethanol (10 mL) was added KOH (470.11 mg, 8.38 mmol) and the mixture was stirred at 35° C. for 16 hours. After the reaction was completed, the reaction mixture was diluted with water (50 mL) and acidified to pH 1.0 by addition of 1N HCl. The resulting suspension was filtered and solid was washed with water. The cake was collected and dried in vacuo to give the crude 3-[2-[(E)-3-(3-chloro-2-hydroxy-phenyl)-3-oxo-prop-1-enyl]-4-methoxy-5-(2,2,2-trifluoroethoxy)phenoxy]propanoic acid (280 mg, 70.38% yield) as an orange solid, which was used in the next step directly. MS obsd. (ESI.sup.+) [(M+H).sup.+]:475.1.

Step 5: Preparation of 3-[2-(8-chloro-4-oxo-chromen-2-yl)-4-methoxy-5-(2,2,2-trifluoroethoxy)phenoxy]propanoic acid

(322) ##STR00233##

(323) To a solution of 3-[2-[(E)-3-(3-chloro-2-hydroxy-phenyl)-3-oxo-prop-1-enyl]-4-methoxy-5-(2,2,2-trifluoroethoxy)phenoxy]propanoic acid (230.0 mg, 0.480 mmol) in DMSO (3 mL) was added iodine (8.61 mg, 0.030 mmol). Then the mixture was stirred at 140° C. for 3 hours. After the reaction was completed, the mixture was poured into water (50 mL) and the resulting suspension was filtrate, the filtered cake was washed with water (50 mL) twice. The filtered cake was then collected, triturated with EtOAc (20 mL) and the resulting suspension was then filtered to give 3-[2-(8-chloro-4-oxo-chromen-2-yl)-4-methoxy-5-(2,2,2-trifluoroethoxy)phenoxy]propanoic acid (116.4 mg, 50.82% yield) as a yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.38-12.53 (m, 1H), 7.92-8.04 (m, 2H), 7.58-7.70 (m, 1H), 7.40-7.53 (m, 1H), 7.06 (s, 2H), 4.88-5.03 (m, 2H), 4.38 (t, J=5.8 Hz, 2H), 3.74-3.93 (m, 3H), 2.74-2.88 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:473.0.

Example A042: 3-[2-[8-chloro-4-oxo-7-(trifluoromethyl)chromen-2-yl]-5-(trifluoromethoxy)phenoxy]propanoic acid

(324) ##STR00234##

Step 1: Preparation of methyl 3-[2-(7-bromo-8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethoxy)phenoxy]propanoate

(325) ##STR00235##

(326) To a solution of 3-[2-(7-bromo-8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethoxy)phenoxy]propanoic acid (Example A023, 600 mg, 1.18 mmol) in methanol (8 mL) was added SOCl.sub.2 (1.64 g, 1 mL, 13.8 mmol) at room temperature and the resulting mixture was stirred at 25° C. for 4 hours. After the reaction was completed, the reaction was adjusted to pH˜4 by addition of 4N HCl and then extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by Prep-HPLC to give methyl 3-[2-(7-bromo-8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethoxy)phenoxy]propanoate (100 mg, 16.2% yield) as a white foam. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 521.1.

Step 2: Preparation of methyl 3-[2-[8-chloro-4-oxo-7-(trifluoromethyl)chromen-2-yl]-5-(trifluoromethoxy)phenoxy]propanoate

(327) ##STR00236##

(328) To a solution of methyl 3-[2-(7-bromo-8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethoxy)phenoxy]propanoate (100 mg, 192 μmol) and copper (I) iodide (110 mg, 575 μmol) in DMF (2 mL) was added methyl 2,2-difluoro-2-(fluorosulfonyl)acetate (368 mg, 246 μL, 1.92 mmol) at room temperature and the resulting mixture was stirred at 105° C. for 4 hours. After the reaction was completed, the reaction was adjusted to pH˜4 by addition of 4N HCl and then extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluent with PE:EtOAc=10:1 to 3:1) to give methyl 3-[2-[8-chloro-4-oxo-7-(trifluoromethyl)chromen-2-yl]-5-(trifluoromethoxy)phenoxy]propanoate (40 mg, 40.9% yield) as a white foam. MS obsd. (ESI.sup.+) [(M+H).sup.+]:511.1.

Step 3: Preparation of 3-[2-[8-chloro-4-oxo-7-(trifluoromethyl)chromen-2-yl]-5-(trifluoromethoxy)phenoxy]propanoic acid

(329) ##STR00237##

(330) To a solution of methyl 3-(2-(8-chloro-4-oxo-7-(trifluoromethyl)-4H-chromen-2-yl)-5-(trifluoromethoxy)phenoxy)propanoate (50 mg, 97.9 μmol) in the mixed solvent of THF (5 mL) and water (5 mL) was added 3.0 M HCl (261 μL, 783 μmol) at room temperature and the mixture was then stirred at 60° C. for 2 hours. After the reaction was completed, the mixture was extracted with EtOAc (10 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by Prep-HPLC to give 3-[2-[8-chloro-4-oxo-7-(trifluoromethyl)chromen-2-yl]-5-(trifluoromethoxy)phenoxy]propanoic acid (7 mg, 113.7% yield) as a white foam. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.09-8.20 (m, 2H), 7.83-7.98 (m, 1H), 7.31-7.41 (m, 1H), 7.22-7.30 (m, 1H), 7.10 (s, 1H), 4.34-4.45 (m, 2H), 2.74-2.85 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:497.1.

Example A043: 3-[2-(8-chloro-4-oxo-chromen-2-yl)-4-methoxy-5-(trifluoromethyl)phenoxy]propanoic acid

(331) ##STR00238##

(332) Example A043 was prepared in analogy to the procedure described for the preparation of example A042 by using 3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-4-methoxy-phenoxy]propanoic acid (Example A007) as the starting material instead of 3-[2-(7-bromo-8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethoxy)phenoxy]propanoic acid (Example A023) in step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHZ): δ ppm 7.99-8.05 (m, 3H), 7.74-7.82 (m, 1H), 7.46-7.57 (m, 2H), 7.06-7.12 (m, 1H), 4.33-4.43 (m, 2H), 3.95 (s, 3H), 2.70-2.80 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:443.1.

Example A044: 3-[2-(8-chloro-4-oxo-chromen-2-yl)-4-methyl-5-(trifluoromethyl)phenoxy]propanoic acid

(333) ##STR00239##

(334) Example A044 was prepared in analogy to the procedure described for the preparation of example A042 by using 3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-4-methyl-phenoxy]propanoic acid (Example A006) as the starting material instead of 3-[2-(7-bromo-8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethoxy)phenoxy]propanoic acid (Example A023) in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.98-8.08 (m, 2H), 7.90-7.98 (m, 1H), 7.47-7.55 (m, 2H), 7.04 (s, 1H), 4.37-4.47 (m, 2H), 2.74-2.84 (m, 2H), 2.48 (s, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:427.1.

Example A045: 3-[2-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoic acid

(335) ##STR00240##

Step 1: Preparation of 1-(3-chloro-2,6-dihydroxy-phenyl)ethanone

(336) ##STR00241##

(337) A mixture of 1-(2,6-dihydroxyphenyl)ethan-1-one (5.0 g, 32.9 mmol), 1-chloropyrrolidine-2,5-dione (5.27 g, 39.4 mmol) in acetic acid (25 mL) was stirred at 50° C. for 2 hours. After the reaction was completed, the mixture was concentrated in vacuo, the residue was triturated with EtOAc (15 mL) and the suspension was then filtered. The filtrate was concentrated in vacuo, the residue was purified by column chromatography on silica gel (eluent with PE:EtOAc=100:1 to 3:1) to give 1-(3-chloro-2,6-dihydroxy-phenyl)ethanone (5.0 g, 81.5% yield) as a yellow solid.

Step 2: Preparation of 1-[3-chloro-2,6-bis(methoxymethoxy)phenyl]ethanone

(338) ##STR00242##

(339) To a solution of 1-(3-chloro-2,6-dihydroxy-phenyl)ethanone (500.0 mg, 2.68 mmol) in THF (10 mL) cooled at 0° C. was added sodium hydride (321.56 mg, 8.04 mmol) and the mixture was stirred at 0° C. for 20 minutes Then to the resulting solution was added bromomethyl methyl ether (0.66 mL, 8.04 mmol) and the mixture stirred at room temperature for another 30 minutes. After the reaction was completed, the reaction was quenched with water (20 mL) and extracted with EtOAc (50 mL) twice. The combined organic layer was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluted with PE:EtOAc=100:1 to 10:1) to give 1-[3-chloro-2,6-bis(methoxymethoxy)phenyl]ethanone (400 mg, 53.4% yield) as an off-white solid.

Step 3: Preparation of 3-[2-[(E)-3-[3-chloro-2,6-bis(methoxymethoxy)phenyl]-3-oxo-prop-1-enyl]-5-(trifluoromethyl)phenoxy]propanoic acid

(340) ##STR00243##

(341) To a solution of 1-[3-chloro-2,6-bis(methoxymethoxy)phenyl]ethanone (83.1 mg, 0.3 mmol) and 3-[2-formyl-5-(trifluoromethyl)phenoxy]propanoic acid (80 mg, 0.3 mmol) in ethanol (5 mL) was added KOH (171 mg, 3.05 mmol) and the mixture was then stirred at 40° C. for 16 hours. After the reaction was completed, the mixture was diluted with water (20 mL) and adjusted to pH˜6 by addition of 1N HCl. The resulting mixture was extracted with EtOAc (20 mL) three times. The combined organic layer was washed with brine (20 mL) twice, dried over Na.sub.2SO.sub.4 and concentrated in vacuo to give 3-[2-[(E)-3-[3-chloro-2,6-bis(methoxymethoxy)phenyl]-3-oxo-prop-1-enyl]-5-(trifluoromethyl)phenoxy]propanoic acid (150 mg, 97.4% yield) as an orange oil.

Step 4: Preparation of 3-[2-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoic acid

(342) ##STR00244##

(343) To a solution of 3-[2-[(E)-3-[3-chloro-2,6-bis(methoxymethoxy)phenyl]-3-oxo-prop-1-enyl]-5-(trifluoromethyl)phenoxy]propanoic acid (150 mg, 0.29 mmol) in DMSO (8 ml) was added I.sub.2 (5.1 mg, 0.02 mmol) and the mixture was stirred at 140° C. for 2 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (30 mL) three times. The combined organic layer was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by Prep-HPLC to give 3-[2-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoic acid (39.3 mg, 37.1% yield) as a yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm. 12.53 (s, 1H), 8.11-8.19 (m, 1H), 7.83-7.91 (m, 1H), 7.58-7.65 (m, 2H), 7.14 (s, 1H), 6.89 (d, J=8.8 Hz, 1H), 4.48 (t, J=5.8 Hz, 2H), 2.81 (t, J=5.8 Hz, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:429.0.

Example A046: 3-[2-(8-chloro-3-hydroxy-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoic acid

(344) ##STR00245##

Step 1: Preparation of 3-[2-[(E)-3-(3-chloro-2-hydroxy-phenyl)-3-oxo-prop-1-enyl]-5-(trifluoromethyl)phenoxy]propanoic acid

(345) ##STR00246##

(346) Compound A046a was prepared in analogy to the procedure described for the preparation of example A003b by using 1-(3-chloro-2-hydroxy-phenyl)ethanone as the starting material instead of 1-(3-chloro-5-fluoro-2-hydroxy-phenyl)ethanone in step 2.

Step 2: Preparation of 3-[2-(8-chloro-3-hydroxy-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoic acid

(347) ##STR00247##

(348) To a solution of 3-[2-[(E)-3-(3-chloro-2-hydroxy-phenyl)-3-oxo-prop-1-enyl]-5-(trifluoromethyl)phenoxy]propanoic acid (100 mg, 240 μmol) in dioxane (3 mL) was added diethylamine (52.3 mg, 0.7 mmol) and H.sub.2O.sub.2 (0.5 mL, 30%) at room temperature and the reaction was then stirred at room temperature for 2 hours. After the reaction was completed, the mixture was concentrated in vacuo and the residue was purified by Prep-HPLC to give 3-[2-(8-chloro-3-hydroxy-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoic acid (70 mg, 22.5% yield) as a white solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.21-12.31 (m, 1H), 8.09 (dd, J=8.0, 1.5 Hz, 1H), 8.01 (dd, J=7.8, 1.5 Hz, 1H), 7.79 (d, J=7.6 Hz, 1H), 7.58-7.61 (m, 1H), 7.48-7.55 (m, 2H), 4.39 (t, J=6.1 Hz, 2H), 2.62 (t, J=6.1 Hz, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:429.1.

Example A047: 3-[2-(8-chloro-3-methoxy-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoic acid

(349) ##STR00248##

Step 1: Preparation of methyl 3-[2-(8-chloro-3-methoxy-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoate

(350) ##STR00249##

(351) To a solution of 3-[2-(8-chloro-3-hydroxy-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoic acid (Example A046, 70.0 mg, 0.16 mmol) and cesium carbonate (150 mg, 0.49 mmol) in DMF (5 mL) was added iodomethane (75 mg, 0.48 mmol) and the mixture was stirred at 40° C. for 2 hours. After the reaction was completed, the reaction mixture was diluted with water (30 mL) and extracted with EtOAc (20 mL) three times. The combined organic layer was washed with brine (20 mL), dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluent with PE:EtOAc=3:1) to give methyl 3-[2-(8-chloro-3-methoxy-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoate (50 mg, 57.4% yield) as a yellow oil. MS obsd. (ESI.sup.+) [(M+H).sup.+]:457.1.

Step 2: Preparation of 3-[2-(8-chloro-3-methoxy-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoic acid

(352) ##STR00250##

(353) A mixture of methyl 3-[2-(8-chloro-3-methoxy-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoate (50 mg, 57.4% yield) in hydrochloric acid (36%˜38%) was stirred at 100° C. for 2 hours. After the reaction was completed, the mixture was concentrated in vacuo and the residue was purified by Prep-HPLC to give 3-[2-(8-chloro-3-methoxy-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoic acid (21.6 mg, 45.7% yield) as a white solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.24-12.32 (m, 1H), 8.07-8.12 (m, 1H), 8.01 (dd, J=7.8, 1.5 Hz, 1H), 7.76-7.81 (m, 1H), 7.58-7.61 (m, 1H), 7.51 (s, 2H), 4.39 (t, J=6.1 Hz, 2H), 3.75 (s, 3H), 2.62 (t, J=6.1 Hz, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:443.1.

Example A048: 2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethoxy)phenoxy]acetic acid

(354) ##STR00251##

Step 1: Preparation of methyl 2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethoxy)phenoxy]acetate

(355) ##STR00252##

(356) To a solution of 8-chloro-2-[2-hydroxy-4-(trifluoromethoxy)phenyl]chromen-4-one (Int-9, 1.2 g, 3.36 mmol, as the “CORE” in Table 3) and methyl 2-bromoacetate (772 mg, 5.05 mmol, as the “SM3” in Table 3) in DMF (10 mL) was added K.sub.2CO.sub.3 (1.39 g, 10.1 mmol) and the mixture was stirred at 50° C. overnight. After the reaction was completed, the reaction mixture was diluted with water (20 mL) and adjusted to PH˜4 by addition of 4N HCl. The resulting suspension was extracted with EtOAc (30 ml) three times. The combined organic layer was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluted with PE:EtOAc=100:1 to 3:1) to give methyl 2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethoxy)phenoxy]acetate (1.0 g, 69.3% yield) as a yellow solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 429.1.

Step 2: Preparation of 2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethoxy)phenoxy]acetic acid

(357) ##STR00253##

(358) To a mixture solution of methyl 2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethoxy)phenoxy]acetate (1.0 g, 2.33 mmol) in THF (5 ml) and water (5 ml) was added LiOH (335 mg, 14 mmol) and the mixture was stirred at room temperature for 2 hours. After the reaction was completed, the reaction was adjusted to pH˜4 by addition of 4N HCl and then extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by Prep-HPLC to give 2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethoxy)phenoxy]acetic acid (700 mg, 72.4% yield) as a white foam. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.08-8.18 (m, 1H), 7.96-8.05 (m, 2H), 7.46-7.57 (m, 1H), 7.31-7.37 (m, 1H), 7.21-7.31 (m, 2H), 5.07 (s, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:415.1.

(359) The following Example A049 to Example A072 were prepared in analogy to the procedure described for the preparation of Example A048, replacing 8-chloro-2-[2-hydroxy-4-(trifluoromethoxy)phenyl]chromen-4-one (Int-9) with “CORE”, and replacing methyl 2-bromoacetate with “SM3” in step1. The “CORE” and “SM3” are the reagent indicated in Table 3.

(360) TABLE-US-00003 TABLE 3 Compounds synthesis and characterization Example Compounds Name and CORE and No. Structure SM3 .sup.1H NMR and (ESI.sup.+ ) A049 2-[2-(8-chloro-4-oxo- chromen-2-yl)-5-methyl- phenoxy]acetic acid embedded image CORE: Int-2 SM3: methyl 2- bromoacetate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 13.07-13.37 (m, 1H), 7.97-8.02 (m, 2H), 7.89-7.96 (m, 1H), 7.44-7.53 (m, 1H), 7.34-7.40 (m, 1H), 7.00-7.09 (m, 2H), 4.85-4.96 (m, 2H), 2.35-2.43 (m, 3H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 345.1. A050 2-[2-(8-chloro-4-oxo- chromen-2-yl)-4,5- dimethoxy-phenoxy]acetic acid embedded image CORE: Int-10 SM3: methyl 2- bromoacetate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.94- 8.05 (m, 2H), 7.59- 7.69 (m, 1H), 7.39- 7.52 (m, 2H), 6.86 (s, 1H), 4.96 (s, 2H), 3.86-3.95 (m, 3H), 3.75-3.84 (m, 3H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 391.0 A051 2-[2-(8-chloro-4-oxo- chromen-2-yl)-5- (trifluoromethyl)phenoxy] acetic acid embedded image CORE: Int-1 SM3: methyl 2- bromoacetate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.82-13.52 (m, 1H), 8.21 (d, J = 8.1 Hz, 1H), 7.90-8.09 (m, 2H), 7.61 (d, J = 8.3 Hz, 1H), 7.44-7.57 (m, 2H), 7.38 (s, 1H), 5.02 (s, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 399.1. A052 4-[2-(8-chloro-4-oxo- chromen-2-yl)-5- (trifluoromethyl)phenoxy] butanoic acid embedded image CORE: Int-1 SM3: methyl 4- bromobutanoate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.01-12.20 (m, 1H), 8.08-8.15 (m, 1H), 8.03 (dd, J = 7.9, 1.2 Hz, 2H), 7.47-7.60 (m, 3H), 7.07 (s, 1H), 4.29 (t, J = 6.5 Hz, 2H), 2.37-2.44 (m, 2H), 1.97-2.06 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 427.2. A053 4-[2-(8-chloro-4-oxo- chromen-2-yl)-5- (trifluoromethoxy)phenoxy] butanoic acid embedded image CORE: Int-9 SM3: methyl 4- bromobutanoate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.23 (s, 1H), 8.04- 8.08 (m, 1H), 7.99- 8.03 (m, 2H), 7.48- 7.53 (m, 1H), 7.29- 7.32 (m, 1H), 7.20- 7.25 (m, 1H), 7.01- 7.04 (m, 1H), 4.20- 4.26 (m, 2H), 2.37- 2.44 (m, 2H), 1.98- 2.06 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 443.1. A054 4-[5-bromo-2-(8-chloro-4- oxo-chromen-2-yl)-4-methyl- phenoxy]butanoic acid embedded image CORE: Int-6 SM3: methyl 4- bromobutanoate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.17 (s, 1H), 7.96- 8.04 (m, 2H), 7.83- 7.90 (m, 1H), 7.46- 7.55 (m, 2H), 6.96- 7.02 (m, 1H), 4.15- 4.22 (m, 2H), 2.35- 2.41 (m, 5H), 1.92- 2.05 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 451.1 A055 4-[5-bromo-2-(8-chloro-4- oxo-chromen-2- yl)phenoxy]butanoic acid 0embedded image CORE: Int-4 SM3: methyl 4- bromobutanoate .sup.1H 1 NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.03-12.24 (m, 1H), 7.96-8.04 (m, 2H), 7.84-7.92 (m, 1H), 7.46-7.54 (m, 2H), 7.37-7.45 (m, 1H), 7.01-7.05 (m, 1H), 4.16-4.26 (m, 2H), 2.36-2.44 (m, 2H), 1.96-2.06 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 437.1 A056 4-[2-(8-chloro-4-oxo- chromen-2-yl)-4,5- dimethoxy-phenoxy]butanoic acid embedded image CORE: Int-10 SM3: methyl 4- bromobutanoate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 11.78-12.40 (br s, 1H), 7.73-8.23 (m, 2H), 7.32-7.63 (m, 2H), 6.94-7.15 (s, 1H), 6.44-6.92 (m, 1H), 4.05-4.30 (m, 2H), 3.84-3.94 (m, 3H), 3.63-3.84 (m, 3H), 2.41-2.47 (m, 2H), 1.88-2.08 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 419.1 A057 4-[5-chloro-2-(8-chloro-4- oxo-chromen-2-yl)-4-methyl- phenoxy]butanoic acid embedded image CORE: Int-5 SM3: methyl 4- bromobutanoate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.27 (s, 1H), 7.96- 8.04 (m, 2H), 7.83- 7.89 (m, 1H), 7.46- 7.53 (m, 1H), 7.34- 7.40 (m, 1H), 6.97- 7.02 (m, 1H), 4.14- 4.22 (m, 2H), 2.32- 2.43 (m, 5H), 1.95- 2.05 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 407.1. A058 4-[5-bromo-2-(8-chloro-4- oxo-chromen-2-yl)-4- methoxy-phenoxy]butanoic acid embedded image CORE: Int-7 SM3: methyl 4- bromobutanoate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.22 (s, 1H), 7.96- 8.05 (m, 2H), 7.59- 7.68 (m, 1H), 7.45- 7.57 (m, 2H), 7.03- 7.09 (m, 1H), 4.13- 4.20 (m, 2H), 3.93 (s, 3H), 2.35-2.42 (m, 2H), 1.93-2.03 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 467.1. A059 4-[2-(8-chloro-4-oxo- chromen-2-yl)-5-methyl- phenoxy]butanoic acid embedded image CORE: Int-2 SM3: methyl 4- bromobutanoate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.26 (s, 1H), 7.95- 8.03 (m, 2H), 7.81- 7.91 (m, 1H), 7.42- 7.52 (m, 1H), 7.09- 7.15 (m, 1H), 6.96- 7.07 (m, 2H), 4.12- 4.22 (m, 2H), 2.39- 2.45 (m, 5H), 1.97- 2.08 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 373.1 A060 4-[2-(8-chloro-4-oxo- chromen-2-yl)-5-methoxy-4- methyl-phenoxy]butanoic acid embedded image CORE: Int-12 SM3: methyl 4- bromobutanoate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.05 (s, 1H), 7.97 (d, J = 7.82 Hz, 2H), 7.69- 7.80 (m, 1H), 7.42- 7.52 (m, 1H), 7.02 (s, 1H), 6.75-6.84 (m, 1H), 4.19-4.28 (m, 2H), 3.92 (s, 3H), 2.39-2.46 (m, 2H), 2.16 (s, 3H), 1.99-2.10 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 403.1. A061 3-[2-(8-chloro-4-oxo- chromen-2-yl)-5- (trifluoromethoxy)phenoxy]- 2,2-dimethyl-propanoic acid CORE: Int-9 SM3: methyl 2,2-dimethyl- 3- (tosyloxy) propanoate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.98-8.07 (m, 3H), 7.44-7.56 (m, 1H), 7.29-7.38 (m, 1H), 7.18-7.28 (m, 1H), 6.91-7.02 (m, 1H), 4.24 (s, 2H), 1.24 (s, 6H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 457.1. A062 3-[2-(8-chloro-4-oxo- chromen-2-yl)-5- (trifluoromethyl)phenoxy]- 2,2-dimethyl-propanoic acid embedded image CORE: Int-1 SM3: methyl 2,2-dimethyl- 3- (tosyloxy) propanoate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.16-12.41 (m, 1H), 8.25-8.33 (m, 1H), 8.07 (d, J = 8.2 Hz, 1H), 7.67-7.81 (m, 3H), 7.54-7.63 (m, 1H), 7.29-7.38 (m, 1H), 3.76-3.95 (m, 2H), 1.00 (s, 6H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 441.1. A063 3-[2-(8-chloro-4-oxo- chromen-2-yl)-5-methyl- phenoxy]-2,2-dimethyl- propanoic acid embedded image CORE: Int-2 SM3: methyl 2,2-dimethyl- 3- (tosyloxy) propanoate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.35 (s, 1H), 7.94- 8.02 (m, 2H), 7.81- 7.89 (m, 1H), 7.42- 7.54 (m, 1H), 7.10- 7.18 (m, 1H), 6.96- 7.07 (m, 2H), 4.19 (s, 2H), 2.40 (s, 3H), 1.26 (s, 6H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 387.1. A064 3-[5-chloro-2-(8-chloro-4- oxo-chromen-2-yl)-4-methyl- phenoxy]-2,2-dimethyl- propanoic acid embedded image CORE: Int-15 SM3: methyl 2,2-dimethyl- 3- (tosyloxy) propanoate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.95-8.05 (m, 2H), 7.81-7.90 (m, 1H), 7.46-7.54 (m, 1H), 7.35-7.43 (m, 1H), 6.95 (s, 1H), 4.21 (s, 2H), 2.36 (s, 3H), 1.23 (s, 6H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 421.1. A065 5-[2-(8-chloro-4-oxo- chromen-2-yl)-5- (trifluoromethyl)phenoxy] pentanoic acid embedded image CORE: Int-1 SM3: methyl 5- bromopentanoate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 11.85-12.14 (br s, 1H), 8.09-8.17 (m, 1H), 7.98-8.08 (m, 2H), 7.44-7.61 (m, 3H), 7.06-7.14 (m, 1H), 4.23-4.32 (m, 2H), 2.29 (t, J = 7.3 Hz, 2H), 1.76-1.88 (m, 2H), 1.60-1.72 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 441.3. A066 7-[2-(8-chloro-4-oxo- chromen-2-yl)-5- (trifluoromethyl)phenoxy] heptanoic acid 0embedded image CORE: Int-1 SM3: methyl 7- bromoheptanoate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 11.92 (br s, 1H), 8.10- 8.17 (m, 1H), 7.98- 8.07 (m, 2H), 7.45- 7.58 (m, 3H), 7.10 (s, 1H), 4.21-4.30 (m, 2H), 2.11-2.20 (m, 2H), 1.75-1.87 (m, 2H), 1.40-1.54 (m, 4H), 1.26-1.39 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 469.2 A067 2-[1-[[2-(8-chloro-4-oxo- chromen-2-yl)-4,5- dimethoxy- phenoxy]methyl]cyclopropyl] acetic acid embedded image CORE: Int-10 SM3: methyl 2-[1- (bromomethyl) cyclopropyl] acetate (CAS #: 855473-50-6, Cat.#: PBGJ3164, from PharmaBlock (NanJing) R&D Co. Ltd). .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 13.11-13.25 (m, 1H), 8.95-9.08 (m, 2H), 8.63 (s, 1H), 8.46-8.56 (m, 1H), 8.23 (s, 1H), 7.87 (s, 1H), 5.12-5.15 (m, 2H), 4.94 (s, 3H), 4.86 (s, 3H), 3.45-3.49 (m, 2H), 1.61-1.74 (m, 4H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 445.1. A068 2-[1-[[5-bromo-2-(8-chloro-4- oxo-chromen-2-yl)-4-methyl- phenoxy]methyl]cyclopropyl] acetic acid embedded image CORE: Int-6 SM3: methyl 2-[1- (bromomethyl) cyclopropyl] acetate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.94- 8.05 (m, 2H), 7.83- 7.90 (m, 1H), 7.41- 7.56 (m, 2H), 7.04- 7.13 (m, 1H), 4.11 (s, 2H), 2.38 (s, 5H), 0.51-0.69 (m, 4H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 477.1. A069 2-[1-[[5-bromo-2-(8-chloro-4- oxo-chromen-2- yl)phenoxy]methyl] cyclopropyl]acetic acid embedded image CORE: Int-4 SM3: methyl 2-[1- (bromomethyl) cyclopropyl] acetate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.19 (s, 1H), 7.96- 8.07 (m, 2H), 7.79- 7.94 (m, 1H), 7.47- 7.56 (m, 1H), 7.36- 7.45 (m, 2H), 7.05- 7.17 (m, 1H), 4.17 (s, 2H), 2.43 (s, 2H), 0.53-0.72 (m, 4H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 463.1. A070 2-[5-bromo-2-(8-chloro-4- oxo-chromen-2-yl)phenoxy]- 2-methyl-propanoic acid embedded image CORE: Int-4 SM3: methyl 2-bromo-2- methyl- propanoate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 13.54 (br s, 1H), 8.01 (dd, J = 7.9, 1.9 Hz, 2H), 7.84 (d, J = 8.4 Hz, 1H), 7.38-7.56 (m, 2H), 7.05 (d, J = 1.7 Hz, 1H), 6.97 (s, 1H), 1.62 (s, 6H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 437.0. A071 5-[2-(8-chloro-4-oxo- chromen-2-yl)-5- (trifluoromethoxy)phenoxy]- 2,2-dimethyl-pentanoic acid embedded image CORE: Int-9 SM3: methyl 5-bromo-2,2- dimethyl- pentanoate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.03 (br s, 1H), 7.98- 8.08 (m, 3H), 7.45- 7.56 (m, 1H), 7.16- 7.30 (m, 2H), 7.00- 7.08 (m, 1H), 4.13- 4.23 (m, 2H), 1.69- 1.78 (m, 2H), 1.59- 1.65 (m, 2H), 1.08- 1.15 (m, 8H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 485.1. A072 3-[[5-bromo-2-(8-chloro-4- oxo-chromen-2- yl)phenoxy]methyl] benzoic acid embedded image CORE: Int-4 SM3: methyl 3- (bromomethyl) benzoate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.79-13.18 (br s, 1H), 8.04-8.09 (m, 1H), 7.88-8.01 (m, 4H), 7.74 (d, J = 7.8 Hz, 1H), 7.62 (d, J = 1.7 Hz, 1H), 7.40-7.57 (m, 3H), 7.00 (s, 1H), 5.44 (s, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+: 485.0. A073 2-[5-bromo-2-(8-chloro-4- oxo-chromen-2-yl)-4-methyl- phenoxy]acetic acid embedded image CORE: Int-6 SM3: methyl 2- bromoacetate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.97- 8.05 (m, 2H), 7.90- 7.96 (m, 1H), 7.41- 7.54 (m, 2H), 7.27- 7.35 (m, 1H), 4.96 (s, 2H), 2.36-2.43 (m, 3H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 423.1.

Example A074: 3-[[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]acetyl]amino]cyclobutanecarboxylic acid

(361) ##STR00278##

Step 1: Preparation of methyl 3-[[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]acetyl]amino]cyclobutanecarboxylate

(362) ##STR00279##

(363) To a solution of 2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]acetic acid (Example A051, 200.0 mg, 0.5 mmol), methyl 3-aminocyclobutanecarboxylate (77.8 mg, 0.60 mmol) and DIPEA (0.25 mL, 1.42 mmol) in DMF (5 mL) was added HATU (269.26 mg, 0.710 mmol) and the reaction mixture was stirred at room temperature for 2 hours. After reaction was completed, the reaction was quenched with water (30 mL) and extracted with EtOAc (30 mL) three times. The combined organic layer was washed with brine (40 mL), dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluent with PE:EtOAc=1:1) to afford methyl 3-[[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]acetyl]amino]cyclobutanecarboxylate (150 mg, 58.1% yield) as a light yellow oil. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 510.0.

Step 2: Preparation of 3-[[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]acetyl]amino]cyclobutanecarboxylic acid

(364) ##STR00280##

(365) To a solution of methyl 3-[[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]acetyl]amino]cyclobutanecarboxylate (150.0 mg, 0.29 mmol) in a mixed solvent of THF (8 mL) and water (2 mL) was added lithium hydroxide (44 mg, 2.0 mmol) and the mixture was stirred at 25° C. for 2 hours. After the reaction was completed, the mixture was adjusted to pH˜3 by addition of HCl (1 M). The resulting suspension was then filtered and the solid was collected to give 3-[[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]acetyl]amino]cyclobutanecarboxylic acid (114.7 mg, 58.09% yield) as a white solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 11.99-12.28 (br s, 1H), 8.44-8.52 (m, 1H), 8.16 (d, J=7.9 Hz, 1H), 8.03 (d, J=7.9 Hz, 2H), 7.61 (dd, J=8.1, 0.7 Hz, 1H), 7.52 (t, J=7.9 Hz, 1H), 7.39-7.44 (m, 1H), 7.27 (s, 1H), 4.77-4.88 (m, 2H), 4.11-4.26 (m, 1H), 2.66-2.80 (m, 1H), 2.33-2.42 (m, 2H), 1.99-2.11 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 496.0.

Example A075: (2R)-1-[3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]propanoyl]pyrrolidine-2-carboxylic acid

(366) ##STR00281##

Step 1: Preparation of tert-butyl (2R)-1-[3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]propanoyl]pyrrolidine-2-carboxylate

(367) ##STR00282##

(368) To a solution of 3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]propanoic acid (Example A004, 200.0 mg, 0.470 mmol, as the “EX” in Table 4), tert-butyl (2R)-pyrrolidine-2-carboxylate (121.26 mg, 0.710 mmol, as the “AMINE” in Table 4) and DIPEA (0.25 mL, 1.42 mmol) in DMF (5 mL) was added HATU (269.26 mg, 0.710 mmol) and the reaction mixture was stirred at room temperature for 2 hours. After reaction was completed, the reaction was quenched with water (30 mL) and extracted with EtOAc (30 mL) three times. The combined organic layer was washed with brine (40 mL), dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluted with PE:EtOAc=1:1) to afford tert-butyl (2R)-1-[3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]propanoyl]pyrrolidine-2-carboxylate (200 mg, 73.44% yield) as a light yellow oil. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 576.0.

Step 2: Preparation of (2R)-1-[3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]propanoyl]pyrrolidine-2-carboxylic acid

(369) ##STR00283##

(370) To a solution of tert-butyl (2R)-1-[3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]propanoyl]pyrrolidine-2-carboxylate (200.0 mg, 0.350 mmol) in DCM (2 mL) was added TFA (2.0 mL, 25.96 mmol) and the mixture was then stirred at room temperature for 4 hours. After the reaction was completed, the mixture was concentrated in vacuo and the residue was purified by Prep-HPLC to give (2R)-1-[3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]propanoyl]pyrrolidine-2-carboxylic acid (85.1 mg, 46.97% yield) as a white solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.38 (s, 1H), 7.99-8.01 (m, 2H), 7.88 (d, J=8.5 Hz, 1H), 7.46-7.54 (m, 2H), 7.43 (d, J=8.4 Hz, 1H), 6.98 (d, J=8.7 Hz, 1H), 4.37-4.49 (m, 2H), 4.26 (dd, J=8.9, 3.3 Hz, 1H), 3.50-3.61 (m, 2H), 3.39-3.46 (m, 1H), 2.87-2.92 (m, 1H), 2.74 (dt, J=7.4, 4.5 Hz, 1H), 2.09-2.15 (m, 1H), 1.81-1.92 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 520.0.

(371) The following Example A076 to Example A083 were prepared in analogy to the procedure described for the preparation of Example A075, replacing 3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]propanoic acid (Example A004) with “EX”, tert-butyl (2R)-pyrrolidine-2-carboxylate “AMINE” in step1. The “EX” and “AMINE” are the reagents indicated in Table 4.

(372) TABLE-US-00004 TABLE 4 Compounds synthesis and characterization Example Compounds Name and EX and No. Structure AMINE .sup.1H NMR and (ESI.sup.+) A076 (2S)-1-[3-[5-bromo-2-(8- chloro-4-oxo-chromen-2- yl)phenoxy]propanoyl] pyrrolidine-2-carboxylic acid embedded image EX: A004 AMINE: tert- butyl (2S)- pyrrolidine-2- carboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.34 (s, 1H), 7.99-8.01 (m, 2H), 7.88 (d, J = 8.4 Hz, 1H), 7.46-7.56 (m, 2H), 7.43 (d, J = 8.4 Hz, 1H), 6.98 (d, J = 8.7 Hz, 1H), 4.37-4.49 (m, 2H), 4.26 (dd, J = 8.9, 3.3 Hz, 1H), 3.50- 3.67 (m, 2H), 3.39- 3.46 (m, 1H), 2.87- 2.92 (m, 1H), 2.76 (dt, J = 7.4, 4.5 Hz, 1H), 2.09-2.19 (m, 1H), 1.81-1.92 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 520.0. A077 (2R)-1-[2-[2-(8-chloro-4-oxo- chromen-2-yl)-5-methyl- phenoxy]acetyl]pyrrolidine- 2-carboxylic acid embedded image EX: A004 AMINE: tert- butyl (2R)- pyrrolidine-2- carboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.87-8.02 (m, 3H), 7.39-7.53 (m, 2H), 7.00-7.08 (m, 2H), 5.06 (s, 2H), 4.26-4.36 (m, 1H), 3.53-3.69 (m, 2H), 2.38 (s, 3H), 1.82-2.25 (m, 4H) MS obsd. (ESI.sup.+) [(M + H).sup.+]: 442.1. A078 (2S)-1-[2-[2-(8-chloro-4-oxo- chromen-2-yl)-5-methyl- phenoxy]acetyl]pyrrolidine- 2-carboxylic acid embedded image EX: A004 AMINE: tert- butyl (2S)- pyrrolidine-2- carboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.88-8.02 (m, 3H), 7.40-7.52 (m, 2H), 6.98-7.07 (m, 2H), 5.02 (s, 2H), 4.25-4.36 (m, 1H), 3.55-3.68 (m, 2H), 2.33 (s, 3H), 2.10-2.26 (m, 1H), 1.81-2.01 (m, 3H) MS obsd. (ESI.sup.+) [(M + H).sup.+]: 442.1. A079 (2R)-1-[2-[5-bromo-2-(8- chloro-4-oxo-chromen-2-yl)- 4-methyl- phenoxy]acetyl]pyrrolidine- 2-carboxylic acid embedded image EX: A073 AMINE: tert- butyl (2R)- pyrrolidine-2- carboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.97-8.03 (m, 2H), 7.90-7.94 (m, 1H), 7.47-7.53 (m, 2H), 7.39-7.42 (m, 1H), 5.14 (s, 2H), 4.26-4.33 (m, 1H), 3.53-3.64 (m, 2H), 2.39 (s, 3H), 2.10-2.23 (m, 1H), 1.82-2.01 (m, 3H) MS obsd. (ESI.sup.+) [(M + H).sup.+]: 520.1. A080 (2S)-1-[2-[5-bromo-2-(8- chloro-4-oxo-chromen-2-yl)- 4-methyl- phenoxy]acetyl]pyrrolidine- 2-carboxylic acid embedded image EX: A073 AMINE: tert- butyl (2S)- pyrrolidine-2- carboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.97-8.05 (m, 2H), 7.93 (s, 1H), 7.41 (s, 3H), 5.06 (s, 2H), 4.23-4.35 (m, 1H), 3.52-3.69 (m, 2H), 2.39 (s, 3H), 2.09-2.24 (m, 1H), 1.81-2.03 (m, 3H) MS obsd. (ESI.sup.+) [(M + H).sup.+]: 520.1 A081 (2R)-1-[2-[2-(8-chloro-4-oxo- chromen-2-yl)-5- (trifluoromethyl)phenoxy] acetyl]pyrrolidine-2-carboxylic acid embedded image EX: A051 AMINE: tert- butyl (2R)- pyrrolidine-2- carboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.17- 8.23 (m, 1H), 8.02 (dd, J = 7.9, 3.4 Hz, 2H), 7.53 (br d, J = 13.2 Hz, 3H), 7.46 (s, 1H), 5.24 (s, 2H), 4.26-4.32 (m, 1H), 3.58-3.67 (m, 2H), 2.12-2.22 (m, 2H), 1.83-2.01 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 496.0. A082 (2S)-1-[2-[2-(8-chloro-4-oxo- chromen-2-yl)-5- (trifluoromethyl)phenoxy] acetyl]pyrrolidine-2-carboxylic acid 0embedded image EX: A051 AMINE: tert- butyl (2S)- pyrrolidine-2- carboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.21 (d, J = 8.1 Hz, 1H), 7.99-8.05 (m, 2H), 7.49-7.61 (m, 3H), 7.43-7.48 (m, 1H), 5.18-5.27 (s, 2H), 4.26-4.33 (m, 1H), 3.55-3.66 (m, 2H), 2.12-2.24 (m, 2H), 1.87-2.00 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 496.0. A083 (3S)-1-[2-[2-(8-chloro-4-oxo- chromen-2-yl)-5- (trifluoromethyl)phenoxy] acetyl]pyrrolidine-3-carboxylic acid embedded image EX: A051 AMINE: tert- butyl (3S)- pyrrolidine-3- carboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.15- 8.24 (m, 1H), 8.02 (s, 2H), 7.46-7.66 (m, 4H), 5.18 (s, 2H), 3.70-3.79 (m, 1H), 3.46-3.65 (m, 2H), 2.92-3.15 (m, 1H), 2.57-2.71 (m, 1H), 1.90-2.21 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 496.0.

Example A084: 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-N-cyclopropylsulfonyl-propanamide

(373) ##STR00292##

(374) To a solution of methyl 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoate (Example A002, 1450.0 mg, 3.4 mmol) and cyclopropanesulfonamide (617.48 mg, 5.1 mmol) in 1,2-dichloroethane (100 mL) cooled at 0° C. was added titanium tetrachloride (1611.15 mg, 8.49 mmol). After addition, the mixture was stirred at 110° C. for 16 hours. After the reaction was completed, the reaction was quenched by pour into ice water (50 mL) and the resulting solution was extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was then purified by column chromatography on silica gel (PE:EtOAc=2:1) to give the crude 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-N-eyelopropylsulfonyl-propanamide, which was further purified by Prep-HPLC to afford 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-N-cyclopropylsulfonyl-propanamide as a white solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 11.87 (s, 1H), 8.16 (d, J=7.9 Hz, 1H), 8.02 (td, J=7.6, 1.5 Hz, 2H), 7.56-7.64 (m, 2H), 7.46-7.55 (m, 1H), 7.03 (s, 1H), 4.46-4.55 (m, 2H), 2.93-2.99 (m, 1H), 2.86-2.93 (m, 2H), 0.90-1.10 (m, 4H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:516.1.

Example A085: 3-[2-(8-chloro-4-oxo-chromen-2-yl)-4,5-dimethoxy-phenoxy]-N-cyclopropylsulfonyl-propanamide

(375) ##STR00293##

Step1: Preparation of methyl 3-[2-(8-chloro-4-oxo-chromen-2-yl)-4,5-dimethoxy-phenoxy]propanoate

(376) ##STR00294##

(377) Example A038 was prepared in analogy to the procedure described for the preparation of Example A002 by using 3-[2-(8-chloro-4-oxo-chromen-2-yl)-4,5-dimethoxy-phenoxy]propanoic acid (Example A010) as the starting material instead of 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoic acid (Example A001).

Step1: Preparation of 3-[2-(8-chloro-4-oxo-chromen-2-yl)-4,5-dimethoxy-phenoxy]-N-cyclopropylsulfonyl-propanamide

(378) ##STR00295##

(379) Example A085 was prepared in analogy to the procedure described for the preparation of example A084 by using methyl 3-[2-(8-chloro-4-oxo-chromen-2-yl)-4,5-dimethoxy-phenoxy]propanoate as the starting material instead of methyl 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoate. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 11.81-11.96 (br s, 1H), 7.96-8.04 (m, 2H), 7.60 (s, 1H), 7.47 (t, J=1.9 Hz, 1H), 7.03 (s, 1H), 6.91 (s, 1H), 4.43 (t, J=5.7 Hz, 2H), 3.90-3.98 (m, 3H), 3.73-3.86 (m, 3H), 2.94-3.02 (m, 1H), 2.79-2.95 (m, 2H), 0.92-1.10 (m, 4H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:508.0.

Example A086: 2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-N-(2-hydroxyethyl)acetamide

(380) ##STR00296##

(381) To a solution of 2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]acetic acid (Example A051, 93.0 mg, 0.230 mmol, as the “EX” in Table 5), 2-hydroxyethylamine (0.03 mL, 0.470 mmol, as the “AMINE” in Table 5), DIPEA (0.12 mL, 0.700 mmol) in DMF (8 mL) was added HATU (133.0 mg, 0.350 mmol) and the mixture was stirred at room temperature for 18 hours. After the reaction was completed, the reaction was diluted with water (20 mL) and extracted with EtOAc (30 mL) three times. The combined organic layer was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by Prep-HPLC to give 2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-N-(2-hydroxyethyl)acetamide (59 mg, 0.130 mmol, 56.11% yield) as a white solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.11-8.20 (m, 2H), 7.99-8.05 (m, 2H), 7.61 (dd, J=8.1, 1.0 Hz, 1H), 7.52 (s, 1H), 7.44-7.47 (m, 1H), 7.26-7.29 (m, 1H), 4.84-4.90 (m, 2H), 4.60-4.73 (m, 1H), 3.42 (s, 2H), 3.15-3.21 (m, 2H). MS obsd. (ESI.sup.+)[(M+H).sup.+]: 442.0.

(382) The following Example A087 to A083 were prepared in analogy to the procedure described for the preparation of Example A086, replacing 2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]acetic acid (Example A051) with “EX”, 2-hydroxyethylamine with “AMINE” in by the reagent indicated in Table 5.

(383) TABLE-US-00005 TABLE 5 Compounds synthesis and characterization Example Compounds Name and EX and No. Structure AMINE .sup.1H NMR and (ESI.sup.+) A087 8-chloro-2-[2-[2-(3- methylsulfonylpyrrolidin-1- yl)-2-oxo-ethoxy]-4- (trifluoromethyl)phenyl] chromen-4-one embedded image EX: A051 AMINE: 3- methylsulfonyl pyrrolidine .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.16- 8.26 (m, 1H), 7.95- 8.06 (m, 2H), 7.45- 7.67 (m, 4H), 5.15- 5.31 (m, 2H), 3.96- 4.15 (m, 1H), 3.87- 3.94 (m, 1H), 3.71- 3.82 (m, 1H), 3.43- 3.71 (m, 2H), 3.08 (d, J = 9.2 Hz, 3H), 2.20- 2.43 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 529.9. A088 2-[4-bromo-2-[2-[(3S)-3- hydroxypyrrolidin-1-yl]-2- oxo-ethoxy]-5-methyl- phenyl]-8-chloro-chromen-4- one embedded image EX: A073 AMINE: (3S)- pyrrolidin-3-ol .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.96- 8.05 (m, 2H), 7.93 (s, 1H), 7.47-7.57 (m, 2H), 7.43 (d, J = 1.3 Hz, 1H), 5.08 (s, 2H), 4.25-4.40 (m, 1H), 3.53-3.64 (m, 2H), 3.42-3.51 (m, 1H), 2.39 (s, 3H), 1.67-2.01 (m, 3H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 492.0. A089 2-[4-bromo-2-[2-[(3R)-3- hydroxypyrrolidin-1-yl]-2- oxo-ethoxy]-5-methyl- phenyl]-8-chloro-chromen-4- one embedded image EX: A073 AMINE: (3R)- pyrrolidin-3-ol .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.96- 8.06 (m, 2H), 7.92 (s, 1H), 7.48-7.57 (m, 2H), 7.43 (d, J = 1.3 Hz, 1H), 5.08 (s, 2H), 4.25-4.43 (m, 1H), 3.53-3.69 (m, 2H), 3.42-3.51 (m, 1H), 2.39 (s, 3H), 1.67-2.01 (m, 3H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 491.8. A090 2-[4-bromo-5-methyl-2-[2- oxo-2-[rac-(3S,4R)-3,4- dihydroxypyrrolidin-1- yl]ethoxy]phenyl]-8-chloro- chromen-4-one 00embedded image EX: A073 AMINE: (3S,4R)- pyrrolidine- 3,4-diol .sup.1H NMR (CDCl.sub.3, 400 MHz): δ ppm 8.11 (d, J = 8.2 Hz, 1H), 7.86-7.99 (m, 1H), 7.65-7.82 (m, 2H), 7.34-7.47 (m, 2H), 4.64-4.87 (s, 2H), 4.20-4.41 (m, 2H), 3.53-3.79 (m, 4H), 2.59-2.68 (m, 1H), 2.41-2.50 (s, 3H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 507.8. A091 2-[2-(8-chloro-4-oxo- chromen-2-yl)-4,5- dimethoxy-phenoxy]-N- cyclopropylsulfonyl- acetamide 01embedded image EX: A050 AMINE: cyclopropane- sulfonamide .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.95-8.02 (m, 2H), 7.60-7.66 (m, 1H), 7.42-7.53 (m, 2H), 6.75-6.83 (m, 1H), 4.62-4.71 (s, 2H), 3.84-3.93 (s, 3H), 3.78-3.84 (s, 3H), 2.77-2.88 (m, 1H), 0.70-0.89 (m, 4H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 494.0. A092 8-chloro-2-[2-(2-morpholino- 2-oxo-ethoxy)-4- (trifluoromethyl)phenyl] chromen-4-one 02embedded image EX: A051 AMINE: morpholine .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.22- 8.27 (m, 1H), 7.99- 8.06 (m, 2H), 7.45- 7.65 (m, 4H), 5.26 (s, 2H), 3.54-3.68 (m, 4H), 3.43-3.54 (m, 4H). MS obsd. (ESI.sup.+) [M + H).sup.+]: 468.0. A093 (2S)-1-[2-[2-(8-chloro-4-oxo- chromen-2-yl)-5-methyl- phenoxy]acetyl]-N- methylsulfonyl-pyrrolidine-2- carboxamide 03embedded image EX: A049 AMINE: methane- sulfonamide .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 11.88 (s, 1H), 7.91- 8.02 (m, 3H), 7.41- 7.52 (m, 2H), 6.99- 7.10 (m, 2H), 5.01- 5.10 (m, 2H), 4.31- 4.41 (m, 1H), 3.54- 3.69 (m, 2H), 3.19 (s, 3H), 2.39 (s, 3H), 2.11-2.24 (m, 1H), 1.77-2.03 (m, 3H). MS obsd. (ESI.sup.+) [(M + H).sup.+: 519.1. A094 (2R)-1-[2-[2-(8-chloro-4-oxo- chromen-2-yl)-5-methyl- phenoxy]acetyl]-N- methylsulfonyl-pyrrolidine-2- carboxamide 04embedded image EX: A049 AMINE: methane- sulfonamide .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 11.95 (s, 1H), 7.91- 8.03 (m, 3H), 7.41- 7.53 (m, 2H), 6.98- 7.10 (m, 2H), 5.02- 5.10 (m, 2H), 4.31- 4.41 (m, 1H), 3.52- 3.73 (m, 2H), 3.20 (s, 3H), 2.39 (s, 3H), 2.11-2.23 (m, 1H), 1.78-2.03 (m, 3H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 519.1.

Example A095: (2S)-2-amino-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoic acid

(384) ##STR00305##

Step 1: Preparation of methyl (2S)-2-amino-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoate

(385) ##STR00306##

(386) To a solution of 8-chloro-2-[2-hydroxy-4-(trifluoromethyl)phenyl]chromen-4-one (Int-1, 1000 mg, 2.94 mmol), methyl trityl-L-serinate (1.27 g, 3.52 mmol) and triphenylphosphine (1.92 g, 7.34 mmol) in THF (10 ml) was added DIAD (1.19 g, 1.14 ml, 5.87 mmol) and the mixture was then stirred at room temperature overnight. The mixture was then diluted with water (30 mL) and extracted with EtOAc (30 mL) three times. The combined organic layer was washed with 1 N HCl (20 mL), brine (20 mL), dried over Na.sub.2SO.sub.4 and concentrated in vacuo.

(387) The residue was dissolved in DCM (20 mL) and to the resulting solution was added TFA (3 mL). The mixture was then stirred at room temperature for 2 hours. The mixture was then concentrated in vacuo and the residue was triturated with EtOAc (30 mL). The suspension was then filtered and the solid was collected to give methyl (2S)-2-amino-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoate (1.1 g, 80% yield) as a white solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 442.1.

Step 2: Preparation of (2S)-2-amino-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoic acid

(388) ##STR00307##

(389) To a solution of methyl (2S)-2-amino-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoate (500 mg, 1.13 mmol) in the mixed solvent of THF (10 ml) and water (1 ml) was added LiOH (27.1 mg, 1.13 mmol). The mixture was then stirred at room temperature for 2 hours. The reaction was then quenched by addition of AcOH (1 mL) and the resulting suspension was filtered. The solid was collected and suspended in a mixed solvent of EtOAc (10 mL) and water (10 mL). The suspension was then filtered. The solid was collected and dried in vacuo to give (2S)-2-amino-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoic acid (200 mg, 39.2% yield) as a white solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.98 (m, 4H), 7.67 (s, 1H), 7.48-7.62 (m, 2H), 7.08 (s, 1H), 4.61-4.69 (m, 1H), 4.41-4.49 (m, 1H), 3.69 (m, 1H), 3.44 (s, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 428.3.

Example A096: (2S)-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-2-(cyclopropylsulfonylamino)propanoic acid

(390) ##STR00308##

(391) To a solution of (2S)-2-amino-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoic acid (40 mg, 93.5 μmol) and TEA (284 mg, 2.81 mmol) in the DCM (10 mL) was added cyclopropanesulfonyl chloride (263 mg, 1.87 mmol) and the mixture was then stirred at room temperature overnight. The mixture was then adjusted to pH˜5.0 by addition of AcOH. The resulting mixture was washed with water (10 mL), brine, dried over MgSO.sub.4 and then concentrated in vacuo. The residue was then purified by Prep-HPLC to give (2S)-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-2-(cyclopropylsulfonylamino)propanoic acid (11 mg, 21.7% yield) as a white solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.11-8.16 (m, 1H), 7.99-8.07 (m, 2H), 7.72-7.85 (m, 1H), 7.57-7.67 (m, 2H), 7.48-7.55 (m, 1H), 7.05-7.13 (m, 1H), 4.45-4.57 (m, 2H), 4.30-4.41 (m, 1H), 2.58-2.62 (m, 1H), 0.71-0.96 (m, 4H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 532.1.

Example A097: (2S)-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-2-(p-tolylsulfonylamino)propanoic acid

(392) ##STR00309##

(393) Example A097 was prepared in analogy to the procedure described for the preparation of example A096 by using 4-methylbenzenesulfonyl chloride as the starting material instead of clopropanesulfonyl chloride. .sup.1H NMR (DMSO-d.sub.6. 400 MHz): δ ppm 8.09 (d, J=8.3 Hz, 1H), 8.03 (d, J=7.8 Hz, 2H), 7.54-7.63 (m, 3H), 7.48-7.54 (m, 1H), 7.44-7.48 (m, 1H), 7.15-7.19 (m, 2H), 7.01-7.06 (m, 1H), 4.39-4.47 (m, 1H), 4.29-4.38 (m, 1H), 4.03-4.12 (m, 1H), 2.21-2.27 (s, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:583.3.

Example A098: methyl (2S)-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-2-(ethylsulfamoylamino)propanoate

(394) ##STR00310##

(395) To a solution of methyl (2S)-2-amino-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propanoate (200 mg, 0.45 mmol) and TEA (202 mg, 2 2 mol) in DCM (10 mL) was added ethylsulfamoyl chloride (143 mg, 1 mmol) and the mixture was then stirred at room temperature for 2 hours. The mixture was then diluted with EtOAc (50 mL) and the resulting solution was washed with water (15 mL), brine (15 mL), dried over Na.sub.2SO.sub.4. The organic layer was then concentrated in vacuo and the residue was purified by column chromatography on silica gel (eluent with PE:EtOAc 10:1 to 3:1) to give methyl (2S)-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-2-(ethylsulfamoylamino)propanoate (120 mg, 45.9% yield) as a white solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.13 (d, J=7.8 Hz, 1H), 8.03 (d, J=7.8 Hz, 2H), 7.71-7.76 (m, 1H), 7.59-7.65 (m, 2H), 7.52 (t, J=7.9 Hz, 1H), 7.00 (s, 1H), 6.95 (t, J=5.7 Hz, 1H), 4.51-4.56 (m, 1H), 4.43-4.49 (m, 1H), 4.25-4.32 (m, 1H), 3.64 (s, 3H), 2.77-2.86 (m, 2H), 0.97 (t, J=7.2 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:549.1.

Example A099: (2S)-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-2-(ethylsulfamoylamino)propanoic acid

(396) ##STR00311##

(397) To a solution of methyl (2S)-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-2-(ethylsulfamoylamino)propanoate (160 mg, 291 μmol) in DCE (15 mL) was added trimethylstannanol (158 mg, 874 μmol) and the mixture was then stirred at 90° C. for 10 hours. After the reaction was completed, the mixture was concentrated in vacuo and the residue was dissolved with 4 N HCl (20 mL). The mixture was then extracted with EtOAc (20 mL) three times. The combined organic layer was concentrated in vacuo and the residue was purified by Prep-HPLC to give (2S)-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-2-(ethylsulfamoylamino)propanoic acid (43.5 mg, 26.5% yield) as a white solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.13 (d, J=7.9 Hz, 1H), 8.02 (d, J=7.8 Hz, 2H), 7.58-7.65 (m, 2H), 7.51 (t, J=7.9 Hz, 1H), 7.24 (d, J=7.0 Hz, 1H), 7.09 (s, 1H), 6.90 (t, J=5.6 Hz, 1H), 4.45-4.56 (m, 2H), 4.11-4.17 (m, 1H), 2.76-2.87 (m, 2H), 0.95 (t, J=7.3 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:535.0.

Example B001: 3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]cyclobutanecarboxylic acid

(398) ##STR00312##

Step 1: Preparation of methyl 3-methylsulfonyloxycyclobutanecarboxylate

(399) ##STR00313##

(400) To a solution of methyl 3-hydroxycyclobutanecarboxylate (1 g, 7.68 mmol, as the “SM4” in Table 6) and TEA (1.17 g, 1.61 mL, 11.5 mmol) in dichloromethane (10 mL) was added methanesulfonyl chloride (1.14 g, 778 μL, 9.99 mmol) at 0° C. and the mixture was then stirred at room temperature overnight. The mixture was then diluted with dichloromethane (50 mL), the resulting solution was then washed with water (20 mL) twice, saturated NaHCO.sub.3 (20 mL) twice, brine (20 mL), dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give the crude methyl 3-methylsulfonyloxycyclobutanecarboxylate (1.6 g, 100%) as a colorless oil. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 209.2.

Step 2: Preparation of methyl 3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]cyclobutanecarboxylate

(401) ##STR00314##

(402) To a mixture of 2-(4-bromo-2-hydroxy-phenyl)-8-chloro-chromen-4-one (Int-4, 100 mg, 284 μmol, as the “CORE” in Table 6), methyl 3-methylsulfonyloxycyclobutanecarboxylate (592 mg, 2.84 mmol) in DMF (5 ml) was added K.sub.2CO.sub.3 (393 mg, 2.84 mmol) and the mixture was stirred at 120° C. for 12 hours. After the reaction was completed, the mixture was diluted with water (15 mL) and extracted with EtOAc (20 mL) three times. The combined organic layer was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo to give the crude methyl 3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]cyclobutanecarboxylate, which was used in the next step directly without further purification.

Step 3: Preparation of 3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]cyclobutanecarboxylic acid

(403) ##STR00315##

(404) A solution of methyl 3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]cyclobutanecarboxylate (crude prepared above) in the mixed solvent of THF (10 mL) and LiOH solution (2N, 2 mL) was stirred at room temperature for 2 hours. After the reaction was completed, the reaction was adjusted to pH˜4 by addition of 2 N HCl. The resulting mixture was concentrated in vacuo and the residue was purified by Prep-HPLC to give 3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]cyclobutanecarboxylic acid (30 mg, 22% yield over 2 steps).

(405) .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.01 (d, J=7.83 Hz, 2H), 7.88 (s, 1H), 7.51 (t, J=7.70 Hz, 1H), 7.43 (d, J=8.56 Hz, 1H), 7.20 (s, 1H), 7.04-7.09 (m, 1H), 4.87-5.15 (m, 1H), 3.07-3.12 (m, 1H), 2.68-2.76 (m, 2H), 2.43-2.47 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:449.1.

Example B002-A and Example B002-B

Cis-3-[2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]cyclobutanecarboxylic acid and traits-3-[2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]cyclobutanecarboxylic acid

(406) ##STR00316##

Step 1: Preparation of methyl 3-[2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]cyclobutanecarboxylate

(407) ##STR00317##

(408) To a mixture of 8-chloro-2-(2-hydroxyphenyl)chromen-4-one (Int-3, 100 mg, 367 μmol), methyl 3-methylsulfonyloxycyclobutanecarboxylate (305 mg, 1.47 mmol) in DMF (5 ml) was added Cs.sub.2CO.sub.3 (478 mg, 1.47 mmol) and the mixture was stirred at 120° C. for 12 hours. After the reaction was completed, the mixture was diluted with water (15 mL) and extracted with EtOAc (20 mL) three times. The combined organic layer was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo to give the crude methyl 3-[2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]cyclobutanecarboxylate, which was used in the next directly without further purification.

Step 2: Preparation of Cis-3-[2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]cyclobutanecarboxylic acid and trans-3-[2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]cyclobutanecarboxylic acid

(409) ##STR00318##

(410) A solution of methyl 3-[2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]cyclobutanecarboxylate (crude prepared above) in the mixed solvent of THF (10 mL) and LiOH solution (2N, 2 mL) was stirred at room temperature for 2 hours. After the reaction was completed, the reaction was adjusted to pH˜4 by addition of 2 N HCl, the resulting mixture was concentrated in vacuo to give the crude-[2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]cyclobutanecarboxylic acid. The crude was further purified by Prep-HPLC to give two diastereomers of cis-3-[2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]cyclobutanecarboxylic acid (Example B002-A, 9 mg, % yield) and trans-3-[2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]cyclobutanecarboxylic acid (Example B002-B, 56 mg, % yield).

(411) Example B002-A: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.01 (qd, J=1.52, 7.92 Hz, 2H), 7.97 (dd, J=1.71, 7.83 Hz, 1H), 7.57 (ddd, J=1.71, 7.34, 8.56 Hz, 1H), 7.50 (t, J=7.83 Hz, 1H), 7.17-7.23 (m, 1H), 7.08-7.13 (m, 1H), 7.07 (s, 1H), 4.79-4.91 (m, 1H), 2.80 (d, J=4.65 Hz, 3H), 2.27 (d, J=7.09 Hz, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 371.0.

(412) Example B002-B: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.33-12.41 (m, 1H), 8.01 (d, J=7.83 Hz, 2H), 7.97 (dd, J=1.71, 7.83 Hz, 1H), 7.53-7.61 (m, 1H), 7.50 (t, J=7.95 Hz, 1H), 7.16-7.23 (m, 1H), 7.10 (s, 1H), 7.03 (d, J=8.31 Hz, 1H), 5.02 (s, 1H), 3.10-3.20 (m, 1H), 2.69-2.79 (m, 2H), 2.37-2.47 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 371.1.

(413) The following Example B003 to Example B010 were prepared in analogy to the procedure described for the preparation of Example B001, replacing methyl 3-hydroxycyclobutanecarboxylate with “SM4” in step1, and replacing 2-(4-bromo-2-hydroxy-phenyl)-8-chloro-chromen-4-one (Int-4) with “CORE” in step 2. “SM4” and “CORE” are the reagents indicated in Table 6.

(414) TABLE-US-00006 TABLE 6 Compounds synthesis and characterization Example Compounds Name and CORE and No. Structure SM4 .sup.1H NMR and (ESI.sup.+) B003 3-[2-(8-chloro-4-oxo- chromen-2-yl)-5- (trifluoromethyl)phenoxy] cyclobutanecarboxylic acid embedded image CORE: Int-1 SM4: 3- hydroxycyclo- butanecarboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.4 (br s, 1H), 8.12-8.14 (m, 1H), 8.02-8.05 (m, 2H), 7.50-7.52 (m, 2H),7.25 (s, 1H), 7.12 (s, 1H), 5.16-5.19 (m, 1H), 3.12-3.17 (m, 1H), 2.68-2.76 (m, 2H), 2.40-2.47 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 439.1. B004 3-[5-bromo-2-(8-chloro-4- oxo-chromen-2-yl)-4- methoxy- phenoxy]cyclobutane- carboxylic acid 0embedded image CORE: Int-7 SM4: 3- hydroxycyclo- butanecarboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.42 (s, 1H), 7.96-8.04 (m, 2H), 7.61-7.66 (m, 1H), 7.47-7.53 (m, 1H), 7.21-7.36 (m, 1H), 7.04-7.13 (m, 1H), 4.77-5.07 (m, 1H), 3.90 (s, 3H), 2.63-3.17 (m, 3H), 2.18-2.44 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 479.1. B005 3-[2-(8-chloro-4-oxo- chromen-2-yl)-5- (trifluoromethoxy)phenoxy] cyclobutanecarboxylic acid embedded image CORE: Int-9 SM4: 3- hydroxycyclo- butanecarboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.27 (s, 1H), 7.99- 8.10 (m, 3H), 7.44- 7.57 (m, 1H), 7.17- 7.27 (m, 1H), 6.97- 7.10 (m, 2H), 4.85- 5.15 (m, 1H), 2.71- 3.21 (m, 3H), 2.37- 2.45 (m, 1H), 2.20- 2.29 (m, 1H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 455.1. B006 3-[2-(8-chloro-4-oxo- chromen-2-yl)-4,5- dimethoxy- phenoxy]cyclobutane- carboxylic acid embedded image CORE: Int-10 SM4: 3- hydroxycyclo- butanecarboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.25-12.34 (br s, 1H), 7.94-8.03 (m, 2H), 7.52-7.65 (m, 1H), 7.43-7.52 (m, 1H), 7.11-7.17 (m, 1H), 6.56 (s, 1H), 5.03-5.12 (m, 1H), 3.89 (s, 3H), 3.81 (s, 3H), 3.09-3.19 (m, 1H), 2.69-2.80 (m, 2H), 2.38-2.46 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 431.1. B007 3-[4-bromo-2-(8-chloro-4- oxo-chromen-2-yl)-5- (trifluoromethoxy)phenoxy] cyclobutanecarboxylic acid embedded image CORE: Int-16 SM4: 3- hydroxycyclo- butanecarboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.25-8.28 (m, 1H), 7.99-8.06 (m, 2H), 7.47-7.55 (m, 1H), 7.18-7.24 (m, 1H), 7.02-7.05 (m, 1H), 4.90-5.15 (m, 1H), 2.72-2.82 (m, 1H), 2.37-2.45 (m, 2H), 2.19-2.29 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 533.1. B009 3-[2-bromo-6-(8-chloro-4- oxo-chromen-2-yl)-4-methyl- phenoxy]cyclobutane- carboxylic acid embedded image CORE: Int-18 SM4: 3- hydroxycyclo- butanecarboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.09 (s, 1H), 8.00- 8.06 (m, 2H), 7.72- 7.77 (m, 1H), 7.59- 7.64 (m, 1H), 7.48- 7.56 (m, 1H), 6.80- 6.86 (m, 1H), 4.27- 4.61 (m, 1H), 2.64- 2.92 (m, 1H), 2.21- 2.42 (m, 7H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 463.1. B010 4-[5-bromo-2-(8-chloro-4- oxo-chromen-2- yl)phenoxy]cyclohexane- carboxylic acid embedded image CORE: Int-4 SM4: methyl 4- hydroxycyclo- hexanecarboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 11.91-12.13 (br s, 1H), 7.96-8.05 (m, 2H), 7.81-7.87 (m, 1H), 7.45-7.57 (m, 2H), 7.34-7.42 (m, 1H), 7.02 (s, 1H), 4.84-4.94 (m, 0.8 H), 4.63-4.73 (m, 0.2 H), 2.27-2.38 (m, 1H), 1.83-1.92 (m, 2H), 1.57-1.79 (m, 6H) MS obsd. (ESI.sup.+) [(M + H).sup.+]: 477.1.

(415) The following compounds B011 to B029 were prepared in analogy to the procedure described for the preparation of example B002-A and B002-B, replacing methyl 3-methylsulfonyloxycyclobutanecarboxylate with “SM4” in step1, 8-chloro-2-(2-hydroxyphenyl)chromen-4-one with “CORE” in step 1. The “CORE” and “SM4” are the reagent indicated in Table 6.

(416) TABLE-US-00007 TABLE 6 Compounds synthesis and characterization Example Compounds Name and CORE and No. Structure SM4 .sup.1H NMR and (ESI.sup.+) B011-A Cis-3-[2-(8-chloro-4-oxo- chromen-2-yl)-5-methoxy- phenoxy]cyclobutane- carboxylic acid embedded image CORE: Int-13 SM4: methyl 3- methylsulfonyl- oxycyclobutane- carboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.92- 8.03 (m, 3H), 7.43- 7.53 (m, 1H), 7.01- 7.07 (m, 1H), 6.78- 6.87 (m, 1H), 6.52- 6.61 (m, 1H), 4.80- 4.95 (m, 1H), 3.90 (s, 3H), 2.72-2.89 (m, 3H), 2.17-2.36 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 401.1. B011-B Trans-3-[2-(8-chloro-4-oxo- chromen-2-yl)-5-methoxy- phenoxy]cyclobutane- carboxylic acid embedded image CORE: Int-13 SM4: methyl 3- methylsulfonyl- oxycyclobutane- carboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.49 (s, 1H), 7.95- 8.03 (m, 3H), 7.43- 7.52 (m, 1H), 7.05- 7.11 (m, 1H), 6.78- 6.85 (m, 1H), 6.43- 6.50 (m, 1H), 4.99- 5.11 (m, 1H), 3.86 (s, 3H), 3.10-3.21 (m, 1H), 2.70-2.81 (m, 2H), 2.38-2.47 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 401.1. B012-A Cis-3-[5-chloro-2-(8-chloro-4- oxo-chromen-2-yl)-4-methyl- phenoxy]cyclobutane- carboxylic acid embedded image CORE: Int-5 SM4: methyl 3- methylsulfonyl- oxycyclobutane- carboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.95- 8.03 (m, 2H), 7.84- 7.92 (m, 1H), 7.45- 7.53 (m, 1H), 7.10- 7.18 (m, 1H), 7.03 (s, 1H), 4.75-4.91 (m, 1H), 2.62-2.79 (m, 3H), 2.35 (s, 3H), 2.11-2.29 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 419.1. B012-B Trans-3-[5-chloro-2-(8- chloro-4-oxo-chromen-2-yl)- 4-methyl- phenoxy]cyclobutane- carboxylic acid embedded image CORE: Int-5 SM4: methyl 3- methylsulfonyl- oxycyclobutane- carboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.97- 8.05 (m, 2H), 7.85- 7.92 (m, 1H), 7.45- 7.54 (m, 1H), 7.04 (s, 2H), 4.98-5.09 (m, 1H), 3.02-3.16 (m, 1H), 2.64-2.77 (m, 2H), 2.35-2.43 (m, 5H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 419.1. B013-A Cis-3-[5-bromo-2-(8-chloro- 4-oxo-chromen-2-yl)-4- methyl- phenoxy]cyclobutane- carboxylic acid 0embedded image CORE: Int-6 SM4: methyl 3- methylsulfonyl- oxycyclobutane- carboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.91-8.01 (m, 2H), 7.79-7.87 (m, 1H), 7.42-7.52 (m, 1H), 7.20-7.29 (m, 1H), 6.97-7.03 (m, 1H), 4.80-4.91 (m, 1H), 2.65-2.84 (m, 3H), 2.34 (s, 3H), 2.15-2.30 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 463.1. B013-B Trans-3-[5-bromo-2-(8- chloro-4-oxo-chromen-2-yl)- 4-methyl- phenoxy]cyclobutane- carboxylic acid embedded image CORE: Int-6 SM4: methyl 3- methylsulfonyl- oxycyclobutane- carboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.96- 8.02 (m, 2H), 7.79- 7.86 (m, 1H), 7.46- 7.52 (m, 1H), 7.14- 7.18 (m, 1H), 7.03 (s, 1H), 4.97-5.07 (m, 1H), 3.07-3.18 (m, 1H), 2.65-2.75 (m, 2H), 2.35-2.43 (m, 5H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 463.1. B014 Trans-3-[4-bromo-2-(8- chloro-4-oxo-chromen-2-yl)- 5-methoxy- phenoxy]cyclobutane- carboxylic acid embedded image CORE: Int-34 SM4: methyl 3- methylsulfonyl- oxycyclobutane- carboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.12- 8.15 (m, 1H), 7.97- 8.02 (m, 2H), 7.44- 7.52 (m, 1H), 7.06- 7.10 (m, 1H), 6.61 (s, 1H), 5.12-5.20 (m, 1H), 4.07-4.13 (m, 1H), 3.98 (s, 3H), 2.72-2.83 (m, 2H), 2.40-2.47 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 479.1. B015-A Cis-3-[2-(8-chloro-4-oxo- chromen-2-yl)-5- (trifluoromethoxy)phenoxy] cyclobutanecarboxylic acid embedded image CORE: Int-9 SM4: methyl 3- methylsulfonyl- oxycyclobutane- carboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.33 (s, 1H), 7.96-8.12 (m, 3H), 7.47-7.55 (m, 1H), 7.19-7.28 (m, 1H), 7.06-7.13 (m, 1H), 7.03-7.05 (m, 1H), 4.87-4.96 (m, 1H), 2.74-2.86 (m, 3H), 2.23-2.29 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 455.1. B016 Cis-3-[2-(8-chloro-4-oxo- chromen-2-yl)-4-methyl- phenoxy]cyclobutane- carboxylic acid embedded image CORE: Int-31 SM4: methyl 3- methylsulfonyl- oxycyclobutane- carboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.40 (s, 1H), 7.97-8.03 (m, 2H), 7.73-7.78 (m, 1H), 7.45-7.54 (m, 1H), 7.33-7.41 (m, 1H), 7.03-7.06 (m, 1H), 6.97-7.02 (m, 1H), 4.73-4.84 (m, 1H), 2.69-2.86 (m, 3H), 2.38 (s, 3H), 2.16-2.29 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 385.1. B017 3-[2-(8-chloro-4-oxo- chromen-2-yl)-5-methoxy-4- methyl- phenoxy]cyclobutane- carboxylic acid embedded image CORE: Int-12 SM4: methyl 3- methylsulfonyl- oxycyclobutane- carboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.31 (s, 1H), 7.95- 8.03 (m, 2H), 7.75- 7.82 (m, 1H), 7.41- 7.52 (m, 1H), 7.04- 7.08 (m, 1H), 6.45- 6.50 (m, 1H), 5.06- 5.16 (m, 1H), 3.91 (s, 3H), 3.11-3.20 (m, 1H), 2.71-2.83 (m, 2H), 2.39-2.47 (m, 2H), 2.16 (s, 3H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 415.1. B018-A Cis-3-[2-(8-chloro-4-oxo- chromen-2-yl)-5-methyl- phenoxy]cyclobutane- carboxylic acid embedded image CORE: Int-2 SM4: methyl 3- methylsulfonyl- oxycyclobutane- carboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.25-12.44 (m, 1H), 7.96-8.03 (m, 2H), 7.84-7.91 (m, 1H), 7.45-7.53 (m, 1H), 7.05-7.08 (m, 1H), 6.99-7.05 (m, 1H), 6.89-6.95 (m, 1H), 4.78-4.88 (m, 1H), 2.74-2.86 (m, 3H), 2.43 (s, 3H), 2.19-2.30 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 385.1. B018-B Trans-3-[2-(8-chloro-4-oxo- chromen-2-yl)-5-methyl- phenoxy]cyclobutane- carboxylic acid embedded image CORE: Int-2 SM4: methyl 3- methylsulfonyl- oxycyclobutane- carboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.00 (d, J = 7.95 Hz, 2H), 7.84-7.91 (m, 1H), 7.44-7.54 (m, 1H), 7.06-7.12 (m, 1H), 6.99-7.05 (m, 1H), 6.81-6.87 (m, 1H), 4.94-5.06 (m, 1H), 3.07-3.19 (m, 1H), 2.69-2.84 (m, 2H), 2.35-2.46 (m, 5H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 385.1. B019-A Cis-3-[2-(8-chloro-4-oxo- chromen-2-yl)-5-ethyl- phenoxy]cyclobutane- carboxylic acid embedded image CORE: Int-29 SM4: methyl 3- methylsulfonyl- oxycyclobutane- carboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.35 (br s, 1H), 7.94- 8.05 (m, 2H), 7.81- 7.92 (m, 1H), 7.42- 7.53 (m, 1H), 6.99- 7.09 (m, 2H), 6.86- 6.95 (m, 1H), 4.85 (br d, J = 4.5 Hz, 1H), 2.74-2.86 (m, 3H), 2.62-2.72 (m, 2H), 2.11-2.35 (m, 2H), 1.22 (td, J = 7.4, 1.8 Hz, 3H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 399.1. B019-B Trans-3-[2-(8-chloro-4-oxo- chromen-2-yl)-5-ethyl- phenoxy]cyclobutane- carboxylic acid embedded image CORE: Int-29 SM4: methyl 3- methylsulfonyl- oxycyclobutane- carboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 112.40 (br s, 1H), 7.98 (dd, J = 7.9, 2.0 Hz, 2H), 7.88 (d, J = 8.1 Hz, 1H), 7.47 (t, J = 7.9 Hz, 1H), 7.05-7.12 (m, 1H), 6.97-7.05 (m, 1H), 6.77-6.86 (m, 1H), 4.95-5.06 (m, 1H), 3.06-3.20 (m, 1H), 2.60-2.81 (m, 4H), 2.36-2.48 (m, 2H), 1.21 (t, J = 7.6 Hz, 3H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 399.1. B020-A Cis-3-[2-(8-chloro-4-oxo- chromen-2-yl)-5-isopropyl- phenoxy]cyclobutane- carboxylic acid 0embedded image CORE: Int-30 SM4: methyl 3- methylsulfonyl- oxycyclobutane- carboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.34 (s, 1H), 7.95 (dd, J = 39.5, 8.0 Hz, 3H), 7.49 (t, J = 7.9 Hz, 1H), 7.07 (d, J = 20.5 Hz, 2H), 6.92 (d, J = 1.0 Hz, 1H), 4.84- 4.92 (m, 1H), 2.97 (dq, J = 14.0, 7.0 Hz, 1H), 2.80 (d, J = 4.1 Hz, 3H), 2.18-2.31 (m, 2H), 1.25 (d, J = 6.9 Hz, 6H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 413.1. B020-B Trans-3-[2-(8-chloro-4-oxo- chromen-2-yl)-5-isopropyl- phenoxy]cyclobutane- carboxylic acid embedded image CORE: Int-30 SM4: methyl 3- methylsulfonyl- oxycyclobutane- carboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.38 (s, 1H), 7.95 (dd, J = 38.4, 8.0 Hz, 3H), 7.49 (t, J = 7.9 Hz, 1H), 7.00-7.19 (m, 2H), 6.83 (d, J = 1.1 Hz, 1H), 5.00-5.09 (m, 1H), 3.07-3.20 (m, 1H), 2.92-3.04 (m, 1H), 2.74 (ddd, J = 13.4, 7.0, 4.1 Hz, 2H), 2.35-2.47 (m, 2H), 1.22 (t, J = 10.9 Hz, 6H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 413.1. B021 Trans-3-[2-(8-chloro-4-oxo- chromen-2-yl)-4-methoxy- phenoxy]cyclobutane- carboxylic acid embedded image CORE: Int-32 SM4: methyl 3- methylsulfonyl- oxycyclobutane- carboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.42 (s, 1H), 7.99- 8.05 (m, 2H), 7.46- 7.56 (m, 2H), 7.13 (s, 2H), 6.95-7.01 (m, 1H), 4.90-4.99 (m, 1H), 3.80 (s, 3H), 3.06-3.15 (m, 1H), 2.63-2.74 (m, 2H), 2.34-2.44 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 401.1. B022-A Cis-3-[2-(8-bromo-4-oxo- chromen-2- yl)phenoxy]cyclobutane- carboxylic acid embedded image CORE: Int-28 SM4: methyl 3- methylsulfonyl- oxycyclobutane- carboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.08-8.11 (m, 1H), 7.93-7.99 (m, 2H), 7.47-7.54 (m, 1H), 7.37 (t, J = 7.8 Hz, 1H), 7.13 (t, J = 7.6 Hz, 1H), 7.01-7.06 (m, 1H), 6.93-6.99 (m, 1H), 4.95 (quin, J = 6.5 Hz, 1H), 3.03-3.10 (m, 2H), 2.63-2.69 (m, 2H), 2.34-2.38 (m, 1H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 415.0. B022-B Trans-3-[2-(8-bromo-4-oxo- chromen-2- yl)phenoxy]cyclobutane- carboxylic acid embedded image CORE: Int-28 SM4: methyl 3- methylsulfonyl- oxycyclobutane- carboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.13- 8.18 (m, 1H), 8.00- 8.07 (m, 2H), 7.54- 7.62 (m, 1H), 7.44 (t, J = 7.9 Hz, 1H), 7.18- 7.23 (m, 1H), 7.07- 7.13 (m, 2H), 4.85 (br dd, J = 9.0, 5.3 Hz, 1H), 2.76-2.83 (m, 3H), 2.24-2.32 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 415.0. B023 Trans-3-[[6-(8-chloro-4-oxo- chromen-2-yl)-2,3- dihydrobenzofuran-5- yl]oxy]cyclobutanecarboxylic acid embedded image CORE: Int-33 SM4: methyl 3- methylsulfonyl- oxycyclobutane- carboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.96- 8.05 (m, 2H), 7.42- 7.55 (m, 1H), 7.26- 7.35 (m, 1H), 7.07- 7.14 (m, 1H), 6.95- 7.04 (m, 1H), 4.84- 5.01 (m, 1H), 4.48- 4.62 (m, 2H), 3.23- 3.30 (m, 2H), 3.04- 3.15 (m, 1H), 2.64- 2.75 (m, 2H), 2.30- 2.45 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 413.1. B024 Trans-3-[5-bromo-2-(8- chloro-4-oxo-chromen-2-yl)- 4- (trifluoromethyl)phenoxy] cyclobutanecarboxylic acid embedded image CORE: Int-27 SM4: methyl 3- methylsulfonyl- oxycyclobutane- carboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.31- 8.37 (m, 1H), 7.97- 8.08 (m, 2H), 7.43- 7.57 (m, 2H), 7.07- 7.17 (m, 1H), 5.15- 5.27 (m, 1H), 3.03- 3.20 (m, 1H), 2.70- 2.82 (m, 2H), 2.38- 2.46 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 516.9. B025-A Cis-3-[[5-bromo-2-(8-chloro- 4-oxo-chromen-2- yl)phenoxy]methyl]cyclobutane- carboxylic acid embedded image CORE: Int-4 SM4: methyl 3-(p- tolylsulfonyl- oxymethyl)cyclo- butanecarboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.95- 8.05 (m, 2H), 7.82- 7.92 (m, 1H), 7.46- 7.54 (m, 2H), 7.39- 7.46 (m, 1H), 6.97- 7.04 (m, 1H), 4.09- 4.21 (m, 2H), 2.93- 3.12 (m, 1H), 2.62- 2.79 (m, 1H), 2.20- 2.38 (m, 2H), 1.93- 2.06 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 416.1. B025-B Trans-3-[[5-bromo-2-(8- chloro-4-oxo-chromen-2- yl)phenoxy]methyl]cyclo- butanecarboxylic acid embedded image CORE: Int-4 SM4: methyl 3-(p- tolylsulfonyl- oxymethyl)cyclo- butanecarboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.96- 8.04 (m, 2H), 7.84- 7.94 (m, 1H), 7.39- 7.56 (m, 3H), 6.99- 7.10 (m, 1H), 4.15- 4.30 (m, 2H), 3.03- 3.15 (m, 1H), 2.71- 2.86 (m, 1H), 2.23- 2.38 (m, 2H), 2.04- 2.19 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 416.1. B026-A Cis-3-[[2-(8-chloro-4-oxo- chromen-2- yl)phenoxy]methyl]cyclo- butanecarboxylic acid embedded image CORE: Int-3 SM4: methyl 3-(p- tolylsulfonyloxy- methyl)cyclo- butanecarboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.95- 8.03 (m, 3H), 7.57 (d, J = 1.47 Hz, 1H), 7.49 (t, J = 7.83 Hz, 1H), 7.25 (d, J = 8.07 Hz, 1H), 7.16-7.23 (m, 1H), 7.04 (s, 1H), 4.12 (d, J = 7.09 Hz, 2H), 3.00-3.12 (m, 1H), 2.73 (s, 1H), 2.25-2.36 (m, 2H), 1.96-2.06 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 385.1. B026-B Trans-3-[[2-(8-chloro-4-oxo- chromen-2- yl)phenoxy]methyl]cyclo- butanecarboxylic acid 0embedded image CORE: Int-3 SM4: methyl 3-(p- tolylsulfonyloxy- methyl)cyclo- butanecarboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.94- 8.05 (m, 3H), 7.56- 7.64 (m, 1H), 7.46- 7.54 (m, 1H), 7.16- 7.33 (m, 2H), 7.01- 7.10 (m, 1H), 4.14- 4.24 (m, 2H), 3.00- 3.15 (m, 1H), 2.74- 2.84 (m, 1H), 2.25- 2.35 (m, 2H), 2.06- 2.21 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 385.1. B027-A Cis-[2-(8-chloro-4-oxo- chromen-2-yl)-4-methoxy- phenoxy]methyl]cyclobutane- carboxylic acid embedded image CORE: Int-32 SM4: methyl 3-(p- tolylsulfonyloxy- methyl)cyclo- butanecarboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.14 (s, 1H), 7.95- 8.06 (m, 2H), 7.44- 7.57 (m, 2H), 7.14- 7.25 (m, 2H), 7.07- 7.11 (m, 1H), 4.02- 4.08 (m, 2H), 3.80 (s, 3H), 2.96-3.09 (m, 1H), 2.64-2.75 (m, 1H), 2.21-2.34 (m, 2H), 1.91-2.04 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+: 415.1. B027-B Trans-[2-(8-chloro-4-oxo- chromen-2-yl)-4-methoxy- phenoxy]methyl]cyclobutane- carboxylic acid embedded image CORE: Int-32 SM4: methyl 3-(p- tolylsulfonyloxy- methyl)cyclo- butanecarboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.95- 8.05 (m, 2H), 7.45- 7.56 (m, 2H), 7.16- 7.27 (m, 2H), 7.08- 7.13 (m, 1H), 4.09- 4.17 (m, 2H), 3.87 (s, 3H), 3.02-3.12 (m, 1H), 2.72-2.81 (m, 1H), 2.25-2.36 (m, 2H), 2.06-2.18 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 415.1. B028-A Cis-3-[5-bromo-2-(8-chloro- 4-oxo-chromen-2- yl)phenoxy]cyclopentane- carboxylic acid embedded image CORE: Int-4 SM4: methyl 3-(p- tolylsulfonyloxy) cyclopentane- carboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 11.96-12.16 (m, 1H), 7.96-8.04 (m, 2H), 7.83-7.92 (m, 1H), 7.38-7.54 (m, 3H), 6.97-7.09 (m, 1H), 5.06-5.17 (m, 1H), 2.75-2.89 (m, 1H), 2.29-2.45 (m, 1H), 1.87-2.04 (m, 5H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 463.0. B028-B Trans-3-[5-bromo-2-(8- chloro-4-oxo-chromen-2- yl)phenoxy]cyclopentane- carboxylic acid embedded image CORE: Int-4 SM4: methyl 3-(p- tolylsulfonyloxy) cyclopentane- carboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.08-12.31 (m, 1H), 7.95-8.06 (m, 2H), 7.81-7.92 (m, 1H), 7.34-7.56 (m, 3H), 6.92-7.02 (m, 1H), 5.15-5.25 (m, 1H), 2.85-2.99 (m, 1H), 1.91-2.22 (m, 5H), 1.77-1.89 (m, 1H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 463.0. B029 Trans-3-[[5-bromo-2-(8- chloro-4-oxo-chromen-2-yl)- 3- pyridyl]oxy]cyclobutane- carboxylic acid embedded image CORE: Int-26 SM4: methyl 3- methylsulfonyl- oxycyclobutane- carboxylate .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.47- 8.57 (m, 1H), 7.99- 8.07 (m, 2H), 7.77- 7.82 (m, 1H), 7.35- 7.59 (m, 1H), 6.94- 7.08 (m, 1H), 5.02- 5.19 (m, 1H), 3.04- 3.19 (m, 1H), 2.69- 2.80 (m, 2H), 2.38- 2.48 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 450.1.

(417) Example B035-A and Example B035-B: cis-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-cyclopropyl-phenoxy]cyclobutanecarboxylic acid and trans-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-cyclopropyl-phenoxy]cyclobutanecarboxylic acid

(418) ##STR00356##

Step 1: Preparation of methyl 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-cyclopropyl-phenoxy]cyclobutanecarboxylate

(419) ##STR00357##

(420) To a mixture of methyl 3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]cyclobutanecarboxylate (Example B001b, 800.0 mg, 1.73 mmol), potassium cyclopropyltrifluoroborate (1021.19 mg, 6.9 mmol), 2-dicyclohexylphosphino-2′,6′-dimethoxybiphenyl (70.83 mg, 0.170 mmol) in the mixed solvent of toluene (10 mL) and water (1 mL) was added Pd(OAc).sub.2 (387.33 mg, 1.73 mmol) under N.sub.2 atmosphere and the reaction was stirred at 90° C. for 3 hours. After the reaction was completed, the mixture was concentrated in vacuo and the residue was purified by column chromatography on solica gel (eluent with PE:EtOAc=100:1 to 2:1) to give methyl 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-cyclopropyl-phenoxy]cyclobutanecarboxylate (430 mg, 57.8% yield) as a yellow solid. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 425.1.

Step 2: Preparation of 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-cyclopropyl-phenoxy]cyclobutanecarboxylic acid

cis-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-cyclopropyl-phenoxy]cyclobutanecarboxylic acid and trans-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-cyclopropyl-phenoxy]cyclobutanecarboxylic acid

(421) ##STR00358##

(422) Example B035-A and B035-B was prepared in analogy to the procedure described for the preparation of example B002-A and B002-B by using methyl 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-cyclopropyl-phenoxy]cyclobutanecarboxylate as the starting material instead of methyl 3-[2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]cyclobutanecarboxylate in step 2. Example B035-A: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.94-8.04 (m, 2H), 7.82-7.90 (m, 1H), 7.42-7.57 (m, 1H), 7.03-7.11 (m, 1H), 6.83-6.92 (m, 1H), 6.72-6.79 (m, 1H), 4.79-4.96 (m, 1H), 2.73-2.87 (m, 3H), 2.20-2.36 (m, 2H), 1.97-2.10 (m, 1H), 0.99-1.15 (m, 2H), 0.76-0.89 (m, 2H). MS obsd. (ESI.sup.+)[(M+H).sup.+]: 411.0.

(423) Example B035-B: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.95-8.03 (m, 2H), 7.80-7.92 (m, 1H), 7.43-7.55 (m, 1H), 7.04-7.15 (m, 1H), 6.77-6.88 (m, 1H), 6.65-6.75 (m, 1H), 4.98-5.13 (m, 1H), 3.04-3.21 (m, 1H), 2.69-2.82 (m, 2H), 2.34-2.46 (m, 2H), 2.01-2.11 (m, 1H), 1.00-1.13 (m, 2H), 0.71-0.85 (m, 2H). MS obsd. (ESI.sup.+)[(M+H).sup.+]: 411.0.

Example B036-A and Example B036-B: Cis-3-[5-bromo-2-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)phenoxy]cyclobutanecarboxylic acid and trans-3-[5-bromo-2-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)phenoxy]cyclobutanecarboxylic acid

(424) ##STR00359##

Step 1: Preparation of methyl 3-(5-bromo-2-formyl-phenoxy)cyclobutanecarboxylate

(425) ##STR00360##

(426) To a mixture of 4-bromo-2-hydroxy-benzaldehyde (500 mg, 2.5 mmol), methyl 3-methylsulfonyloxycyclobutanecarboxylate (750 mg, 4.2 mmol) in DMF (10 ml) was added K.sub.2CO.sub.3 (690 mg, 5.0 mmol) and the mixture was stirred at 120° C. for 2 hours. After the reaction was completed, the mixture was diluted with water (15 mL) and extracted with EtOAc (30 mL) three times. The combined organic layer was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo to give the crude methyl 3-(5-bromo-2-formyl-phenoxy)cyclobutanecarboxylate (657 mg, 82.1% yield), which was used in the next directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]:312.9.

Step 2: Preparation of 3-[5-bromo-2-[(E)-3-[3-chloro-2,6-bis(methoxymethoxy)phenyl]-3-oxo-prop-1-enyl]phenoxy]cyclobutanecarboxylic acid

(427) ##STR00361##

(428) To a solution of 1-[3-chloro-2,6-bis(methoxymethoxy)phenyl]ethanone (83.1 mg, 0.3 mmol) and methyl 3-(5-bromo-2-formyl-phenoxy)cyclobutanecarboxylate (80 mg, 0.3 mmol) in ethanol (5 mL) was added KOH (171 mg, 3.05 mmol) and the mixture was then stirred at 40° C. for 16 hours. After the reaction was completed, the mixture was diluted with water (20 mL) and adjusted to PH˜6 by addition of 1N HCl. The resulting mixture was extracted with EtOAc (20 mL) three times, the combined organic layer was washed with brine (20 mL) twice, dried over Na.sub.2SO.sub.4 and concentrated in vacuo to give 3-[5-bromo-2-[(E)-3-[3-chloro-2,6-bis(methoxymethoxy)phenyl]-3-oxo-prop-1-enyl]phenoxy]cyclobutanecarboxylic acid (150 mg, 97.4% yield) as an orange oil. MS obsd. (ESI.sup.+) [(M+H).sup.+]:555.1.

Step 3: Preparation of Cis-3-[5-bromo-2-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)phenoxy]cyclobutanecarboxylic acid and trans-3-[5-bromo-2-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)phenoxy]cyclobutanecarboxylic acid

(429) ##STR00362##

(430) To a solution of 3-[5-bromo-2-[(E)-3-[3-chloro-2,6-bis(methoxymethoxy)phenyl]-3-oxo-prop-1-enyl]phenoxy]cyclobutanecarboxylic acid (150 mg, 0.29 mmol) in DMSO (8 ml) was added I.sub.2 (5.1 mg, 0.02 mmol) and the mixture was stirred 140° C. at for 2 hours. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (30 mL) three times. The combined organic layer was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by Prep-HPLC to give two diastereomers of cis-3-[5-bromo-2-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)phenoxy]cyclobutanecarboxylic acid (Example B036-A, 9 mg, % yield) and trans-3-[5-bromo-2-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)phenoxy]cyclobutanecarboxylic acid (Example B036-B, 56 mg, % yield).

(431) Example B036-A: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.58 (s, 1H), 12.23-12.39 (br, 1H), 7.87 (dd, J=16.1, 8.7 Hz, 2H), 7.44 (dd, J=8.5, 1.8 Hz, 1H), 7.31 (d, J=1.7 Hz, 1H), 7.11 (s, 1H), 6.87 (d, J=8.9 Hz, 1H), 4.88-5.00 (m, 1H), 2.75-2.83 (m, 3H), 2.21-2.29 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:465.1.

(432) Example B036-B: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.58 (s, 1H), 7.88 (s, 2H), 7.41-7.47 (m, 1H), 7.14 (s, 1H), 6.96 (s, 1H), 6.88 (d, J=8.8 Hz, 1H), 5.07-5.12 (m, 1H), 3.11-3.18 (m, 2H), 2.72-2.77 (m, 2H), 2.39-2.442 (m, 1H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:465.1.

Example B037-A and Example B037-B

Cis-3-[2-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)-5-methyl-phenoxy]cyclobutanecarboxylic acid and Trans-3-[2-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)-5-methyl-phenoxy]cyclobutanecarboxylic acid

(433) ##STR00363##

(434) Example B037-A and B037-B were prepared in analogy to the procedure described for the preparation of example B036-A and B036-B by using 2-hydroxy-4-methyl-benzaldehyde as the starting material instead of 4-bromo-2-hydroxy-benzaldehyde in step 1.

(435) Example B037-A: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.57 (s, 1H), 12.36 (s, 1H), 7.76-7.92 (m, 2H), 7.07-7.15 (m, 1H), 6.95-7.02 (m, 1H), 6.79-6.93 (m, 2H), 4.76-4.88 (m, 1H), 2.74-2.91 (m, 3H), 2.35 (s, 3H), 2.18-2.33 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:401.0.

(436) Example B037-B: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.61 (s, 1H), 12.36 (s, 1H), 7.76-7.92 (m, 2H), 7.11-7.16 (m, 1H), 6.96-7.04 (m, 1H), 6.80-6.89 (m, 2H), 4.95-5.06 (m, 1H), 3.06-3.20 (m, 1H), 2.69-2.84 (m, 2H), 2.39-2.45 (m, 5H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:401.0.

Example B038-A and Example B038-B: Cis-3-[2-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]cyclobutanecarboxylic acid and Trans-3-[2-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]cyclobutanecarboxylic acid

(437) ##STR00364##

(438) Example B038-A and B038-B were prepared in analogy to the procedure described for the preparation of example B036-A and B036-B by using 2-hydroxy-4-(trifluoromethyl)benzaldehyde as the starting material instead of 4-bromo-2-hydroxy-benzaldehyde in step 1.

(439) Example B038-A: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.58 (s, 1H), 12.36 (s, 1H), 8.08-8.17 (m, 1H), 7.83-7.91 (m, 1H), 7.53-7.62 (m, 1H), 7.30-7.38 (m, 1H), 7.12-7.19 (m, 1H), 6.83-6.93 (m, 1H), 4.96-5.09 (m, 1H), 2.70-2.88 (m, 3H), 2.19-2.37 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:455.0.

(440) Example B038-B: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.51 (s, 1H), 8.05-8.18 (m, 1H), 7.75-7.90 (m, 1H), 7.49-7.61 (m, 1H), 7.13-7.29 (m, 2H), 6.79-6.92 (m, 1H), 5.11-5.24 (m, 1H), 3.06-3.18 (m, 1H), 2.65-2.82 (m, 2H), 2.33-2.46 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:455.1.

Example B039-A and Example B039-B: Cis-3-[2-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)-5-ethoxy-phenoxy]cyclobutanecarboxylic acid and Trans-3-[2-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)-5-ethoxy-phenoxy]cyclobutanecarboxylic acid

(441) ##STR00365##

(442) Example B039-A and B039-B were prepared in analogy to the procedure described for the preparation of example B036-A and B036-B by using 4-ethoxy-2-hydroxy-benzaldehyde as the starting material instead of 4-bromo-2-hydroxy-benzaldehyde in step 1.

(443) Example B039-A: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.69 (s, 1H), 12.17-12.50 (br s, 1H), 7.92-8.02 (m, 1H), 7.73-7.85 (m, 1H), 7.04-7.16 (m, 1H), 6.73-6.89 (m, 2H), 6.47-6.60 (m, 1H), 4.83-4.94 (m, 1H), 4.04-4.21 (m, 2H), 2.73-2.89 (m, 3H), 2.19-2.39 (m, 2H), 1.29-1.42 (m, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:431.1.

(444) Example B039-B: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.79 (s, 1H), 7.92-8.02 (m, 1H), 7.73-7.87 (m, 1H), 7.07-7.18 (m, 1H), 6.71-6.91 (m, 2H), 6.32-6.47 (m, 1H), 4.96-5.10 (m, 1H), 4.08-4.22 (m, 2H), 3.07-3.21 (m, 1H), 2.69-2.82 (m, 2H), 2.36-2.45 (m, 2H), 1.29-1.40 (m, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:431.1.

Example B040-A and Example B040-B: cis-3-[5-bromo-2-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)-4-methyl-phenoxy]cyclobutanecarboxylic acid and trans-3-[5-bromo-2-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)-4-methyl-phenoxy]cyclobutanecarboxylic acid

(445) ##STR00366##

(446) Example B040-A and B040-B were prepared in analogy to the procedure described for the preparation of example B036-A and B036-B by using 4-bromo-2-hydroxy-5-methyl-benzaldehyde as the starting material instead of 4-bromo-2-hydroxy-benzaldehyde in step 1.

(447) Example B040-A: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.64 (s, 1H), 12.34 (s, 1H), 7.78-7.90 (m, 2H), 7.27-7.34 (m, 1H), 7.04-7.11 (m, 1H), 6.78-6.92 (m, 1H), 4.81-4.95 (m, 1H), 2.65-2.86 (m, 3H), 2.36 (s, 3H), 2.17-2.30 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:479.0.

(448) Example B040-B: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.52 (s, 1H), 12.38 (s, 1H), 7.79-7.89 (m, 2H), 7.17-7.23 (m, 1H), 7.06-7.13 (m, 1H), 6.75-6.92 (m, 1H), 4.95-5.11 (m, 1H), 3.07-3.19 (m, 1H), 2.66-2.79 (m, 2H), 2.38-2.45 (m, 2H), 2.35 (s, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:479.0.

Example B041 4-[2-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]butanoic acid

(449) ##STR00367##

(450) Example B041 was prepared in analogy to the procedure described for the preparation of example B036-A and B036-B by using 2-hydroxy-4-(trifluoromethyl)benzaldehyde and methyl 4-bromobutanoate as the starting material and methyl 3-methylsulfonyloxycyclobutanecarboxylate instead of 4-bromo-2-hydroxy-benzaldehyde in step 1.

(451) Example B041: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.63 (s, 1H), 8.09-8.17 (m, 1H), 7.82-7.89 (m, 1H), 7.54-7.63 (m, 2H), 7.11-7.18 (m, 1H), 6.82-6.96 (m, 1H), 4.21-4.36 (m, 2H), 2.38-2.45 (m, 2H), 1.99-2.08 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:443.1.

Example B042 3-[2-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)-4,5-dimethoxy-phenoxy]cyclobutanecarboxylic acid

(452) ##STR00368##

(453) Example B042 were prepared in analogy to the procedure described for the preparation of example B036-A and B036-B by using 2-hydroxy-4,5-dimethoxy-benzaldehyde as the starting material instead of 4-bromo-2-hydroxy-benzaldehyde in step 1. After purified by Prep-HPLC in step 3, the cis- and trans-two diastereomers were afforded as a mixture.

(454) Example B042: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 13.51 (s, 1H), 12.11-12.37 (br, 1H), 7.84 (d, J=9.0 Hz, 1H), 7.52 (s, 1H), 7.31 (d, J=9.0 Hz, 1H), 7.06-7.16 (m, 1H), 6.62-6.69 (m, 1H), 4.82-4.96 (m, 1H), 3.90 (s, 3H), 3.80-3.86 (m, 3H), 2.75-2.86 (m, 3H), 2.21-2.29 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:447.0.

Example B043-A and B043-B

Cis-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-N-cyclopropylsulfonyl-cyclobutanecarboxamide and trans-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-N-cyclopropylsulfonyl-cyclobutanecarboxamide

(455) ##STR00369##

Step 1: Preparation of methyl 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]cyclobutanecarboxylate

(456) ##STR00370##

(457) To a solution of 8-chloro-2-[2-hydroxy-4-(trifluoromethyl)phenyl]chromen-4-one (Int-1, 470.0 mg, 1.38 mmol, as the “CORE” in Table 7), methyl 3-(p-tolylsulfonyloxy)cyclobutanecarboxylate (615 mg, 4.1 mmol) in DMF (5 mL) was added Cs.sub.2CO.sub.3 (2.25 g, 6.9 mmol) and the reaction mixture was stirred at 100° C. for 16 hours. After the reaction was completed, the mixture was diluted with water (15 mL) and extracted with EtOAc (20 mL) three times. The combined organic layer was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo to give the crude methyl 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]cyclobutanecarboxylate (600 mg, 96.0% yield) as a brown solid, which was used in the next step directly. MS obsd. (ESI.sup.+) [(M+Na).sup.+]: 475.0.

Step 2: Preparation of 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]cyclobutanecarboxylic acid

(458) ##STR00371##

(459) To a solution of methyl 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]cyclobutanecarboxylate (600 mg, 1.2 mmol) in THF (8 mL) and water (8 mL) was added LiOH (408 mg, 9.3 mmol). The reaction mixture was stirred at room temperature for 2 hours. After the reaction was completed, the mixture was diluted with water (15 mL) and extracted with EtOAc (20 mL) three times. The combined organic layer was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo to give the crude product of 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]cyclobutanecarboxylic acid (570 mg, 98.8% yield), which was used in the next step directly without further purification. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 439.0.

Step 3: Preparation of B043-A and B043-B

Cis-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-N-cyclopropylsulfonyl-cyclobutanecarboxamide and trans-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-N-cyclopropylsulfonyl-cyclobutanecarboxamide

(460) ##STR00372##

(461) To a solution of 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]cyclobutanecarboxylic acid (0.33 g, 752 μmol) and DIPEA (292 mg, 2.26 mmol) in DMF (10 mL) was added HATU (429 mg, 1.13 mmol) and the mixture was stirred at room temperature for 30 minutes. Then to the resulting solution was added solution of cyclopropanesulfonamide (364 mg, 3.01 mmol, as the “AMINE” in Table 7) and DMAP (368 mg, 3.01 mmol) in DMF (5 mL). The reaction was then stirred at room temperature overnight. After the reaction was completed, the reaction mixture was quenched with water (30 mL) and extracted with DCM (30 mL) three times. The combined organic layer was washed with brine, dried over MgSO.sub.4 and concentrated in vacuo to give the crude 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-N-cyclopropylsulfonyl-cyclobutanecarboxamide. The crude was further purified by Prep-HPLC to give cis-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-N-cyclopropylsulfonyl-cyclobutanecarboxamide (Example B043-A) and trans-3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-N-cyclopropylsulfonyl-cyclobutanecarboxamide (Example B043-B). The configuration of Example B043-A and Example B043-B were further confirmed by NOESY.

(462) Example B043-A: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 11.86 (s, 1H), 8.10-8.19 (m, 1H), 7.95-8.08 (m, 2H), 7.48-7.63 (m, 2H), 7.30-7.41 (m, 1H), 7.00-7.14 (m, 1H), 4.98-5.14 (m, 1H), 2.87-3.01 (m, 2H), 2.72-2.83 (m, 2H), 2.21-2.36 (m, 2H), 0.99-1.14 (m, 4H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:542.1.

(463) Example B043-B: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 11.82 (s, 1H), 8.11-8.18 (m, 1H), 7.95-8.09 (m, 2H), 7.48-7.66 (m, 2H), 7.18-7.27 (m, 1H), 7.08-7.17 (m, 1H), 5.06-5.22 (m, 1H), 3.97-4.10 (m, 1H), 2.90-3.04 (m, 1H), 2.68-2.80 (m, 2H), 2.37-2.47 (m, 2H), 1.06-1.12 (m, 4H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:542.1.

(464) ##STR00373##

(465) (NOESY correlation observed) (no NOESY correlation observed) Example B044-A and B044-B: cis-3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-N-methylsulfonyl-cyclobutanecarboxamide and trans-3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-N-methylsulfonyl-cyclobutanecarboxamide

(466) ##STR00374##

(467) To a solution of 3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]cyclobutanecarboxylic acid (Example B001, 250 mg, 556 μmol) and DIPEA (719 mg, 971 μl, 5.56 mmol) in DCM (5 ml) were added HATU (423 mg, 1.11 mmol) and methanesulfonamide (106 mg, Ell mmol) and the mixture was stirred at room temperature for 12 hours. After the reaction was completed, the reaction was concentrated in vacuo and the residue was purified by Prep-HPLC to give cis-3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-N-methylsulfonyl-cyclobutanecarboxamide (Example B044-A, 4 mg, 1.4% yield) and trans-3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-N-methylsulfonyl-cyclobutanecarboxamide (Example B044-B, 12 mg, 4.1% yield).

(468) Example B044-A: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 11.78 (s, 1H), 7.97-8.04 (m, 2H), 7.84-7.92 (m, 1H), 7.47-7.54 (m, 1H), 7.40-7.47 (m, 1H), 7.26-7.34 (m, 1H), 7.02-7.08 (m, 1H), 4.89-5.03 (m, 1H), 3.17 (s, 3H), 2.70-2.94 (m, 3H), 2.23-2.35 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:526.1.

(469) Example B044-B: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 11.81 (s, 1H), 7.97-8.06 (m, 2H), 7.84-7.93 (m, 1H), 7.48-7.56 (m, 1H), 7.38-7.46 (m, 1H), 7.19-7.21 (m, 1H), 7.07-7.12 (m, 1H), 4.98-5.10 (m, 1H), 3.31 (s, 3H), 3.22-3.27 (m, 1H), 2.71-2.79 (m, 2H), 2.35-2.45 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:526.1.

(470) The following Example B047 to Example B035 were prepared in analogy to the procedure described for the preparation of Example B043-A, B043-B, replacing 8-chloro-2-[2-hydroxy-4-(trifluoromethyl)phenyl]chromen-4-one(Int-1) with “CORE” in step 1, cyclopropanesulfonamide with “AMINE” in step 3. The “CORE” and “AMINE” are the reagents indicated in Table 7.

(471) TABLE-US-00008 TABLE 7 Compounds synthesis and characterization Example Compounds Name and CORE and No. Structure AMINE .sup.1H NMR and (ESI.sup.+) B047-A Cis-3-[2-(8-chloro-4-oxo- chromen-2-yl)-5- (trifluoromethoxy)phenoxy]- N-methylsulfonyl- cyclobutanecarboxamide embedded image CORE: Int-9 AMINE: methane- sulfonamide .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 11.92 (s, 1H), 8.05- 8.12 (m, 1H), 7.97- 8.05 (m, 2H), 7.45- 7.55 (m, 1H), 7.19- 7.28 (m, 1H), 7.07- 7.14 (m, 1H), 7.00- 7.06 (m, 1H), 4.90- 5.03 (m, 1H), 3.25 (s, 3H), 2.83-2.94 (m, 1H), 2.71-2.81 (m, 2H), 2.21-2.36 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 532.1. B047-B Trans-3-[2-(8-chloro-4-oxo- chromen-2-yl)-5- (trifluoromethoxy)phenoxy]- N-methylsulfonyl- cyclobutanecarboxamide embedded image CORE: Int-9 AMINE: methane- sulfonamide .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 11.80 (s, 1H), 7.97- 8.13 (m, 3H), 7.42- 7.58 (m, 1H), 7.16- 7.30 (m, 1H), 7.04- 7.11 (m, 1H), 6.96- 7.04 (m, 1H), 4.99- 5.14 (m, 1H), 3.28- 3.31 (m, 4H), 2.71- 2.80 (m, 2H), 2.36- 2.46 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 532.1. B048-A Cis-3-[2-(8-chloro-4-oxo- chromen-2-yl)-5- (trifluoromethyl)phenoxy]-N- methylsulfonyl- cyclobutanecarboxamide embedded image CORE: Int-1 AMINE: methane- sulfonamide .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.32- 8.40 (m, 1H), 8.10- 8.21 (m, 2H), 7.66- 7.73 (m, 1H), 7.26- 7.39 (m, 2H), 6.95- 7.03 (m, 1H), 4.69- 4.81 (m, 1H), 3.18 (s, 3H), 2.66-2.94 (m, 5H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 516.1. B048-B Trans-3-[2-(8-chloro-4-oxo- chromen-2-yl)-5- (trifluoromethyl)phenoxy]-N- methylsulfonyl- cyclobutanecarboxamide embedded image CORE: Int-1 AMINE: methane- sulfonamide .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.42- 8.52 (m, 1H), 8.10- 8.27 (m, 2H), 7.66- 7.76 (m, 1H), 7.29- 7.41 (m, 2H), 6.92- 7.03 (m, 1H), 4.92- 5.16 (m, 1H), 3.25- 3.39 (m, 1H), 3.19 (s, 3H), 2.71-2.87 (m, 4H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 516.1. B049-A Cis-3-[5-bromo-2-(8-chloro- 4-oxo-chromen-2-yl)-4- methyl-phenoxy]-N- methylsulfonyl- cyclobutanecarboxamide embedded image CORE: Int-6 AMINE: methane- sulfonamide .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.95- 8.05 (m, 2H), 7.83- 7.92 (m, 1H), 7.43- 7.55 (m, 1H), 7.27- 7.36 (m, 1H), 7.01 (s, 1H), 4.87-4.98 (m, 1H), 3.23 (s, 3H), 2.81-2.92 (m, 1H), 2.69-2.78 (m, 2H), 2.38 (s, 3H), 2.21-2.31 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 540.1. B049-B Trans-3-[5-bromo-2-(8- chloro-4-oxo-chromen-2-yl) 4-methyl-phenoxy]-N- methylsulfonyl- cyclobutanecarboxamide 0embedded image CORE: Int-6 AMINE: methane- sulfonamide .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.98- 8.06 (m, 2H), 7.86- 7.92 (m, 1H), 7.46- 7.54 (m, 1H), 7.19 (s, 1H), 7.05 (s, 1H), 4.96-5.07 (m, 1H), 3.19-3.23 (m, 4H), 2.63-2.77 (m, 2H), 2.26-2.38 (s, 5H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 540.1. B050-A Cis-3-[2-(8-chloro-4-oxo- chromen-2-yl)-5-methoxy-4- methyl-phenoxy]-N- methylsulfonyl- cyclobutanecarboxamide embedded image CORE: Int-12 AMINE: methane- sulfonamide .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 11.88 (s, 1H), 7.94- 8.01 (m, 2H), 7.74- 7.81 (m, 1H), 7.42- 7.52 (m, 1H), 6.99- 7.07 (m, 1H), 6.55- 6.63 (m, 1H), 4.90- 5.03 (m, 1H), 3.92 (s, 3H), 3.27 (s, 3H), 2.74-2.96 (m, 3H), 2.24-2.36 (m, 2H), 2.18 (s, 3H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 492.1. B050-B Trans-3-[2-(8-chloro-4-oxo- chromen-2-yl)-5-methoxy-4- methyl-phenoxy]-N- methylsulfonyl- cyclobutanecarboxamide embedded image CORE: Int-12 AMINE: methane- sulfonamide .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 11.70 (s, 1H), 7.94- 8.02 (m, 2H), 7.74- 7.81 (m, 1H), 7.42- 7.52 (m, 1H), 7.04- 7.10 (m, 1H), 6.44- 6.49 (m, 1H), 5.03- 5.12 (m, 1H), 3.91 (s, 3H), 3.22-3.31 (m, 4H), 2.73-2.82 (m, 2H), 2.36-2.47 (m, 2H), 2.16 (s, 3H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 492.1. B051-A Cis-3-[2-(8-chloro-4-oxo- chromen-2-yl)-5-methyl- phenoxy]-N-methylsulfonyl- cyclobutanecarboxamide embedded image CORE: Int-2 AMINE: methane- sulfonamide .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.96- 8.02 (m, 2H), 7.84- 7.91 (m, 1H), 7.44- 7.52 (m, 1H), 6.98- 7.08 (m, 2H), 6.90- 6.96 (m, 1H), 4.81- 4.93 (m, 1H), 3.27 (s, 3H), 2.72-2.95 (m, 3H), 2.42 (s, 3H), 2.23-2.34 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 462.1. B051-B Trans-3-[2-(8-chloro-4-oxo- chromen-2-yl)-5-methyl- phenoxy]-N-methylsulfonyl- cyclobutanecarboxamide embedded image CORE: Int-2 AMINE: methane- sulfonamide .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 11.84 (s, 1H), 7.97- 8.03 (m, 2H), 7.84- 7.93 (m, 1H), 7.45- 7.52 (m, 1H), 7.06- 7.14 (m, 1H), 6.99- 7.04 (m, 1H), 6.79- 6.87 (m, 1H), 4.92- 5.06 (m, 1H), 3.22- 3.28 (m, 4H), 2.71- 2.81 (m, 2H), 2.39- 2.44 (m, 5H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 462.1. B052-A Cis-3-[2-(8-chloro-4-oxo- chromen-2-yl)-5-methyl- phenoxy]-N- cyclopropylsulfonyl- cyclobutanecarboxamide embedded image CORE: Int-2 AMINE: cyclopropane- sulfonamide .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 11.64 (s, 1H), 7.99 (d, J = 7.95 Hz, 2H), 7.80- 7.91 (m, 1H), 7.43- 7.54 (m, 1H), 7.06 (s, 2H), 6.89-6.97 (m, 1H), 4.82-4.96 (m, 1H), 2.85-3.04 (m, 2H), 2.73-2.85 (m, 2H), 2.40 (s, 3H), 2.18-2.35 (m, 2H), 1.1- 1.05 (m, 4H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 488.1. B052-B Trans-3-[2-(8-chloro-4-oxo- chromen-2-yl)-5-methyl- phenoxy]-N- cyclopropylsulfonyl- cyclobutanecarboxamide embedded image CORE: Int-2 AMINE: cyclopropane- sulfonamide .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 11.67 (s, 1H), 7.96- 8.05 (m, 2H), 7.82- 7.93 (m, 1H), 7.42- 7.54 (m, 1H), 7.08- 7.13 (m, 1H), 6.97- 7.06 (m, 1H), 6.79- 6.84 (m, 1H), 4.93- 5.05 (m, 1H), 3.22- 3.33 (m, 1H), 2.94- 3.06 (m, 1H), 2.69- 2.82 (m, 2H), 2.39- 2.45 (m, 5H), 1.07- 1.13 (m, 4H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 488.1. B053-A Cis-3-[5-bromo-2-(8-chloro- 4-oxo-chromen-2-yl)-4- methoxy-phenoxy]-N- methylsulfonyl- cyclobutanecarboxamide embedded image CORE: Int-7 AMINE: methane- sulfonamide .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 11.86 (s, 1H), 7.97- 8.04 (m, 2H), 7.62- 7.67 (m, 1H), 7.45- 7.56 (m, 1H), 7.33- 7.39 (m, 1H), 7.03- 7.11 (m, 1H), 4.78- 4.94 (m, 1H), 3.90 (s, 3H), 3.24 (s, 3H), 2.79-2.94 (m, 1H), 2.69-2.76 (m, 2H), 2.20-2.30 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 556.1. B053-A Trans-3-[5-bromo-2-(8- chloro-4-oxo-chromen-2-yl)- 4-methoxy-phenoxy]-N- methylsulfonyl- cyclobutanecarboxamide embedded image CORE: Int-7 AMINE: methane- sulfonamide .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 11.81 (s, 1H), 7.96- 8.07 (m, 2H), 7.62- 7.67 (m, 1H), 7.47- 7.55 (m, 1H), 7.23- 7.26 (m, 1H), 7.09- 7.13 (m, 1H), 4.92- 5.05 (m, 1H), 3.93 (s, 3H), 3.14-3.19 (m, 1H), 2.64-2.76 (m, 2H), 2.31-2.43 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 556.1. B054 Cis-3-[5-bromo-2-(8-chloro- 4-oxo-chromen-2-yl)-4- methoxy-phenoxy]-N- cyclopropylsulfonyl- cyclobutanecarboxamide embedded image CORE: Int-7 AMINE: cyclopropane- sulfonamide .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 11.84 (s, 1H), 7.96- 8.04 (m, 2H), 7.61- 7.67 (m, 1H), 7.46- 7.55 (m, 1H), 7.33- 7.38 (m, 1H), 7.05- 7.11 (m, 1H), 4.84- 4.95 (m, 1H), 3.92 (s, 3H), 2.92-3.00 (m, 1H), 2.82-2.92 (m, 1H), 2.64-2.78 (m, 2H), 2.18-2.29 (m, 2H), 1.03-1.10 (m, 4H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 582.1. B055-A Cis-3-[4-bromo-2-(8-chloro- 4-oxo-chromen-2-yl)-5- methoxy-phenoxy]-N- methylsulfonyl- cyclobutanecarboxamide 0embedded image CORE: Int-34 AMINE: methane- sulfonamide .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 11.84 (s, 1H), 8.12- 8.18 (m, 1H), 7.95- 8.03 (m, 2H), 7.44- 7.53 (m, 1H), 7.02- 7.07 (m, 1H), 6.69- 6.74 (m, 1H), 4.99- 5.11 (m, 1H), 4.02 (s, 3H), 3.26 (s, 3H), 2.75-2.95 (m, 3H), 2.24-2.38 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 556.1. B055-B Trans-3-[4-bromo-2-(8- chloro-4-oxo-chromen-2-yl)- 5-methoxy-phenoxy]-N- methylsulfonyl- cyclobutanecarboxamide embedded image CORE: Int-34 AMINE: methane- sulfonamide .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 11.70 (s, 1H), 8.12- 8.17 (m, 1H), 7.96- 8.05 (m, 2H), 7.45- 7.54 (m, 1H), 7.06- 7.12 (m, 1H), 6.56- 6.62 (m, 1H), 5.07- 5.18 (m, 1H), 3.98 (s, 3H), 3.10-3.33 (m, 4H), 2.74-2.84 (m, 2H), 2.38-2.47 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 556.1. B056-A Cis-3-[4-bromo-2-(8-chloro- 4-oxo-chromen-2-yl)-5- methoxy-phenoxy]-N- cyclopropylsulfonyl- cyclobutanecarboxamide embedded image CORE: Int-34 AMINE: cyclopropane- sulfonamide .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.13 (s, 1H), 7.94-8.03 (m, 2H), 7.43-7.52 (m, 1H), 7.04 (s, 1H), 6.67-6.74 (m, 1H), 4.98-5.10 (m, 1H), 4.04 (s, 3H), 2.76-3.04 (m, 4H), 2.19-2.37 (m, 2H), 1.01-1.14 (m, 4H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 582.1. B057 3-[2-(8-chloro-4-oxo- chromen-2-yl)-4,5- dimethoxy-phenoxy]-N- methylsulfonyl- cyclobutanecarboxamide embedded image CORE: Int-10 AMINE: methane- sulfonamide .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.96- 8.05 (m, 2H), 7.56- 7.63 (m, 1H), 7.42- 7.56 (m, 1H), 7.11- 7.17 (m, 1H), 6.49- 6.64 (m, 1H), 5.00- 5.15 (m, 1H), 3.87 (s, 3H), 3.84 (s, 3H), 3.28 (s, 3H), 2.69-2.82 (m, 2H), 2.36-2.46 (m, 3H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 508.0.

Example B070: 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]cyclobutanecarbonitrile

(472) ##STR00394##

Step 1: Preparation of (3-cyanocyclobutyl) 4-methylbenzenesulfonate

(473) ##STR00395##

(474) To a solution of 3-hydroxycyclobutane-1-carbonitrile (500 mg, 5.15 mmol), DMAP (1.01 g, 8.24 mmol) in DCM (25 mL) was added 4-methylbenzenesulfonyl chloride (1.18 g, 6.2 mmol) and the mixture was then stirred at room temperature overnight. After the reaction was completed, the mixture was concentrated in vacuo and the residue was partitioned between EtOAc (30 mL) and water (20 mL). The organic layer was separated out and washed by brine, dried over Na.sub.2SO.sub.4, then concentrated in vacuo to give the crude (3-cyanocyclobutyl) 4-methylbenzenesulfonate (0.517 g, 40% yield) as a colorless oil, which was used in the next step directly without further purification.

Step 2: Preparation of 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]cyclobutanecarbonitrile

(475) ##STR00396##

(476) A mixture of 8-chloro-2-[2-hydroxy-4-(trifluoromethyl)phenyl]chromen-4-one (Int-1, 117 mg, 342 μmol), 3-cyanocyclobutyl 4-methylbenzenesulfonate (86 mg, 342 μmol) and K.sub.2CO.sub.3 (236 mg, 1.71 mmol) in DMF (5 mL) was stirred at 70° C. overnight. After the reaction was completed, the mixture was diluted with water (15 mL) and extracted with EtOAc (30 mL) three times. The combined organic layer was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by Prep-HPLC to give 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]cyclobutanecarbonitrile (31 mg, 21.4% yield) as a white solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.09-8.17 (m, 1H), 7.97-8.07 (m, 2H), 7.47-7.62 (m, 2H), 7.35-7.44 (m, 1H), 7.04-7.11 (m, 1H), 5.28-5.45 (m, 1H), 3.44-3.55 (m, 1H), 2.85-2.97 (m, 2H), 2.55-2.68 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 419.1.

Example B071: 3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-N,N-dimethyl-propane-1-sulfonamide

(477) ##STR00397##

(478) To a suspension of 2-(4-bromo-2-hydroxy-phenyl)-8-chloro-chromen-4-one (Int-4, 150 mg, 427 μmol) and 3-chloro-N,N-dimethylpropane-1-sulfonamide (111 mg, 597 μmol) in DMF (5 mL) was added K.sub.2CO.sub.3 (354 mg, 2.56 mmol) and the mixture was then stirred at 40° C. for 4 hours. The mixture was then purified by Prep-HPLC to give 3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-N,N-dimethyl-propane-1-sulfonamide (112 mg, 51.4% yield) as a white solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.01 (dd, J=7.9, 1.3 Hz, 2H), 7.85 (d, J=8.3 Hz, 1H), 7.43-7.52 (m, 3H), 6.98 (s, 1H), 4.31 (t, J=6.1 Hz, 2H), 3.13-3.22 (m, 2H), 2.74 (s, 6H), 2.13-2.23 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 500.2.

Example B072: 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propane-1-sulfonamide

(479) ##STR00398##

Step1: Preparation of 3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-N-tert-butyl-propane-1-sulfonamide

(480) ##STR00399##

(481) To a suspension of 2-(4-bromo-2-hydroxy-phenyl)-8-chloro-chromen-4-one (Int-4, 150 mg, 440 μmol) and N-(tert-butyl)-3-chloropropane-1-sulfonamide (132 mg, 616 μmol) in DMF (5 mL) was added K.sub.2CO.sub.3 (365 mg, 2.64 mmol). The mixture was then stirred at 40° C. for 4 hours. After the reaction was completed, the mixture was poured into water (20 mL) and extracted with EtOAc (30 mL) three times. The combined organic layer was concentrated in vacuo to give the crude 3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-N-tert-butyl-propane-1-sulfonamide (200 mg, 87.7% yield) as a white solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 518.3.

Step 2: Preparation of 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propane-1-sulfonamide

(482) ##STR00400##

(483) To a suspension of 3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-N-tert-butyl-propane-1-sulfonamide (30 mg, 57.9 μmol) in AcOH (4 mL) was added concentrated HCl (1 mL) and the mixture was stirred at 110° C. for 4 hours. The mixture was then diluted with water (15 mL) and extracted with EtOAc (20 mL) three times. The combined organic layer was concentrated in vacuo and the residue was purified by Prep-HPLC to give 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propane-1-sulfonamide (15 mg, 55.0% yield) as a white solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.14 (s, 1H), 8.01-8.06 (m, 2H), 7.49-7.62 (m, 3H), 7.07 (s, 1H), 6.88 (s, 2H), 4.40 (t, J=6.5 Hz, 2H), 3.09-3.17 (m, 2H), 2.17-2.26 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 462.3.

Example B073: 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-2-hydroxy-propanoic acid

(484) ##STR00401##

Step 1: Preparation of methyl 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-2-hydroxy-propanoate

(485) ##STR00402##

(486) To a suspension of 8-chloro-2-[2-hydroxy-4-(trifluoromethyl)phenyl]chromen-4-one (Int-1, 100 mg, 294 μmol) and methyl oxirane-2-carboxylate (300 mg, 2.94 mmol) in DMSO (5 mL) was added K.sub.2CO.sub.3 (243 mg, 1.76 mmol) and the mixture was then stirred at 80° C. for 40 hours. The mixture was then poured into water (20 mL) and extracted with EtOAc (20 mL) three times. The combined organic layer was concentrated in vacuo to give the crude methyl 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-2-hydroxy-propanoate (50 mg, 25% purity), which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 443.1

Step 2: Preparation of 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-2-hydroxy-propanoic acid

(487) ##STR00403##

(488) To a solution of methyl 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-2-hydroxy-propanoate (20 mg, 45.2 μmol) in a mixed solvent of THF (6 mL), MeOH (3 mL) and water (1 mL) was added LiOH (54.1 mg, 2.26 mmol) and the mixture was stirred at room temperature for 4 hours. The mixture was then adjusted to PH-6.0 by addition of AcOH and the resulting mixture was concentrated in vacuo. The residue was purified by Prep-HPLC to give 3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-2-hydroxy-propanoic acid (7.1 mg, 34.8% yield) as an off-white solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.80-12.99 (m, 1H), 8.16 (s, 1H), 8.02 (dd, J=7.8, 2.3 Hz, 2H), 7.65 (s, 2H), 7.49-7.58 (m, 1H), 7.22 (s, 1H), 5.69-5.78 (m, 1H), 4.41-4.55 (m, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 429.1.

Example B075: (2S,4S)-4-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]pyrrolidine-2-carboxylic acid

(489) ##STR00404##

Step 1: Preparation of O1-tert-butyl O2-methyl (2S,4S)-4-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]pyrrolidine-1,2-dicarboxylate

(490) ##STR00405##

(491) A mixture of 2-(4-bromo-2-hydroxy-phenyl)-8-chloro-chromen-4-one (Int-4, 100 mg, 284 μmol), O1-tert-butyl O2-methyl (2R,4S)-4-(p-tolylsulfonyloxy)pyrrolidine-1,2-dicarboxylate (114 mg, 284 μmol) and K.sub.2CO.sub.3 (197 mg, 1.42 mmol) in DMF (15 mL) was stirred at 50° C. overnight. The mixture was then poured into water (50 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was concentrated in vacuo and the residue was purified by column chromatography on silica gel (eluted with PE:EtOAc=100:1 to 3:1) to give O1-tert-butyl O2-methyl (2S,4S)-4-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]pyrrolidine-1,2-dicarboxylate (150 mg, 91.1% yield) as a yellow solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 578.1.

Step 2: Preparation of methyl (2S,4S)-4-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]pyrrolidine-2-carboxylate

(492) ##STR00406##

(493) To a solution of O1-tert-butyl O2-methyl (2S,4S)-4-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]pyrrolidine-1,2-dicarboxylate (1.3 g, 2.25 mmol) in DCM (30 mL) was added TFA (1.28 g, 865 μl, 11.2 mmol) and the mixture was then stirred at room temperature overnight. After the reaction was completed, the mixture was concentrated in vacuo to give the crude methyl (2S,4S)-4-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]pyrrolidine-2-carboxylate (1.08 g, 100% yield) as a white solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 578.1.

Step 3: Preparation of (2S,4S)-4-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]pyrrolidine-2-carboxylic acid

(494) ##STR00407##

(495) To a solution of methyl (2S,4S)-4-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]pyrrolidine-2-carboxylate (150 mg, 313 μmol) in the mixed solvent of THF (20 ml) and MeOH (10 ml) was added LiOH (30 mg, 1.25 mmol) and the mixture was then stirred at room temperature for 4 hours. The mixture was then quenched by addition of AcOH (0.5 mL) and the resulting mixture was concentrated in vacuo. The residue was purified by Prep-HPLC to give (2S,4S)-4-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]pyrrolidine-2-carboxylic acid (45 mg, 29.4%) yield as white solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.00 (d, J=7.8 Hz, 2H), 7.83 (d, J=8.3 Hz, 1H), 7.43-7.55 (m, 3H), 6.95 (s, 1H), 5.34 (br s, 1H), 4.37-4.40 (m, 1H), 3.62-3.69 (m, 1H), 3.51-3.56 (m, 1H), 2.60-2.84 (m, 2H), 2.37-2.66 (m, 1H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 464.0.

Example B076: (2S,4R)-1-(benzenesulfonyl)-4-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]pyrrolidine-2-carboxylic acid

(496) ##STR00408##

Step 1: Preparation of O1-tert-butyl O2-methyl (2S,4R)-4-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]pyrrolidine-1,2-dicarboxylate

(497) ##STR00409##

(498) A mixture of 8-chloro-2-[2-hydroxy-4-(trifluoromethyl)phenyl]chromen-4-one (Int-1, 323 mg, 948 μmol, as the “CORE” in Table 8), 1-(tert-butyl) 2-methyl (2S,4S)-4-((methylsulfonyl)oxy)pyrrolidine-1,2-dicarboxylate (460 mg, 1.42 mmol, as the “SM5” in Table 8) and K.sub.2CO.sub.3 (524 mg, 3.79 mmol) in DMF (10 mL) was stirred at 80° C. overnight. After the reaction was completed, the mixture was diluted with water (30 mL) and extracted with EtOAc (30 mL) three times. The combined organic layer was concentrated in vacuo and the residue was purified by column chromatography on silica gel to give O1-tert-butyl O2-methyl (2S,4R)-4-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]pyrrolidine-1,2-dicarboxylate (400 mg, 74.3% yield) as a light yellow solid.

Step 2: Preparation of methyl (2S,4R)-4-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]pyrrolidine-2-carboxylate

(499) ##STR00410##

(500) To a solution of O1-tert-butyl O2-methyl (2S,4R)-4-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]pyrrolidine-1,2-dicarboxylate (400 mg, 704 μmol) in DCM (10 mL) was added TLA (402 mg, 3.52 mmol) and the mixture was then stirred at room temperature overnight. The mixture was then concentrated in vacuo to give the crude methyl (2S,4R)-4-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]pyrrolidine-2-carboxylate (320 mg, 97.1% yield) as a white solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 468.9.

Step 3: Preparation of (2S,4R)-1-(benzenesulfonyl)-4-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]pyrrolidine-2-carboxylic acid

(501) ##STR00411##

(502) To a solution of methyl (2S,4R)-4-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]pyrrolidine-2-carboxylate (120 mg, 250 μmol) in the mixed solvent of THF (10 ml) and Water (1 ml) was added LiOH (20.5 mg, 855 μmol) and the mixture was then stirred at room temperature for 2 hours. After complete conversion of methyl (2S,4R)-4-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]pyrrolidine-2-carboxylate to the (2S,4R)-4-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]pyrrolidine-2-carboxylic acid, to the resulting solution was added benzenesulfonyl chloride (195 mg, 1.1 mmol, as the “SM6” in Table 8) and the mixture was then stirred at room temperature for 30 minutes. The mixture was diluted with water (15 mL) and adjusted to pH 3.0 by addition of 2 N HCl. The resulting suspension was then extracted with EtOAc (30 mL) twice. The combined organic layer (60 mL) was washed with brine, dried over Na.sub.2SO.sub.4, concentrated in vacuo and the residue was purified by Prep-HPLC to give (2S,4R)-1-(benzenesulfonyl)-4-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]pyrrolidine-2-carboxylic acid (87 mg, 65.1% yield) as a white solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.02-8.09 (m, 3H), 7.51-7.61 (m, 4H), 7.45 (s, 1H), 7.07-7.17 (m, 3H), 6.65 (s, 1H), 5.35 (br s, 1H), 4.16 (dd, J=9.5, 7.2 Hz, 1H), 3.85 (dd, J=12.7, 3.4 Hz, 1H), 3.60 (br d, J=12.1 Hz, 1H), 2.61 (br dd, J=13.9, 7.2 Hz, 1H), 2.35 (ddd, J=13.9, 9.6, 4.5 Hz, 1H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 594.4.

(503) The following Example B077 to Example B088 were prepared in analogy to the procedure described for the preparation of Example B076, replacing 8-chloro-2-[2-hydroxy-4-(trifluoromethyl)phenyl]chromen-4-one with “CORE”, 1-(tert-butyl) 2-methyl (2S,4S)-4-((methylsulfonyl)oxy)pyrrolidine-1,2-dicarboxylate with “SM5” in step1 and benzenesulfonyl chloride with “SM6” in step 3. The “CORE”, “SM5” and “SM6” are the reagents indicated in Table 8.

(504) TABLE-US-00009 TABLE 8 Compounds synthesis and characterization Example Compounds Name and CORE and No. Structure SM4 .sup.1H NMR and (ESI.sup.+) B077 (2S,4R)-4-[2-(8-chloro-4-oxo- CORE: Int-1 .sup.1H NMR (DMSO-d.sub.6, chromen-2-yl)-5- SM5: 1-(tert- 400 MHz): δ ppm (trifluoromethyl)phenoxyl-1- butyl) 2- 8.00-8.14 (m, 3H), cyclopropylsulfonyl- methyl 7.59-7.65 (m, 2H), pyrrolidine-2-carboxylic acid (2S,4S)-4- 7.52 (t, J = 7.9 Hz, embedded image ((methylsulfonyl) oxy)pyrrolidine- 1,2-dicarboxlate (Int-Pro2) SM6: cyclopropane- sulfonyl chloride 1H), 7.00 (s, 1H), 5.48 (br s, 1H), 4.38 (t, J = 8.2 Hz, 1H), 3.76 (br d, J = 2.9 H, 1H), 2.60-2.70 (m, 2H), 2.29-2.42 (m, 2H), 0.64-0.91 (m, 4H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 558.4. B078 (2S,4S)-4-[2-(8-chloro-4-oxo- CORE: Int-1 .sup.1H NMR (DMSO-d.sub.6, chromen-2-yl)-5- SM5: O1-tert- 400 MHz): δ ppm (trifluoromethyl)phenoxy]-1- butyl O2- 12.56-12.73 (m, 1H), cyclopropylsulfonyl- methyl 8.16 (d, J = 8.1 Hz, pyrrolidine-2-carboxylic acid (2R,45)-4-(p- 1H), 8.01 (dd, J = 7.9, embedded image tolylsulfonyloxy) pyrrolidine- 1,2- dicarboxylate (Int-Pro1) SM6: cyclopropane sulfonyl chloride 2.5 Hz, 2H), 7.54-7.63 (m, 2H), 7.50 (t, J = 7.9 Hz, 1H), 7.16 (s, 1H), 5.48 (br s, 1H), 4.49-4.52 (m, 1H), 3.89-3.93 (m, 1H), 3.64 (d, J = 11.2 Hz, 1H), 2.91-2.99 (m, 1H), 2.72-2.78 (m, 1H), 2.34 (d, J = 13.7 Hz, 1H), 0.90-1.14 (m, 4H). MS obsd. (ESL.sup.+) [(M + H).sup.+]: 558.1. C079 (2S,4S)-4-[2-(8-chloro-4-oxo- CORE: Int-1 .sup.1H NMR (DMSO-d.sub.6, chromen-2-yl)-5- SM5: O1-tert- 400 MHz): δ ppm 7.98- (trifluoromethybphenoxy]-1- butyl O2- 8.10 (m, 3H), 7.52- (3-methoxyphenyl)sulfonyl- methyl 7.59 (m, 3H), 7.45- pyrrolidine-2-carboxylic acid (2R,45)-4-(p- 7.51 (m, 2H), 7.34- embedded image tolylsulfonyloxy) pyrrolidine- 1,2- dicarboxylate (Int-Pro1) SM6: 3- methoxybenzene- sulfonyl chloride 7.41 (m, 1H), 7.25- 7.30 (m, 1H), 6.96- 6.99 (m, 1H), 5.27 (br d, J = 3.3 Hz, 1H), 4.49 (t, J = 6.1 Hz, 1H), 3.83 (s, 3H), 3.73 (dd, J = 12.2, 5.8 Hz, 1H), 3.56 (br d, J = 1.5 Hz, 1H), 2.25-2.30 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 624.3. B080 (2S,4S)-1-(benzenesulfonyl)- CORE: Int-1 .sup.1H NMR (DMSO-d.sub.6, 4-[2-(8-chloro-4-oxo- SM5: O1-tert- 400MHz):12.96-13.13 chromen-2-yl)-5- butyl O2- (m, 1H), 8.00-8.11 (m, (trifluoromethyl)phenoxy]methyl 3H), 7.53-7.63 (m, pyrrolidine-2-carboxylic acid (2R,45)-4-(p- 4H), 7.04-7.20 (m, embedded image tolylsulfonyloxy) pyrrolidine- 1,2- dicarboxylate (Int-Pro1) SM6: benzenesulfonyl chloride 3H), 6.65 (s, 1H), 5.30-5.40 (m, 1H), 4.15 (dd, J = 9.5, 7.2 Hz, 1H), 3.85 (dd, J = 12.6, 3.4 Hz, 1H), 3.60 (br d, J = 12.8 Hz, 1H), 2.57-2.64 (m, 1H), 2.30-2.38 (m, 1H). MS obsd. (ESI) [(M + H).sup.+]: 594.3. B081 (2S,4S)-1-(benzenesulfonyl)- CORE: Int-10 .sup.1H NMR (DMSO-d.sub.6, 4-[2-(8-chloro-4-oxo- SM5: O1-tert- 400 MHz): δ ppm 7.90- chromen-2-yl)-4,5- butyl O2- 8.03 (m, 4H), 7.69- dimethoxy- methyl 7.75 (m, 1H), 7.61- phenoxylpyrrolidine-2- (2R,45)-4-(p- 7.67 (m, 2H), 7.44- carboxylic acid tolylsulfonyloxy) 7.53 (m, 2H), 6.98 (s, embedded image pyrrolidine- 1,2- dicarboxylate (Int-Pro1) SM6: benzenesulfonyl chloride 1H), 6.69 (s, 1H), 5.03-5.10 (m, 1H), 4.45 (t, J = 6.3 Hz, 1H), 3.86 (s, 3H), 3.80 (s, 3H), 3.67 (dd, J = 11.6, 5.6 Hz, 1H), 3.53 (br dd, J = 11.5, 2.2 Hz, 2H), 2.30 (dd, J = 6.2, 4.0 Hz, 1H). MS obsd. (ESL.sup.+) [(M + H).sup.+: 586.3. B082 (2S,4S)-1-(benzenesulfonyl)- CORE: Int-4 .sup.1H NMR (DMSO-d.sub.6, 4-[5-bromo-2-(8-chloro-4- SM5: O1-tert- 400 MHz): δ ppm 7.91- oxo-chromen-2- butyl O2- 8.03 (m, 4H), 7.79- yl)phenoxylpyrrolidine-2- methyl 7.86 (m, 1H), 7.67- carboxylic acid (2R,45)-4-(p- 7.74 (m, 1H), 7.59- embedded image tolylsulfonyloxy) pyrrolidine- 1,2- dicarboxylate (Int-Pro1) SM6: benzenesulfonyl chloride 7.66 (m, 2H), 7.46- 7.53 (m, 1H), 7.34- 7.44 (m, 2H), 6.97- 7.02 (m, 1H), 4.99- 5.07 (m, 1H), 4.29- 4.38 (m, 1H), 3.70- 3.78 (m, 1H), 3.43- 3.51 (m, 1H), 2.16- 2.36 (m, 2H). MS obsd. (ESL.sup.+) [(M + H).sup.+]:602.1. B083 (2S,4S)-4-[5-bromo-2-(8- CORE: Int-4 .sup.1H NMR (DMSO-d.sub.6, chloro-4-oxo-chromen-2- SM5: O1-tert- 400 MHz): δ ppm 8.00 yl)phenoxy]-1- butyl O2- (dd, J = 7.9, 1.9 Hz, cyclopropylsulfonyl- methyl 2H), 7.86-7.97 (m, pyrrolidine-2-carboxylic acid (2R,45)-4-(p- 1H), 7.39-7.55 (m, embedded image tolylsulfonyloxpy) pyrrolidine-1,2- dicarboxylate (Int-Pro1) SM6: cyclopropane- sulfonyl chloride 3H), 7.12 (s, 1H), 5.32-5.39 (m, 1H), 4.45-4.56 (m, 1H), 3.88-3.93 (m, 1H), 3.63 (br d, J = 11.1 Hz, 1H), 2.95-3.04 (m, 1H), 2.68-2.79 (m, 1H), 2.35 (br d, J = 14.1 Hz, 1H), 0.91- 1.17 (m, 4H) .MS obsd. (ESI.sup.+) [(M + H).sup.+]: 568.3. B084 (2S,4S)-1-(benzenesulfonyl)- CORE: Int-5 .sup.1H NMR (DMSO-d.sub.6, 4-[5-chloro-2-(8-chloro-4- SM5: O1-tert- 400 MHz): δ ppm oxo-chromen-2-yl)-4-methyl- butyl O2- 12.79 (s, 1H), 7.96- phenoxy]pyrrolidine-2- methyl 8.04 (m, 2H), 7.89- carboxylic acid (2R,4S)-4-(p- 7.96 (m, 2H), 7.81- embedded image tolylsulfonyloxy) pyrrolidine- 1,2- dicarboxylate (Int-Pro1) SM6: benzenesulfonyl chloride 7.85 (m, 1H), 7.68- 7.75 (m, 1H), 7.58- 7.67 (m, 2H), 7.45- 7.53 (m, 1H), 7.24- 7.31 (m, 1H), 6.90- 6.95 (m, 1H), 5.06- 5.12 (m, 1H), 4.40- 4.48 (m, 1H), 3.63- 3.72 (m, 1H), 3.48- 3.55 (m, 1H), 2.37 (s, 3H), 2.23-2.29 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 574.1. B085 (2S,4S)-1-(benzenesulfonyl)- CORE: Int-9 .sup.1H NMR (DMSO-d.sub.6, 4-[2-(8-chloro-4-oxo- SM5: O1-tert- 400 MHz): δ ppm 7.97- chromen-2-yl)-5- butyl O2- 8.06 (m, 3H), 7.89- (trifluoromethoxy)phenoxy] methyl 7.96 (m, 2H), 7.68- pyrrolidine-2-carboxylic acid (2R,45)-4-(p- 7.78 (m, 1H), 7.59- 0embedded image tolylsulfonyloxy) pyrrolidine- 1,2- dicarboxylate (Int-Pro1) SM6: benzenesulfonyl chloride 7.68 (m, 2H), 7.46- 7.55 (m, 1H), 7.17- 7.26 (m, 2H), 6.94- 6.98 (m, 1H), 5.11- 5.19 (m, 1H), 4.41- 4.51 (m, 1H), 3.66- 3.75 (m, 2H), 2.23- 2.33 (m, 2H) .MS obsd. (ESL.sup.+) [(M + H).sup.+]: 610.1. B086 (2S,4S)-1-benzoyl-4-[5- CORE: Int-4 .sup.1HNMR (DMSO-d.sub.6, bromo-2-(8-chloro-4-oxo- SM5: O1-tert- 400 MHz): δ ppm 7.97- chromen-2-yl) butyl O2- 8.09 (m, 2H), 7.87 (br phenoxylpyrrolidine-2- methyl d, J = 8.6 Hz, 1H), carboxylic acid (2R,45)-4-(p- 7.39-7.58 (m, 8H), embedded image tolylsulfonyloxy) pyrrolidine- 1,2- dicarboxylate (Int-Pro1) SM6: benzoyl chloride 7.09 (s, 1H), 5.23-5.32 (m, 1H), 4.65-4.71 (m, 1H), 4.48-4.54 (m, 1H), 3.73-3.84 (m, 1H), 2.74-2.82 (m, 1H), 2.26-2.32 (m, 1H). MS obsd. (ESL.sup.+) [(M + H).sup.+]: 570.1. B087 (2R,4S)-1-(benzenesulfonyl)- CORE: Int-1 .sup.1H NMR (DMSO-d.sub.6, 4-[2-(8-chloro-4-oxo- SM5: O1-tert- 400 MHz): δ ppm 8.04- chromen-2-yl)-5- butyl O2- 8.11 (m, 3H), 7.53- (trifluoromethyl)phenoxy] methyl 7.59 (m, 4H), 7.06- pyrrolidine-2-carboxylic acid (2R,4R)-4-(p- 7.18 (m, 3H), 6.62- embedded image tolylsulfonyloxy) pyrrolidine- 1,2- dicarboxylate (Int-Pro3) SM6: benzenesulfonyl chloride 6.67 (m, 1H), 5.24- 5.41 (m, 1H), 4.14- 4.23 (m, 1H), 3.81- 3.90 (m, 1H), 3.60 br d, J = 12.2 Hz, 1H), 2.58-2.66 (m, 1H), 2.28-2.41 (m, 1H). MS obsd. (ESL.sup.+) [(M + H).sup.+]: 594.6. B088 (2R,4R)-1-(benzenesulfonyl)- CORE: Int-1 .sup.1H NMR (DMSO-d.sub.6, 4-[2-(8-chloro-4-oxo- SM5: O1-tert- 400 MHz): δ ppm chromen-2-yl)-5- butyl O2- 7.98-8.13 (m, 3H), (trifluoromethyl)phenoxy] methyl 7.91-7.97 (m, 2H), pyrrolidine-2-carboxylic acid (2S,4R)-4-(p- 7.72 (s, 1H), 7.39-7.66 embedded image tolylsulfonyloxy) y)pyrrolidine- 1,2- dicarboxylate (Int-Pro4) SM6: benzenesulfonyl chloride (m, 5H), 7.00 (s, 1H), 5.26 (br d, J = 3.3 Hz, 1H), 4.46 (dd, J = 7.6, 4.5 Hz, 1H), 3.70 (dd, J = 11.7, 5.4 Hz, 1H), 3.54 (dd, J = 11.7, 1.5 Hz, 1H), 2.51-2.54 (m, 1H), 2.24-2.30 (m, 1H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 594.1.

Example C001: 2-[3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propoxy]acetic acid

(505) ##STR00424##

Step 1: Preparation of tert-butyl 2-[3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propoxy]acetate

(506) ##STR00425##

(507) To a mixture of 8-chloro-2-[2-hydroxy-4-(trifluoromethyl)phenyl]chromen-4-one (Int-1, 500.0 mg, 1.47 mmol, as the “CORE” in Table 9), K.sub.2CO.sub.3 (608.5 mg, 4.4 mmol) in DMF (10 mL) was added tert-butyl 2-[2-(p-tolylsulfonyloxy)ethoxy]acetate (Int-T3, 533.4 mg, 1.61 mmol, as the “Tail” in Table 9) and the mixture was stirred at 80° C. for 4 hours. After the reaction was completed, the mixture was diluted with water (15 mL) and extracted with EtOAc (15 mL) three times. The combined organic layer was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluted with PE:EtOAc=3:1 to 1:1) to give tert-butyl 2-[3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propoxy]acetate (632 mg, 83.9% yield) as a colorless oil. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 513.1.

Step 2: Preparation of 2-[3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propoxy]acetic acid

(508) ##STR00426##

(509) To a mixture of tert-butyl 2-[3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propoxy]acetate (2000.0 mg, 3.9 mmol) in DCM (50 mL) was added TFA (5.0 mL, 64.9 mmol) and the mixture was stirred at room temperature for 4 hours. After the reaction was completed, the mixture was concentrated in vacuo. The residue was triturated with EtOAc (30 mL) and then filtered, the solid was collected and dried in vacuo to give 2-[3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propoxy]acetic acid (1580 mg, 88.7% yield) as a white solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.21-8.27 (m, 1H), 8.08-8.15 (m, 1H), 7.87-7.99 (m, 1H), 7.45-7.58 (m, 3H), 7.29-7.36 (m, 1H), 4.36-4.48 (m, 2H), 4.01-4.10 (m, 2H), 3.73-3.83 (m, 2H), 2.16-2.30 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 457.1.

Example C002: 2-[3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methyl-phenoxy]propoxy]acetic acid

(510) ##STR00427##

(511) Example C002 was prepared in analogy to the procedure described for the preparation of Example C001 by using 8-chloro-2-(2-hydroxy-4-methyl-phenyl)chromen-4-one (Int-2) as the starting materials instead of 8-chloro-2-[2-hydroxy-4-(trifluoromethyl)phenyl]chromen-4-one (Int-1) in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.42 (s, 1H), 7.96-8.03 (m, 2H), 7.83-7.93 (m, 1H), 7.44-7.53 (m, 1H), 7.10-7.16 (m, 1H), 7.07-7.10 (m, 1H), 6.99-7.04 (m, 1H), 4.19-4.29 (m, 2H), 3.97-4.04 (m, 2H), 3.60-3.70 (m, 2H), 2.43 (s, 3H), 2.01-2.10 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 403.1.

Example C003-A and Example C003-B: Cis-3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid and tram-3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

(512) ##STR00428##

Step 1: Preparation of methyl 3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate

(513) ##STR00429##

(514) To a mixture of 2-(4-bromo-2-hydroxy-phenyl)-8-chloro-chromen-4-one (Int-4, 300.0 mg, 0.850 mmol) and methyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate (Int-T1, 336.24 mg, 1.02 mmol) in DMF (5 mL) was added K.sub.2CO.sub.3 (176.89 mg, 1.28 mmol) at 25° C. and the mixture was then stirred at 80° C. for 16 hours. After the reaction was completed, the mixture was poured into water (50 mL) and extracted with EtOAc (100 mL) twice. The combined organic layer was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluted with PE:EtOAc=3:1 to 1:1) to give methyl 3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate (300 mg, 69.4% yield) as a yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.95-8.02 (m, 2H), 7.90 (s, 1H), 7.85-7.94 (m, 1H), 7.46-7.53 (m, 2H), 7.37-7.43 (m, 1H), 7.31 (s, 1H), 4.27-4.35 (m, 2H), 4.20 (t, J=6.8 Hz, 0.6H), 3.96 (t, J=7.0 Hz, 0.4H), 3.66-3.73 (m, 2H), 3.53-3.61 (m, 3H), 3.02-3.11 (m, 0.6H), 2.60-2.67 (m, 0.4H), 2.36-2.42 (m, 2H), 2.17-2.29 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 509.3.

Step 2: Preparation of Cis-3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid and tram-3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

(515) ##STR00430##

(516) To a mixture of methyl 3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate (300.0 mg, 0.590 mmol) in THF (3 mL) and water (1 mL) was added LiOH.H.sub.2O (74.37 mg, 1.77 mmol) at 25° C. and the mixture was then stirred at 25° C. for 3 hours. After the reaction was completed, the mixture was poured into water (30 mL) and adjusted to pH ˜5 by addition of HCl (4 N). The resulting solution was then extracted with EtOAc (50 mL) twice. The combined organic layer was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo to give the crude 3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid. The crude was purified by Prep-HPLC to give two sets of diastereomers of the 3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid with cis- and trans-configuration, one of which is characterized as Example C003-A (25 mg, 8.3%) and the other is Example C003-B (48 mg, 16.0%).

(517) Example C003-A: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.10 (br s, 1H), 7.98 (br d, J=7.7 Hz, 2H), 7.90 (br d, J=8.4 Hz, 1H), 7.35-7.57 (m, 3H), 7.13-7.27 (m, 1H), 4.23-4.40 (m, 2H), 3.86-4.01 (m, 1H), 3.68-3.72 (m, 2H), 2.30-2.47 (m, 3H), 1.94-2.06 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:495.0.

(518) Example C003-B: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 11.28-12.64 (m, 1H), 7.72-8.19 (m, 3H), 7.14-7.67 (m, 4H), 4.07-4.39 (m, 3H), 3.51-3.56 (m, 2H), 2.83-3.08 (m, 1H), 2.40 (br s, 2H), 2.24 (br s, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:495.0.

Example C004: 3-[2-[5-chloro-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

(519) ##STR00431##

Step 1: Preparation of methyl 3-[2-[5-chloro-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate

(520) ##STR00432##

(521) To a solution of 8-chloro-2-(4-chloro-2-hydroxy-phenyl)chromen-4-one (Int-35, 200.0 mg, 0.650 mmol) and K.sub.2CO.sub.3 (180.0 mg, 1.3 mmol) in DMF (5 mL) was added methyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate (213.84 mg, 0.650 mmol) and the reaction mixture was stirred at 80° C. for 16 hours. The reaction mixture was then poured into water (30 mL) and extracted with EtOAc (30 mL) twice. The combined organic layer was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo to give the crude methyl 3-[2-[5-chloro-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate (210 mg, 55.68% yield) as a yellow solid, which was used in the next step directly without further purification.

Step 2: Preparation of 3-[2-[5-chloro-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

(522) ##STR00433##

(523) To a solution of methyl 3-[2-[5-chloro-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate (210.0 mg, 0.450 mmol) in DMF (5 mL) was added sodium hydroxide (54.4 mg, 1.36 mmol) at 20° C. and the reaction mixture was stirred at 20° C. for 3 hours. After the reaction was completed, the mixture was concentrated in vacuo and the residue was purified by Prep-HPLC to give the product 3-[2-[5-chloro-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid (20.4 mg, 9.85% yield) as a yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.91-8.02 (m, 3H), 7.46 (t, J=7.9 Hz, 1H), 7.19-7.38 (m, 3H), 4.27-4.34 (m, 2H), 4.15-4.22 (m, 1H), 3.662-3.72 (m, 2H), 2.86-2.95 (m, 1H), 2.35-2.41 (m, 2H), 2.10-2.24 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 449.6.

Example C005: 2-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]ethoxy]acetic acid

(524) ##STR00434##

Step 1: Preparation of methyl 2-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]ethoxy]acetate

(525) ##STR00435##

(526) Compound C005a was prepared in analogy to the procedure described for the preparation of compound C003a by using 8-chloro-2-[2-hydroxy-4-(trifluoromethyl)phenyl]chromen-4-one (Int-1) and methyl 2-[2-(p-tolylsulfonyloxy)ethoxy]acetate (Int-T4) as the starting materials instead of 2-(4-bromo-2-hydroxy-phenyl)-8-chloro-chromen-4-one (Int-4) and methyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate (Int-T1) in Step 1.

Step 2: Preparation of 2-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]ethoxy]acetic acid

(527) ##STR00436##

(528) To a solution of methyl 2-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]ethoxy]acetate (400 mg, 876 μmol) in the THF (20 mL)/water (5 mL) was added LiOH (220 mg, 5.25 mmol). The reaction was stirred at room temperature for 4 hours. After the reaction was completed, the mixture was concentrated in vacuo and the residue was purified by Prep-HPLC to give 2-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]ethoxy]acetic acid (128.4, 31.8% yield) as a white solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.11-8.20 (m, 1H), 7.96-8.05 (m, 2H), 7.48-7.64 (m, 3H), 7.21-7.28 (m, 1H), 4.40-4.48 (m, 2H), 4.13 (s, 2H), 3.83-3.97 (m, 2H). (ESI.sup.+) [(M+H).sup.+]: 443.1.

Example C006: 2-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]acetic acid

(529) ##STR00437##

Step 1: Preparation of methyl 2-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]acetate

(530) ##STR00438##

(531) Compound C006a was prepared in analogy to the procedure described for the preparation of compound C003a by using methyl 2-[2-(p-tolylsulfonyloxy)ethoxy]acetate (Int-T4) as the starting materials instead of methyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate (Int-T1) in Step 1.

Step 2: Preparation of 2-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]acetic acid

(532) ##STR00439##

(533) To a solution of methyl 2-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]acetate (400 mg, 855 μmol) in a mixed solvent of MeOH (10 ml) and THF (10 ml) was added LiOH (20.5 mg, 855 μmol) and the mixture was stirred at room temperature for 4 hours. After the reaction was completed, the mixture was adjusted to pH ˜ 5.0 by addition of concentrated HCl. The resulting solution was concentrated in vacuo and the residue was triturated with EtOH (15 mL). The suspension was then filtered, the solid was collected and dried in vacuo to give 2-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]acetic acid (220 mg, 50.5% yield) as a yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.00 (dd, J=7.9, 2.1 Hz, 2H), 7.92 (d, J=8.6 Hz, 1H), 7.47-7.57 (m, 2H), 7.43 (dd, J=8.5, 1.8 Hz, 1H), 7.23 (s, 1H), 4.31-4.37 (m, 2H), 3.82-3.89 (m, 2H), 3.68-3.73 (m, 2H). (ESI.sup.+) [(M+H).sup.+]: 453.0.

(534) The following Example C009 to Example C019 were prepared in analogy to the procedure described for the preparation of Example C001. By replacing tert-butyl 2-[2-(p-tolylsulfonyloxy)ethoxy]acetate with “Tail”, 8-chloro-2-[2-hydroxy-4-(trifluoromethyl)phenyl]chromen-4-one with “CORE” in step 1. The Tail” and “CORE” are the reagents indicated in Table 9.

(535) TABLE-US-00010 TABLE 9 Compounds synthesis and characterization Example Compounds Name and No. Structure CORE,TAIL .sup.1NMR and (ESI.sup.+) C009 2-[3-[5-chloro-2-(8-chloro-4- CORE:Int-35 .sup.1H NMR (DMSO-d.sub.6, oxo-chromen-2- TAIL:Int-T3 400 MHz): δ ppm 7.91- yl)phenoxy]propoxy]acetic 8.05 (m, 3H), 7.45- acid 7.54 (m, 1H), 7.37- 0embedded image 7.43 (m, 1H), 7.25- 7.33 (m, 1H), 7.02- 7.11 (m, 1H), 4.21- 4.33 (m, 2H), 4.05 (s, 2H), 3.59-3.66 (m, 2H), 1.98-2.11 (m, 2H). (ESI.sup.+) [(M + H).sup.+]: 423.1. C010 2-[3-[5-bromo-2-(8-chloro-4- CORE:Int-4 .sup.1H NMR (DMSO-d.sub.6, oxo-chromen-2- TAIL:Int-T3 400 MHz): δ ppm 7.94- yl)phenoxy]propoxy]acetic 8.05 (m, 2H), 7.78- acid 7.93 (m, 1H), 7.36- embedded image 7.58 (m, 3H), 7.02- 7.11 (m, 1H), 4.20- 4.33 (m, 2H), 3.89- 4.03 (m, 2H), 3.59- 3.68 (m, 2H), 1.98- 2.12 (m, 2H). (ESI.sup.+) [(M + H).sup.+]: 465.1. C011 2-[3-[5-bromo-2-(8-chloro-4- CORE:Int-6 .sup.1H NMR (DMSO-d.sub.6, oxo-chromen-2-yl)-4-methyl- TAIL:Int-T3 400 MHz): δ ppm 7.99 phenoxy]propoxy]acetic acid (br d, J = 3.55 Hz, 2H), embedded image 7.84-7.89 (m, 1H), 7.45-7.53 (m, 2H), 6.98-7.08 (m, 1H), 4.18-4.27 (m, 2H), 3.95 (s, 2H), 3.56-3.64 (m, 2H), 2.36 (s, 3H), 1.94-2.09 (m, 2H). (ESI.sup.+) [(M + H).sup.+]: 481.1. C012 2-[3-[2-(8-chloro-4-oxo- CORE:Int-10 .sup.1H NMR (DMSO-d.sub.6, chromen-2-yl)-4,5- TAIL:Int-T3 400 MHz): δ ppm 7.90- dimethoxy- 8.03 (m, 2H), 7.52- phenoxy]propoxy]acetic acid 7.63 (m, 1H), 7.39- embedded image 7.52 (m, 1H), 7.06- 7.15 (m, 1H), 6.79- 6.89 (m, 1H), 4.17- 4.31 (m, 2H), 4.07 (s, 2H), 3.93 (s, 3H), 3.80 (s, 3H), 3.60-3.71 (m, 2H), 2.00-2.13 (m, 2H). (ESI.sup.+) [(M + H).sup.+]: 449.1. C013 2-[3-[5-bromo-2-(8-chloro-4- CORE:Int-7 .sup.1H NMR (DMSO-d.sub.6, oxo-chromen-2-yl)-4- TAIL:Int-T3 400 MHz): δ ppm methoxy- 12.46 (s, 1H), 7.96- phenoxy]propoxy]acetic acid 8.04 (m, 2H), 7.62- embedded image 7.68 (m, 1H), 7.54- 7.57 (m, 1H), 7.47- 7.53 (m, 1H), 7.04- 7.13 (m, 1H), 4.17- 4.27 (m, 2H), 3.97- 4.03 (m, 2H), 3.94 (s, 3H), 3.58-3.65 (m, 2H), 1.94-2.07 (m, 2H). (ESI.sup.+) [(M + H).sup.+]: 497.1. C014 2-[3-[2-(8-chloro-4-oxo- CORE:Int-9 .sup.1H NMR (DMSO-d.sub.6, chromen-2-yl)-5- TAIL:Int-T3 400 MHz): δ ppm 7.97- (trifluoromethoxy)phenoxy] 8.10 (m, 3H), 7.44- propoxy]acetic acid 7.54 (m, 1H), 7.19- embedded image 7.32 (m, 2H), 7.03- 7.09 (m, 1H), 4.25- 4.33 (m, 2H), 4.04 (s, 2H), 3.59-3.66 (m, 2H), 2.00-2.09 (m, 2H). (ESI.sup.+) [(M + H).sup.+]: 473.1. C015 2-[3-[[6-(8-chloro-4-oxo- CORE:Int-11 .sup.1H NMR (DMSO-d.sub.6, chromen-2-yl)-1,3- TAIL:Int-T3 400 MHz): δ ppm 7.94- benzodioxo1-5- 8.03 (m, 2H), 7.41- yl]oxy]propoxy]acetic acid 7.53 (m, 2H), 7.00- embedded image 7.11 (m, 2H), 6.20 (s, 2H), 4.14-4.26 (m, 2H), 4.03 (s, 2H), 3.59-3.67 (m, 2H), 1.94-2.08 (m, 2H). (ESI.sup.+) [(M + H).sup.+]: 433.1. C016 2-[3-[5-chloro-2-(8-chloro-4- CORE:Int-8 .sup.1H NMR (DMSO-d.sub.6, oxo-chromen-2-yl)-4- TAIL:Int-T3 400 MHz): δ ppm methoxy- 12.63 (s, 1H), 7.97- phenoxy]propoxy]acetic acid 8.06 (m, 2H), 7.65- embedded image 7.71 (m, 1H), 7.47- 7.56 (m, 1H), 7.41- 7.45 (m, 1H), 7.05- 7.13 (m, 1H), 4.18- 4.27 (m, 2H), 4.05 (s, 2H), 3.91 (s, 3H), 3.57-3.66 (m, 2H), 1.94-2.07 (m, 2H). (ESI.sup.+) [(M + H).sup.+]: 453.1. C017 2-[3-[2-(8-bromo-4-oxo- CORE:Int-24 .sup.1H NMR (DMSO-d.sub.6, chromen-2-yl)-5-methyl- TAIL:Int-T3 400 MHz): δ ppm 8.07- phenoxy]propoxy]acetic acid 8.16 (m, 1H), 7.98- embedded image 8.05 (m, 1H), 7.89- 7.97 (m, 1H), 7.37- 7.49 (m, 1H), 7.07- 7.16 (m, 2H), 6.97- 7.06 (m, 1H), 4.16- 4.29 (m, 2H), 4.01 (s, 2H), 3.58-3.70 (m, 2H), 2.40 (s, 3H), 1.96-2.11 (m, 2H). (ESI.sup.+) [(M + H).sup.+]: 447.1. C018 2-[3-[2-(8-bromo-4-oxo- CORE:Int-25 .sup.1H NMR (DMSO-d.sub.6, chromen-2-yl)-5-chloro-4- TAIL:Int-T3 400 MHz): δ ppm 8.11- methyl- 8.16 (m, 1H), 8.01- phenoxy]propoxy]acetic acid 8.05 (m, 1H), 7.92- embedded image 7.96 (m, 1H), 7.40- 7.47 (m, 1H), 7.35- 7.39 (m, 1H), 7.06 (s, 1H), 4.22-4.28 (m, 2H), 4.00 (s, 2H), 3.58-3.66 (m, 2H), 2.37 (s, 3H), 1.99-2.09 (m, 2H). (ESI.sup.+) [(M + H).sup.+]: 481.1. C019 2-[3-[5-chloro-2-(8-chloro-4- CORE:Int-5 .sup.1H NMR (DMSO-d.sub.6, oxo-chromen-2-yl)-4-methyl- TAIL:Int-T3 400 MHz): δ ppm 7.96- phenoxy]propoxy]acetic acid 8.04 (m, 2H), 7.85- 0embedded image 7.91 (m, 1H), 7.46- 7.54 (m, 1H), 7.34- 7.39 (m, 1H), 7.00- 7 .08 (m, 1H), 4.20- 4.30 (m, 2H), 3.95- 4.04 (m, 2H), 3.59- 3.68 (m, 2H), 2.40 (s, 3H), 1.95-2.08 (m, 2H). (ESI.sup.+) [(M + H).sup.+]: 437.1.

(536) The following compounds C020 to C058 were prepared in analogy to the procedure described for the preparation of example C005. By replacing methyl 2-[2-(p-tolylsulfonyloxy)ethoxy]acetate with “Tail”, 8-chloro-2-[2-hydroxy-4-(trifluoromethyl)phenyl]chromen-4-one with “CORE” in step 1. The “Tail” and “CORE” are the reagents indicated in Table 8.

(537) TABLE-US-00011 Example Compounds Name and No. Structure CORE,TAIL, .sup.1H NMR and (ESI.sup.+) C020 2-[2-[5-bromo-2-(8-chloro-4- CORE:Int-7 .sup.1H NMR (DMSO-d.sub.6, oxo-chromen-2-yl)-4- TAIL:Int-T4 400 MHz): δ ppm methoxy- 12.56 (s, 1H), 7.94- phenoxy]ethoxy]acetic acid 8.05 (m, 2H), 7.66 (s, embedded image 1H), 7.55-7.62 (m, 1H), 7.45-7.53 (m, 1H), 7.23 (s, 1H), 4.26-4.36 (m, 2H), 4.10 (s, 2H), 3.91 (s, 3H), 3.84-3.89 (m, 2H). (ESI.sup.+) [(M + H).sup.+]: 483.1. C021 2-[2-[5-bromo-2-(8-chloro-4- CORE:Int-6 .sup.1H NMR (DMSO-d.sub.6, oxo-chromen-2-yl)-4-methyl- TAIL:Int-T4 400 MHz): δ ppm 7.99 phenoxy]ethoxy]acetic acid (br d, J = 4.28 Hz, 2H), embedded image 7.90 (s, 1H), 7.52 (d, J = 17.85 Hz, 2H), 7.16 (s, 1H), 4.31-4.37 (m, 2H), 4.09 (s, 2H), 3.83-3.93 (m, 2H), 2.38 (s, 3H). (ESI.sup.+) [(M + H).sup.+]: 467.1. C022 2-[2-[2-(8-chloro-4-oxo- CORE:Int-10 .sup.1H NMR (DMSO-d.sub.6, chromen-2-yl)-4,5- TAIL:Int-T4 400 MHz): δ ppm dimethoxy- 12.65 (br s, 1H), 7.97 phenoxy]ethoxy]acetic acid (br dd, J = 7.8, 2.8 Hz, 491 embedded image 2H), 7.59 (s, 1H), 7.46 (t, J = 7.9 Hz, 1H), 7.22 (s, 1H), 6.91 (s, 1H), 4.27-4.43 (m, 2H), 4.14 (s, 2H), 3.91 (m, 5H), 3.81 (s, 3H). . (ESI.sup.+) [(M + H).sup.+]: 435.1. C023 2-[2-[2-(8-chloro-4-oxo- CORE:Int-9 .sup.1H NMR (DMSO-d.sub.6, chromen-2-yl)-5- TAIL:Int-T4 400 MHz): δ ppm (trifluoromethoxy)phenoxy] 12.51 (s, 1H), 8.07- ethoxy]acetic acid 8.13 (m, 1H), 7.95- embedded image 8.04 (m, 2H), 7.45- 7.56 (m, 1H), 7.30- 7.36 (m, 1H), 7.22- 7.28 (m, 1H), 7.15- 7.19 (m, 1H), 4.32- 4.42 (m, 2H), 4.10 (s, 2H), 3.84-3.94 (m, 2H). (ESI.sup.+) [(M + H).sup.+]: 459.1. C024 2-[3-[2-(8-chloro-4-oxo- CORE:Int-1 .sup.1H NMR (DMSO-d.sub.6, chromen-2-yl)-5- TAIL:Int-T8 400 MHz): δ ppm 8.08- (trifluoromethyl)phenoxy] 8.16 (m, 1H), 8.02 (d, butoxy]acetic acid 2H, J = 7.8 Hz), 7.47- embedded image 7.62 (m, 3H), 7.07 (s, 1H), 4.99 (td, 1H, J = 5.7, 11.5 Hz), 3.96 (s, 2H), 1.75-2.05 (m, 2H), 1.31-1.41 (m, 3H), 1.07-1.20 (m, 2H). (ESI.sup.+) [(M + H).sup.+]:471.3.

(538) The following compounds C025 to C024 were prepared in analogy to the procedure described for the preparation of example C003-A and C003-B. By replacing methyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate (Int-T1) with “Tail”, 2-(4-bromo-2-hydroxy-phenyl)-8-chloro-chromen-4-one (Int-4) with “CORE” in step 1. The “CORE” and “Tail” are the reagents indicated in Table 9.

(539) TABLE-US-00012 TABLE 9 Compounds synthesis and characterization Example Compounds Name and No. Structure CORE,TAIL .sup.1H NMR and (ESI.sup.+) C025-A Cis-3-[2-[2-(8-chloro-4-oxo- CORE:Int-3 .sup.1H NMR (DMSO-d.sub.6, chromen-2- TAIL:Int-T1 400 MHz): δ ppm yl)phenoxy]ethoxy]cyclobutane- 12.08 (br s, 1H), 7.97- carboxylic acid 8.04 (m, 3H), 7.59 (br embedded image t, J = 7.9 Hz, 1H), 7.49 (t, J = 7.9 Hz, 1H), 7.18-7.31 (m, 3H), 4.22-4.34 (m, 2H), 3.95 (quin, J = 7.3 Hz, 1H), 3.68-3.76 (m, 2H), 2.37-2.59 (m, 3H), 1.93-2.05 (m, 2H). (ESI.sup.+) [(M + H).sup.+]: 415.1. C025-B Trans-3-[2-[2-(8-chloro-4- CORE:Int-3 .sup.1H NMR (DMSO-d.sub.6, oxo-chromen-2- TAIL:Int-T1 400 MHz): δ ppm yl)phenoxy]ethoxy]cyclobutane- 12.06 (br s, 1H), 7.9 carboxylic acid 8.03 (m, 3H), 7.59 embedded image (ddd, J = 8.5, 7.2, 1.7 Hz, 1H), 7.50 (t, J = 7.9 Hz, 1H), 7.18-7.30 (m, 3H), 4.24-4.31 (m, 2H), 3.89-4.01 (m, 1H), 3.66-3.76 (m, 2H), 3.40 (br d, J = 3.8 Hz, 1H), 2.36-2.48 (m, 2H), 1.94-2.03 (m, 2H). (ESI.sup.+) [(M + H).sup.+]: 415.3. C026 Cis-3- [2-[2-(8-chloro-4-oxo- CORE:Int-1 .sup.1H NMR (DMSO-d.sub.6, chromen-2-yl)-5- TAIL:Int-T1 400 MHz): δ ppm 8.17 (trifluoromethyl)phenoxy] 8.26 (m, 1H), 7.99- ethoxy]cyclobutanecarboxylic 8.07 (m, 2H), 7.49- acid 7.64 (m, 3H), 7.37 (s, embedded image 1H), 4.32-4.45 (m, 2H), 4.18 (quin, J = 6.7 Hz, 1H), 3.64-3.73 (m, 2H), 2.82-3.06 (m, 1H), 2.31-2.47 (m, 2H), 2.10-2.26 (m, 2H).. (ESI.sup.+) [(M + H).sup.+]: 483.2. C027 Trans-3-2-[[5-bromo-2-(8- CORE:Int-26 .sup.1H NMR (DMSO-d.sub.6, chloro-4-oxo-chromen-2-yl)- TAIL:Int-T1 400 MHz): δ ppm 8.15 3- (br dd, J = 7.9, 1.6 Hz, pyridyl]oxy]ethoxy] 1H), 7.79 (br dd, J = cyclobutanecarboxylic 7.8, 1.5 Hz, 2H), 7.28- acid 7.45 (m, 2H), 7.00 (s, embedded image 1H), 4.24-4.50 (m, 2H), 4.22 (br s, 1H), 3.72-3.83 (m, 2H), 3.28 (s, 1H), 2.55 (br dd, J = 11.7, 6.4 Hz, 2H), 2.21-2.34 (m, 2H). (ESI.sup.+) [(M + H).sup.+]: 496.0. C028 Cis-3-[2-[5-bromo-2-(8- CORE:Int-37 .sup.1H NMR (DMSO-d.sub.6, chloro-6-fluoro-4-oxo- TAIL:Int-T1 400 MHz): δ ppm chromen-2- 12.10 (br s, 1H), 8.11 yl)phenoxy]ethoxy] (dd, J = 8.2, 3.1 Hz, cyclobutanecarboxylic 1H), 7.89 (d, J = 8.6 acid Hz, 1H), 7.71 (dd, J = 0embedded image 8.1, 3.1 Hz, 1H), 7.52 (d, J = 1.7 Hz, 1H), 7.43 (dd, J = 8.4, 1.7 Hz, 1H), 7.22 (s, 1H), 4.27-4.37 (m, 2H), 3.94 (quin, J = 7.4 Hz, 1H), 3.66-3.73 (m, 2H), 2.52-2.57 (m, 1H), 2.37-2.48 (m, 2H), 1.93-2.03 (m, 2H). (ESI.sup.+) [(M + H).sup.+]: 513.1. C029-A Cis-3-[2-[2-(8-chloro-7- CORE:Int-38 .sup.1H NMR (DMSO-d.sub.6, methyl-4-oxo-chromen-2- TAIL:Int-T1 400 MHz): δ ppm 8.02 yl)phenoxy]ethoxy] (br d, J = 7.6 Hz, 1H), cyclobutanecarboxylic 7.90 (d, J = 8.1 Hz, acid 1H), 7.58 (br t, J = 7.5 embedded image Hz, 1H), 7.49 (d, J = 8.1 Hz, 1H), 7.16-7.31 (m, 3H), 4.13-4.40 (m, 2H), 3.95 (dt, J = 14.7, 7.4 Hz, 1H), 3.65-3.77 (m, 2H), 2.52-2.58 (m, 3H), 2.36-2.48 (m, 3H), 1.77-2.04 (m, 2H). (ESI.sup.+) [(M + H).sup.+]: 429.1. C029-B Trans-3-[2-[2-(8-chloro-7- CORE:Int-38 .sup.1H NMR (DMSO-d.sub.6, methyl-4-oxo-chromen-2- TAIL:Int-T1 400 MHz): δ ppm yl)phenoxy]ethoxy]cyclobutane- 12.15 (s, 1H),8.03 (dt, carboxylic acid J = 10.0, 5.0 Hz, 1H), embedded image 7.89 (d, J = 8.1 Hz, 1H), 7.53-7.61 (m, 1H), 7.47 (d, J = 8.2 Hz, 1H), 7.33 (s, 1H), 7.16-7.29 (m, 2H), 4.24-4.36 (m, 2H), 4.17 (dd, J = 13.6, 6.8 Hz, 1H), 3.56-3.77 (m, 2H), 2.95 (ddd, J = 13.9, 9.9, 3.8 Hz, 1H), 2.52 (s, 3H), 2.38 (ddd, J = 13.0, 6.8, 3.6 Hz, 2H), 2.16-2.27 (m, 2H). (ESI.sup.+) [(M + H).sup.+]: 429.1. C030-A Cis-3-[2-[5-bromo-2-(8- CORE:Int-39 .sup.1H NMR (DMSO-d.sub.6, chloro-7-fluoro-4-oxo- TAIL:Int-T1 400 MHz): δ ppm 8.16 chromen-2- (br dd, J = 8.9, 6.0 Hz, yl)phenoxy]ethoxy] 2H), 7.87-8.06 (m, cyclobutanecarboxylic 1H), 7.40 (s, 1H), acid 7.28-7.36 (m, 1H), embedded image 7.11-7.25 (m, 1H), 4.19-4.37 (m, 2H), 4.08 (dt, J = 12.5, 6.3 Hz, 1H), 3.70-3.88 (m, 2H), 2.83 (dt, J = 16.3, 8.3 Hz, 1H), 2.48-2.70 (m, 2H), 2.27-2.47 (m, 2H). (ESI.sup.+) [(M + H).sup.+]: 513.0. C030-B Trans-3-[2-[5-bromo-2-(8- CORE:Int-39 .sup.1NMR (DMSO-d.sub.6, chloro-7-fluoro-4-oxo- TAIL:Int-T1 400 MHz): δ ppm 8.15 chromen-2- (dd, J = 8.9, 6.0 Hz, yl)phenoxy]ethoxy] 1H), 7.98 (d, J = 8.6 cyclobutanecarboxylic Hz, 1H), 7.45 (s, 1H), acid 7.19-7.35 (m, 3H), embedded image 4.20-4.35 (m, 2H), 3.71-3.93 (m, 2H), 3.30-3.42 (m, 1H), 2.51-2.71 (m, 2H), 2.39 (ddd, J = 12.7, 9.7, 5.3 Hz, 2H), 1.26 (m, 1H). (ESI.sup.+) [(M + H).sup.+]: 513.0. C031-A Cis-3-[2-[5-bromo-2-(8- CORE:Int-6 .sup.1NMR (DMSO-d.sub.6, chloro-4-oxo-chromen-2-yl)- TAIL:Int-T1 400 MHz): δ ppm 7.94- 4-methyl- 8.03 (m, 2H), 7.83- phenoxy]ethoxy] 7.91 (m, 1H), 7.41- cyclobutanecarboxylic 7.53 (m, 2H), 7.13- acid 7.20 (m, 1H), 4.23- embedded image 4.31 (m, 2H), 3.86- 4.00 (m, 1H), 3.60- 3.74 (m,3H), 2.38-2.45 (m, 5H), 1.90-2.03 (m, 2H). (ESI.sup.+) [(M + H).sup.+]: 507.1. C032-A Cis-3-[2-[4-bromo-2-(8- CORE:Int-40 .sup.+NMR (DMSO-d.sub.6, chloro-4-oxo-chromen-2-yl)- TAIL:Int-T1 400 MHz): δ ppm 5-fluoro- 12.03 (s, 1H), 8.21 (t, J = phenoxy]ethoxy] 8.0 Hz, 1H), 7.98- cyclobutanecarboxylic 8.03 (m, 2H), 7.45- acid 7.52 (m, 2H), 7.16 (s, embedded image 1H), 4.30-4.32 (m, 2H), 3.89-3.95 (m, 1H), 3.69-3.71 (m, 2H), 2.36-2.50 (m, 3H), 1.93-2.01 (m, 2H). (ESI.sup.+) [(M + H).sup.+]: 511.0. C033-A Cis-3-[2-[2-(8-chloro-4-oxo- CORE:Int-41 .sup.1H NMR (DMSO-d.sub.6, chromen-2-yl)-4-fluoro- TAIL:Int-T1 400 MHz): δ ppm phenoxy]ethoxy] 11.96 (br s, 1H), 8.01 cyclobutanecarboxylic (td, J = 7.6, 1.5 Hz, acid 2H), 7.76 (dd, J = 9.7, embedded image 3.2 Hz, 1H), 7.42-7.56 (m, 2H), 7.33 (dd, J = 9.2, 4.6 Hz, 1H), 7.28 (s, 1H), 4.23-4.31 (m, 2H), 3.94 (quin, J = 7.3 Hz, 1H), 3.66-3.75 (m, 2H), 3.29-3.31 (m, 1H), 2.33-2.47 (m, 2H), 1.93-2.04 (m, 2H). (ESI.sup.+) [(M + H).sup.+]: 433.1. C033-B Trans-3- [2-[2-(8-chloro-4- CORE:Int-41 .sup.1NMR (DMSO-d.sub.6, oxo-chromen-2-yl)-4-fluoro- TAIL:Int-T1 400 MHz): δ ppm phenoxy]ethoxy] 12.12 (br s, 1H), 7.92- cyclobutanecarboxylic 8.12 (m, 2H), 7.77 (br acid dd, J = 9.5, 3.1 Hz, embedded image 1H), 7.37-7.56 (m, 3H), 7.32 (br dd, J = 9.1, 4.5 Hz, 1H), 4.27 (br s, 2H), 4.12-4.23 (m, 1H), 3.68 (br s, 2H), 2.87-3.04 (m, 1H), 2.31-2.45 (m, 2H), 2.12-2.30 (m, 2H). (ESI.sup.+) [(M + H).sup.+]: 433.1. C034-A Cis-3-[2-[2-(8-chloro-4-oxo- CORE:Int-42 .sup.1H NMR (DMSO-d.sub.6, chromen-2-yl)-5-fluoro- TAIL:Int-T1 400 MHz): δ ppm phenoxy]ethoxy] 12.12 (br s, 1H), 7.96- cyclobutanecarboxylic acid 8.07 (m, 3H), 7.49 (t, J = embedded image 7.9 Hz, 1H), 7.17- 7.25 (m, 2H), 7.08 (td, J = 8.4, 2.4 Hz, 1H), 4.26-4.34 (m, 2H), 3.82-4.09 (m, 1H), 3.54-3.77 (m, 2H), 2.53-2.58 (m, 1H), 2.37-2.49 (m, 2H), 1.94-2.08 (m, 2H). (ESI.sup.+) [(M + H).sup.+]: 433.2. C034-B Trans-3-[2-[2-(8-chloro-4- CORE:Int-42 .sup.1H NMR (DMSO-d.sub.6, oxo-chromen-2-yl)-5-fluoro- TAIL:Int-T1 400 MHz): δ ppm 7.95- phenoxy]ethoxy] 8.01 (m, 2H), 7.47 (t, J = cyclobutanecarboxylic 7.9 Hz, 1H), 7.19 (s, acid 1H), 6.75-6.82 (m, 0embedded image 2H), 4.23-4.33 (m, 2H), 4.16 (q, J = 6.9 Hz, 1H), 3.97 (quin, J = 7.2 Hz, 1H), 3.67- 3.78 (m, 2H),2.36-2.47 (m, 2H), 1.94-2.08 (m, 2H). (ESI.sup.+) [(M + H).sup.+]: 433.2. C035-A Cis-3-[2-[2-(8-chloro-4-oxo- CORE:Int-43 .sup.1H NMR (DMSO-d.sub.6, chromen-2-yl)-5-ethoxy- TAIL:Int-T1 400 MHz): δ ppm 7.95- phenoxy]ethoxy] 8.01 (m, 3H), 7.47 (t, J = cyclobutanecarboxylic 7.9 Hz, 1H), 7.19 (s, acid 1H), 6.75-6.82 (m, embedded image 2H), 4.23-4.33 (m, 2H), 4.16 (q, J = 6.9 Hz, 2H), 3.97 (quin, J = 7.2 Hz, 1H), 3.67- 3.78 (m, 2H), 2.54- 2.64 (m, 1H), 2.36- 2.47 (m, 2H), 1.94- 2.08 (m, 2H), 1.37 (t, J = 7.0 Hz, 3H). (ESI.sup.+) [(M + H).sup.+]: 459.3. C035-B Trans-3-[2-[2-(8-chloro-4- CORE:Int-43 .sup.‘H NMR (DMSO-d.sub.6, oxo-chromen-2-yl)-5-ethoxy- TAIL:Int-T1 400 MHz): δ ppm 7.96- phenoxy]ethoxy] 8.03 (m, 3H), 7.47 (t, J = cyclobutanecarboxylic 7.9 Hz, 1H), 7.32 (s, acid 1H), 6.76-6.83 (m, embedded image 2H), 4.25-4.32 (m, 2H), 4.09-4.24 (m, 3H), 3.64-3.73 (m, 2H), 2.93-3.01 (m, 1H), 2.35-2.47 (m, 2H), 2.18-2.32 (m, 2H), 1.37 (t, J = 7.0 Hz, 3H). (ESI.sup.+) [(M + H).sup.+]: 459.2. C036-A Cis-3-[2-[2-(8-chloro-6- CORE:Int-44 .sup.1NMR (DMSO-d.sub.6, fluoro-4-oxo-chromen-2- TAIL:Int-T1 400 MHz): δ ppm yl)phenoxy]ethoxy] 12.10 (br s, 1H), 8.11 cyclobutanecarboxylic (dd, J = 8.2, 3.1 Hz, acid 1H), 7.99 (dd, J = 7.9, embedded image 1.7 Hz, 1H), 7.72 (dd, J = 8.1, 3.1 Hz, 1H), 7.59 (ddd, J = 8.5, 7.2, 1.8 Hz, 1H), 7.18-7.31 (m, 3H), 4.17-4.38 (m, 2H), 3.82-4.08 (m, 1H), 3.48-3.75 (m, 2H), 2.53-2.62 (m, 1H), 2.37-2.49 (m, 2H), 1.94-2.03 (m, 2H). (ESI.sup.+) [(M + H).sup.+]: 433.1. C036-B Trans-3-[2-[2-(8-chloro-6- CORE:Int-44 .sup.1H NMR (DMSO-d.sub.6, fluoro-4-oxo-chromen-2- TAIL:Int-T1 400 MHz): δ ppm yl)phenoxy]ethoxy] 12.16 (br s, 1H), 8.09 cyclobutanecarboxylic (dd, J = 8.2, 3.1 Hz, acid 1H), 8.01 (dd, J = 7.9, embedded image 1.7 Hz, 1H), 7.71 (dd, J = 8.1, 3.1 Hz, 1H), 7.58 (ddd, J = 8.5, 7.2, 1.7 Hz, 1H), 7.37 (s, 1H), 7.27 (d, J = 8.1 Hz, 1H), 7.20 (t, J = 7.3 Hz, 1H), 4.14-4.32 (m, 3H), 3.65-3.73 (m, 2H), 2.88-3.02 (m, 1H), 2.38 (qd, J = 6.6, 3.8 Hz, 2H), 2.17- 2.29 (m, 2H). (ESI.sup.+) [(M + H).sup.+]: 433.1. C037-A Cis-3-[2-[2-(8-chloro-4-oxo- CORE:Int-45 .sup.1H NMR (DMSO-d.sub.6, chromen-2-yl)-6-fluoro- TAIL:Int-T1 400 MHz): δ ppm 7.99- phenoxy]ethoxy] 8.16 (m, 2H), 7.74 (br cyclobutanecarboxylic d, J = 7.6 Hz, 1H), acid 7.44-7.66 (m, 2H), embedded image 7.36 (td, J = 8.1, 5.3 Hz, 1H), 7.09 (s, 1H), 4.27 (br s, 2H), 3.64- 3.88 (m, 1H), 3.41- 3.63 (m, 2H), 2.37- 2.48 (m, 1H), 2.15- 2.30 (m, 2H),1.78-1.99 (m, 2H). (ESI.sup.+) [(M + H).sup.+]: 433.0. C037-B Trans-3-[2-[2-(8-chloro-4- CORE:Int-45 .sup.1H NMR (DMSO-d.sub.6, oxo-chromen-2-yl)-6-fluoro- TAIL:Int-T1 400 MHz): δ ppm 8.01- phenoxy]ethoxy] 8.25 (m, 2H), 7.63- cyclobutanecarboxylic 7.88 (m, 1H), 7.45- acid 7.63 (m, 2H), 7.24- embedded image 7.44 (m, 1H), 7.14 (s, 1H), 4.26-4.42 (m, 2H), 3.86-4.15 (m, 1H), 3.44-3.56 (m, 2H), 2.55-2.80 (m, 1H), 2.08-2.28 (m, 2H), 1.89-2.06 (m, 2H).MS obsd. (ESI.sup.+) [(M + H).sup.+]: 433.0. C038-A Cis-3-[2-[2-(8-chloro-4-oxo- CORE:Int-2 .sup.1H NMR (DMSO-d.sub.6, chromen-2-yl)-5-methyl- TAIL:Int-T1 400 MHz): δ ppm phenoxy]ethoxy] 11.98-12.25 (m, 1H), cyclobutane- 7.89-8.05 (m, 3H), carboxylic acid 7.48 (t, J = 7.9 Hz, embedded image 1H), 7.35 (s, 1H), 7.12 (s, 1H), 7.03 (d, J = 8.1 Hz, 1H), 4.23-4.32 (m, 2H), 4.15-4.23 (m, 1H), 3.66-3.72 (m, 2H), 2.88-2.99 (m, 1H), 2.36-2.45 (m, 5H), 2.15-2.27 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 429.1. C038-B Trans-3-[2-[2-(8-chloro-4- CORE:Int-2 .sup.1NMR (DMSO-d.sub.6, oxo-chromen-2-yl)-5-methyl- TAIL:Int-T1 400 MHz): δ ppm phenoxy]ethoxy] 12.02-12.21 (m, 1H), cyclobutanecarboxylic 7.99 (d, J = 7.8 Hz, acid 2H), 7.89-7.95 (m, embedded image 1H), 7.48(t, J = 7.8 Hz, 1H), 7.20-7.25 (m, 1H), 7.12 (s, 1H), 7.03 (d, J = 7.9 Hz, 1H), 4.21-4.29 (m, 2H), 3.92-3.99 (m, 1H), 3.69-3.75 (m, 2H), 2.42 (s, 3H), 1.91-2.06 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 429.1. C039-A Cis-3-[2-[2-(8-chloro-4-oxo- CORE:Int-13 .sup.1H NMR (DMSO-d.sub.6, chromen-2-yl)-5-methoxy- TAIL:Int-T1 400 MHz): δ ppm 7.97 phenoxy]ethoxy] (d, J = 7.82 Hz, 3H), cyclobutanecarboxylic 7.42-7.54 (m, 1H), acid 7.19 (s, 1H), 6.76-6.87 embedded image (m, 2H), 4.21-4.34 (m, 2H), 3.92-4.01 (m, 1H), 3.87 (s, 3H), 3.69-3.77 (m, 2H), 2.52-2.56 (m, 1H), 2.38-2.48 (m, 2H), 1.95-2.06 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 445.1. C039-B Trans-3-[2-[2-(8-chloro-4- CORE:Int-13 .sup.1H NMR (DMSO-d.sub.6, oxo-chromen-2-yl)-5- TAIL:Int-T1 400 MHz): δ ppm methoxy- 12.23 (s, 1H), 7.93- phenoxy]ethoxy] 8.08 (m, 3H), 7.39- cyclobutanecarboxylic 7.51 (m, 1H), 7.30- acid 7.36 (m, 1H), 6.73- 0embedded image 6.86 (m, 2H), 4.26- 4.33 (m, 2H), 4.14- 4.24 (m, 1H), 3.87 (s, 3H), 3.65-3.73 (m, 2H), 2.88-3.03 (m, 1H), 2.36-2.44 (m, 2H), 2.18-2.29 (m, 2H). (ESI.sup.+) [(M + H).sup.+]: 445.1. C040-A Cis-3- [2-[4-bromo-2-(8- CORE:Int-34 .sup.1H NMR (DMSO-d.sub.6, chloro-4-oxo-chromen-2-yl)- TAIL:Int-T1 400 MHz): δ ppm 5-methoxy- 12.05 (s, 1H), 8.14 (s, phenoxy]ethoxy] 1H), 7.92-8.02 (m, cyclobutanecarboxylic 2H), 7.43-7.52 (m, acid 1H), 7.19 (s, 1H), embedded image 6.88-7.00 (m, 1H), 4.30-4.42 (m, 2H), 3.85-3.99 (m, 4H), 3.65-3.81 (m, 2H), 2.53-2.58 (m, 1H), 2.39-2.48 (m, 2H), 1.96-2.06 (m, 2H). (ESI.sup.+) [(M + H).sup.+]: 523.1. C040-B Trans-3-[2-[4-bromo-2-(8- CORE:Int-34 .sup.1H NMR (DMSO-d.sub.6, chloro-4-oxo-chromen-2-yl)- TAIL:Int-T1 400 MHz): δ ppm 8.16 5-methoxy- (s, 1H), 7.91-8.03 (m, phenoxy]ethoxy] 2H), 7.42-7.54 (m, cyclobutanecarboxylic 1H), 7.32 (s, 1H), acid 6.88-7.01 (m, 1H), embedded image 4.33-4.43 (m, 2H), 4.11-4.25 (m, 1H), 3.99 (s, 3H), 3.67-3.76 (m, 2H), 2.88-3.02 (m, 1H), 2.35-2.45 (m, 2H), 2.16-2.28 (m, 2H). (ESI.sup.+) [(M + H).sup.+]: 523.1. C041-A Cis-3-[2-[2-(8-chloro-4-oxo- CORE:Int-12 .sup.1H NMR (DMSO-d.sub.6, chromen-2-yl)-5-methoxy-4- TAIL:Int-Tl 400 MHz): δ ppm methyl- 12.04 (s, 1H), 7.94- phenoxy]ethoxy] 8.01 (m, 2H), 7.74- cyclobutanecarboxylic 7.82 (m, 1H), 7.43- acid 7.50 (m, 1H), 7.17- embedded image 7.21 (m, 1H), 6.78- 6.85 (m, 1H), 4.29- 4.36 (m, 2H), 3.95- 4.02 (m, 1H), 3.92 (s, 3H), 3.70-3.76 (m, 2H), 2.52-2.56 (m, 1H), 2.38-2.47 (m, 2H), 2.17 (s, 3H), 1.95-2.06 (m, 2H). (ESI.sup.+) [(M + H).sup.+]: 459.1. C041-B Trans-3-[2-[2-(8-chloro-4- CORE:Int-12 .sup.1H NMR (DMSO-d.sub.6, oxo-chromen-2-yl)-5- TAIL:Int-T1 400 MHz): δ ppm 7.97 methoxy-4-methyl- (d, J = 7.95 Hz, 2H), phenoxy]ethoxy] 7.77-7.86 (m, 1H), cyclobutanecarboxylic 7.41-7.51 (m, 1H), acid 7.28-7.37 (m, 1H), embedded image 6.78-6.85 (m, 1H), 4.29-4.36 (m, 2H), 4.11-4.24 (m, 1H), 3.92 (s, 3H), 3.66-3.75 (m, 2H), 2.88-3.04 (m, 1H), 2.35-2.44 (m, 2H), 2.19-2.28 (m, 2H), 2.18 (s, 3H) . (ESI.sup.+) [(M + H)]: 459.1. C042-A Cis-3-[2-[5-bromo-2-(8- CORE:Int-27 .sup.1H NMR (DMSO-d.sub.6, chloro-4-oxo-chromen-2-yl)- TAIL:Int-T1 400 MHz): δ ppm 8.36 4- (s, 1H), 8.00 (td, J = (trifluoromethybphenoxy] 8.1, 1.6 Hz, 2H), 7.81 ethoxy]cyclobutane- (s, 1H), 7.50 (t, J = 7.9 carboxylic acid Hz, 1H), 7.23 (s, 1H), embedded image 4.40-4.47 (m, 2H), 3.92 (quin, J = 7.2 Hz, 1H), 3.66-3.77 (m, 2H), 2.25-2.47 (m, 3H), 1.90-2.08 (m, 2H). (ESI.sup.+) [(M + H).sup.+]: 561.0. C042-B Trans-3-[2-[5-bromo-2-(8- CORE:Int-27 .sup.1H NMR (DMSO-d.sub.6, chloro-4-oxo-chromen-2-yl)- TAIL:Int-T1 400 MHz): δ ppm 4- 12.18 (br s, 1H), 8.40 (trifluoromethybphenoxy] (s, 1H), 7.97-8.07 (m, ethoxy]cyclobutanecarboxylic 2H), 7.82 (s, 1H), acid 7.47-7.56 (m, 1H), embedded image 7.37 (s, 1H), 4.45 (br s, 2H), 4.19 (quin, J = 6.8 Hz, 1H), 3.71 (br d, J = 3.9 Hz, 2H), 2.88-3.01 (m, 1H), 2.34-2.45 (m, 2H), 2.15-2.32 (m, 2H).MS obsd. (ESI.sup.+) [(M + H).sup.+]: 561.0. C043-A Cis-3-[2-[[6-(8-chloro-4-oxo- CORE:Int-11 .sup.1H NMR (DMSO-d.sub.6, chromen-2-yl)-1,3- TAIL:Int-T112.10 400 MHz): δ ppm benzodioxo1-5- (br s, 1H), 7.98 yl]oxy]ethoxy] (d, J = 1.7 Hz, 1H), cyclobutanecarboxylic 7.96 (d, J = 2.1 Hz, acid 1H), 7.44-7.50 (m, embedded image 2H), 7.18 (s, 1H), 7.07 (s, 1H), 6.14 (s, 2H), 4.19-4.28 (m, 2H), 3.88-4.07 (m, 1H), 3.64-3.72 (m, 2H), 2.53-2.66 (m, 3H), 2.36-2.48 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 459.1. C043-B Trans-3-[2-[[6-(8-chloro-4- CORE:Int-11 .sup.1H NMR (DMSO-d.sub.6, oxo-chromen-2-yl)-1,3- TAIL:Int-T1 400 MHz): δ ppm benzodioxo1-5- 12.09 (br s, 1H), 7.98 yl]oxy]ethoxy]cyclobutane (d, J = 7.9 Hz, 2H), carboxylic acid 7.44-7.52 (m, 2H), embedded image 7.31 (s, 1H), 7.07 (s, 1H), 6.14 (s, 2H), 4.13-4.30 (m, 3H), 3.61-3.70 (m, 2H), 2.90-2.99 (m, 1H), 2.32-2.46 (m, 2H), 2.16-2.29 (m, 2H).MS obsd. (ESI.sup.+) [(M + H).sup.+]: 459.1. C044-A Cis-3-[2-[5-bromo-2-(8- CORE:Int-46 .sup.1NMR (DMSO-d.sub.6, chloro-4-oxo-chromen-2-yl)- TAIL:Int-T1 400 MHz): δ ppm 4-fluoro- 12.10 (br s, 1H), 8.00 phenoxy]ethoxy] (ddd, J = 9.8, 8.1, 1.5 cyclobutanecarboxylic Hz, 2H), 7.86 (d, J = acid 9.5 Hz, 1H), 7.67 (d, J = embedded image 5.7 Hz, 1H), 7.50 (t, J = 7.9 Hz, 1H), 7.25 (s, 1H), 4.27-4.37 (m, 2H), 3.81-4.07 (m, 1H), 3.66-3.73 (m, 2H), 2.67 (br s, 1H), 2.33-2.47 (m, 2H), 1.93-2.03 (m, 2H).MS obsd. (ESI.sup.+) [(M + H).sup.+]: 511.0. C044-B Trans- 3-[2-[5-bromo-2-(8- CORE:Int-46 .sup.1H NMR (DMSO-d.sub.6, chloro-4-oxo-chromen-2-yl)- TAIL:Int-T1 400 MHz): δ ppm 4-fluoro- 12.18 (br s, 1H), 7.99 phenoxy]ethoxy] (m, 2H), 7.85 (d, J = cyclobutanecarboxylic 9.5 Hz, 1H), 7.64 (d, J = acid 5.7 Hz, 1H), 7.49 0embedded image (m, 1H), 7.37 (s, 1H), 4.24-4.34 (m, 3H), 3.66 (m, 1H), 2.95 (m, 2H), 2.33-2.03 (m, 4H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 510.9. C045-A Cis-3-[2-[2-(8-chloro-6- CORE:Int-47 .sup.1 H NMR (DMSO-d.sub.6, fluoro-4-oxo-chromen-2-yl)- TAIL:Int-T1 400 MHz): δ ppm 8.11 5-fluoro- (dd, J = 8.1, 3.1 Hz, phenoxy]ethoxy] 1H), 8.03 (dd, J = 8.9, cyclobutanecarboxylic 6.8 Hz, 1H), 7.71 (dd, acid J = 8.1, 3.1 Hz, 1H), embedded image 7.23 (dd, J = 11.4, 2.3 Hz, 1H), 7.18 (s, 1H), 7.08 (td, J = 8.4, 2.4 Hz, 1H), 4.21-4.37 (m, 2H), 3.81-4.03 (m, 1H), 3.47-3.75 (m, 2H), 2.52-2.60 (m, 1H), 2.33-2.47 (m, 2H), 1.93-2.03 (m, 2H).MS obsd. (ESI.sup.+) [(M + H).sup.+]: 451.3. C045-B Trans-3-[2-[2-(8-chloro-6- CORE:Int-47 .sup.1H NMR (DMSO-d.sub.6, fluoro-4-oxo-chromen-2-yl)- TAIL:Int-T1 400 MHz): δ ppm 8.10 5-fluoro- (dd, J = 8.1, 3.0 Hz, phenoxy]ethoxy] 1H), 8.04 (dd, J = 8.9, cyclobutanecarboxylic 6.8 Hz, 1H), 7.71 (dd, acid J = 7.9, 3.1 Hz, 1H), embedded image 7.31 (s, 1H), 7.22 (dd, J = 11.3, 2.4 Hz, 1H), 7.07 (td, J = 8.4, 2.4 Hz, 1H), 4.25-4.35 (m, 2H), 4.18 (quin, J = 6.7 Hz, 1H), 3.52-3.78 (m, 2H), 2.82-3.08 (m, 1H), 2.30-2.47 (m, 2H), 2.16-2.26 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 451.3. C046-A Cis-3-[2-[2-(8-bromo-4-oxo- CORE:Int-28 .sup.1H NMR (DMSO-d.sub.6, chromen-2- TAIL:Int-T 400 MHz): δ ppm yl)phenoxy]ethoxy] 11.92-12.18 (m, 1H), cyclobutanecarboxylic 8.14 (dd, J = 7.7, 1.5 acid Hz, 1H), 8.05 (td, J = embedded image 8.4, 1.6 Hz, 2H), 7.56- 7.63 (m, 1H), 7.43 (t, J = 7.8 Hz, 1H), 7.18- 7.32 (m, 3H), 4.23- 4.34 (m, 2H), 3.95 (quin, J = 7.3 Hz, 1H), 3.67-3.78 (m, 2H), 2.45-2.48 (m, 1H), 2.36-2.44 (m, 2H), 1.91-2.03 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 459.1. C046-B Trans-3-[2-[2-(8-bromo-4- CORE:Int-28 .sup.1H NMR (DMSO-d.sub.6, oxo-chromen-2- TAIL:Int-T1 400 MHz): δ ppm yl)phenoxy]ethoxy] 12.01-12.28 (m, 1H), cyclobutanecarboxylic 7.99-8.16 (m, 3H), acid 7.55-7.63 (m, 1H), embedded image 7.41-7.47 (m, 1H), 7.38 (s, 1H), 7.18-7.33 (m, 2H), 4.23-4.33 (m, 2H), 4.14-4.23 (m, 1H), 3.66-3.73 (m, 2H), 2.90-2.99 (m, 1H), 2.33-2.43 (m, 2H), 2.15-2.27 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 459.1. C047-A Cis-3-[2-[2-[4-oxo-8- CORE:Int-48 .sup.1H NMR (DMSO-d.sub.6, (trifluoromethyl)chromen-2- TAIL:Int-T1 400 MHz): δ ppm 8.34 yl]phenoxy]ethoxy] (dd, J = 7.9, 1.2 Hz, cyclobutanecarboxylic 1H), 8.22 (d, J = 7.5 acid Hz, 1H), 7.89 (dd, J = embedded image 7.9, 1.7 Hz, 1H), 7.66 (t, J = 7.8 Hz, 1H), 7.57-7.63 (m, 1H), 7.26-7.34 (m, 2H), 7.22 (t, J = 7.6 Hz, 1H), 4.26-4.31 (m, 2H), 3.90-4.01 (m, 1H), 3.69-3.75 (m, 2H), 2.50-2.58 (m, 1H), 2.37-2.45 (m, 2H), 1.95-2.05 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 449.2. C047-B Trans-3-[2-[2-[4-oxo-8- CORE:Int-48 .sup.1H NMR (DMSO-d.sub.6, (trifluoromethyl)chromen-2- TAIL:Int-T1 400 MHz): δ ppm yl]phenoxy]ethoxy] 12.00-12.37 (m, 1H), cyclobutanecarboxylic 8.35 (dd, J = 7.9, 1.0 acid Hz, 1H), 8.22 (d, J = embedded image 7.6 Hz, 1H), 7.91 (dd, J = 7.9, 1.7 Hz, 1H), 7.54-7.71 (m, 2H), 7.42 (s, 1H), 7.22 (t, J = 7.6 Hz, 2H), 4.27- 4.34 (m, 2H), 4.15- 4.22 (m, 1H), 3.69 (dd, J = 5.1, 3.5 Hz, 2H), 2.90-2.99 (m, 1H), 2.33-2.43 (m, 2H), 2.16-2.27 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 449.2. C048-A Cis-3-[2-[5-bromo-2-[8- CORE:Int-49 .sup.1H NMR (DMSO-d.sub.6, chloro-4-oxo-7- TAIL:Int-T1 400 MHz): δ ppm (trifluoromethyl)chromen-2- 12.12 (br s, 1H), 7.98- yl]phenoxy]ethoxy] 8.23 (m, 1H), 7.53- cyclobutanecarboxylic 7.78 (m, 2H), 7.36 (s, acid 1H), 7.09-7.32 (m, embedded image 2H), 4.28 (brs, 2H), 4.04 (s, 1H), 3.69 (brs, 2H), 2.54-2.60 (m, 1H), 2.31-2.47 (m, 2H), 2.22 (brs, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 561.0. C048-B Trans-3-[2-[5-bromo-2-[8- CORE:Int-49 .sup.1H NMR (DMSO-d.sub.6, chloro-4-oxo-7- TAIL:Int-T1 400 MHz): δ ppm (trifluoromethyl)chromen-2- 12.12 (brs, 1 H), 7.98- yl]phenoxy]ethoxy] 8.23 (m, 1H), 7.53- cyclobutanecarboxylic 7.78 (m, 2H), 7.36 (s, acid 1H), 7.09-7.32 (m, embedded image 2H), 4.28 (brs, 2H), 4.11-4.24 (m, 1H), 3.69 (brs, 2H), 2.96 (m, 1H), 2.31-2.47 (m, 2H), 2.22 (brs, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 561.0. C049-A Cis-3-[2-[5-bromo-2-[8- CORE:Int-50 .sup.1H NMR (DMSO-d.sub.6, chloro -4-oxo-5- TAIL:Int-T1 400 MHz): δ ppm 8.17 (trifluoromethyl)chromen-2- (d, J = 8.44 Hz, 1H), yl]phenoxy]ethoxy] 7.86-7.98 (m, 2H), cyclobutanecarboxylic 7.54 (d, J = 1.71 Hz, acid 1H), 7.45 (dd, J = 8.44, embedded image 1.71 Hz, 1H), 7.24 (s, 1 H), 4.28-4.41 (m, 2H), 3.95 (quin, J = 7.34 Hz, 1H), 3.67- 3.76 (m, 2H), 2.32- 2.47 (m, 3H), 1.93- 2.03 (m, 2 H).. (ESI.sup.+) [(M + H).sup.+]: 561.0. C049-B Trans-3-[2-[5-bromo-248- CORE:Int-50 .sup.1H NMR (DMSO-d.sub.6, chloro -4-oxo-5- TAIL:Int-T1 400 MHz): δ ppm 8.17 (trifluoromethyl)chromen-2- (br d, J = 8.1 Hz, 1H), yl]phenoxy]ethoxy] 7.96 (br dd, J = 8.6, cyclobutanecarboxylic 2.2 Hz, 1H), 7.88 (br acid d, J = 8.3 Hz, 1H), 00embedded image 7.53 (br s, 1H), 7.45 (br d, J = 8.6 Hz, 1H), 7.36 (s, 1H), 4.34 (br s, 2H), 4.18 (dt, J = 13.6, 6.7 Hz, 1H), 3.64-3.71 (m, 2H), 2.89 (br d, J = 10.5 Hz, 1H), 2.29- 2.47 (m, 2H), 2.09- 2.28 (m, 2H). MS obsd. (ESL.sup.+) [(M + H).sup.+]: 561.0. C050-A Cis-3- [2-[2-(8-chloro-4-oxo- CORE:Int-31 .sup.1H NMR (DMSO-d.sub.6, chromen-2-yl)-4-methyl- TAIL:Int-T1 400 MHz): δ ppm 7.97- phenoxy]ethoxy] 8.02 (m, 2H), 7.77- cyclobutanecarboxylic 7.81 (m, 1H), 7.45- acid 7.53 (m, 1H), 7.37- 01embedded image 7.43 (m, 1H), 7.15- 7.22 (m, 2H), 4.19- 4.26 (m, 2H), 3.87- 3.98 (m, 1H), 3.65- 3.72 (m, 2H), 2.31- 2.48 (m, 6H), 1.91- 2.02 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 429.1. C050-B Trans-3-[2-[2-(8-chloro-4- CORE:Int-31 .sup.1H NMR (DMSO-d.sub.6, oxo-chromen-2-yl)-4-methyl- TAIL:Int-T1 400 MHz): δ ppm phenoxy]ethoxy] 11.99-12.16 (m, 1H), cyclobutanecarboxylic 7.97-8.03 (m, 2H), acid 7.75-7.81 (m, 1H), 02embedded image 7.44-7.54 (m, 1H), 7.34-7.42 (m, 1H), 7.14-7.22 (m, 2H), 4.18-4.27 (m, 2H), 4.05-4.14 (m, 1H), 3.66-3.72 (m, 2H), 3.14-3.20 (m, 1H), 2.30-2.44 (m, 5H), 1.92-2.03 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 429.1. C051-A Cis-3-[2-[2-(8-chloro-4-oxo- CORE:Int-51 .sup.1H NMR (DMSO-d.sub.6, chromen-2-yl)-4-ethoxy- TAIL:Int-T1 400 MHz): δ ppm 7.95- phenoxy]ethoxy] 8.03 (m, 2H), 7.46- cyclobutanecarboxylic 7.56 (m, 2H), 7.11- acid 7.29 (m, 3H), 4.17- 03embedded image 4.24 (m, 2H), 4.02- 4.12 (m, 2H), 3.86- 3.98 (m, 1H), 3.62- 3.73 (m, 2H), 2.45- 2.49 (m, 1H), 2.33- 2.46 (m, 2H), 1.91- 2.03 (m, 2H), 1.30- 1.41 (m, 3H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 459.1. C051-B Trans-3-[2-[2-(8-chloro-4- CORE:Int-51 .sup.1H NMR (DMSO-d.sub.6, oxo-chromen-2-yl)-4-ethoxy- TAIL:Int-T1 400 MHz): δ ppm 7.99 phenoxy]ethoxy] (d, J = 7.95 Hz, 2H), cyclobutanecarboxylic 7.53-7.56 (m, 1H), acid 7.45-7.51 (m, 1H), 04embedded image 7.38 (s, 1H), 7.12-7.21 (m, 2H), 4.11-4.23 (m, 3H), 4.02-4.10 (m, 2H), 3.62-3.68 (m, 2H), 2.88-3.00 (m, 1H), 2.32-2.42 (m, 2H), 2.13-2.26 (m, 2H), 1.31-1.35 (m, 3H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 459.1. C052-A Cis-3-[2-[2-(8-chloro-4-oxo- CORE:Int-9 .sup.1H NMR (DMSO-d.sub.6, chromen-2-yl)-5- TAIL:Int-T1 400 MHz): δ ppm (trifluoromethoxy)phenoxy] 12.03 (s, 1H), 8.05- ethoxy]cyclobutanecarboxylic 8.13 (m, 1H), 7.96- acid 8.04 (m, 2H), 7.47- 05embedded image 7.54 (m, 1H), 7.29- 7.36 (m, 1H), 7.14- 7.27 (m, 2H), 4.27- 4.37 (m, 2H), 3.86- 3.99 (m, 1H), 3.65- 3.75 (m, 2H), 2.31- 2.46 (m, 3H), 1.91- 2.03 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 499.1. C053-B Trans-3-[2-[4-bromo-2-(8- CORE:Int-52 .sup.1H NMR (DMSO-d.sub.6, chloro-6-fluoro-4-oxo- TAIL:Int-T1 400 MHz): δ ppm 8.20 chromen-2- (d, J = 2.4 Hz, 1H), yl)phenoxy]ethoxy] 7.79 (dd, J = 7.8, 2.9 cyclobutanecarboxylic Hz, 1H), 7.49-7.68 (m, acid 2H), 7.28-7.48 (m, 06embedded image 1H), 6.82-7.05 (m, 1H), 4.19-4.38 (m, 3H), 3.74-3.91 (m, 2H), 3.32 (m, 1H), 2.51-2.73 (m, 2H), 2.30-2.49 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 510.9. C054-A Cis-3-[2-[2-(8-chloro-7- CORE:Int-53 .sup.1H NMR (DMSO-d.sub.6, fluoro-4-oxo-chromen-2- TAIL:Int-T1 400 MHz): δ ppm yl)phenoxy]ethoxy] 12.06 (br s, 1H), 7.98- cyclobutanecarboxylic acid 8.13 (m, 2H), 7.55- 07embedded image 7.65 (m, 2H), 7.19- 7.32 (m, 2H), 4.23- 4.35 (m, 2H), 3.88- 4.01 (m, 1H), 3.66- 3.78 (m, 2H), 2.54- 2.61 (m, 1H), 2.32- 2.47 (m, 2H), 1.91- 2.04 (m, 2H).MS obsd. (ES.sup.+) [(M + H).sup.+]: 433.1. C055-A Cis-3-[2-[5-chloro-2-(8- CORE:Int-5 .sup.1H NMR (DMSO-d.sub.6, chloro-4-oxo-chromen-2-yl)- TAIL:Int-T1 400 MHz): δ ppm 4-methyl- 12.04 (br s, 1H), 8.00 phenoxy]ethoxy] (ddd, J =7.8, 6.2, 1.6 cyclobutanecarboxylic Hz, 2H), 7.91 (s, 1H), acid 7.49 (t, J = 7.8 Hz, 08embedded image 1H), 7.39 (s, 1H), 7.18 (s, 1H), 4.22-4.41 (m, 2H), 3.86-4.07 (m, 1H), 3.59-3.79 (m, 2H), 2.67 (br s, 1H), 2.28-2.48 (m, 5H), 1.88-2.04 (m, 2H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 463.1. C056-A Cis-3- [3-[5-bromo-2-(8- CORE:Int-4 .sup.1H NMR (DMSO-d.sub.6, chloro-4-oxo-chromen-2- TAIL:Int-T2 400 MHz): δ ppm 8.00 yl)phenoxy]propoxy] (d, J = 7.8 Hz, 2H), cyclobutanecarboxylic 7.88 (d, J = 8.4 Hz, acid 1H), 7.48-7.55 (m, 09embedded image 2H), 7.42 (dd, J = 8.4, 1.7 Hz, 1H), 7.03 (s, 1H), 4.25 (t, J = 6.0 Hz, 2H), 3.80 (t, J = 7.2 Hz, 1H), 3.35-3.50 (m, 2H), 2.30-2.47 (m, 4H), 1.87-2.04 (m, 3H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 507.0. C056-B Trans-3-[3-[5-bromo-2-(8- CORE:Int-4 .sup.1H NMR (DMSO-d.sub.6, chloro-4-oxo-chromen-2- TAIL:Int-T2 400 MHz): δ ppm 12.14 yl)phenoxy]propoxy] (br s, 1H), 8.00 (d, J = cyclobutanecarboxylic 7.9 Hz, 2H), 7.87 (d, J = acid 8.4 Hz, 1H), 7.32- 0embedded image 7.58 (m, 3H), 7.01- 7.07 (m, 1H), 4.26 (t, J = 5.9 Hz, 2H), 3.99- 4.11 (m, 1H), 3.36- 3.51 (m, 2H), 2.79- 2.94 (m, 1H), 2.25- 2.42 (m, 2H), 1.89- 2.14 (m, 4H). MS obsd. (ESI.sup.+) [(M + H).sup.+]: 507.0. C057-A Cis-3-[2-[5-bromo-4-chloro- CORE:Int-54 .sup.1H NMR (DMSO-d.sub.6, 2-(8-chloro-4-oxo-chromen-2- TAIL:Int-T1 400 MHz): δ ppm 8.08 yl)phenoxy]ethoxy] (s, 1H), 8.00 (ddd, J = cyclobutanecarboxylic 9.4, 7.9, 1.5 Hz, 2H), acid 7.72 (s, 1H), 7.50 (t, J = embedded image 7.9 Hz, 1H), 7.20 (s, 1H), 4.29-4.37 (m, 2H), 3.90-3.95 (m, 1H), 3.62-3.75 (m, 2H), 2.52-2.54 (m, 1H), 2.31-2.48 (m, 2H), 1.90-2.08 (m, 2H) MS obsd. (ES.sup.+) [(M + H).sup.+]: 562.9. C058-A Cis-3-[2-[2-(8-chloro-7- CORE:Int-55 .sup.1H NMR (DMSO-d.sub.6, cyclopropyl-4-oxo-chromen- TAIL:Int-T1 400 MHz): δ ppm 8.16 2- (dd, J = 7.9, 1.7 Hz, yl)phenoxy]ethoxy] 1H), 8.04 (d, J =8.4 cyclobutanecarboxylic Hz, 1H), 7.44-7.53 (m, acid 2H), 7.17 (t, J = 7.4 embedded image Hz, 1H), 7.05 (d, J = 8.2 Hz, 1H), 6.90 (d, J = 8.4 Hz, 1H), 4.19- 4.35 (m, 2H), 3.66- 3.94 (m, 3H), 2.73- 2.85 (m, 1H), 2.53- 2.64 (m, 2H), 2.29- 2.49 (m, 3H), 1.13- 1.28 (m, 2H), 0.81- 0.92 (m, 2H).MS obsd. (ESI.sup.+) [(M + H).sup.+]: 455.1.

Example C060-A and Example C060-B: Cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid and Trans-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid

(540) ##STR00513##

Step 1: Preparation of 2-hydroxy-5-methoxy-benzaldehyde

(541) ##STR00514##

(542) Compound C060a was prepared in analogy to the procedure described for the preparation of compound Int-5a by using 4-methoxyphenol as the starting material instead of 3-chloro-4-methy 1-phenol in Step 1.

Step 2: Preparation of methyl 3-[2-(2-formyl-4-methoxy-phenoxy)ethoxy]cyclobutanecarboxylate

(543) ##STR00515##

(544) To a mixture of 2-hydroxy-5-methoxybenzaldehyde (550 mg, 3.61 mmol), methyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate (Int-T1, 600 mg, 1.95 mmol) in DMF (10 mL) was added K.sub.2CO.sub.3 (1.5 g, 10.8 mmol) and the mixture was then stirred at 50° C. for 16 hours. After the reaction was completed, the mixture was diluted with water (50 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluted with PE:EtOAc=100:1 to 3:1) to give methyl 3-[2-(2-formyl-4-methoxy-phenoxy)ethoxy]cyclobutanecarboxylate (600 mg, 53.8% yield) as a yellow oil. (ESI.sup.+)[(M+H).sup.+]309.1.

Step 3: Preparation of 3-[2-[2-[(E)-3-(3-chloro-2-hydroxy-phenyl)-3-oxo-prop-1-enyl]-4-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid

(545) ##STR00516##

(546) A mixture of KOH (395 mg, 7.03 mmol), methyl 3-(2-(2-formyl-4-methoxyphenoxy)ethoxy)cyclobutane-1-carboxylate (361 mg, 1.17 mmol) and 1-(3-chloro-2-hydroxyphenyl)ethan-1-one (200 mg, 1.17 mmol) in ethanol (50 mL) was stirred at 80° C. overnight. After the reaction was completed, the mixture was adjusted to PH˜2 by addition of 6N HCl, the resulting suspension was then filtered, the solid was collected and dried in vacuo to give 3-[2-[2-[(E)-3-(3-chloro-2-hydroxy-phenyl)-3-oxo-prop-1-enyl]-4-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid (500 mg, 95.4% yield) as a yellow solid. (ESI.sup.+)[(M+H).sup.+]447.1.

Step 4: Preparation of Cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid and Trans-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid

(547) ##STR00517##

(548) To a mixture solution of 3-[2-[2-[(E)-3-(3-chloro-2-hydroxy-phenyl)-3-oxo-prop-1-enyl]-4-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid (500 mg, 1.12 mmol) in DMSO (30 mL) was added I.sub.2 (28.4 mg, 112 μmol) and the mixture was then stirred at 125° C. for 3 hours. After the reaction was completed, the reaction was quenched with 2N Na.sub.2S.sub.2O.sub.3 solution (15 mL) and the resulting suspension was filtered. The solid cake was collected to give the crude 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid, which was further purified by Prep-HPLC to give two sets of diastereomers of the 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid with cis- and trans-configuration, one of which is characterized as Example C060-A (90 mg, 17.7%) and the other is Example C060-B (90 mg, 17.7%) as yellow powder.

(549) Example C060-A .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm. 12.17 (s, 1H), 7.94-8.03 (m, 2H), 7.44-7.58 (m, 2H), 7.15-7.26 (m, 3H), 4.16-4.27 (m, 2H), 3.88-4.01 (m, 1H), 3.81 (s, 3H), 3.62-3.72 (m, 2H), 2.51-2.54 (m, 1H), 2.35-2.45 (m, 2H), 1.92-2.04 (m, 2H). (ESI.sup.+) [(M+H).sup.+]: 445.1.

(550) Example CMO-B .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.15 (s, 1H), 8.00 (d, J=8.1 Hz, 2H), 7.57 (d, J=2.9 Hz, 1H), 7.49 (t, J=7.9 Hz, 1H), 7.39 (s, 1H), 7.06-7.25 (m, 2H), 4.19-4.28 (m, 2H), 4.09-4.19 (m, 1H), 3.89 (s, 3H), 3.58-3.69 (m, 2H), 2.76-3.01 (m, 1H), 2.32-2.42 (m, 2H), 2.14-2.28 (m, 2H). (ESI.sup.+)[(M+H).sup.+]445.1.

Example C061: 3-[2-[[4-(8-chloro-4-oxo-chromen-2-yl)-3-pyridyl]oxy]ethoxy]cyclobutanecarboxylic acid

(551) ##STR00518##

Step 1: Preparation of methyl 3-[2-[(4-formyl-3-pyridyl)oxy]ethoxy]cyclobutanecarboxylate

(552) ##STR00519##

(553) Compound C061a was prepared in analogy to the procedure described for the preparation of compound C060b by using 3-hydroxypyridine-4-carbaldehyde as the starting material instead of 2-hydroxy-5-methoxybenzaldehyde in Step 2.

Step 2: Preparation of methyl 3-[2-[[4-[(E)-3-(3-chloro-2-hydroxy-phenyl)-3-oxo-prop-1-enyl]-3-pyridyl]oxy]ethoxy]cyclobutanecarboxylate

(554) ##STR00520##

(555) To a solution of 1-(3-chloro-2-hydroxy-phenyl)ethanone (128.27 mg, 0.750 mmol), potassium tert-butoxide (126.56 mg, 1.13 mmol) in THF (30 mL) was added methyl 3-[2-[(4-formyl-3-pyridyl)oxy]ethoxy]cyclobutanecarboxylate (210.0 mg, 0.750 mmol) and the mixture was stirred at room temperature for 3 hours. The mixture was concentrated in vacuo and the residue was adjusted to pH˜5 by addition of 1N HCl. The mixture was extracted with EtOAc (20 mL) three times. The combined organic layer was dried over Na.sub.2SO.sub.4 and concentrated in vacuo to give methyl 3-[2-[[4-[(E)-3-(3-chloro-2-hydroxy-phenyl)-3-oxo-prop-1-enyl]-3-pyridyl]oxy]ethoxy]cyclobutanecarboxylate (273 mg, 84.0% yield) as a light brown oil. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 432.1.

Step 3: Preparation of methyl 3-[2-[[4-(8-chloro-4-oxo-chromen-2-yl)-3-pyridyl]oxy]ethoxy]cyclobutanecarboxylate

(556) ##STR00521##

(557) A mixture of methyl 3-[2-[[4-[(E)-3-(3-chloro-2-hydroxy-phenyl)-3-oxo-prop-1-enyl]-3-pyridyl]oxy]ethoxy]cyclobutanecarboxylate (273.0 mg, 0.630 mmol) and iodine (8.02 mg, 0.030 mmol) in DMSO (5 mL) was stirred at 140° C. for 3 hours. The mixture was diluted with water (20 mL) and the resulting suspension was filtered. The solid was collected and dried in vacuo to give methyl 3-[2-[[4-(8-chloro-4-oxo-chromen-2-yl)-3-pyridyl]oxy]ethoxy]cyclobutanecarboxylate (200 mg, 73.6% yield) as a yellow solid. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 430.0.

Step 4: Preparation of 3-[2-[[4-(8-chloro-4-oxo-chromen-2-yl)-3-pyridyl]oxy]ethoxy]cyclobutanecarboxylic acid

(558) ##STR00522##

(559) A mixture of methyl 3-[2-[[4-(8-chloro-4-oxo-chromen-2-yl)-3-pyridyl]oxy]ethoxy]cyclobutanecarboxylate (300.0 mg, 0.700 mmol) and LiOH (0.02 mL, 2.09 mmol) in a mixed solvent of THF (5 mL) and water (5 mL) was stirred at room temperature for 0.5 hour. The mixture was concentrated in vacuo and the residue was purified by Prep-HPLC to give 3-[2-[[4-(8-chloro-4-oxo-chromen-2-yl)-3-pyridyl]oxy]ethoxy]cyclobutanecarboxylic acid (16.4 mg, 5.48% yield) as a yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.19 (s, 1H), 8.60 (s, 1H), 8.44 (d, J=5.1 Hz, 1H), 8.07 (d, J=5.1 Hz, 1H), 7.97 (d, J=7.9 Hz, 1H), 7.82 (d, J=7.5 Hz, 1H), 7.37 (t, J=7.7 Hz, 1H), 7.15 (d, J=9.0 Hz, 1H), 4.33-4.46 (m, 2H), 4.15-4.24 (m, 0.4H), 3.94-4.04 (m, 0.6H), 3.72 (d, J=4.2 Hz, 2H), 2.81-3.04 (m, 1H), 2.44 (dd, J=10.8, 6.4 Hz, 2H), 2.11-2.29 (m, 1H), 1.91-2.05 (m, 1H). MS obsd. (ESI.sup.+)[(M+H).sup.+]: 416.1.

Example C062: 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(2-oxooxazolidin-3-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

(560) ##STR00523##

Step 1: Preparation of methyl 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(2-oxooxazolidin-3-yl)phenoxy]ethoxy]cyclobutanecarboxylate

(561) ##STR00524##

(562) To a solution of methyl 3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate (C003a, 300.0 mg, 0.590 mmol), 2-oxazolidone (154.35 mg, 1.77 mmol) and Cs.sub.2CO.sub.3 (385.01 mg, 1.18 mmol) in DMF (4 mL) were added CuI (202.1 mg, 1.18 mmol), N,N-dimethylethylenediamine (208.33 mg, 2.36 mmol) under N.sub.2 atmosphere. The mixture was then stirred at 110° C. for 4 hours. After the reaction was completed, the mixture was filtered and the filtrate was concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluted with PE:EtOAc=5:1 to 2:1) to give methyl 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(2-oxooxazolidin-3-yl)phenoxy]ethoxy]cyclobutanecarboxylate (290 mg, 93.6% yield) as yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.94-8.06 (m, 3H), 7.41-7.54 (m, 2H), 7.28-7.38 (m, 1H), 7.23 (s, 1H), 4.40-4.58 (m, 2H), 4.10-4.33 (m, 5H), 3.73 (br d, J=2.8 Hz, 2H), 3.52-3.65 (s, 3H), 2.23-2.48 (m, 4H), 1.99-2.09 (m, 1H). (ESI.sup.+)[(M+H).sup.+]:514.2.

Step 2: Preparation of 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(2-oxooxazolidin-3-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

(563) ##STR00525##

(564) To a solution of methyl 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(2-oxooxazolidin-3-yl)phenoxy]ethoxy]cyclobutanecarboxylate (150.0 mg, 0.290 mmol) in THF (5 mL)/water (0.500 mL) was added LiOH (11 mg, 0.500 mmol). The mixture was stirred at room temperature for 30 minutes. After the reaction was completed, the mixture was adjusted to pH˜5 by addition of 2M HCl. The resulting suspension was then filtered and the solid was collected. The solid was then purified by preparative HPLC to give 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(2-oxooxazolidin-3-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid (60 mg, 38.24% yield) as a yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.15 (br s, 1H), 8.07 (t, J=8.9 Hz, 1H), 8.01-7.94 (m, 2H), 7.53 (s, 1H), 7.48 (t, J=7.9 Hz, 1H), 7.39-7.31 (m, 2H), 4.55-4.45 (m, 2H), 4.28 (br s, 2H), 3.91-4.22 (m, 3H), 3.80-3.68 (m, 2H), 3.04-2.91 (m, 1H), 2.43-2.36 (m, 2H), 2.29-2.20 (m, 1H), 2.10-1.92 (m, 1H). (ESI.sup.+)[(M+H).sup.+]:500.3.

Example C063-A and Example C063-B: Cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(2-oxopyrrolidin-1-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid and Trans-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(2-oxopyrrolidin-1-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

(565) ##STR00526##

Step 1: Preparation of methyl 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(2-oxopyrrolidin-1-yl)phenoxy]ethoxy]cyclobutanecarboxylate

(566) ##STR00527##

(567) Compound C063a was prepared in analogy to the procedure described for the preparation of example C062a by using pyrrolidin-2-one as the starting material instead of 2-oxazolidone. (ESI.sup.+)[(M+H).sup.+]:512.1.

Step 2: Preparation of Cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(2-oxopyrrolidin-1-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid and Trans-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(2-oxopyrrolidin-1-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

(568) ##STR00528##

(569) Example C063-A and C063-B were prepared in analogy to the procedure described for the preparation of example C003-A and C003-B by using methyl 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(2-oxopyrrolidin-1-yl)phenoxy]ethoxy]cyclobutanecarboxylate as the starting material instead of methyl 3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate in Step 2.

(570) Example C063-A: .sup.1H NMR (DMSO-<fc, 400 MHz): δ ppm 7.96-8.07 (m, 3H), 7.69-7.74 (m, 1H), 7.43-7.52 (m, 2H), 7.25 (s, 1H), 4.23-4.29 (m, 2H), 3.87-4.01 (m, 3H), 3.70-3.79 (m, 2H), 2.55-2.59 (m, 2H), 2.41-2.47 (m, 2H), 2.07-2.17 (m, 2H), 1.94-2.06 (m, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:498.2.

(571) Example C063-B: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.07 (d, J=8.8 Hz, 1H), 7.99 (d, J=7.8 Hz, 2H), 7.71 (d, J=1.7 Hz, 1H), 7.44-7.51 (m, 2H), 7.38 (s, 1H), 4.24-4.30 (m, 2H), 4.19 (t, J=6.8 Hz, 1H), 3.92 (t, J=7.1 Hz, 2H), 3.70-3.75 (m, 2H), 2.93-3.01 (m, 1H), 2.55-2.60 (m, 2H), 2.36-2.44 (m, 2H), 2.21-2.28 (m, 2H), 2.06-2.15 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:498.2.

Example C064-A and Example C064-B: Cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methylsulfanyl-phenoxy]ethoxy]cyclobutanecarboxylic acid and trans-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methylsulfanyl-phenoxy]ethoxy]cyclobutanecarboxylic acid

(572) ##STR00529##

Step 1: Preparation of methyl 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methylsulfanyl-phenoxy]ethoxy]cyclobutanecarboxylate

(573) ##STR00530##

(574) A mixture of methyl 3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate (C003a, 50 mg, 98.5 μmol), DABCO (22.1 mg, 197 μmol), CuI (37.5 mg, 197 μmol) in DMSO (5 mL) was microwaved at 170° C. for 2.5 hour. After the reaction was completed, the mixture was diluted with EtOAc (30 mL) and the suspension was then filtered through silica pad. The filtrate was concentrated in vacuo to give a dark solution of methyl 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methylsulfanyl-phenoxy]ethoxy]cyclobutanecarboxylate in DMSO, which was used in the next step directly without further purification. (ESI.sup.+)[(M+H).sup.+]:475.1

Step 2: Preparation of Cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methylsulfanyl-phenoxy]ethoxy]cyclobutanecarboxylic acid and trans-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methylsulfanyl-phenoxy]ethoxy]cyclobutanecarboxylic acid

(575) ##STR00531##

(576) Example C064-A and C064-B were prepared in analogy to the procedure described for the preparation of example C003-A and C003-B by using methyl 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(2-oxopyrrolidin-1-yl)phenoxy]ethoxy]cyclobutanecarboxylate as the starting material instead of methyl 3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate in Step 2.

(577) Example C064-A: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.95-8.05 (m, 3H), 7.49 (t, J=1.9 Hz, 1H), 7.19-7.29 (m, 1H), 7.05-7.14 (m, 2H), 4.26-4.39 (m, 2H), 3.93-4.04 (m, 1H), 3.68-3.79 (m, 2H), 2.57-2.62 (m, 4H), 2.39-2.47 (m, 2H), 1.97-2.08 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 461.2.

(578) Example C064-B: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.96-8.02 (m, 3H), 7.49 (t, J=7.9 Hz, 1H), 7.36 (s, 1H), 7.07-7.13 (m, 2H), 4.31-4.36 (m, 2H), 4.15-4.24 (m, 1H), 3.67-3.72 (m, 2H), 2.89-3.00 (m, 1H), 2.58 (s, 3H), 2.40 (qd, J=6.6, 3.7 Hz, 2H), 2.16-2.28 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 461.2.

Example C065-A and Example C065-B: Cis-methyl 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methylsulfonyl-phenoxy]ethoxy]cyclobutanecarboxylate and Trans-methyl 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methylsulfonyl-phenoxy]ethoxy]cyclobutanecarboxylate

(579) ##STR00532##

(580) To the solution of methyl 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methylsulfanyl-phenoxy]ethoxy]cyclobutanecarboxylate (142 mg, 299 μmol) in the DCM (25 mL) was added m-CPBA (103 mg, 598 μmol), the mixture was then stirred at room temperature overnight. After the reaction was completed, the mixture was purified Prep-HPLC to give two sets of diastereomers of the methyl 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methylsulfanyl-phenoxy]ethoxy]cyclobutanecarboxylate with cis- and trans-configuration, one of which is characterized as Example C065-A (3.5 mg, 1.9% yield) and the other is Example C065-B (6.5 mg, 3.9% yield) as white solid.

(581) Example C065-A: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.19 (d, J=8.7 Hz, 1H), 8.03 (ddd, J=7.9, 6.5, 1.5 Hz, 2H), 7.72-7.76 (m, 2H), 7.52 (s, 1H), 7.24 (s, 1H), 4.39-4.43 (m, 2H), 3.92-3.99 (m, 1H), 3.70-3.75 (m, 2H), 3.56 (s, 3H), 3.31 (s, 3H), 2.58-2.64 (m, 1H), 2.38-2.43 (m, 2H), 1.98-2.03 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 507.3.

(582) Example C065-B: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.18-8.24 (m, 1H), 7.99-8.06 (m, 2H), 7.73-7.77 (m, 2H), 7.52 (t, J=7.9 Hz, 1H), 7.34 (s, 1H), 4.38-4.45 (m, 2H), 4.19 (quin, J=6.6 Hz, 1H), 3.69-3.75 (m, 2H), 3.59 (s, 3H), 3.33 (s, 3H), 2.99-3.07 (m, 1H), 2.35-2.42 (m, 2H), 2.09-2.26 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 507.3.

Example C066-A and Example C066-B: Cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-thiazol-2-yl-phenoxy]ethoxy]cyclobutanecarboxylic acid and Trans-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-thiazol-2-yl-phenoxy]ethoxy]cyclobutanecarboxylic acid

(583) ##STR00533##

Step 1: Preparation of methyl 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-thiazol-2-yl-phenoxy]ethoxy]cyclobutanecarboxylate

(584) ##STR00534##

(585) A mixture of methyl 3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate (C003a, 80 mg, 158 μmol), Pd(OAc).sub.2 (35.4 mg, 158 μmol), CuI (60 mg, 315 μmol), thiazole (26.8 mg, 315 μmol) in DMF (2 ml) was stirred at 150° C. under microwave condition for 3 hours. After the reaction was completed, the mixture was diluted with EtOAc (30 ml) and then filtered, the filtrate was concentrated in vacuo to give the crude methyl 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-thiazol-2-yl-phenoxy]ethoxy]cyclobutanecarboxylate (80 mg, 100% yield) as a yellow solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 512.2.

Step 2: Preparation of Cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-thiazol-2-yl-phenoxy]ethoxy]cyclobutanecarboxylic acid and traits-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-thiazol-2-yl-phenoxy]ethoxy]cyclobutanecarboxylic acid

(586) ##STR00535##

(587) Example C066-A and C066-B were prepared in analogy to the procedure described for the preparation of example C003-A and C003-B by using methyl 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-thiazol-2-yl-phenoxy]ethoxy]cyclobutanecarboxylate as the starting material instead of methyl 3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate in Step 2.

(588) Example C066-A: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.14 (d, J=8.6 Hz, 1H), 7.98-8.05 (m, 3H), 7.93 (d, J=3.2 Hz, 1H), 7.79 (td, J=4.2, 1.5 Hz, 2H), 7.48-7.54 (m, 1H), 7.31 (s, 1H), 4.39-4.44 (m, 2H), 3.93-4.00 (m, 1H), 3.73-3.79 (m, 2H), 2.47-2.49 (m, 1H), 2.36-2.46 (m, 2H), 1.98-2.05 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 498.1.

(589) Example C066-B: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.17 (d, J=8.7 Hz, 1H), 8.00-8.05 (m, 3H), 7.94 (d, J=3.2 Hz, 1H), 7.76-7.83 (m, 2H), 7.48-7.54 (m, 1H), 7.44 (s, 1H), 4.41-4.46 (m, 2H), 4.16-4.24 (m, 1H), 3.72-3.76 (m, 2H), 2.94-2.99 (m, 1H), 2.38-2.44 (m, 2H), 2.21-2.27 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 498.1.

Example C067-A and Example C067-B: Cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-morpholino-phenoxy]ethoxy]cyclobutanecarboxylic acid and trans-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-morpholino-phenoxy]ethoxy]cyclobutanecarboxylic acid

(590) ##STR00536##

(591) The mixture of methyl 3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate (C003a, 80 mg, 158 μmol), morpholine (41.2 mg, 473 μmol), K.sub.2CO.sub.3 (65.3 mg, 473 μmol) and RuPhos Pd G2 (12.2 mg, 15.8 μmol) in 1,4-Dioxane (3 ml) was stirred at 100° C. overnight. After the reaction was completed, to the reaction mixture was added LiOH solution (1N, 1 mL) and then the mixture was stirred at 50° C. for 2 hours. The mixture was adjusted to pH˜5 by addition of AcOH and the mixture was concentrated in vacuo. The residue was purified by prep-HPLC to give two sets of diastereomers of the 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-morpholino-phenoxy]ethoxy]cyclobutanecarboxylic acid with cis- and trans-configuration, one of which is characterized as Example C067-A (9.5 mg, 11.5% yield) and the other is Example C067-B (3.5 mg, 4.2% yield) as white solid.

(592) Example C067-A: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.11 (br s, 1H), 7.90-8.00 (m, 3H), 7.45 (t, J=7.9 Hz, 1H), 7.19 (s, 1H), 6.78 (dd, J=9.0, 2.2 Hz, 1H), 6.66 (d, J=2.2 Hz, 1H), 4.23-4.33 (m, 2H), 3.95-4.06 (m, 1H), 3.70-3.82 (m, 6H), 2.52-2.58 (m, 1H), 2.40-2.46 (m, 2H), 1.93-2.11 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 500.3.

(593) Example C067-B: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.01-12.32 (m, 1H), 7.90-7.99 (m, 3H), 7.37-7.50 (m, 1H), 7.28-7.34 (m, 1H), 6.78 (dd, J=9.0, 2.2 Hz, 1H), 6.65 (d, J=2.0 Hz, 1H), 4.26-4.37 (m, 2H), 4.15-4.24 (m, 1H), 3.68-3.81 (m, 6H), 2.93-3.05 (m, 1H), 2.40 (ddd, J=9.8, 6.7, 3.4 Hz, 2H), 2.17-2.30 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 500.3.

Example C068: cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-pyrrolidin-1-yl-phenoxy]ethoxy]cyclobutanecarboxylic acid

(594) ##STR00537##

Step 1: Preparation of cis-tert-butyl 3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate

(595) ##STR00538##

(596) Compound C068a was prepared in analogy to the procedure described for the preparation of compound C003a by using cis-tert-butyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate as the starting material instead of methyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate.

Step 2: Preparation of cis-tert-butyl 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-pyrrolidin-1-yl-phenoxy]ethoxy]cyclobutanecarboxylate

(597) ##STR00539##

(598) A mixture of cis-tert-butyl 3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate (330.0 mg, 0.600 mmol), pyrrolidine (213.42 mg, 3 mmol), Pd.sub.2(dba).sub.3 (54.96 mg, 0.060 mmol), 9,9-dimethyl-4,5-bis(diphenylphosphino)xanthene (34.73 mg, 0.060 mmol) and Cs.sub.2CO.sub.3 (586.6 mg, 1.8 mmol) in 1,4-dioxane (7 mL) was stirred at 105° C. for 5 hours. The mixture was filtered and the filtrate was concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluted with PE:EtOAc=10:1 to 1:1) to give cis-tert-butyl 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-pyrrolidin-1-yl-phenoxy]ethoxy]cyclobutanecarboxylate (250 mg, 77.13% yield) as light yellow oil. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 540.1.

Step 3: Preparation of cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-pyrrolidin-1-yl-phenoxy]ethoxy]cyclobutanecarboxylic acid

(599) ##STR00540##

(600) To a solution of cis-tert-butyl 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-pyrrolidin-1-yl-phenoxy]ethoxy]cyclobutanecarboxylate (250.0 mg, 0.460 mmol) in DCM (5 mL) was added TFA (2.5 mL, 32.45 mmol) and the mixture was stirred at room temperature for 1 hour. The mixture was concentrated in vacuo and the residue was triturated with mixed solvent of EtOAc (3 mL) and PE (15 mL). The suspension was then filtered, the solid was collected and dried in vacuo to give cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-pyrrolidin-1-yl-phenoxy]ethoxy]cyclobutanecarboxylic acid (137.5 mg, 59.6% yield) as light red solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.39-11.69 (m, 1H), 7.89-7.96 (m, 3H), 7.42 (t, J=7.9 Hz, 1H), 7.15 (s, 1H), 6.37 (d, J=9.0 Hz, 1H), 6.19 (s, 1H), 4.16-4.36 (m, 2H), 3.86-4.12 (m, 1H), 3.65-3.83 (m, 2H), 2.53-2.64 (m, 4H), 2.39-2.48 (m, 3H), 1.93-2.08 (m, 6H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 484.7.

Example C069-A and Example C069-B: Cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-cyclopropyl-phenoxy]ethoxy]cyclobutanecarboxylic acid and Trans-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-cyclopropyl-phenoxy]ethoxy]cyclobutanecarboxylic acid

(601) ##STR00541##

(602) A mixture of methyl 3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate (C003a, 80 mg, 158 μmol), potassium cyclopropyltrifluoroborate (35 mg, 236 μmol), Pd(Ph.sub.3P).sub.4 (18.2 mg, 15.8 μmol) and K.sub.2CO.sub.3 (54.4 mg, 394 μmol) in 1,4-Dioxane (5 mL) and water (1 mL) was stirred at 100° C. for 3 hours. Then to the resulting mixture was added LiOH (22 mg, 1 mmol) and the mixture was stirred at 50° C. for 30 minutes. After the reaction was completed, the mixture was adjusted to PH˜5 by addition of 6N HCl. The mixture was then concentrated in vacuo and the residue was purified by Prep-HPLC to give two sets of diastereomers of the 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-cyclopropyl-phenoxy]ethoxy]cyclobutanecarboxylic acid with cis- and trans-configuration, one of which is characterized as Example C069-A (10 mg, 13.5% yield) and the other is Example C069-B (22 mg, 30% yield) as white solid.

(603) Example C069-A: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.98 (d, J=7.34 Hz, 2H), 7.90 (d, J=7.58 Hz, 1H), 7.45-7.53 (m, 1H), 7.21 (br. s., 1H), 6.96 (br. s., 1H), 6.90 (d, J=7.58 Hz, 1H), 4.29 (br. s., 2H), 3.95 (d, J=5.87 Hz, 1H), 3.72 (br. s., 2H), 2.43 (br. s., 3H), 2.01 (br. s., 3H), 1.06 (d, J=6.11 Hz, 2H), 0.80-0.90 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 455.1.

(604) Example C069-B: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.88-8.05 (m, 3H), 7.41-7.54 (m, 1H), 7.29-7.37 (m, 1H), 6.90 (dd, J=8.3, 1.4 Hz, 2H), 4.26-4.38 (m, 2H), 4.13-4.24 (m, 1H), 3.64-3.73 (m, 2H), 2.90-3.02 (m, 1H), 2.35-2.44 (m, 2H), 2.15-2.27 (m, 2H), 1.91-2.06 (m, 1H), 1.02-1.11 (m, 2H), 0.69-0.90 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 455.1.

Example C070: Cis-3-[2-[2-bromo-6-(8-chloro-6-fluoro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

(605) ##STR00542##

Step 1: Preparation of 2-(3-bromo-2-hydroxy-phenyl)-8-chloro-6-fluoro-chromen-4-one

(606) ##STR00543##

(607) Compound C070a was prepared in analogy to the procedure described for the preparation of compound Int-5 by using 3-bromo-2-hydroxy-benzaldehyde (CAS #: 1829-34-1, Cat. #: SY013143, from Accela ChemBio Inc) as the starting material instead of 4-chloro-2-hydroxy-5-methyl-benzaldehyde in Step 2 and using 1-(3-chloro-5-fluoro-2-hydroxy-phenyl)ethanone as the starting material instead of 1-(3-chloro-2-hydroxy-phenyl)ethanone in Step 3.

Step 2: Preparation of Cis-3-[2-[2-bromo-6-(8-chloro-6-fluoro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

(608) ##STR00544##

(609) Example C070a was prepared in analogy to the procedure described for the preparation of example C004 by using 2-(3-bromo-2-hydroxy-phenyl)-8-chloro-6-fluoro-chromen-4-one as the starting material instead of 8-chloro-2-(4-chloro-2-hydroxy-phenyl)chromen-4-one in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.10 (br s, 1H), 7.79-7.89 (m, 4H), 7.47-7.66 (m, 1H), 7.34 (t, J=7.7 Hz, 1H), 3.97-4.09 (m, 2H), 3.90 (quin, J=6.7 Hz, 1H), 3.26-3.45 (m, 3H), 2.08-2.29 (m, 2H), 1.73-2.00 (m, 2H). (ESI.sup.+)[(M+H).sup.+]: 511.1.

Example C071: Cis-3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-3-fluoro-phenoxy]ethoxy]cyclobutanecarboxylic acid

(610) ##STR00545##

Step 1: Preparation of 2-(4-bromo-2-fluoro-6-hydroxy-phenyl)-8-chloro-chromen-4-one

(611) ##STR00546##

(612) Compound C070a was prepared in analogy to the procedure described for the preparation of compound Int-5 by using 4-bromo-2-fluoro-6-hydroxy-benzaldehyde (CAS #: 1427438-90-1, Cat. #: BD260521, from Bide Pharmtach) as the starting material instead of 4-chloro-2-hydroxy-5-methyl-benzaldehyde in Step 2.

Step 2: Preparation of cis-tert-butyl 3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-3-fluoro-phenoxy]ethoxy]cyclobutanecarboxylate

(613) ##STR00547##

(614) A solution of 2-(4-bromo-2-fluoro-6-hydroxy-phenyl)-8-chloro-chromen-4-one (200.0 mg, 0.540 mmol), cis-tert-butyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate (200.48 mg, 0.540 mmol) and K.sub.2CO.sub.3 (74.79 mg, 0.540 mmol) in DMF (15 mL) was stirred at 80° C. for 8 hours. After the reaction was completed, the mixture was concentrated in vacuo and the residue was purified by column chromatography on silica gel (eluted with PE:EtOAc=20:1 to 3:1) to give cis-tert-butyl 3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-3-fluoro-phenoxy]ethoxy]cyclobutanecarboxylate (170 mg, 55.32% yield, purity 36.42%) as a light yellow oil. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 567.0.

Step 3: Preparation of cis-3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-3-fluoro-phenoxy]ethoxy]cyclobutanecarboxylic acid

(615) ##STR00548##

(616) To a solution of cis-tert-butyl 3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-3-fluoro-phenoxy]ethoxy]cyclobutanecarboxylate (170.0 mg, 0.300 mmol) in DCM (5 mL) was added TFA (2.5 mL, 32.45 mmol) and the mixture was stirred at 20° C. for 5 hours. After the reaction was completed, the mixture was concentrated in vacuo and the residue was purified by Prep-HPLC to give cis-3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-3-fluoro-phenoxy]ethoxy]cyclobutanecarboxylic acid (89.7 mg, 58.55% yield) as an off-white solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.07 (br s, 1H), 7.99-8.07 (m, 2H), 7.53 (t, J=7.9 Hz, 1H), 7.38-7.45 (m, 2H), 6.71 (s, 1H), 4.19-4.32 (m, 2H), 3.77 (quin, J=7.2 Hz, 1H), 3.41-3.62 (m, 2H), 2.16-2.34 (m, 3H), 1.74-1.85 (m, 2H). (ESI.sup.+)[(M+H).sup.+]: 511.5.

Example C072: Cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4,5-dimethoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid

(617) ##STR00549##

(618) Example C072 was prepared in analogy to the procedure described for the preparation of example C071 by using 8-chloro-2-(2-hydroxy-4,5-dimethoxy-phenyl)chromen-4-one (Int-10) as the starting material instead of 2-(4-bromo-2-fluoro-6-hydroxy-phenyl)-8-chloro-chromen-4-one in Step 2. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.98 (dd, J=7.9, 2.9 Hz, 2H), 7.60 (s, 1H), 7.47 (t, J=7.9 Hz, 1H), 7.25 (s, 1H), 6.91 (s, 1H), 4.28-4.35 (m, 2H), 3.88-4.00 (m, 4H), 3.82 (s, 3H), 3.67-3.76 (m, 2H), 2.38-2.47 (m, 2H), 1.96-2.06 (m, 2H). (ESI.sup.+)[(M+H).sup.+]: 475.1.

Example C073: Cis-3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-4-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid

(619) ##STR00550##

(620) Example C073 was prepared in analogy to the procedure described for the preparation of example C071 by using 2-(4-bromo-2-hydroxy-5-methoxy-phenyl)-8-chloro-chromen-4-one as the starting material instead of 2-(4-bromo-2-fluoro-6-hydroxy-phenyl)-8-chloro-chromen-4-one in Step 2. .sup.1H NMR (DMSO-&, 400 MHz): δ ppm 12.08 (br s, 1H), 8.00 (br t, J=7.5 Hz, 2H), 7.54-7.70 (m, 2H), 7.50 (t, J=7.8 Hz, 1H), 7.23-7.30 (m, 1H), 4.17-4.36 (m, 2H), 3.87-3.96 (m, 4H), 3.63-3.73 (m, 2H), 2.54-2.61 (m, 1H), 2.33-2.48 (m, 2H), 1.93-2.03 (m, 2H). (ESI.sup.+)[(M+H).sup.+]:523.2.

Example C074: Cis-3-[2-[[7-(8-chloro-4-oxo-chromen-2-yl)-2,3-dihydro-1,4-benzodioxin-6-yl]oxy]ethoxy]cyclobutanecarboxylic acid

(621) ##STR00551##

Step 1: Preparation of 6-hydroxy-2,3-dihydro-1,4-benzodioxine-7-carbaldehyde

(622) ##STR00552##

(623) Compound C074a was prepared in analogy to the procedure described for the preparation of compound Int-5a by using 2,3-dihydro-1,4-benzodioxin-6-ol as the starting material instead of 3-chloro-4-methyl-phenol in Step 1.

Step 2: Preparation of 8-chloro-2-(6-hydroxy-2,3-dihydro-1,4-benzodioxin-7-yl)chromen-4-one

(624) ##STR00553##

(625) Compound C070a was prepared in analogy to the procedure described for the preparation of compound Int-5 by using 6-hydroxy-2,3-dihydro-1,4-benzodioxine-7-carbaldehyde as the starting material instead of 4-chloro-2-hydroxy-5-methyl-benzaldehyde in Step 2.

Step 3: Preparation of cis-3-[2-[[7-(8-chloro-4-oxo-chromen-2-yl)-2,3-dihydro-1,4-benzodioxin-6-yl]oxy]ethoxy]cyclobutanecarboxylic acid

(626) ##STR00554##

(627) Example C074 was prepared in analogy to the procedure described for the preparation of example C071 by using 8-chloro-2-(6-hydroxy-2,3-dihydro-1,4-benzodioxin-7-yl)chromen-4-one as the starting material instead of 2-(4-bromo-2-fluoro-6-hydroxy-phenyl)-8-chloro-chromen-4-one in Step 2. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.95-7.98 (m, 2H), 7.52 (s, 1H), 7.49 (s, 1H), 7.45 (m, 1H), 7.22 (s, 1H), 6.80 (s, 1H), 4.35 (dd, J=5.3, 2.1 Hz, 2H), 4.27 (dd, J=5.3, 2.1 Hz, 2H), 4.17-4.19 (m, 2H), 3.95 (m, 1H), 3.67-3.70 (m, 2H), 2.53 (br s, 1H), 2.41-2.44 (m, 2H), 2.01-2.02 (m, 2H). (ESI.sup.+)[(M+H).sup.+]:473.0.

Example C075: Cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4-(difluoromethyl)-5-methyl-phenoxy]ethoxy]cyclobutanecarboxylic acid

(628) ##STR00555##

Step 1: Preparation of 4-benzyloxy-2-methyl-benzaldehyde

(629) ##STR00556##

(630) To a solution of 4-hydroxy-2-methyl-benzaldehyde (2000.0 mg, 14.69 mmol) in DMF (15 mL) were added potassium carbonate (2436.24 mg, 17.63 mmol) and benzyl bromide (1.83 mL, 15.42 mmol), then the mixture was stirred at 25° C. for 16 hours. After the reaction was completed, the reaction was quenched with water (150 mL) and the resulting solution was extracted with EtOAc (80 mL) three times. The combined organic layer was washed with brine (100 mL), dried over MgSO.sub.4, filtered and the filtrate was concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluted with PE:EtOAc=5:1) to give 4-benzyloxy-2-methyl-benzaldehyde (3200 mg, 96.27% yield) as a white solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 227.1.

Step 2: Preparation of 4-benzyloxy-5-bromo-2-methyl-benzaldehyde

(631) ##STR00557##

(632) To a solution of 4-benzyloxy-2-methyl-benzaldehyde (3200.0 mg, 14.14 mmol) in methanol (40 mL) cooled in ice-bath was added pyridinium tribromide (6784.53 mg, 21.21 mmol) and the mixture was stirred at 25° C. for 3 hours. After the reaction was completed, the reaction was quenched with 10% Na.sub.2SO.sub.3 solution (150 mL) and the resulting solution was extracted with EtOAc (100 mL) three times. The combined organic layer was washed with brine (100 mL), dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluted with PE:EtOAc=5:1) to give 4-benzyloxy-5-bromo-2-methyl-benzaldehyde (3519 mg, 81.54% yield) as a white solid. MS obsd. (ESI.sup.+) [(M+E1).sup.+]: 305.0.

Step 3: Preparation of methyl 2-benzyloxy-5-formyl-4-methyl-benzoate

(633) ##STR00558##

(634) A mixture of 4-benzyloxy-5-bromo-2-methyl-benzaldehyde (3519.0 mg, 11.53 mmol), (dppf).sub.2 PdCl.sub.2 (2845.97 mg, 3.46 mmol), TEA (4.82 mL, 34.59 mmol) in methanol (100 mL) was stirred under CO (0.5 MPa) at 80° C. for 16 hours. After the reaction was completed and the reaction mixture was concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluted with PE:EtOAc=5:1) to give methyl 2-benzyloxy-5-formyl-4-methyl-benzoate (2044 mg, 62.35% yield) as a white solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 285.2.

Step 4: Preparation of methyl 2-benzyloxy-5-(difluoromethyl)-4-methyl-benzoate

(635) ##STR00559##

(636) To a solution of methyl 2-benzyloxy-5-formyl-4-methyl-benzoate (2300.0 mg, 8.09 mmol) in DCM (40 mL) was added DAST (5.34 mL, 40.45 mmol) and then the reaction mixture was stirred at 25° C. for 16 hours. After the reaction was completed, the mixture was poured into ice water (100 mL) and the resulting mixture was extracted with DCM (50 mL) three times. The combined organic layer was washed with brine (50 mL), dried over MgSO.sub.4, filtered and the filtrate was concentrated in vacuo. The residue was purified by column chromatography on silica gel (PE/EtOAc=10/1) to give methyl 2-benzyloxy-5-(difluoromethyl)-4-methyl-benzoate (2229 mg, 89.96% yield) as a white solid. MS obsd. (ESI.sup.+) [(M+Na).sup.+]: 329.1.

Step 5: Preparation of [2-benzyloxy-5-(difluoromethyl)-4-methyl-phenyl]methanol

(637) ##STR00560##

(638) To a solution of methyl 2-benzyloxy-5-(difluoromethyl)-4-methyl-benzoate (2229.0 mg, 7.28 mmol) in THF (50 mL) was added LiAlH.sub.4 (1104.68 mg, 29.11 mmol) at 0° C. and the mixture was stirred at 0° C. for 2 hours. After the reaction was completed, the reaction was quenched with 15% NaOH aqueous solution (1.1 mL) and water (3.3 mL). The resulting mixture was filtered and the filtrate was concentrated in vacuo to give [2-benzyloxy-5-(difluoromethyl)-4-methyl-phenyl]methanol (1824 mg, 90.07% yield) as a white solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+)[(M+Na).sup.+]: 301.1.

Step 6: Preparation of 2-benzyloxy-5-(difluoromethyl)-4-methyl-benzaldehyde

(639) ##STR00561##

(640) To a solution of [2-benzyloxy-5-(difluoromethyl)-4-methyl-phenyl]methanol (1824.0 mg, 6.55 mmol) in DCM (50 mL) was added MnO.sub.2 (5698.06 mg, 65.54 mmol) and the mixture was stirred at 25° C. for 16 hours. After the reaction was completed, the mixture was filtered and the filtrate was concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluted with PE:EtOAc=10:1) to give 2-benzyloxy-5-(difluoromethyl)-4-methyl-benzaldehyde (1696 mg, 93.66% yield) as a white solid. MS obsd. (ESI.sup.+) [(M+Na).sup.+]: 299.1.

Step 7: Preparation of (E)-3-[2-benzyloxy-5-(difluoromethyl)-4-methyl-phenyl]-1-(3-chloro-2-hydroxy-phenyl)prop-2-en-1-one

(641) ##STR00562##

(642) To a solution of 1-(3-chloro-2-hydroxy-phenyl)ethanone (950.0 mg, 5.57 mmol) and 2-benzyloxy-5-(difluoromethyl)-4-methyl-benzaldehyde (1692.4 mg, 6.13 mmol) in ethanol (100 mL) was added KOH (3124.4 mg, 55.69 mmol) and the mixture was stirred at 35° C. for 16 hours. After the reaction was completed and the reaction mixture was adjusted to pH˜6 by addition of 1N HCl to give a yellow suspension. The suspension was filtered, the solid was washed with water and then dried in vacuo to give the crude (E)-3-[2-benzyloxy-5-(difluoromethyl)-4-methyl-phenyl]-1-(3-chloro-2-hydroxy-phenyl)prop-2-en-1-one (2240 mg, 93.79% yield) as a yellow solid which was used in the next step directly without further purification.

Step 8: Preparation of 2-[2-benzyloxy-5-(difluoromethyl)-4-methyl-phenyl]-8-chloro-chromen-4-one

(643) ##STR00563##

(644) To a solution of (E)-3-[2-benzyloxy-5-(difluoromethyl)-4-methyl-phenyl]-1-(3-chloro-2-hydroxy-phenyl)prop-2-en-1-one (1250.0 mg, 2.91 mmol) in DMSO (250 mL) was added I.sub.2 (51.78 mg, 0.200 mmol) and then the reaction mixture was stirred at 140° C. for 6 hours. After the reaction was completed, the reaction mixture was quenched with water (500 mL) and the resulting suspension was filtered. The solid was washed with EtOH and then dried in vacuo to give 2-[2-benzyloxy-5-(difluoromethyl)-4-methyl-phenyl]-8-chloro-chromen-4-one (1114 mg, 89.54% yield) as a light yellow solid which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 427.0.

Step 9: Preparation of 8-chloro-2-[5-(difluoromethyl)-2-hydroxy-4-methyl-phenyl]chromen-4-one

(645) ##STR00564##

(646) To a solution of 2-[2-benzyloxy-5-(difluoromethyl)-4-methyl-phenyl]-8-chloro-chromen-4-one (1100.0 mg, 2.58 mmol) in methanol (80 mL) was added Pd/C (10% Pd on carbon, 55% water) (110.0 mg, 2.58 mmol) and the reaction was stirred under H.sub.2 atmosphere at 25° C. for 12 hours. After the reaction was completed, the mixture was filtered through celite, the filtrate was concentrated in vacuo to give the crude 8-chloro-2-[5-(difluoromethyl)-2-hydroxy-4-methyl-phenyl]chromen-4-one (600 mg, 69.14% yield) as a dark brown solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 337.0.

Step 10: Preparation of Cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4-(difluoromethyl)-5-methyl-phenoxy]ethoxy]cyclobutanecarboxylic acid

(647) ##STR00565##

(648) Example C075 was prepared in analogy to the procedure described for the preparation of example C071 by using 8-chloro-2-[5-(difluoromethyl)-2-hydroxy-4-methyl-phenyl]chromen-4-one as the starting material instead of 2-(4-bromo-2-fluoro-6-hydroxy-phenyl)-8-chloro-chromen-4-one in Step 2. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.08 (br s, 1H), 8.18 (s, 1H), 7.97-8.03 (m, 2H), 7.49 (t, J=7.9 Hz, 1H), 7.11-7.39 (m, 1H), 7.24 (s, 2H), 4.30-4.37 (m, 2H), 3.96 (quin, J=7.3 Hz, 1H), 3.69-3.78 (m, 2H), 2.38-2.52 (m, 6H), 1.95-2.05 (m, 2H). (ESI.sup.+)[(M+H).sup.+]:478.9.

Example C076: Cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-hydroxy-4-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid

(649) ##STR00566##

Step 1: Preparation of 2-hydroxy-5-methoxy-4-[(4-methoxyphenyl)methoxy]benzaldehyde

(650) ##STR00567##

(651) To a mixture of 2,4-dihydroxy-5-methoxybenzaldehyde (785 mg, 4.67 mmol), sodium bicarbonate (471 mg, 5.6 mmol) in DMF (15 mL) was added 1-(chloromethyl)-4-methoxybenzene (877 mg, 5.6 mmol) and the mixture was stirred at 85° C. for 24 hours. After the reaction was completed, the reaction mixture was diluted with water (100 mL) and the resulting suspension was filtered. The solid was collected and dried in vacuo to give the crude 2-hydroxy-5-methoxy-4-[(4-methoxyphenyl)methoxy]benzaldehyde (1.06 g, 71%) as a brown solid, which was directly used for next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 288.7.

Step 2: Preparation of cis-tert-butyl 3-[2-[2-formyl-4-methoxy-5-[(4-methoxyphenyl)methoxy]phenoxy]ethoxy]cyclobutanecarboxylate

(652) ##STR00568##

(653) A mixture of 2-hydroxy-5-methoxy-4-((4-methoxybenzyl)oxy)benzaldehyde (1.06 g, 3.31 mmol), cis-tert-butyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate (1.35 g, 3.64 mmol) and K.sub.2CO.sub.3 (915 mg, 6.62 mmol) in DMF (10 mL) was heated to 50° C. for 20 hours. After the reaction was completed, the reaction mixture was diluted with water (50 mL) and EtOAc (50 ml) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give the crude cis-tert-butyl 3-[2-[2-formyl-4-methoxy-5-[(4-methoxyphenyl)methoxy]phenoxy]ethoxy]cyclobutanecarboxylate (1.91 g, 93.9% yield) as a dark brown oil, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 486.8.

Step 3: Preparation of Cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-hydroxy-4-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid

(654) ##STR00569##

(655) A mixture of cis-tert-butyl 3-[2-[2-formyl-4-methoxy-5-[(4-methoxyphenyl)methoxy]phenoxy]ethoxy]cyclobutanecarboxylate (1.6 g, 2.63 mmol), 1-(3-chloro-2-hydroxyphenyl)ethan-1-one (494 mg, 2.89 mmol) and pyrrolidine (93.6 mg, 1.32 mmol) in DMSO (10 mL) was stirred at 100° C. for 30 minutes. After the reaction was completed, the reaction mixture was diluted with water (50 ml), extracted with EtOAc (50 mL) three times. The combined organic layer was washed with 2 N HCl, water, brine, dried over anhydrous Na.sub.2SO.sub.4 and then concentrated in vacuo to give light brown oil. The brown oil was dissolved in DMSO (10 mL) and to the resulting solution was added I.sub.2 (66.8 mg, 0.26 mmol), the mixture was then stirred at 140° C. for 3 hours. After the reaction was completed, the reaction mixture was cooled to room temperature and then diluted with water (50 mL). The resulting mixture was extracted with EtOAc (50 mL) three times. The combined organic layer was directly concentrated in vacuo to give the crude Cis-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-hydroxy-4-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid (2.76 g) as a dark oil which was directly used for next step without purification. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 10.17 (s, 1H), 7.94-8.01 (m, 2H), 7.61 (s, 1H), 7.46 (s, 1H), 7.20-7.23 (m, 1H), 7.06-7.10 (m, 1H), 6.93-6.98 (m, 1H), 4.11-4.19 (m, 2H), 3.96 (br t, J=6.8 Hz, 1H), 3.83 (s, 3H), 3.66-3.73 (m, 2H), 2.76-2.80 (m, 1H), 2.38-2.45 (m, 2H), 1.91-2.05 (m, 2H). (ESI.sup.+)[(M+H).sup.+]:MS obsd. (ESI.sup.+) [(M+H).sup.+]: 461.1 Example C077: Cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4-methoxy-5-propoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid

(656) ##STR00570##

Step 1: Preparation of cis-propyl 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4-methoxy-5-propoxy-phenoxy]ethoxy]cyclobutanecarboxylate

(657) ##STR00571##

(658) To a mixture of cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-hydroxy-4-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid (346 mg, 0.3 mmol), K.sub.2CO.sub.3 (166 mg, 1.2 mmol) and NaI (45 mg, 0.3 mmol) in DMF (3 mL) was added 1-bromopropane (111 mg, 0.9 mmol) and the mixture was then stirred at 70° C. for 16 hours. After the reaction was completed, the reaction mixture was diluted with water (30 mL) and extracted with EtOAc (100 mL) three times. The combined organic layer was washed with water, brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give the crude cis-propyl 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4-methoxy-5-propoxy-phenoxy]ethoxy]cyclobutanecarboxylate (152 mg, 92.9% yield) as a dark brown oil, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 545.2

Step 2: Preparation of Cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4-methoxy-5-propoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid

(659) ##STR00572##

(660) To a solution of cis-propyl 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4-methoxy-5-propoxy-phenoxy]ethoxy]cyclobutanecarboxylate (152 mg, 0.28 mmol) in THF (4 ml) and water (1 ml) was added lithium hydroxide monohydrate (58.2 mg, 1.39 mmol) and the mixture was then stirred at room temperature for 16 hours. After the reaction was completed, the mixture was adjusted to PH˜3 by addition of 1N HCl. The reaction was then concentrated in vacuo and the residue was purified by Prep-HPLC to give cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4-methoxy-5-propoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid (50 mg, 35.6% yield) as a yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz) δ ppm 12.10 (s, 1H), 8.00-7.94 (m, 2H), 7.60 (s, 1H), 7.47 (t, J=7.9 Hz, 1H), 7.24 (s, 1H), 6.89 (s, 1H), 4.32-4.25 (m, 2H), 4.08 (t, J=6.6 Hz, 2H), 4.01-3.91 (m, 1H), 3.82 (s, 3H), 3.73-3.67 (m, 2H), 2.59-2.52 (m, 1H), 2.47-2.39 (m, 2H), 2.06-1.95 (m, 2H), 1.85-1.73 (m, 2H), 1.01 (t, J=7.4 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 503.3.

Example 078: Cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-ethoxy-4-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid

(661) ##STR00573##

(662) Example C078 was prepared in analogy to the procedure described for the preparation of example C077 by using iodoethane as the starting material instead of 1-bromopropane in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.10 (br s, 1H), 7.97 (dq, J=7.9, 1.7 Hz, 2H), 7.55-7.62 (m, 1H), 7.47 (t, J=7.9 Hz, 1H), 7.24 (s, 1H), 6.88 (s, 1H), 4.26-4.33 (m, 2H), 4.13-4.22 (m, 2H), 3.90-4.03 (m, 1H), 3.78-3.86 (m, 3H), 3.64-3.75 (m, 2H), 2.53-2.58 (m, 1H), 2.38-2.47 (m, 2H), 1.92-2.07 (m, 2H), 1.38 (t, J=7.0 Hz, 3H). (ESI.sup.+)[(M+H).sup.+]:489.2.

Example 079: Cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(cyclopropylmethoxy)-4-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid

(663) ##STR00574##

(664) Example C079 was prepared in analogy to the procedure described for the preparation of example C077 by using bromomethylcyclopropane as the starting material instead of 1-bromopropane in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz) δ ppm 12.04 (br s, 1H), 8.01-7.94 (m, 2H), 7.60 (s, 1H), 7.47 (t, J=7.9 Hz, 1H), 7.24 (s, 1H), 6.85 (s, 1H), 4.30-4.25 (m, 2H), 4.01-3.91 (m, 3H), 3.83 (s, 3H), 3.72-3.68 (m, 2H), 2.59-2.52 (m, 1H), 2.47-2.38 (m, 2H), 2.05-1.95 (m, 2H), 1.34-1.26 (m, 1H), 0.65-0.58 (m, 2H), 0.39-0.32 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 515.1.

Example 080: Cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4-methoxy-5-(2,2,2-trifluoroethoxy)phenoxy]ethoxy]cyclobutanecarboxylic acid

(665) ##STR00575##

(666) Example C080 was prepared in analogy to the procedure described for the preparation of example C077 by using 1,1,1-trifluoro-2-iodoethane as the starting material instead of 1-bromopropane in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz) δ ppm 12.05 (br s, 1H), 8.02-7.95 (m, 2H), 7.65 (s, 1H), 7.48 (t, J=7.9 Hz, 1H), 7.24 (s, 1H), 7.05 (s, 1H), 4.92 (q, J=8.8 Hz, 2H), 4.32-4.26 (m, 2H), 4.00-3.89 (m, 1H), 3.85 (s, 3H), 3.73-3.68 (m, 2H), 2.52 (d, J=1.8 Hz, 1H), 2.46-2.37 (m, 2H), 2.06-1.94 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 543.1

Example C081: Cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(difluoromethoxy)-4-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid

(667) ##STR00576##

(668) Example C081 was prepared in analogy to the procedure described for the preparation of example C077 by using sodium chlorodifluoroacetate as the starting material instead of 1-bromopropane in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz) δ ppm 12.01 (br s, 1H), 8.05-7.97 (m, 2H), 7.73 (s, 1H), 7.53-7.47 (m, 1H), 7.31-7.10 (m, 2H), 4.29-4.22 (m, 2H), 3.97-3.87 (m, 4H), 3.71-3.65 (m, 2H), 2.52-2.59 (m, 1H), 2.44-2.35 (m, 2H), 2.04-1.93 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 511.2.

Example C082: cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4-(cyclopropylmethoxy)-5-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid

(669) ##STR00577##

Step 1: Preparation of 2-fluoro-5-hydroxy-4-methoxy-benzaldehyde

(670) ##STR00578##

(671) A mixture of 6-fluoroveratraldehyde (3600.0 mg, 19.55 mmol) in sulfuric acid (36.0 mL) was stirred at 95° C. under nitrogen for 6 hours. Then the resulting mixture was poured into ice water (150 g) and the resulting suspension was filtered. The filtered cake was washed with water (100 mL) twice and dried in vacuo to give 2-fluoro-5-hydroxy-4-methoxy-benzaldehyde (3025 mg, 1 90.95% yield, purity) as a brown solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 171.1.

Step 2: Preparation of 5-(cyclopropylmethoxy)-2-fluoro-4-methoxy-benzaldehyde

(672) ##STR00579##

(673) To a solution of 2-fluoro-5-hydroxy-4-methoxy-benzaldehyde (1000.0 mg, 5.88 mmol), bromomethylcyclopropane (0.86 mL, 8.82 mmol) in DMF (25 mL) was added K.sub.2CO.sub.3 (3249.23 mg, 23.51 mmol) and the mixture was stirred at 80° C. for 2 hours. After the reaction was completed, the reaction mixture was diluted with water (100 mL) and the resulting mixture was extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine (50 mL) twice, dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluted with PE:EtOAc=6:1) to give 5-(cyclopropylmethoxy)-2-fluoro-4-methoxy-benzaldehyde (1050 mg, 79.67% yield) as a white solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 225.2.

Step 3: Preparation of 5-(cyclopropylmethoxy)-4-methoxy-2-[(4-methoxyphenyl)methoxy]benzaldehyde

(674) ##STR00580##

(675) To a mixture of 5-(cyclopropylmethoxy)-2-fluoro-4-methoxy-benzaldehyde (1000.0 mg, 4.46 mmol), Cs.sub.2CO.sub.3 (726.53 mg, 2.23 mmol) was added 4-methoxybenzyl alcohol (6161.53 mg, 44.6 mmol) and the mixture was stirred at 120° C. under microwave condition for 1 hour. The mixture was purified by reversed phase column chromatography (eluent with water/MeOH=1:3) to give 5-(cyclopropylmethoxy)-4-methoxy-2-[(4-methoxyphenyl)methoxy]benzaldehyde (515 mg, 33.73% yield) as a white solid. MS obsd. (ESI.sup.+) [(M+Na).sup.+]: 365.0.

Step 4: Preparation of 8-chloro-2-[5-(cyclopropylmethoxy)-2-hydroxy-4-methoxy-phenyl]chromen-4-one

(676) ##STR00581##

(677) Compound C082d was prepared in analogy to the procedure described for the preparation of compound C075i by using 5-(cyclopropylmethoxy)-4-methoxy-2-[(4-methoxyphenyl)methoxy]benzaldehyde as the starting material instead of 2-benzyloxy-5-(difluoromethyl)-4-methyl-benzaldehyde in Step 7.

Step 5: Preparation of cis-tert-butyl 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4-(cyclopropylmethoxy)-5-methoxy-phenoxy]ethoxy]cyclobutanecarboxylate

(678) ##STR00582##

(679) Compound C082e was prepared in analogy to the procedure described for the preparation of compound C071b by using 8-chloro-2-[5-(cyclopropylmethoxy)-2-hydroxy-4-methoxy-phenyl]chromen-4-one as the starting material instead of 2-(4-bromo-2-fluoro-6-hydroxy-phenyl)-8-chloro-chromen-4-one in Step 7.

Step 6: Preparation of cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4-(cyclopropylmethoxy)-5-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid

(680) ##STR00583##

(681) To a solution of cis-tert-butyl 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4-(cyclopropylmethoxy)-5-methoxy-phenoxy]ethoxy]cyclobutanecarboxylate (80.0 mg, 0.140 mmol) in DCM (15 mL) was added TFA (1.2 mL, 15.58 mmol) and the mixture was stirred at 25° C. for 1 hour. The mixture was then concentrated in vacuo and the residue was purified by Prep-HPLC to give cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4-(cyclopropylmethoxy)-5-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid (43 mg, 58.35% yield) as a light yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm. 12.12 (br s, 1H), 7.97 (dq, J=7.9, 1.7 Hz, 2H), 7.59 (s, 1H), 7.47 (t, J=7.9 Hz, 1H), 7.22 (s, 1H), 6.90 (s, 1H), 4.28-4.34 (m, 2H), 3.89-3.98 (m, 4H), 3.84 (d, J=7.0 Hz, 2H), 3.68-3.74 (m, 2H), 2.35-2.47 (m, 3H), 1.96-2.05 (m, 2H), 1.20-1.30 (m, 1H), 0.55-0.60 (m, 2H), 0.29-0.37 (m, 2H). MS obsd. (ESI.sup.+)[(M+H).sup.+]: 514.9.

Example C083: cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4-hydroxy-5-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid

(682) ##STR00584##

(683) A mixture of cis-tert-butyl 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4-(cyclopropylmethoxy)-5-methoxy-phenoxy]ethoxy]cyclobutanecarboxylate (50.0 mg, 0.090 mmol) in TFA (3.0 mL, 38.94 mmol) was stirred at 40° C. for 1 hour. The mixture was then concentrated in vacuo and the residue was purified by Prep-HPLC to give cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4-hydroxy-5-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid (25.2 mg, 62.38% yield) as a yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 9.11 (s, 1H), 7.97 (ddd, J=7.9, 1.6 Hz, 2H), 7.53 (s, 1H), 7.46 (t, J=7.9 Hz, 1H), 7.25 (s, 1H), 6.85 (s, 1H), 4.24-4.29 (m, 2H), 3.96 (t, J=7.0 Hz, 1H), 3.90 (s, 3H), 3.67-3.73 (m, 2H), 2.52-2.56 (m, 1H), 2.35-2.47 (m, 2H), 1.97-2.08 (m, 2H). (ESI.sup.+)[(M+H).sup.+]: 460.9.

Example C084: cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4-ethoxy-5-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid

(684) ##STR00585##

(685) Example C084 was prepared in analogy to the procedure described for the preparation of example C082 by using iodoethane as the starting material instead of bromomethylcyclopropane in Step 2. .sup.1H NMR (DMSO-<fc, 400 MHz): δ ppm 7.94-8.00 (m, 2H), 7.59 (s, 1H), 7.47 (t, J=7.9 Hz, 1H), 7.24 (s, 1H), 6.89 (s, 1H), 4.24-4.36 (m, 2H), 3.88-4.09 (m, 6H), 3.65-3.77 (m, 2H), 2.52-2.58 (m, 1H), 2.38-2.48 (m, 2H), 1.96-2.08 (m, 2H), 1.36 (t, J=7.0 Hz, 3H). (ESI.sup.+)[(M+H).sup.+]:489.0.

Example C085: cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methoxy-4-(2,2,2-trifluoroethoxy)phenoxy]ethoxy]cyclobutanecarboxylic acid

(686) ##STR00586##

(687) Example C085 was prepared in analogy to the procedure described for the preparation of example C082 by using 2,2,2-trifluoroethyl trifluoromethanesulfonate as the starting material instead of bromomethylcyclopropane in Step 2. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.11 (br s, 1H), 7.96-8.01 (m, 2H), 7.69 (s, 1H), 7.48 (t, J=7.9 Hz, 1H), 7.20 (s, 1H), 6.96 (s, 1H), 4.70 (q, J=9.0 Hz, 2H), 4.28-4.38 (m, 1H), 3.95 (s, 3H), 3.67-3.77 (m, 2H), 2.52-2.57 (m, 3H), 2.38-2.47 (m, 2H), 1.95-2.04 (m, 2H). (ESI.sup.+)[(M+H).sup.+]:543.1.

Example C086: cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4-(difluoromethoxy)-5-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid

(688) ##STR00587##

(689) Example C086 was prepared in analogy to the procedure described for the preparation of example C082 by using sodium chlorodifluoroacetate as the starting material instead of bromomethylcyclopropane in Step 2. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.12 (br s, 1H), 7.94-8.03 (m, 2H), 7.85 (s, 1H), 7.48 (t, J=7.9 Hz, 1H), 7.24 (s, 1H), 6.95 (br d, 1H), 6.87 (s, 1H), 4.34-4.42 (m, 2H), 3.89-4.06 (m, 4H), 3.70-3.83 (m, 2H), 2.52-2.59 (m, 1H), 2.37-2.47 (m, 2H), 1.95-2.07 (m, 2H). (ESI.sup.+)[(M+H).sup.+]:511.1.

Example C087: cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4,5-bis(difluoromethoxy)phenoxy]ethoxy]cyclobutanecarboxylic acid

(690) ##STR00588##

Step 1: Preparation of cis-tert-butyl 3-[2-[[6-(8-chloro-4-oxo-chromen-2-yl)-1,3-benzodioxol-5-yl]oxy]ethoxy]cyclobutanecarboxylate

(691) ##STR00589##

(692) Compound C087a was prepared in analogy to the procedure described for the preparation of compound C071b by using 8-chloro-2-(6-hydroxy-1,3-benzodioxol-5-yl)chromen-4-one as the starting material instead of 2-(4-bromo-2-fluoro-6-hydroxy-phenyl)-8-chloro-chromen-4-one in Step 7.

Step 2: Preparation of cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4,5-dihydroxy-phenoxy]ethoxy]cyclobutanecarboxylic acid

(693) ##STR00590##

(694) To a solution of cis-tert-butyl 3-[2-[[6-(8-chloro-4-oxo-chromen-2-yl)-1,3-benzodioxol-5-yl]oxy]ethoxy]cyclobutanecarboxylate (250.0 mg, 0.490 mmol) in DCM (20 mL) was added AlCl.sub.3 (517.88 mg, 3.88 mmol) and the mixture was stirred at 30° C. for 1 hour. The reaction was quenched with water (25 mL) and the resulting mixture was extracted with DCM (25 mL) twice. The combined organic layer was washed with brine, dried over MgSO.sub.4, filtered and the filtrate was concentrated in vacuo to give the crude cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4,5-dihydroxy-phenoxy]ethoxy]cyclobutanecarboxylic acid (210 mg, 89.1% yield) as a red solid. (ESI.sup.+)[(M+H).sup.+]:477.1.

Step 3: Preparation of cis-methyl 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4,5-dihydroxy-phenoxy]ethoxy]cyclobutanecarboxylate

(695) ##STR00591##

(696) To a solution of cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4,5-dihydroxy-phenoxy]ethoxy]cyclobutanecarboxylic acid (350.0 mg, 0.780 mmol) in MeOH (40 mL) was added SOCl.sub.2 (1.0 mL, 0.780 mmol) and the resulting mixture was stirred at 30° C. for 3 hours. Then the reaction mixture was concentrated in vacuo and the residue was purified by column chromatography on silica gel (eluted with PE/EtOAc=3:1 to 1:10) to give cis-methyl 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4,5-dihydroxy-phenoxy]ethoxy]cyclobutanecarboxylate (280 mg, 77.56% yield) as a light yellow solid.

Step 4: Preparation of cis-methyl 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4,5-bis(difluoromethoxy)phenoxy]ethoxy]cyclobutanecarboxylate

(697) ##STR00592##

(698) To a solution of cis-methyl 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4,5-dihydroxy-phenoxy]ethoxy]cyclobutanecarboxylate (120.0 mg, 0.260 mmol), (2-chloro-2,2-difluoro-acetyl)oxysodium (79.4 mg, 0.520 mmol) in DMF (8 mL) was added Cs.sub.2CO.sub.3 (254.51 mg, 0.780 mmol) and the mixture was stirred at 80° C. for 3 hours. The mixture was then concentrated in vacuo and the residue was purified by column chromatography on silica gel (eluted with PE:EtOAc=3:1) to give cis-methyl 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4,5-bis(difluoromethoxy)phenoxy]ethoxy]cyclobutanecarboxylate (65 mg, 044.51% yield) as a yellow solid. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 561.1.

Step 5: Preparation of cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4,5-bis(difluoromethoxy)phenoxy]ethoxy]cyclobutanecarboxylic acid

(699) ##STR00593##

(700) To a solution of cis-methyl 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4,5-bis(difluoromethoxy)phenoxy]ethoxy]cyclobutanecarboxylate (60.0 mg, 0.110 mmol) in THF (5 mL) and water (1 mL) was added LiOH (11 mg, 0.50 mmol). The reaction mixture was stirred at room temperature for 2 hours. Then the mixture was adjusted to pH ˜5 by addition of 2N HCl. The resulting mixture was concentrated in vacuo and the residue was purified by Prep-HPLC to give 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4,5-bis(difluoromethoxy)phenoxy]ethoxy]cyclobutanecarboxylic acid (12 mg, 20.1% yield) as an off-white solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.99-8.04 (m, 2H), 7.96 (s, 1H), 7.50 (t, J=7.9 Hz, 1H), 7.43 (dd, 1H), 7.28 (m, 1H), 7.23 (s, 1H), 7.18 (dd, 1H), 4.28-4.40 (m, 2H), 3.82-4.06 (m, 1H), 3.66-3.76 (m, 2H), 2.25-2.46 (m, 3H), 1.93-2.04 (m, 2H). MS obsd. (ESI.sup.+)[(M+H).sup.+]: 547.1.

Example C088: Cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4,5-diethoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid

(701) ##STR00594##

(702) Example C088 was prepared in analogy to the procedure described for the preparation of example C077 by using cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4,5-dihydroxy-phenoxy]ethoxy]cyclobutanecarboxylic acid and iodoethane as the starting material instead of cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-hydroxy-4-methoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid and 1-bromopropane in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.09 (s, 1H), 7.97 (dd, J=7.8, 3.3 Hz, 2H), 7.60 (s, 1H), 7.47 (t, J=7.9 Hz, 1H), 7.24 (s, 1H), 6.88 (s, 1H), 4.25-4.29 (m, 2H), 4.19 (dd, J=13.9, 6.9 Hz, 2H), 4.08 (dd, J=13.9, 6.9 Hz, 2H), 3.93-4.09 (m, 1H), 3.70 (s, 2H), 2.42 (dd, J=12.1, 4.8 Hz, 3H), 1.94-2.07 (m, 2H), 1.37 (dd, J=15.3, 7.0 Hz, 6H). (ESI.sup.+)[(M+H).sup.+]:503.0.

Example C089: Cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methoxy-4-(trifluoromethoxy)phenoxy]ethoxy]cyclobutanecarboxylic acid

(703) ##STR00595##

Step 1: Preparation of cis-tert-butyl 3-[2-[5-bromo-2-formyl-4-(trifluoromethoxy)phenoxy]ethoxy]cyclobutanecarboxylate

(704) ##STR00596##

(705) To a mixture of 4-bromo-2-hydroxy-5-(trifluoromethoxy)benzaldehyde (221.8 mg, 0.780 mmol), cis-tert-butyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate (432.44 mg, 1.17 mmol) in DMF (20 mL) was added K.sub.2CO.sub.3 (537.77 mg, 3.89 mmol) and the reaction was stirred at 80° C. for 4 hours. The reaction was diluted with water (200 mL) and the resulting mixture was extracted with EtOAc (150 mL) three times. The combined organic layer was washed with water (100 mL) twice, brine (100 mL), dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluent with PE:EtOAc=4:1) to give cis-tert-butyl 3-[2-[5-bromo-2-formyl-4-(trifluoromethoxy)phenoxy]ethoxy]cyclobutanecarboxylate (300 mg, 79.77% yield) as a colorless oil. MS obsd. (ESI.sup.+) [(M+Na).sup.+]: 505.0.

Step 2: Preparation of cis-tert-butyl 3-[2-[2-formyl-5-hydroxy-4-(trifluoromethoxy)phenoxy]ethoxy]cyclobutanecarboxylate

(706) ##STR00597##

(707) To a solution of cis-tert-butyl 3-[2-[5-bromo-2-formyl-4-(trifluoromethoxy)phenoxy]ethoxy]cyclobutanecarboxylate (200.0 mg, 0.410 mmol), 4-methoxybenzyl alcohol (171.53 mg, 1.24 mmol), tBuXPhos (7.03 mg, 0.020 mmol) in 1,4-dioxane (15 mL) was added Pd.sub.2(dba).sub.3 (7.58 mg, 0.010 mmol) under N.sub.2 atmosphere. The mixture was stirred at 100° C. for 16 hours. The mixture was cooled to room temperature and concentrated in vacuo. The residue was purified by prep-HPLC to give cis-tert-butyl 3-[2-[2-formyl-5-hydroxy-4-(trifluoromethoxy)phenoxy]ethoxy]cyclobutanecarboxylate (70 mg, 40.24% yield) as dense oil. MS obsd. (ESI.sup.+) [(M+Na).sup.+]: 443.1.

Step 3: Preparation of cis-tert-butyl 3-[2-[2-formyl-5-methoxy-4-(trifluoromethoxy)phenoxy]ethoxy]cyclobutanecarboxylate

(708) ##STR00598##

(709) To a solution of cis-tert-butyl 3-[2-[2-formyl-5-hydroxy-4-(trifluoromethoxy)phenoxy]ethoxy]cyclobutanecarboxylate (70.0 mg, 0.170 mmol), K.sub.2CO.sub.3 (45.96 mg, 0.330 mmol) in ACN (2 mL) was added iodomethane (28.36 mg, 0.200 mmol) and the mixture was stirred at 30° C. for 10 hours. The mixture was concentrated in vacuo and the residue was purified by column chromatography on silica gel (eluted with PE:EtOAc=3:1) to give cis-tert-butyl 3-[2-[2-formyl-5-methoxy-4-(trifluoromethoxy)phenoxy]ethoxy]cyclobutanecarboxylate (65 mg, 89.8% yield) as a colorless oil. MS obsd. (ESI.sup.+)[(M+Na).sup.+]: 457.0.

Step 4: Preparation of cis-tert-butyl 3-[2-[2-[(E)-3-(3-chloro-2-hydroxy-phenyl)-3-oxo-prop-1-enyl]-5-methoxy-4-(trifluoromethoxy)phenoxy]ethoxy]cyclobutanecarboxylate

(710) ##STR00599##

(711) A mixture of 1-(3-chloro-2-hydroxy-phenyl)ethanone (27.49 mg, 0.160 mmol), cis-tert-butyl 3-[2-[2-formyl-4-methoxy-5-(trifluoromethoxy)phenoxy]ethoxy]cyclobutanecarboxylate (70.0 mg, 0.160 mmol), KOH (90.42 mg, 1.61 mmol) in EtOH (5 mL) was stirred at 40° C. for 20 hours. The mixture was poured into 1N HCl (15 mL) and the resulting suspension was filtered. The solid was collected and dried in vacuo to give cis-tert-butyl 3-[2-[2-[(E)-3-(3-chloro-2-hydroxy-phenyl)-3-oxo-prop -1-enyl]-5-methoxy-4-(trifluoromethoxy)phenoxy]ethoxy]cyclobutanecarboxylate (80 mg, 84.58% yield) as a yellow solid. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 531.1.

Step 4: Preparation of cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methoxy-4-(trifluoromethoxy)phenoxy]ethoxy]cyclobutanecarboxylic acid

(712) ##STR00600##

(713) A mixture of cis-3-[2-[2-[(E)-3-(3-chloro-2-hydroxy-phenyl)-3-oxo-prop-1-enyl]-5-methoxy-4-(trifluoromethoxy)phenoxy]ethoxy]cyclobutanecarboxylic acid (80.0 mg, 0.150 mmol) and iodine (4.3 mg, 0.020 mmol) in DMSO (2 mL) was stirred at 140° C. for 3 hours. The resulting mixture was purified by prep-HPLC to give cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-methoxy-4-(trifluoromethoxy)phenoxy]ethoxy]cyclobutanecarboxylic acid (26 mg, 32.3% yield) as an off-white solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz) δ ppm 12.11 (br s, 1H), 7.99 (dd, J=7.2, 5.7 Hz, 3H), 7.48 (t, J=7.9 Hz, 1H), 7.24 (s, 1H), 7.07 (s, 1H), 4.41 (s, 2H), 4.01 (s, 3H), 3.92-3.99 (m, 1H), 3.76 (d, J=4.5 Hz, 2H), 2.39-2.47 (m, 3H), 2.01 (dd, J=20.0, 8.8 Hz, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 529.0.

Example C090: Cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-hydroxy-4-(trifluoromethoxy)phenoxy]ethoxy]cyclobutanecarboxylic acid

(714) ##STR00601##

Step 1: Preparation of cis-tert-butyl 3-[2-[2-formyl-5-[(4-methoxyphenyl)methoxy]-4-(trifluoromethoxy)phenoxy]ethoxy]cyclobutanecarboxylate

(715) ##STR00602##

(716) To a solution of cis-tert-butyl 3-[2-[2-formyl-5-hydroxy-4-(trifluoromethoxy)phenoxy]ethoxy]cyclobutanecarboxylate (140.0 mg, 0.330 mmol), K.sub.2CO.sub.3 (91.92 mg, 0.670 mmol) in ACN (12 mL) was added 4-methoxybenzylchloride (0.05 mL, 0.400 mmol) and the mixture was stirred at 60° C. for 16 hours. The mixture was concentrated in vacuo and the residue was purified by column chromatography on silica gel (eluted with PE:EtOAc=3:1) to give cis-tert-butyl 3-[2-[2-formyl-5-[(4-methoxyphenyl)methoxy]-4-(trifluoromethoxy)phenoxy]ethoxy]cyclobutanecarboxylate (160 mg, 0.300 mmol) as a colorless oil. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 563.2.

Step 2: Preparation of cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-[(4-methoxyphenyl)methoxy]-4-(trifluoromethoxy)phenoxy]ethoxy]cyclobutanecarboxylic acid

(717) ##STR00603##

(718) Compound C090b was prepared in analogy to the procedure described for the preparation of example C082 by using cis-tert-butyl 3-[2-[2-formyl-5-[(4-methoxyphenyl)methoxy]-4-(trifluoromethoxy)phenoxy]ethoxy]cyclobutanecarboxylate as the starting material instead of cis-tert-butyl 3-[2-[2-formyl-4-methoxy-5-(trifluoromethoxy)phenoxy]ethoxy]cyclobutanecarboxylate in Step 3. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 635.1.

Step 3: Preparation of cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-hydroxy-4-(trifluoromethoxy)phenoxy]ethoxy]cyclobutanecarboxylic acid

(719) ##STR00604##

(720) A mixture of cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-[(4-methoxyphenyl)methoxy]-4-(trifluoromethoxy)phenoxy]ethoxy]cyclobutanecarboxylic acid (95.99 mg, 0.150 mmol) and TFA (0.001 mL, 0.020 mmol) in DMSO (2 mL) was stirred at 140° C. for 3 hours. The mixture was concentrated in vacuo, the residue was purified by Prep-HPLC to give cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-hydroxy-4-(trifluoromethoxy)phenoxy]ethoxy]cyclobutanecarboxylic acid (5 mg, 6.06% yield) as a grey solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz) δ ppm 12.09 (br s, 1H), 11.29 (s, 1H), 7.97 (dd, J=14.9, 7.0 Hz, 3H), 7.47 (t, J=7.9 Hz, 1H), 7.21 (s, 1H), 6.80 (s, 1H), 4.18-4.28 (m, 2H), 3.92-3.99 (m, 1H), 3.68-3.77 (m, 2H), 2.39-2.44 (m, 3H), 1.94-2.05 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 515.1.

Example C091: Cis-3-[2-[6-(8-chloro-4-oxo-chromen-2-yl)-2-oxo-indolin-5-yl]oxyethoxy]cyclobutanecarboxylic acid

(721) ##STR00605##

Step 1: Preparation of cis-methyl 4-bromo-2-[2-(3-tert-butoxycarbonylcyclobutoxy)ethoxy]benzoate

(722) ##STR00606##

(723) To a mixture of methyl 4-bromo-2-hydroxybenzoate (2 g, 8.66 mmol), K.sub.2CO.sub.3 (2.39 g, 17.3 mmol) in DMF (20 mL) was added cis-tert-butyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate (3.85 g, 10.4 mmol) and the resulting mixture was stirred at 50° C. for 16 hours. After the reaction was completed, the reaction mixture was diluted with water (60 mL) and extracted with EtOAc (100 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give the crude cis-methyl 4-bromo-2-[2-(3-tert-butoxycarbonylcyclobutoxy)ethoxy]benzoate (4.41 g, 95.6% yield) as a yellow oil, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 428.9.

Step 2: Preparation of cis-3-[2-(5-bromo-2-methoxycarbonyl-4-nitro-phenoxy)ethoxy]cyclobutanecarboxylic acid

(724) ##STR00607##

(725) To a solution of cis-methyl 4-bromo-2-[2-(3-tert-butoxycarbonylcyclobutoxy)ethoxy]benzoate (4.31 g, 8.43 mmol) in Conc.H.sub.2SO.sub.4 (50 mL) was added KNO.sub.3 (938 mg, 9.28 mmol) at 0° C. in small portions while keeping inner temperature below 5° C. After addition, the mixture stirred at 0° C. for another 20 minutes and then the reaction mixture was poured into ice-water (200 g). The resulted suspension was extracted with EtOAc (100 mL) three times, the combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give the crude cis-3-[2-(5-bromo-2-methoxycarbonyl-4-nitro-phenoxy)ethoxy]cyclobutanecarboxylic acid (3.54 g, 100% yield) as a yellow solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 417.8

Step 3: Preparation of cis-3-[2-[5-bromo-2-[3-(3-chloro-2-hydroxy-phenyl)-3-oxo-propanoyl]-4-nitro-phenoxy]ethoxy]cyclobutanecarboxylic acid

(726) ##STR00608##

(727) To LiHMDS solution (1 mol/L in THF, 5 mL, 5 mmol) was added cooled at −78° C. was added 1-(3-chloro-2-hydroxyphenyl)ethan-1-one solution (2 mol/L in THF, 2 mL, 2 mmol) dropwise and resulting solution was stirred at −78° C. 30 min. Then to the resulting mixture was added cis-3-[2-(5-bromo-2-methoxycarbonyl-4-nitro-phenoxy)ethoxy]cyclobutanecarboxylic acid (935 mg, 2 mmol, dissolved in THF (3 mL)) at −78° C. and the reaction was then warmed to room temperature and stirred at room temperature for 16 hours. Then reaction mixture was diluted with water (25 mL) and adjusted to pH 5.0 by addition of AcOH, the resulting mixture was extracted with EtOAc (60 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give the crude cis-3-[2-[5-bromo-2-[3-(3-chloro-2-hydroxy-phenyl)-3-oxo-propanoyl]-4-nitro-phenoxy]ethoxy]cyclobutanecarboxylic acid (710 mg, 63.8% yield) as a brown solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 556.0.

Step 4: Preparation of cis-3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-4-nitro-phenoxy]ethoxy]cyclobutanecarboxylic acid

(728) ##STR00609##

(729) To a mixture of cis-3-[2-[5-bromo-2-[3-(3-chloro-2-hydroxy-phenyl)-3-oxo-propanoyl]-4-nitro-phenoxy]ethoxy]cyclobutanecarboxylic acid (710 mg, 1.28 mmol) in AcOH (10 mL) was added Con. H.sub.2SO.sub.4 (0.05 mL) and the resulting mixture was stirred at 100° C. for 1 hour. The mixture was concentrated in vacuo and the residue was purified by column chromatography on silica gel (eluted with PE:EtOAc 5:1 to 1:10) to give cis-3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-4-nitro-phenoxy]ethoxy]cyclobutanecarboxylic acid (360 mg, 52% yield) as a brown foam, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 537.9

Step 5: Preparation of cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(2-methoxy-1-methoxycarbonyl-2-oxo-ethyl)-4-nitro-phenoxy]ethoxy]cyclobutanecarboxylic acid

(730) ##STR00610##

(731) A mixture of cis-3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)-4-nitro-phenoxy]ethoxy]cyclobutanecarboxylic acid (333 mg, 0.62 mmol), dimethyl malonate (98 mg, 0.74 mmol) and K.sub.2CO.sub.3 (342 mg, 2.47 mmol) in DMF (5 mL) was stirred at 70° C. overnight. After cooling to room temperature, the reaction mixture was diluted with water (30 mL), adjusted to PH˜3 by addition of 1N HCl and the resulting mixture was extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give the crude cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(2-methoxy-1-methoxycarbonyl-2-oxo-ethyl)-4-nitro-phenoxy]ethoxy]cyclobutanecarboxylic acid (265 mg, 73% yield) as a brown oil, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 590.1

Step 6: Preparation of cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(2-methoxy-2-oxo-ethyl)-4-nitro-phenoxy]ethoxy]cyclobutanecarboxylic acid

(732) ##STR00611##

(733) A mixture of cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(2-methoxy-1-methoxycarbonyl-2-oxo-ethyl)-4-nitro-phenoxy]ethoxy]cyclobutanecarboxylic acid (240 mg, 0.41 mmol), lithium chloride (51.7 mg, 1.22 mmol) in DMSO (3 mL) and water (0.3 mL) was stirred at 100° C. for 16 hours. After cooling to room temperature, the reaction mixture was diluted with water (20 mL) and adjusted to pH˜3 by addition of 1N HCl. The resulting mixture was extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give the crude cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(2-methoxy-2-oxo-ethyl)-4-nitro-phenoxy]ethoxy]cyclobutanecarboxylic acid (306 mg) as a brown oil, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+E1).sup.+]: 532.1

Step 7: Preparation of cis-3-[2-[6-(8-chloro-4-oxo-chromen-2-yl)-2-oxo-indolin-5-yl]oxyethoxy]cyclobutanecarboxylic acid

(734) ##STR00612##

(735) A mixture of cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(2-methoxy-2-oxo-ethyl)-4-nitro-phenoxy]ethoxy]cyclobutanecarboxylic acid (168 mg, 0.32 mmol), sodium hydrosulfite (275 mg, 1.58 mmol) in EtOH (6 mL) and water (2 mL) was stirred at 110° C. for 4 hours. After cooling to room temperature, the reaction mixture was diluted with water and adjusted to PH˜3 by addition of 2 N HCl. The resulting mixture was extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by Prep-HPLC to give cis-3-[2-[6-(8-chloro-4-oxo-chromen-2-yl)-2-oxo-indolin-5-yl]oxyethoxy]cyclobutanecarboxylic acid (6 mg, 4%) as a yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz) δ ppm 10.46 (s, 1H), 8.02-7.97 (m, 2H), 7.49 (t, J=7.9 Hz, 1H), 7.44 (s, 1H), 7.28-7.24 (m, 2H), 4.25-4.19 (m, 2H), 3.95-3.85 (m, 1H), 3.69-3.66 (m, 2H), 3.59 (s, 2H), 2.42-2.32 (m, 3H), 2.05-1.93 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 470.1

Example C092: cis-3-[2-[6-(8-chloro-4-oxo-chromen-2-yl)-3,3-dimethyl-2-oxo-indolin-5-yl]oxyethoxy]cyclobutanecarboxylic acid

(736) ##STR00613##

Step 1: Preparation of cis-methyl 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(2-methoxy-1,1-dimethyl-2-oxo-ethyl)-4-nitro-phenoxy]ethoxy]cyclobutanecarboxylate

(737) ##STR00614##

(738) To a solution of cis-3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(2-methoxy-2-oxo-ethyl)-4-nitro-phenoxy]ethoxy]cyclobutanecarboxylic acid (160 mg, 0.3 mmol), Mel (170 mg, 1.2 mmol) in DMF (2 mL) was added NaH (48 mg, 1.2 mmol) at 0° C. and the mixture was then stirred at room temperature for 6 hours. The reaction mixture was diluted with water (20 mL) and extracted with EtOAc (20 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo to give the crude cis-methyl 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(2-methoxy-1, l-dimethyl-2-oxo-ethyl)-4-nitro-phenoxy]ethoxy]cyclobutanecarboxylate (162 mg, 92.9% yield) as a brown oil, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 574.2

Step 2: Preparation of cis-methyl 3-[2-[6-(8-chloro-4-oxo-chromen-2-yl)-3,3-dimethyl-2-oxo-indolin-5-yl]oxyethoxy]cyclobutanecarboxylate

(739) ##STR00615##

(740) A mixture of cis-methyl 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(2-methoxy-1,1-dimethyl-2-oxo-ethyl)-4-nitro-phenoxy]ethoxy]cyclobutanecarboxylate (crude, 162 mg, 0.28 mmol) and iron (221 mg, 3.95 mmol) in AcOH (3 mL) was stirred at 100° C. for 6 hours. After cooling to room temperature, the reaction mixture was diluted with THF (30 mL) and then filtered. The filtrate was concentrated in vacuo to give the crude cis-methyl 3-[2-[6-(8-chloro-4-oxo-chromen-2-yl)-3,3-dimethyl-2-oxo-indolin-5-yl]oxyethoxy]cyclobutanecarboxylate (213 mg) as a brown oil, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 512.4

Step 3: Preparation of cis-3-[2-[6-(8-chloro-4-oxo-chromen-2-yl)-3,3-dimethyl-2-oxo-indolin-5-yl]oxyethoxy]cyclobutanecarboxylic acid

(741) ##STR00616##

(742) A mixture of cis-methyl 3-[2-[6-(8-chloro-4-oxo-chromen-2-yl)-3,3-dimethyl-2-oxo-indolin-5-yl]oxyethoxy]cyclobutanecarboxylate (213 mg, 0.17 mmol, crude prepared above), lithium hydroxide monohydrate (140 mg, 3.33 mmol) in THF (4 mL) and water (1 mL) was stirred at room temperature for 3 hours. The mixture was adjusted to PH˜3 by addition of 1N HCl and concentrated in vacuo. The residue was purified by Prep-HPLC to give ds-3-[2-[6-(8-chloro-4-oxo-chromen-2-yl)-3,3-dimethyl-2-oxo-indolin-5-yl]oxyethoxy]cyclobutanecarboxylic acid (12 mg, 14% yield) as a yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz) δ ppm 10.42 (s, 1H), 8.00 (d, J=7.9 Hz, 2H), 7.52-7.39 (m, 3H), 7.21 (s, 1H), 4.30-4.22 (m, 2H), 4.00-3.88 (m, 1H), 3.72-3.63 (m, 2H), 2.44-2.35 (m, 3H), 2.03-1.93 (m, 2H), 1.31 (s, 6H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 512.4

Example C093: Cis-3-[2-[6-(8-chloro-4-oxo-chromen-2-yl)-1,3,3-trimethyl-2-oxo-indolin-5-yl]oxyethoxy]cyclobutanecarboxylic acid

(743) ##STR00617##

Step 1: Preparation of cis-methyl 3-[2-[6-(8-chloro-4-oxo-chromen-2-yl)-1,3,3-trimethyl-2-oxo-indolin-5-yl]oxyethoxy]cyclobutanecarboxylate

(744) ##STR00618##

(745) To a solution of cis-3-[2-[6-(8-chloro-4-oxo-chromen-2-yl)-2-oxo-indolin-5-yl]oxyethoxy]cyclobutanecarboxylic acid (390 mg, 0.58 mmol) in DMF (6 mL) was added NaH (232 mg, 5.81 mmol) at 0° C. and the mixture was stirred at 0° C. for 30 minutes. Then to the resulting mixture was added Mel (660 mg, 4.65 mmol) and the reaction mixture was stirred at room temperature for 16 hours. The reaction mixture was diluted with water (50 mL) and the resulting suspension was filtered. The solid was collected and dried in vacuo to give the crude cis-methyl 3-[2-[6-(8-chloro-4-oxo-chromen-2-yl)-1,3,3-trimethyl-2-oxo-indolin-5-yl]oxyethoxy]cyclobutanecarboxylate (331 mg, 87% yield) as a brown solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 526.5

Step 2: Preparation of cis-3-[2-[6-(8-chloro-4-oxo-chromen-2-yl)-1,3,3-trimethyl-2-oxo-indolin-5-yl]oxyethoxy]cyclobutanecarboxylic acid

(746) ##STR00619##

(747) A mixture of cis-methyl 3-[2-[6-(8-chloro-4-oxo-chromen-2-yl)-1,3,3-trimethyl-2-oxo-indolin-5-yl]oxyethoxy]cyclobutanecarboxylate (331 mg, 0.5 mmol) and lithium hydroxide monohydrate (211 mg, 5 mmol) in THF (4 mL) and water (1 mL) was stirred at room temperature for 2 hours. The mixture was adjusted to pH˜3 by addition of 1N HCl and concentrated in vacuo. The residue was purified by Prep-HPLC to give cis-3-[2-[6-(8-chloro-4-oxo-chromen-2-yl)-1,3,3-trimethyl-2-oxo-indolin-5-yl]oxyethoxy]cyclobutanecarboxylic acid (12 mg, 4% yield) as a yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz) δ ppm 8.05-7.98 (m, 2H), 7.54-7.47 (m, 3H), 7.17 (s, 1H), 4.33-4.25 (m, 2H), 3.96-3.87 (m, 1H), 3.72-3.64 (m, 2H), 3.18 (s, 3H), 2.45-2.30 (m, 3H), 2.03-1.90 (m, 2H), 1.34 (s, 6H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 512.1.

Example C094: cis-3-[2-[2-[8-chloro-4-oxo-5-(trifluoromethyl)chromen-2-yl]phenoxy]ethoxy]cyclobutanecarboxylic acid

(748) ##STR00620##

Step 1: Preparation of 5-bromo-8-chloro-2-(2-hydroxyphenyl)chromen-4-one

(749) ##STR00621##

(750) Compound C094a was prepared in analogy to the procedure described for the preparation of compound Int-1 by using 1-(6-bromo-3-chloro-2-hydroxy-phenyl)ethanone and 2-hydroxybenzaldehyde as the starting material instead of 1-(3-chloro-2-hydroxy-phenyl)ethanone and 2-methoxy-4-(trifluoromethyl)benzaldehyde in Step 1.

Step 2: Preparation of cis-tert-butyl 3-[2-[2-(5-bromo-8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate

(751) ##STR00622##

(752) A solution of 5-bromo-8-chloro-2-(2-hydroxyphenyl)chromen-4-one (200.0 mg, 0.570 mmol), cis-tert-butyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate (210.74 mg, 0.570 mmol) and potassium carbonate (235.86 mg, 1.71 mmol) in DMF (10 mL) was stirred at 80° C. for 3 hours. The mixture was then concentrated in vacuo and the residue was purified by column chromatography on silica gel (eluted with PE:EtOAc=20:1 to 3:1) to give cis-tert-butyl 3-[2-[2-(5-bromo-8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate (145 mg, 46.36% yield) as light yellow oil. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 549.0.

Step 3: Preparation of cis-3-[2-[2-[8-chloro-4-oxo-5-(trifluoromethyl)chromen-2-yl]phenoxy]ethoxy]cyclobutanecarboxylic acid

(753) ##STR00623##

(754) A mixture of cis-tert-butyl 3-[2-[2-(5-bromo-8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate (145.0 mg, 0.260 mmol), methyl 2,2-difluoro-2-(fluorosulfonyl)acetate (253.31 mg, 1.32 mmol) and copper (I) iodide (100.45 mg, 0.530 mmol) in DMF (3.5 mL) was stirred at 120° C. for 12 hours. The mixture was then concentrated in vacuo and the residue was purified by Prep-HPLC to give cis-3-[2-[2-[8-chloro-4-oxo-5-(trifluoromethyl)chromen-2-yl]phenoxy]ethoxy]cyclobutanecarboxylic acid (24.9 mg, 19.56% yield) as an off-white solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.02 (br s, 1H), 8.17 (d, J=8.4 Hz, 1H), 8.05 (d, J=7.8 Hz, 1H), 7.88 (d, J=8.4 Hz, 1H), 7.60 (t, J=7.9 Hz, 1H), 7.19-7.34 (m, 3H), 4.24-4.34 (m, 2H), 3.96 (quin, J=7.3 Hz, 1H), 3.68-3.77 (m, 2H), 2.36-2.46 (m, 3H), 1.92-2.04 (m, 2H). MS obsd. (ESI.sup.+): [(M+H).sup.+]:483.5.

Example C095: cis-3-[2-[2-[8-chloro-4-oxo-5-(trifluoromethyl)chromen-2-yl]-5-ethoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid

(755) ##STR00624##

Step 1: Preparation of 5-bromo-8-chloro-2-(4-ethoxy-2-hydroxy-phenyl)chromen-4-one

(756) ##STR00625##

(757) Compound C095a was prepared in analogy to the procedure described for the preparation of compound Int-5 by using 2-hydroxy-5-methoxy-benzaldehyde as the starting material instead of 4-chloro-2-hydroxy-5-methyl-benzaldehyde in Step 2 and 1-(6-bromo-3-chloro-2-hydroxy-phenyl)ethanone as the starting material instead of 1-(3-chloro-2-hydroxy-phenyl)ethanone in step 3.

Step 2: Preparation of cis-3-[2-[2-[8-chloro-4-oxo-5-(trifluoromethyl)chromen-2-yl]-5-ethoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid

(758) ##STR00626##

(759) Example C095 was prepared in analogy to the procedure described for the preparation of example C094 by using 5-bromo-8-chloro-2-(4-ethoxy-2-hydroxy-phenyl)chromen-4-one as the starting material instead of 5-bromo-8-chloro-2-(2-hydroxyphenyl)chromen-4-one in Step 2. .sup.1H NMR (DMSO-<fc, 400 MHz): δ ppm 12.06 (br s, 1H), 8.14 (d, J=8.4 Hz, 1H), 8.01 (d, J=8.7 Hz, 1H), 7.85 (d, J=8.4 Hz, 1H), 7.21 (s, 1H), 6.77-6.83 (m, 2H), 4.24-4.33 (m, 2H), 4.16 (q, J=6.9 Hz, 2H), 3.98 (quin, J=7.2 Hz, 1H), 3.68-3.77 (m, 2H), 2.39-2.48 (m, 3H), 1.95-2.04 (m, 2H), 1.37 (t, J=7.0 Hz, 3H). (ESI.sup.+)[(M+H).sup.+]:527.1.

Example C096: Cis-3-[2-[2-[8-chloro-4-oxo-5-(trifluoromethyl)chromen-2-yl]-4,5-dimethoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid

(760) ##STR00627##

Step 1: Preparation of 5-bromo-8-chloro-2-(2-hydroxy-4,5-dimethoxy-phenyl)chromen-4-one

(761) ##STR00628##

(762) Compound C096a was prepared in analogy to the procedure described for the preparation of compound Int-5 by using 2-hydroxy-4,5-dimethoxy-benzaldehyde as the starting material instead of 4-chloro-2-hydroxy-5-methyl-benzaldehyde in Step 2 and 1-(6-bromo-3-chloro-2-hydroxy-phenyl)ethanone as the starting material instead of 1-(3-chloro-2-hydroxy-phenyl)ethanone in step 3.

Step 2: Preparation of cis-3-[2-[2-[8-chloro-4-oxo-5-(trifluoromethyl)chromen-2-yl]-4,5-dimethoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid

(763) ##STR00629##

(764) Example C096 was prepared in analogy to the procedure described for the preparation of example C094 by using 5-bromo-8-chloro-2-(2-hydroxy-4,5-dimethoxy-phenyl)chromen-4-one as the starting material instead of 5-bromo-8-chloro-2-(2-hydroxyphenyl)chromen-4-one in Step 2. .sup.1H NMR (DMSO-<fc, 400 MHz): δ ppm 8.11-8.17 (m, J=8.3 Hz, 1H), 7.81-7.89 (m, J=8.4 Hz, 1H), 7.62 (s, 1H), 7.26 (s, 1H), 6.91 (s, 1H), 4.21-4.41 (m, 2H), 3.86-4.00 (m, 4H), 3.82 (s, 3H), 3.68-3.77 (m, 2H), 2.38-2.46 (m, 3H), 1.90-2.12 (m, 2H). (ESI.sup.+)[(M+H).sup.+]:543.1.

Example C097: 3-[2-[2-[8-chloro-4-oxo-7-(trifluoromethyl)chromen-2-yl]-5-ethoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid

(765) ##STR00630##

Step 1: Preparation of 8-chloro-2-(4-ethoxy-2-hydroxy-phenyl)-7-(trifluoromethyl)chromen-4-one

(766) ##STR00631##

(767) Compound C095a was prepared in analogy to the procedure described for the preparation of compound Int-5 by using 2-hydroxy-5-methoxy-benzaldehyde as the starting material instead of 4-chloro-2-hydroxy-5-methyl-benzaldehyde in Step 2 and 1-[3-chloro-2-hydroxy-4-(trifluoromethyl)phenyl]ethanone as the starting material instead of 1-(3-chloro-2-hydroxy-phenyl)ethanone in step 3.

Step 2: Preparation of 3-[2-[2-[8-chloro-4-oxo-7-(trifluoromethyl)chromen-2-yl]-5-ethoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid

(768) ##STR00632##

(769) Example C097 was prepared in analogy to the procedure described for the preparation of example C004 by using 8-chloro-2-(4-ethoxy-2-hydroxy-phenyl)-7-(trifluoromethyl)chromen-4-one as the starting material instead of 8-chloro-2-(4-chloro-2-hydroxy-phenyl)chromen-4-one in Step 2. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.13 (d, J=8.4 Hz, 1H), 8.03 (d, J=8.8 Hz, 1H), 7.90 (d, J=8.4 Hz, 1H), 7.29 (s, 1H), 6.77-6.85 (m, 2H), 4.29 (br s, 2H), 4.17 (q, J=7.0 Hz, 2H), 3.97 (br t, J=7.2 Hz, 1H), 3.73 (br s, 2H), 2.43 (br d, J=7.0 Hz, 3H), 1.95-2.06 (m, 2H), 1.37 (t, J=6.9 Hz, 3H). (ESI.sup.+)[(M+H).sup.+]:527.1.

Example C098: cis-3-[2-[2-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)-4,5-dimethoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid

(770) ##STR00633##

Step 1: Preparation of cis-tert-butyl 3-[2-(2-formyl-4,5-dimethoxy-phenoxy)ethoxy]cyclobutanecarboxylate

(771) ##STR00634##

(772) A mixture of cis-tert-butyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate (2.44 g, 6.59 mmol), 2-hydroxy-4,5-dimethoxybenzaldehyde (600 mg, 3.29 mmol) and K.sub.2CO.sub.3 (1.37 g, 9.88 mmol) in DMF (20 mL) was stirred at 60° C. overnight.

(773) After the reaction was completed, the mixture was diluted with water (40 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluted with PE:EtOAc=10:1 to 3:1) to give cis-tert-butyl 3-[2-(2-formyl-4,5-dimethoxy-phenoxy)ethoxy]cyclobutanecarboxylate (600 mg, 47.9% yield) as a colorless oil. MS obsd. (ESI.sup.+): [(M+H).sup.+]:381.3.

Step 2: Preparation of cis-tert-butyl 3-[2-[2-[(E)-3-[3-chloro-2,6-bis(methoxymethoxy)phenyl]-3-oxo-prop-1-enyl]-4,5-dimethoxy-phenoxy]ethoxy]cyclobutanecarboxylate

(774) ##STR00635##

(775) A mixture of 1-(3-chloro-2-hydroxy-6-(methoxymethoxy)phenyl)ethan-1-one (160 mg, 694 μmol), cis-tert-butyl 3-[2-(2-formyl-4,5-dimethoxy-phenoxy)ethoxy]cyclobutanecarboxylate (200 mg, 526 μmol) and KOH (29.5 mg, 526 μmol) in EtOH (10 mL) was stirred at room temperature for 2 hours. After the reaction was completed, the mixture was diluted with water (50 mL) and extracted with EtOAc (30 mL) three times. The combined organic layer was concentrated in vacuo to give the crude cis-tert-butyl 3-[2-[2-[(E)-3-[3-chloro-2,6-bis(methoxymethoxy)phenyl]-3-oxo-prop-1-enyl]-4,5-dimethoxy-phenoxy]ethoxy]cyclobutanecarboxylate (305 mg, 100% yield) as a brown solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+): [(M+H).sup.+]:581.2.

Step 3: Preparation of cis-3-[2-[2-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)-4,5-dimethoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid

(776) ##STR00636##

(777) To a suspension of cis-tert-butyl 3-[2-[2-[(T)-3-[3-chloro-2,6-bis(methoxymethoxy)phenyl]-3-oxo-prop-1-enyl]-4,5-dimethoxy-phenoxy]ethoxy]cyclobutanecarboxylate (300 mg, 471 μmol) in DCM (20 Ml) was added TFA (1 mL) and the mixture was then stirred at room temperature for 2 hours. Then the mixture was then washed with water (10 mL) and the organic phase was concentrated in vacuo. The residue was dissolved in DMSO (5 mL) and to the resulting solution was added I.sub.2 (12 mg, 471 μmol). The mixture was stirred at 140° C. for 1 hour. After cooling to room temperature, the mixture was purified by Prep-HPLC to give cis-3-[2-[2-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)-4,5-dimethoxy-phenoxy]ethoxy]cyclobutanecarboxylic acid (19.1 mg, 7.4% yield) as an orange solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.80 (s, 1H), 11.97-12.19 (m, 1H), 7.81 (d, J=8.9 Hz, 1H), 7.61 (s, 1H), 7.34 (s, 1H), 6.88-6.94 (m, 1H), 6.83 (d, J=8.8 Hz, 1H), 4.26-4.37 (m, 2H), 3.95-4.00 (m, 1H), 3.90 (s, 3H), 3.81 (s, 3H), 3.70-3.74 (m, 2H), 2.56-2.61 (m, 1H), 2.41-2.45 (m, 2H), 1.97-2.07 (m, 2H). MS obsd. (ESI.sup.+): [(M+H).sup.+]:491.3.

Example C099: cis-3-[2-[2-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]ethoxy]cyclobutanecarboxylic acid

(778) ##STR00637##

(779) Example C099 was prepared in analogy to the procedure described for the preparation of example C098 by using 2-hydroxy-4-(trifluoromethyl)benzaldehyde as the starting material instead of 2-hydroxy-4,5-dimethoxybenzaldehyde in step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): 5 ppm 12.54 (s, 1H), 8.18 (br d, J=7.8 Hz, 1H), 7.87 (d, J=8.8 Hz, 1H), 7.48-7.73 (m, 2H), 7.36 (s, 1H), 6.89 (d, J=9.0 Hz, 1H), 4.30-4.49 (m, 2H), 3.95 (br t, J=7.5 Hz, 1H), 3.62-3.78 (m, 2H), 2.36-2.46 (m, 3H), 1.93-2.17 (m, 2H). (ESI.sup.+)[(M+H).sup.+]:499.0.

Example C100: 2-[3-[2-(8-chloro-5-hydroxy-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propoxy]acetic acid

(780) ##STR00638##

(781) Example C100 was prepared in analogy to the procedure described for the preparation of example C098 by using 2-hydroxy-4-(trifluoromethyl)benzaldehyde and tert-butyl 2-[3-(p-tolylsulfonyloxy)propoxy]acetate as the starting material instead of 2-hydroxy-4,5-dimethoxybenzaldehyde and cis-tert-butyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate in step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): 5 ppm 12.51-12.60 (m, 2H), 8.14 (d, J=8.4 Hz, 1H), 7.87 (d, J=8.8 Hz, 1H), 7.56-7.61 (m, 2H), 7.19 (s, 1H), 6.89 (d, J=8.9 Hz, 1H), 4.36 (t, J=6.2 Hz, 2H), 4.01 (s, 2H), 3.64 (t, J=6.1 Hz, 2H), 2.01-2.11 (m, 2H). (ESI.sup.+)[(M+H).sup.+]:473.1.

Example C101: Cis-3-[2-[5-bromo-2-(8-chloro-3-methoxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

(782) ##STR00639##

Step 1: Preparation of cis-tert-butyl 3-[2-(5-bromo-2-formyl-phenoxy)ethoxy]cyclobutanecarboxylate

(783) ##STR00640##

(784) To a solution of 4-bromo-2-hydroxybenzaldehyde (200.0 mg, 0.990 mmol), K.sub.2CO.sub.3 (412.51 mg, 2.98 mmol) in DMF (10 mL) was added cis-tert-butyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate (368.58 mg, 0.990 mmol) and the reaction mixture was stirred at 80° C. for 6 hours. Then the reaction was diluted with water (25 mL) and the resulting mixture was extracted with EtOAc (20 mL) three times. The combined organic layer was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo to give cis-tert-butyl 3-[2-(5-bromo-2-formyl-phenoxy)ethoxy]cyclobutanecarboxylate (350 mg, 88.1% yield) as a yellow solid. MS obsd. (ESI.sup.+) [(M+Na).sup.+]: 421.0.

Step 2: Preparation of cis-3-[2-[5-bromo-2-[(E)-3-(3-chloro-2-hydroxy-phenyl)-3-oxo-prop-1-enyl]phenoxy]ethoxy]cyclobutanecarboxylic acid

(785) ##STR00641##

(786) A mixture of 1-(3-chloro-2-hydroxy-phenyl)ethanone (250.0 mg, 1.47 mmol), cis-tert-butyl 3-[2-(5-bromo-2-formyl-phenoxy)ethoxy]cyclobutanecarboxylate (312.5 mg, 0.780 mmol) and KOH (411.15 mg, 7.33 mmol) in EtOH (20 mL) was stirred at 30° C. for 8 hours. Then the mixture was adjusted to PH˜2 by addition of 1N HCl and the resulting suspension was filtered. The solid was washed with water and dried in vacuo to give the crude cis-3-[2-[5-bromo-2-[(E)-3-(3-chloro-2-hydroxy-phenyl)-3-oxo-prop-1-enyl]phenoxy]ethoxy]cyclobutanecarboxylic acid (400 mg, 55.06% yield) as a light yellow solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+)[(M+Na).sup.+]: 516.9.

Step 3: Preparation of cis-3-[2-[5-bromo-2-(8-chloro-3-hydroxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

(787) ##STR00642##

(788) To a solution of cis-3-[2-[5-bromo-2-[(E)-3-(3-chloro-2-hydroxy-phenyl)-3-oxo-prop-1-enyl]phenoxy]ethoxy]cyclobutanecarboxylic acid (70.0 mg, 0.140 mmol) in EtOH (2 mL) were added hydrogen peroxide (35.22 mg, 0.310 mmol) and sodium hydroxide (11.3 mg, 0.280 mmol). The mixture was stirred at 25° C. for 16 hours. Then the mixture was poured into water (15 mL) and the resulting suspension was filtered. The solid was collected and purified by Prep-HPLC to give cis-3-[2-[5-bromo-2-(8-chloro-3-hydroxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid (15 mg, 18.4% yield) as a white solid. .sup.1H NMR (400 MHz, DMSO) δ ppm: 8.04-8.20 (m, 1H), 7.96 (dd, J=7.7, 1.3 Hz, 1H), 7.39-7.56 (m, 3H), 7.32 (dd, J=8.2, 1.6 Hz, 1H), 4.17-4.20 (m, 2H), 3.73 (t, J=6.9 Hz, 1H), 3.51-3.61 (m, 2H), 2.05-2.21 (m, 3H), 1.74 (dd, J=18.1, 7.8 Hz, 2H). MS obsd. (ESI.sup.+)[(M+H).sup.+]: 509.0.

Step 4: Preparation of cis-methyl 3-[2-[5-bromo-2-(8-chloro-3-methoxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate

(789) ##STR00643##

(790) To a solution of cis-3-[2-[5-bromo-2-(8-chloro-3-hydroxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid (25.0 mg, 0.050 mmol), Cs.sub.2CO.sub.3 (47.94 mg, 0.150 mmol) in DMF (2 mL) was added iodomethane (13.92 mg, 0.100 mmol) and the mixture was stirred at 40° C. for 2 hours. The reaction mixture was then quenched with water (30 mL) and extracted with EtOAc (40 mL) three times. The combined organic layer was washed with brine (40 mL), dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluted with PE:EtOAc=3:1) to give civ-methyl 3-[2-[5-bromo-2-(8-chloro-3-methoxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate (18 mg, 70.07% yield) as a colorless oil. MS obsd. (ESI.sup.+) [(M+Na).sup.+]: 559.0.

Step 5: Preparation of Cis-3-[2-[5-bromo-2-(8-chloro-3-methoxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid

(791) ##STR00644##

(792) To a solution of civ-methyl 3-[2-[5-bromo-2-(8-chloro-3-methoxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylate (18.0 mg, 0.030 mmol) in THF (8 mL) and water (1 mL) was added lithium hydroxide (8.02 mg, 0.330 mmol) and the mixture was stirred at 25° C. for 16 hours. The mixture was adjusted to pH˜6 by addition of 1N HCl and the resulting solution was concentrated in vacuo. The residue was purified by Prep-HPLC to give cis-3-[2-[5-bromo-2-(8-chloro-3-methoxy-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclobutanecarboxylic acid (12.1 mg, 68.33% yield) as a white solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.09 (dd, J=7.9, 1.5 Hz, 1H), 8.00 (dd, J=7.7, 1.5 Hz, 1H), 7.48-7.53 (m, 3H), 7.35 (dd, J=8.1, 1.7 Hz, 1H), 4.18-4.25 (m, 2H), 3.71-3.78 (m, 4H), 3.36-3.58 (m, 2H), 2.10-2.26 (m, 3H), 1.70-1.81 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 523.0.

Example C102: Cis-3-[2-[[6-(8-chloro-4-oxo-chromen-2-yl)-2,2-difluoro-1,3-benzodioxol-5-yl]oxy]ethoxy]cyclobutanecarboxylic acid

(793) ##STR00645##

Step 1: Preparation of civ-methyl 3-[2-[[6-(8-chloro-4-oxo-chromen-2-yl)-2-thioxo-1,3-benzodioxol-5-yl]oxy]ethoxy]cyclobutanecarboxylate

(794) ##STR00646##

(795) To a solution of cis-methyl 3-[2-[2-(8-chloro-4-oxo-chromen-2-yl)-4,5-dihydroxy-phenoxy]ethoxy]cyclobutanecarboxylate (100.0 mg, 0.220 mmol), DMAP (58.32 mg, 0.480 mmol) in DCM (20 mL) was added thiophosgene (29.94 mg, 0.260 mmol) and the mixture was stirred at room temperature for 4 hours. The resulting solution was washed with water (20 mL), brine (15 mL), dried over MgSO.sub.4 and concentrated in vacuo to give the crude cis-methyl 3-[2-[[6-(8-chloro-4-oxo-chromen-2-yl)-2-thioxo-1,3-benzodioxol-5-yl]oxy]ethoxy]cyclobutanecarboxylate (102 mg, 93.47% yield) as a light yellow solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 503.1.

Step 2: Preparation of cis-methyl 3-[2-[[6-(8-chloro-4-oxo-chromen-2-yl)-2,2-difluoro-1,3-benzodioxol-5-yl]oxy]ethoxy]cyclobutanecarboxylate

(796) ##STR00647##

(797) To a solution of cis-methyl 3-[2-[[6-(8-chloro-4-oxo-chromen-2-yl)-2-thioxo-1,3-benzodioxol-5-yl]oxy]ethoxy]cyclobutanecarboxylate (230.0 mg, 0.460 mmol), NIS (246.9 mg, 1.1 mmol) in DCM (10 mL) was added tetrabutylammonium dihydrogen trifluoride (413.6 mg, 1.37 mmol) at 0° C. and the mixture was stirred at room temperature for 2 hours. The reaction was quenched with water (10 mL) and the resulting mixture was extracted with DCM (20 mL) twice. The combined organic layer was dried over Na.sub.2SO.sub.4 and concentrated in vacuo, the residue was purified by prep-HPLC to give cis-methyl 3-[2-[[6-(8-chloro-4-oxo-chromen-2-yl)-2,2-difluoro-1,3-benzodioxol-5-yl]oxy]ethoxy]cyclobutanecarboxylate (21.3 mg, 9.15% yield) as a yellow solid. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 509.1.

Step 3: Preparation of cis-3-[2-[[6-(8-chloro-4-oxo-chromen-2-yl)-2,2-difluoro-1,3-benzodioxol-5-yl]oxy]ethoxy]cyclobutanecarboxylic acid

(798) ##STR00648##

(799) A solution of cis-methyl 3-[2-[[6-(8-chloro-4-oxo-chromen-2-yl)-2,2-difluoro-1,3-benzodioxol-5-yl]oxy]ethoxy]cyclobutanecarboxylate (20.0 mg, 0.040 mmol) in hydrochloric acid (10 mL, 120 mmol) was stirred at 100° C. for 20 minutes. The reaction mixture was concentrated in vacuo and the residue was purification by prep-HPLC to give cis-3-[2-[[6-(8-chloro-4-oxo-chromen-2-yl)-2,2-difluoro-1,3-benzodioxol-5-yl]oxy]ethoxy]cyclobutanecarboxylic acid (14.1 mg, 70.96% yield) as a white solid. .sup.1H NMR (400 MHz, DMSO) δ ppm: 12.11 (s, 1H), 7.97-8.04 (m, 2H), 7.88 (s, 1H), 7.58 (s, 1H), 7.50 (t, J=7.9 Hz, 1H), 7.15 (s, 1H), 4.28-4.30 (m, 2H), 3.86-3.93 (m, 1H), 3.68-3.70 (m, 2H), 2.36-2.46 (m, 3H), 1.92-1.99 (m, 2H). MS obsd. (ESI.sup.+)[(M+H).sup.+]: 495.1.

Example C103: 3-[3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propoxy]cyclobutanecarboxylic acid

(800) ##STR00649##

(801) Example C103 was prepared in analogy to the procedure described for the preparation of example C004 by using 8-chloro-2-[2-hydroxy-4-(trifluoromethyl)phenyl]chromen-4-one and methyl 3-[3-(p-tolylsulfonyloxy)propoxy]cyclobutanecarboxylate as the starting material instead of 8-chloro-2-(4-chloro-2-hydroxy-phenyl)chromen-4-one and methyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate in step 1. .sup.1H NMR (400 MHz, DMSO) δ ppm: 12.03-12.13 (m, 1H), 8.10-8.15 (m, 1H), 8.03 (ddt, J=7.8, 3.0, 1.5 Hz, 2H), 7.48-7.59 (m, 3H), 7.05-7.12 (m, 1H), 4.27-4.37 (m, 2H), 4.01-4.05 (m, 0.3H), 3.76-3.85 (m, 0.7H), 3.41-3.48 (m, 2H), 2.80-2.90 (m, 0.3H), 2.51-2.54 (m, 0.7H), 2.26-2.39 (m, 2H), 1.86-2.11 (m, 4H). MS obsd. (ESI.sup.+)[(M+H).sup.+]: 496.9.

Example C104: 3-[3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propoxy]cyclopentanecarboxylic acid

(802) ##STR00650##

(803) Example C104 was prepared in analogy to the procedure described for the preparation of example C004 by using 8-chloro-2-[2-hydroxy-4-(trifluoromethyl)phenyl]chromen-4-one and methyl 3-[3-(p-tolylsulfonyloxy)propoxy]cyclopentanecarboxylate as the starting material instead of 8-chloro-2-(4-chloro-2-hydroxy-phenyl)chromen-4-one and methyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate in step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.11-8.23 (m, 1H), 8.05 (br dd, 1H, J=6.4, 8.0 Hz), 7.88-8.00 (m, 1H), 7.38-7.50 (m, 3H), 7.21-7.26 (m, 1H), 4.32 (br d, 2H, J=5.6 Hz), 3.89-4.01 (m, 1H), 3.59 (t, 2H, J=5.9 Hz), 2.83 (br t, 1H, J=7.9 Hz), 2.13 (br t, 2H, J=5.3 Hz), 1.93 (br d, 2H, J=7.3 Hz), 1.79-1.99 (m, 2H), 1.64-1.77 (m, 2H). (ESI.sup.+)[(M+H).sup.+]:510.9.

Example C105: 3-[3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]propoxy]cyclopentanecarboxylic acid

(804) ##STR00651##

(805) Example C105 was prepared in analogy to the procedure described for the preparation of example C004 by using 2-(4-bromo-2-hydroxy-phenyl)-8-chloro-chromen-4-one and methyl 3-[3-(p-tolylsulfonyloxy)propoxy]cyclopentanecarboxylate as the starting material instead of 8-chloro-2-(4-chloro-2-hydroxy-phenyl)chromen-4-one and methyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate in step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.01 (br s, 1H), 7.96-8.03 (m, 2H), 7.83-7.91 (m, 1H), 7.38-7.55 (m, 3H), 7.02-7.06 (m, 1H), 4.19-4.29 (m, 2H), 3.80-3.93 (m, 1H), 3.48 (t, J=6.2 Hz, 2H), 2.68-2.78 (m, 1H), 1.94-2.07 (m, 2H), 1.68-1.89 (m, 4H), 1.53-1.66 (m, 2H). (ESI.sup.+)[(M+H).sup.+]:521.0.

Example C106: 3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]cyclopentanecarboxylic acid

(806) ##STR00652##

(807) Example C106 was prepared in analogy to the procedure described for the preparation of example C004 by using 2-(4-bromo-2-hydroxy-phenyl)-8-chloro-chromen-4-one and methyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclopentanecarboxylate as the starting material instead of 8-chloro-2-(4-chloro-2-hydroxy-phenyl)chromen-4-one and methyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate in step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): 5 ppm 12.01 (br s, 1H), 7.91-8.02 (m, 3H), 7.41-7.54 (m, 3H), 7.25 (s, 1H), 4.27-4.37 (m, 2H), 4.04 (dq, J=5.4, 2.6 Hz, 1H), 3.67-3.78 (m, 2H), 2.76-2.85 (m, 1H), 1.74-1.95 (m, 4H), 1.59-1.71 (m, 2H). (ESI.sup.+)[(M+H).sup.+]:507.1.

Example C107: 4-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]benzoic acid

(808) ##STR00653##

Step 1: Preparation of 2-[4-bromo-2-(2-bromoethoxy)phenyl]-8-chloro-chromen-4-one

(809) ##STR00654##

(810) To the solution of 2-(4-bromo-2-hydroxy-phenyl)-8-chloro-chromen-4-one (500 mg, 1.42 mmol), 1,2-dibromoethane (1.07 g, 5.69 mmol) in DMF was added K.sub.2CO.sub.3 (197 mg, 1.42 mmol) and the mixture was then stirred at 50° C. overnight. After the reaction was completed, the mixture was partitioned between EtOAc (10 mL) and water (30 ml). The resulting suspension was filtered. The solid was collected and dried in vacuo to give 2-[4-bromo-2-(2-bromoethoxy)phenyl]-8-chloro-chromen-4-one (450 mg, 69% yield) as a yellow solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]:457.0.

Step 2: Preparation of methyl 4-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]benzoate

(811) ##STR00655##

(812) A mixture of 2-[4-bromo-2-(2-bromoethoxy)phenyl]-8-chloro-chromen-4-one (110 mg, 239 μmol), methyl 4-hydroxybenzoate (60 mg, 392 μmol), K.sub.2CO.sub.3 (54.3 mg, 393 μmol) in a mixed solvent of THF (5 mL) and DMF (2 mL) was stirred at 30° C. overnight. After the reaction was completed, the reaction mixture was diluted with EtOAc (40 mL). The resulting solution was washed with water (20 mL), brine (15 mL), dried over Na.sub.2SO.sub.4 and concentrated in vacuo to give the crude methyl 4-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]benzoate (120 mg, 100% yield) as a yellow oil, which was used in the next step directly. MS obsd. (ESI.sup.+) [(M+H).sup.+]:527.0.

Step 3: Preparation of 4-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]benzoic acid

(813) ##STR00656##

(814) To a solution of methyl 4-(2-(5-bromo-2-(8-chloro-4-oxo-4H-chromen-2-yl)phenoxy)ethoxy)benzoate (120 mg, 227 μmol) in a mixed solvent of THF (5 ml), MeOH (5 ml) and water (1 mL) was added LiOH (43.4 mg, 1.81 mmol). The mixture was then stirred at room temperature for 48 hours. The reaction mixture was diluted with water (10 mL) and methanol (10 mL) and the resulting suspension was filtered. The solid was collected and purified by Prep-HPLC to give 4-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]benzoic acid (16 mg, 12.3% yield) as an off-white solid. .sup.1H NMR (400 MHz, DMSO) δ ppm: 7.97 (td, J=7.5, 1.5 Hz, 2H), 7.91 (d, J=8.4 Hz, 1H), 7.85 (d, J=8.8 Hz, 2H), 7.60-7.65 (m, 1H), 7.45-7.50 (m, 2H), 7.19 (s, 1H), 7.08 (d, J=8.8 Hz, 2H), 4.61 (dd, J=5.9, 2.3 Hz, 2H), 4.47 (dd, J=5.6, 2.5 Hz, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:515.1.

Example C108: 3-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]benzoic acid

(815) ##STR00657##

(816) Example C108 was prepared in analogy to the procedure described for the preparation of example C107 by using methyl 3-hydroxybenzoate as the starting material instead of methyl 4-hydroxybenzoate in step 2. .sup.1H NMR (400 MHz, DMSO) δ ppm: 7.89-8.02 (m, 3H), 7.61-7.67 (m, 1H), 7.43-7.54 (m, 4H), 7.36-7.40 (m, 1H), 7.27 (br d, J=1.7 Hz, 1H), 7.20 (s, 1H), 4.56-4.66 (m, 2H), 4.31-4.49 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:515.1.

Example C109: 2-[3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]propoxy]-2-methyl-propanoic acid

(817) ##STR00658##

(818) Example C109 was prepared in analogy to the procedure described for the preparation of example C107 by using 8-chloro-2-[2-hydroxy-4-(trifluoromethyl)phenyl]chromen-4-one and 1,3-dibromopropane as the starting material instead of 2-(4-bromo-2-hydroxy-phenyl)-8-chloro-chromen-4-one and 1,2-dibromoethane in step 1 and using methyl 2-hydroxy-2-methyl-propanoate as the starting material instead of methyl 4-hydroxybenzoate in step 2. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.23 (d, 1H, J=7.9 Hz), 8.13 (dd, 1H, J=1.5, 8.0 Hz), 7.95 (dd, 1H, J=1.5, 7.8 Hz), 7.48-7.55 (m, 3H), 7.25 (s, 1H), 4.35-4.41 (m, 4H), 2.31 (m, 2H), 1.38 (s, 6H). (ESI.sup.+)[(M+H).sup.+]:485.3.

Example C110: cis-3-[3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-2,2-dimethyl-propoxy]cyclobutanecarboxylic acid and trans-3-[3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-2,2-dimethyl-propoxy]cyclobutanecarboxylic acid

(819) ##STR00659##

Step 1: Preparation of 3-benzyloxy-2,2-dimethyl-propan-1-ol

(820) ##STR00660##

(821) To a solution of 2,2-dimethylpropane-1,3-diol (2800.0 mg, 26.88 mmol) in THF (60 mL) were added NaH (1290.45 mg, 32.26 mmol), benzyl bromide (3.2 mL, 26.88 mmol) and tetrabutylammonium iodide (9930.17 mg, 26.88 mmol) at 0° C. The resulting mixture was stirred at 25° C. for 16 hours. Then the reaction mixture was quenched with saturated aqueous NH.sub.4Cl (50 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine (80 mL), dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluted with PE:EtOAc=100:1 to 5:1) to give 3-benzyloxy-2,2-dimethyl-propan-1-ol (3800 mg, 72.74% yield) as a colorless oil. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 195.2.

Step 2: Preparation of methyl 3-[2,2-dimethyl-3-(p-tolylsulfonyloxy)propoxy]cyclobutanecarboxylate

(822) ##STR00661##

(823) Compound C110b was prepared in analogy to the procedure described for the preparation of compound Int-T1 by using 3-benzyloxy-2,2-dimethyl-propan-1-ol as the starting material instead of 2-benzyloxyethanol in Step 1.

Step 3: Preparation of cis-3-[3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-2,2-dimethyl-propoxy]cyclobutanecarboxylic acid and trans-3-[3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-2,2-dimethyl-propoxy]cyclobutanecarboxylic acid

(824) ##STR00662##

(825) Example C110-A and C110-B were prepared in analogy to the procedure described for the preparation of example C003-A and example C003-B by using 8-chloro-2-[2-hydroxy-4-(trifluoromethyl)phenyl]chromen-4-one and methyl 3-[2,2-dimethyl-3-(p-tolylsulfonyloxy)propoxy]cyclobutanecarboxylate as the starting materials instead of 2-(4-bromo-2-hydroxy-phenyl)-8-chloro-chromen-4-one and methyl 3-[2-(p-tolylsulfonyloxy)ethoxy]cyclobutanecarboxylate in Step 1.

(826) Example C110-A: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.06 (br s, 1H), 8.01 (dq, J=7.9, 1.4 Hz, 2H), 7.84 (d, J=8.6 Hz, 1H), 7.39-7.56 (m, 3H), 7.00 (s, 1H), 3.94 (s, 2H), 3.69-3.86 (m, 1H), 3.14 (s, 2H), 2.44-2.48 (m, 1H), 2.15-2.38 (m, 2H), 1.76-1.95 (m, 2H), 0.87-1.04 (m, 6H). (ESI.sup.+)[(M+H).sup.+]:535.0.

(827) Example C110-B: .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 12.11 (br s, 1H), 8.01 (d, J=8.1 Hz, 2H), 7.85 (d, J=8.6 Hz, 1H), 7.40-7.59 (m, 3H), 7.02 (s, 1H), 3.91-4.06 (m, 3H), 3.13 (s, 2H), 2.73-2.98 (m, 1H), 2.16-2.34 (m, 2H), 1.95-2.10 (m, 2H), 0.98 (s, 6H). (ESI.sup.+)[(M+H).sup.+]:535.0.

Example C111: (3R)-1-[2-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]acetyl]pyrrolidine-3-carboxylic acid

(828) ##STR00663##

(829) Example 111 was prepared in analogy to the procedure described for the preparation of example A075 by using 2-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]acetic acid as the starting material instead of 3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]propanoic acid (Example A004) in step 1. .sup.1H NMR (400 MHz, DMSO) δ ppm: 7.96-8.02 (m, 2H), 7.88-7.92 (m, 1H), 7.40-7.55 (m, 3H), 7.17 (d, J=6.0 Hz, 1H), 4.33-4.40 (m, 2H), 4.14-4.21 (m, 2H), 3.85-3.93 (m, 2H), 3.24-3.61 (m, 4H), 2.90-3.09 (m, 1H), 1.85-2.04 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:550.1.

Example 012: (3S)-1-[2-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]acetyl]pyrrolidine-3-carboxylic acid

(830) ##STR00664##

(831) Example 111 was prepared in analogy to the procedure described for the preparation of example A075 by using 2-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]acetic acid and tert-butyl (2S)-pyrrolidine-2-carboxylate as the starting material instead of 3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]propanoic acid (Example A004) and tert-butyl (2R)˜pyrrolidine-2-carboxylate in step 1. .sup.1H NMR (400 MHz, DMSO) δ ppm: 12.40-12.56 (m, 1H), 7.97-8.04 (m, 2H), 7.86-7.93 (m, 1H), 7.41-7.55 (m, 3H), 7.17 (d, J=6.1 Hz, 1H), 4.31-4.44 (m, 2H), 4.11-4.20 (m, 2H), 3.89 (br d, J=2.6 Hz, 2H), 3.37-3.61 (m, 4H), 2.90-3.08 (m, 1H), 1.86-2.09 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]:550.0.

Example 013: 2-[3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-2-hydroxy-propoxy]acetic acid

(832) ##STR00665##

Step 1: Preparation of 2-[4-bromo-2-(oxiran-2-ylmethoxy)phenyl]-8-chloro-chromen-4-one

(833) ##STR00666##

(834) A mixture of 2-(4-bromo-2-hydroxy-phenyl)-8-chloro-chromen-4-one (300 mg, 853 μmol), 2-(chloromethyl)oxirane (789 mg, 8.53 mmol) and K.sub.2CO.sub.3 (1.77 g, 12.8 mmol) in DMF (25 mL) was stirred at 50° C. overnight. The mixture was then poured into water (75 mL) and extracted with EtOAc (100 mL) twice. The combined organic layer was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was then triturated with MTBE (20 mL) and the suspension was then filtered. The filtered cake was collected and dried in vacuo to give 2-[4-bromo-2-(oxiran-2-ylmethoxy)phenyl]-8-chloro-chromen-4-one (300 mg, 86.2% yield) as a yellow solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 406.9.

Step 2: Preparation of methyl 2-[3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-2-hydroxy-propoxy]acetate

(835) ##STR00667##

(836) To a solution of 2-[4-bromo-2-(oxiran-2-ylmethoxy)phenyl]-8-chloro-chromen-4-one (220.0 mg, 0.540 mmol) in methyl glycolate (486.15 mg, 5.4 mmol) was added boron fluoride ethyl ether (182.98 mg, 2.7 mmol) and the mixture was stirred at 25° C. for 1 hour. The mixture was concentrated in vacuo and the residue was purified column chromatography on silica gel (eluted with PE:EtOAc=5:1 to 1:1) to give methyl 2-[3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-2-hydroxy-propoxy]acetate (150 mg, 55.84% yield) as a colorless oil. MS obsd. (ESI.sup.+)[(M+H).sup.+]: 497.0.

Step 3: Preparation of 2-[3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-2-hydroxy-propoxy]acetic acid

(837) ##STR00668##

(838) To a solution of methyl 2-[3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-2-hydroxy-propoxy]acetate (250.0 mg, 0.500 mmol) in THF (5 mL) and water (1 mL) was add LiOH (55 mg, 2.51 mmol) and the mixture was stirred at 25° C. for 3 hours. The mixture was then adjusted to pH˜6 by addition of 2N HCl and the resulting mixture was concentrated in vacuo. The residue was then purified by Prep-HPLC to give 2-[3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-2-hydroxy-propoxy]acetic acid (130 mg, 0.03% yield) as a white solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz) δ ppm 8.00 (d, J=7.7 Hz, 2H), 7.90 (d, J=8.5 Hz, 1H), 7.56-7.46 (m, 2H), 7.42 (dd, J=8.5, 1.8 Hz, 1H), 7.19 (s, 1H), 4.16 (ddd, J=15.8, 9.9, 5.3 Hz, 2H), 4.02-3.90 (m, 1H), 3.83-3.72 (m, 2H), 3.64-3.50 (m, 2H). MS obsd. (ESI.sup.+)[(M+H).sup.+]: 483.0.

Example 014: 2-[3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-2-hydroxy-propoxy]acetamide

(839) ##STR00669##

(840) A solution of methyl 2-[3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-2-hydroxy-propoxy]acetate (100.0 mg, 0.200 mmol) in ammonia (1 mL) was stirred at room temperature for 3 hours. The mixture was concentrated in vacuo and the residue was then purified by Prep-HPLC to give 2-[3-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]-2-hydroxy-propoxy]acetamide (30 mg, 29.08% yield) as a white solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz) δ ppm 8.01 (dd, J=1N, 1.9 Hz, 2H), 7.91 (d, J=8.5 Hz, 1H), 7.54 (d, J=1.6 Hz, 1H), 7.50 (t, J=1N Hz, 1H), 7.44 (dd, J=8.5, 1.7 Hz, 1H), 7.32 (d, J=17.4 Hz, 2H), 7.23 (s, 1H), 5.40 (d, J=5.0 Hz, 1H), 4.29 (dd, J=10.1, 3.9 Hz, 1H), 4.19 (dd, J=10.0, 6.1 Hz, 1H), 4.07 (dd, J=9.4, 5.1 Hz, 1H), 3.83 (d, J=1.7 Hz, 2H), 3.55 (qd, J=9.8, 5.4 Hz, 2H). MS obsd. (ESI.sup.+)[(M+H).sup.+]:482.0.

Example 015: 2-[3-[2-(8-chloro-4-oxo-chromen-2-yl)-5-(trifluoromethyl)phenoxy]-2-hydroxy-propoxy]acetic acid

(841) ##STR00670##

(842) Example 115 was prepared in analogy to the procedure described for the preparation of example 013 by using 8-chloro-2-[2-hydroxy-4-(trifluoromethyl)phenyl]chromen-4-one as the starting material instead of 2-(4-bromo-2-hydroxy-phenyl)-8-chloro-chromen-4-one in step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz) δ ppm 8.13-8.18 (m, 1H), 7.99-8.06 (m, 2H), 7.56-7.61 (m, 2H), 7.49-7.55 (m, 1H), 7.20-7.27 (m, 1H), 5.22-5.32 (m, 1H), 4.31-4.37 (m, 1H), 4.21-4.26 (m, 1H), 4.05 (s, 2H), 3.52-3.59 (m, 1H), 3.52-3.55 (m, 1H). MS obsd. (ESI.sup.+)[(M+H).sup.+]:473.2.

Example 016: 2-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]-N-cyclopropylsulfonyl-acetamide

(843) ##STR00671##

(844) To a mixture of 2-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]acetic acid (100 mg, 220 μmol, as the “EX” in Table 10), cyclopropanesulfonamide (34.7 mg, 287 μmol, as the “AMINE” in Table 10), DMAP (40.4 mg, 331 μmol) in DCM (10 mL) was added HATU (134 mg, 353 μmol) and the mixture was then stirred at room temperature overnight. After the reaction was completed, the reaction solution was diluted with DCM (30 mL), the resulting solution was washed by water (15 mL), brine (15 ml), dried over MgSO.sub.4 and filtered. The filtrate was concentrated in vacuo and the residue was purified by Prep-HPLC to give 2-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]-N-cyclopropylsulfonyl-acetamide (26.5 mg, 20.5% yield) as a white solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz) δ ppm 11.68 (s, 1H), 8.00 (ddd, J=7.8, 6.4, 1.5 Hz, 2H), 7.88-7.94 (m, 1H), 7.38-7.57 (m, 3H), 7.19 (s, 1H), 4.30-4.43 (m, 2H), 4.12-4.19 (m, 2H), 3.78-3.96 (m, 2H), 2.88-2.99 (m, 1H), 1.03-1.13 (m, 4H). MS obsd. (ESI.sup.+)[(M+H).sup.+]:556.1.

(845) The following compounds 017 to 026 were prepared in analogy to the procedure described for the preparation of Example 016, replacing 2-[2-[5-bromo-2-(8-chloro-4-oxo-chromen-2-yl)phenoxy]ethoxy]acetic acid with “EX”, cyclopropanesulfonamide with “AMINE”. The “EX” and “AMINE” are the reagents indicated in Table 10.

(846) TABLE-US-00013 TABLE 10 Compounds synthesis and characterization Example Compounds Name and EX and No. Structure AMINE .sup.1H NMR and (ESI.sup.+) C117 2-[3-[2-(8-chloro-4-oxo- chromen-2-yl)-5- (trifluoromethyl)phenoxy] propoxy]-N- cyclopropylsulfonyl- acetamide embedded image EX: C001 AMINE: cyclopropane- sulfonamide .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 11.65 (s, 1H), 8.14 (br d, J = 8.4 Hz, 1H), 8.03 (br t, J = 6.5 Hz, 2H), 7.49- 7.64 (m, 3H), 7.12 (s, 1H), 4.36 (br t, J = 6.1 Hz, 2H), 4.06 (s, 2H), 3.64 (br t, J = 6.0 Hz, 2H), 2.68-2.95 (m, 1H), 2.07 (br t, J = 6.1 Hz, 2H), 0.97-1.12 (m, 4H). (ESI.sup.+)[(M + H).sup.+]: 560.1. C118 2-[2-[2-(8-chloro-4-oxo- chromen-2-yl)-5- (trifluoromethyl)phenoxy] ethoxy]-N-cyclopropylsulfonyl- acetamide embedded image EX: C005 AMINE: cyclopropane- sulfonamide .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 11.66 (s, 1H), 8.17 (d, J = 8.2 Hz, 1H), 8.00- 8.06 (m, 2H), 7.50- 7.65 (m, 3H), 7.24 (s, 1H), 4.43-4.50 (m, 2H), 4.16 (s, 2H), 3.93 (br d, J = 4.2 Hz, 2H), 2.90-2.97 (m, 1H), 0.99-1.14 (m, 4H). (ESI.sup.+)[(M + H).sup.+]: 546.0. C119 Cis-3-[2-[2-(8-chloro-4-oxo- chromen-2-yl)-4,5- dimethoxy-phenoxy]ethoxy]- N-cyclopropylsulfonyl- cyclobutanecarboxamide embedded image EX: C072 AMINE: cyclopropane- sulfonamide .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 11.63 (br s, 1H), 7.97 (ddd, J = 10.0, 8.1, 1.5 Hz, 2H), 7.61 (s, 1H), 7.47 (t, J = 7.9 Hz, 1H), 7.25 (s, 1H), 6.91 (s, 1H), 4.26-4.38 (m, 2H), 3.84-4.02 (m, 4H), 3.82 (s, 3H), 3.66-3.77 (m, 2H), 2.83-2.97 (m, 1H), 2.52-2.64 (m, 1H), 2.33-2.46 (m, 2H), 1.96-2.08 (m, 2H), 0.96-1.06 (m, 4H).. (ESI.sup.+)[(M + H).sup.+]: 577.8. C120 2-[2-[2-(8-chloro-4-oxo- chromen-2-yl)-5- (trifluoromethyl)phenoxy] ethoxy]-N-methylsulfonyl- acetamide embedded image EX: C005 AMINE: methane- sulfonamide .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 11.70 (s, 1H), 8.17 (d, 1H, J = 8.1 Hz), 7.98- 8.05 (m, 2H), 7.49- 7.63 (m, 3H), 7.25 (s, 1H), 4.40-4.52 (m, 2H), 4.16 (s, 2H), 3.88-3.98 (m, 2H), 3.24 (s, 3H). (ESI.sup.+)[(M + H).sup.+]: 520.1. C121 Cis-3-[2-[2-(8-chloro-4-oxo- chromen-2-yl)-5- (trifluoromethyl)phenoxy] ethoxy]-N-methylsulfonyl- cyclobutanecarboxamide embedded image EX: C026-A AMINE: methane- sulfonamide .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.17 (d, J = 8.1 Hz, 1H), 7.98-8.07 (m, 2H), 7.47-7.63 (m, 3H), 7.22-7.29 (m, 1H), 4.37-4.45 (m, 2H), 3.93 (quin, J = 7.4 Hz, 1H), 3.67-3.77 (m, 2H), 2.98-3.08 (m, 3H), 2.43-2.47 (m, 1H), 2.27-2.37 (m, 2H), 1.87-2.05 (m, 2H). (ESI.sup.+)[(M + H).sup.+]: 560.1. C122 Cis-3-[2-[5-bromo-2-(8- chloro-4-oxo-chromen-2- yl)phenoxy]ethoxy]-N- methylsulfonyl- cyclobutanecarboxamide embedded image EX: C003-A AMINE: methane- sulfonamide .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.00 (ddd, J = 9.1, 7.8, 1.5 Hz, 2H), 7.90-7.95 (m, 1H), 7.40-7.55 (m, 3H), 7.20-7.24 (m, 1H), 4.29-4.36 (m, 2H), 3.89-3.98 (m, 1H), 3.66-3.72 (m, 2H), 3.10 (s, 3H), 2.53-2.57 (m, 1H), 2.30-2.39 (m, 2H), 1.94-2.06 (m, 2H). (ESI.sup.+)[(M + H).sup.+]: 570.0. C123 Trans-3-[2-[5-bromo-2-(8- chloro-4-oxo-chromen-2- yl)phenoxy]ethoxy]-N- methylsulfonyl- cyclobutanecarboxamide embedded image EX: C003-B AMINE: methane- sulfonamide .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.01 (d, J = 7.8 Hz, 2H), 7.94 (d, J = 8.6 Hz, 1H), 7.41-7.56 (m, 3H), 7.33 (s, 1H), 4.31-4.36 (m, 2H), 4.10-4.17 (m, 1H), 3.63-3.70 (m, 2H), 3.28 (s, 3H), 2.87-2.93 (m, 1H), 2.25-2.33 (m, 2H), 1.98-2.12 (m, 2H). (ESI.sup.+)[(M + H).sup.+]: 569.9. C124 3-[3-[2-(8-chloro-4-oxo- chromen-2-yl)-5- (trifluoromethyl)phenoxy] propoxy]-N-methylsulfonyl- cyclopentanecarboxamide embedded image EX: C104 AMINE: methane- sulfonamide .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 8.1- 8.2 (m, 1H), 7.89-8.02 (m, 1H), 7.80-7.91 (m, 1H), 7.28-7.41 (m, 3H), 7.11-7.19 (m, 1H), 4.23 (t, 2H, J = 6.0 Hz), 3.82-4.01 (m, 1H), 3.38-3.59 (m, 2H), 3.01-3.09 (s, 3H), 2.48-2.93 (m, 1H), 2.01-2.12 (m, 2H), 1.51-1.92 (m, 6H). (ESI.sup.+)[(M + H).sup.+]: 587.9. C125 3-[2-[2-(8-chloro-4-oxo- chromen-2-yl)-4,5- dimethoxy-phenoxy]ethoxy]- N-methylsulfonyl- cyclobutanecarboxamide 0embedded image EX: C072 AMINE: methane- sulfonamide .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ ppm 7.97 (dd, J = 7.0, 5.7 Hz, 2H), 7.61 (s, 1H), 7.47 (t, J = 7.8 Hz, 1H), 7.24 (s, 1H), 6.91 (s, 1H), 4.25-4.37 (m, 2H), 3.87-3.98 (m, 4H), 3.82 (s, 3H), 3.63-3.77 (m, 2H), 3.02 (s, 3H), 2.28-2.42 (m, 3H), 1.95-2.05 (m, 2H). (ESI.sup.+)[(M + H).sup.+]: 552.1. C126 2-[4-bromo-2-[2-[2-(3- hydroxypyrrolidin-1-yl)-2- oxo-ethoxy]ethoxy]phenyl]-8- chloro-chromen-4-one embedded image EX:C006 AMINE: pyrrolidin-3-ol .sup.1H NMR (DMSO-d.sub.6, 400 MHz) δ ppm 7.96- 8.05 (m, 2H), 7.91 (dd, J = 8.6, 1.8 Hz, 1H), 7.38-7.56 (m, 3H), 7.18 (d, J = 2.9 Hz, 1H), 4.84-4.96 (m, 1H), 4.38 (t, J = 4.4 Hz, 2H), 4.10-4.24 (m, 3H), 3.82-3.94 (m, 2H), 3.35-3.40 (m, 2H), 3.11-3.25 (m, 2H), 1.63-1.88 (m, 2H). MS obsd. (ESI.sup.+)[(M + H).sup.+]: 522.1.

(847) Similar flavone compounds, 7-hydroxy-2-(2-hydroxyphenyl)chromen-4-one (compound F-1) in patent WO2015061294 for treating HBV infection as STING agonist and 6-methoxy-2-(2-methoxyphenyl)chromen-4-one (compound F-2) disclosed in patent WO 2001003681 for treating infections, were chosen as reference compounds in present invention.

(848) ##STR00682##

BIOLOGICAL EXAMPLES

Biological Example 1: Engineered HepDES19 Primary Screen Assay

(849) The assay was employed to screen for novel cccDNA inhibitors. HepDES19 is a cccDNA-producing cell line. In this cell line, HBeAg in the cell culture supernatant as surrogate marker, as HBeAg production depends on cccDNA level and activity. HepDES19 is an engineered cell line which contains a 1.1 unit length HBV genome, and pgRNA transcription from the transgene is controlled by Tetracycline (Tet). In the absence of Tet, pgRNA transcription will be induced, but HBV e antigen (HBeAg) could not be produced from this pgRNA due to very short leader sequence before the HBeAg start codon and the start codon is disrupted. Only after cccDNA is formed, the missing leader sequence and start codon mutation would be restored from the 3′-terminal redundancy of pgRNA, and then HBeAg could be synthesized. Therefore, HBeAg could be used as a surrogate marker for cccDNA (Zhou, T. et al., Antiviral Res. (2006), 72(2), 116-124; Guo, H. et al., J. Virol. (2007), 81(22), 12472-12484).

(850) HepDES19 cells were seeded at 2×10.sup.6 cells per T150 flask and cultured with the culture medium (Dulbecco's Modified Eagle Medium: Nutrient Mixture F-12 [DMEM-F12, Gibco Cat. 11320-82], 10% Fetal Bovine Serum [FBS, Clontech Cat. 631101], 0.1 mM Non-Essential Amino Acids Solution [NEAA, Gibco Cat. 11140-050], 50 μg/mL Penicillin-Streptomycin [PS, Invitrogen Cat. 15140-163], 500 μg/mL Geneticin [G418, Invitrogen Cat. 10131-027]) containing 3 μg/mL Tet (Sigma, Cat. 87128) for 5 days. Cells were then seeded at 4×10.sup.6 cells per T150 in the same culture medium as described above in the absence of Tet for 8 days. Cells were then harvested and frozen at density of 2×10.sup.6 cells per mL. For compound testing, the frozen cells were thawed and seeded into 96-well plates at a density of 6×10.sup.4 cells per well. At 24 hours after seeding, half log serial dilutions of compounds made with Dimethyl sulfoxide (DMSO, Sigma, Cat. D2650) were further diluted with the same culture medium as described above before they were added to the cells to reach desired final compound concentrations and 1% DMSO concentration. Plates were then incubated at 37° C. for another 5 days before measurement of HBeAg level and cell viability. Intracellular HBeAg level were measured with enzyme-linked immunosorbent assay (ELISA) kit (Shanghai Kehua Diagnostic Medical Products Co., Ltd). Cell viability was assessed using Cell Counting Kit-8 (DonJindo, Cat. CK04-20). IC.sub.50 values were derived from the dose-response curve using 4 parameter logistic curve fit method.

(851) The compounds of the present invention were tested for their capacity to inhibit extracellular HBeAg level as described herein. The compounds of this invention were found to have IC.sub.50 below 50 μM. Particular compounds of formula (I) were found to have IC.sub.50 below 5.0 μM. Results of HepDES19 primary screen assay are given in Table D1.

(852) TABLE-US-00014 TABLE D1 Activity data in HepDES19 primary screen assay Example No. IC.sub.50 (μM) A001 1.64 A002 0.795 A003 0.362 A004 0.374 A005 1.37 A006 1.23 A007 3.15 A008 2.26 A009 0.403 A010 1.4 A011 0.415 A012 0.65 A013 0.656 A014 3.22 A015 11.1 A016 1.03 A017 3.17 A018 3.32 A019 2.96 A020 0.78 A021 4.04 A022 0.983 A023 29.6 A024 0.57 A025 3.55 A026 2.97 A031 0.377 A032 13.0 A033 0.479 A034 13.4 A038 4.79 A039 0.142 A040 0.525 A041 6.06 A042 17.8 A043 2.25 A044 2.52 A045 2.03 A046 7.86 A047 1.83 A048 9.38 A049 0.0872 A050 11.8 A051 2.41 A052 0.213 A053 0.491 A054 1.47 A055 0.0955 A056 3.11 A057 1.33 A058 0.549 A059 0.622 A060 5.36 A061 15.9 A062 13.0 A063 1.35 A064 9.59 A065 1.9 A066 2.44 A067 1.68 A068 5.7 A069 2.73 A070 0.63 A071 6.46 A072 0.366 A074 2.38 A075 2.85 A076 14.1 A077 9.0 A078 10.2 A079 19.0 A080 17.5 A081 0.26 A082 1.19 A083 5.57 A084 1.45 A085 4.92 A086 1.0 A087 4.98 A088 1.11 A089 11.9 A090 4.79 A091 0.888 A092 1.13 A093 1.32 A094 0.858 A095 3.29 A096 0.114 A097 0.983 A098 0.036 A099 0.0663 B001 0.213 B002-A 0.162 B002-B 0.112 B003 0.468 B004 0.556 B005 0.219 B006 5.48 B007 2.31 B009 5.98 B010 2.76 B011-A 0.851 B011-B 3.48 B012-A 3.27 B012-B 2.72 B013-A 0.919 B013-B 2.45 B014 15.5 B015-A 3.79 B016 3.1 B017 4.85 B018-A 0.146 B018-B 0.548 B019-A 1.03 B019-B 3.63 B020-A 2.84 B020-B 9.44 B021 3.06 B022-A 0.112 B022-B 0.141 B023 3.39 B024 1.64 B025-A 4.92 B025-B 2.27 B026-A 0.0394 B026-B 0.138 B027-A 2.47 B027-B 11.0 B028-A 0.471 B028-B 0.213 B029 14.1 B035-A 0.16 B035-B 2.02 B036-A 0.926 B036-B 0.407 B037-A 4.43 B037-B 0.149 B038-A 1.05 B038-B 0.312 B039-A 6.76 B039-B 11.5 B040-A 0.302 B040-B 2.93 B041 0.289 B042 0.865 B043-A 1.4 B043-B 1.14 B044-A 4.62 B044-B 3.72 B047-A 1.96 B047-B 3.76 B048-A 0.632 B048-B 3.08 B049-A 12.2 B049-B 8.74 B050-A 7.03 B050-B 6.08 B051-A 6.18 B051-B 9.22 B052-A 10.7 B052-B 16.3 B053-A 3.36 B053-B 0.912 B054 1.65 B055-A 3.59 B055-B 3.88 B056-A 9.44 B057 1.08 B070 0.435 B071 0.988 B072 0.95 B073 1.04 B075 0.774 B076 0.111 B077 0.657 B078 0.541 B079 1.52 B080 1.2 B081 3.11 B082 1.98 B083 0.704 B084 0.533 B085 4.57 B086 4.89 B087 3.0 B088 1.85 C001 3.05 C002 0.348 C003a 0.4 C003-A 1.07 C003-B 1.34 C004 1.32 C005 17.7 C006 1.26 C009 2.66 C010 0.696 C011 10.6 C012 5.26 C013 0.252 C014 2.19 C015 7.87 C016 2.46 C017 0.492 C018 4.82 C019 0.185 C020 5.55 C021 9.25 C022 5.53 C023 3.99 C024 0.909 C025-A 0.191 C025-B 0.205 C026 0.526 C027 1.8 C028 3.32 C029-A 3.36 C029-B 1.32 C030-A 1.37 C030-B 12.8 C031-A 6.19 C032-A 19.2 C033-A 1.34 C033-B 0.927 C034-A 0.526 C034-B 1.81 C035-A 12.5 C035-B 17.9 C036-A 0.261 C036-B 0.77 C037-A 0.0975 C037-B 0.531 C038-A 0.643 C038-B 1.53 C039-A 8.91 C039-B 17.5 C040-A 13.2 C040-B 17.1 C041-A 7.84 C041-B 9.64 C042-A 12.7 C042-B 15.3 C043-A 2.68 C043-B 9.42 C044-A 2.01 C044-B 1.57 C045-A 2.62 C045-B 2.88 C046-A 0.192 C046-B 0.251 C047-A 16.6 C047-B 14.0 C048-A 5.12 C049-A 0.0775 C049-B 0.103 C050 15.6 C050-B 0.137 C051-A 4.14 C051-B 9.41 C052-A 5.99 C053-B 5.59 C054 2.99 C055-A 4.03 C056-A 2.39 C056-B 2.18 C057-A 5.01 C058-A 5.1 C060 9.81 C061 3.35 C062 1.51 C062a 2.45 C063-A 4.95 C063-B 14.9 C064-A 1.94 C064-B 2.93 C065-B 12.2 C066-A 1.02 C066-B 1.02 C067-B 8.36 C068 4.74 C069-A 5.09 C069-B 1.29 C070 13.1 C071 10.8 C072 6.31 C073 0.92 C074 7.28 C075 10.9 C076 0.502 C077 3.21 C078 15.0 C079 5.5 C080 4.0 C081 0.779 C082 3.97 C083 4.59 C084 15.1 C085 0.271 C086 5.03 C087 6.35 C088 10.3 C089 3.78 C090 6.57 C091 0.418 C092 11.2 C093 7.79 C094 0.04 C095 3.29 C096 3.48 C097 1.31 C098 8.56 C099 15.7 C100 0.691 C101 2.38 C102 7.0 C103 2.28 C104 4.46 C105 1.74 C106 2.1 C107 0.991 C108 1.25 C109 0.995 C110-A 0.433 C110-B 3.74 C111 1.25 C112 11.4 C113 1.28 C114 1.24 C115 19.2 C116 9.13 C117 2.52 C118 14.7 C119 3.48 C120 1.05 C121 5.89 C122 1.05 C123 6.53 C124 2.84 C125 4.91 C126 4.4 F-1 >50 F-2 >50

Biological Example 2: Cryopreserved Primary Human Hepatocytes (PHH) Assay

(853) This assay is used to confirm the anti-HBV effect of the compounds in HBV PHH infection assay. Cryopreserved PHH (BioreclamationIVT, Lot YJM) was thawed at 37° C. and gently transferred into pre-warmed InVitroGRO HT medium (BioreclamationIVT, Cat. S03317). The mixture was centrifuged at 70 relative centrifugal force (RCF) for 3 minutes at RT, and the supernatant was discarded. Pre-warmed InVitroGRO CP medium (BioreclamationIVT, Cat #S03316) was added to the cell pellet to gently re-suspend cells. The cells were seeded at the density of 5.8×10.sup.4 cells per well to collagen I coated 96-well plate (Gibco, Cat. A1142803) with the InVitroGRO CP medium. All plates were incubated at 37° C. with 5% CO.sub.2 and 85% humidity.

(854) At 20 hours after plating, the medium was changed to PHH culture medium (Dulbecco's Modified Eagle Medium (DMEM)/F12 (1:1) (Gibco, Cat. 11320-033), 10% fetal bovine semm (Gibco Cat. 10099141), 100 U/mL penicillin, 100 μg/mL streptomycin (Gibco, Cat. 151401-122), ng/mL human epidermal growth factor (Invitrogen Cat. PHG0311L), 20 ng/mL dexamethasone (Sigma, Cat. D4902) and 250 ng/mL human recombinant insulin (Gibco, Cat. 12585-014)). And the cells were incubated at 37° C. with 5% CO.sub.2 and 85% humidity for 4 hours. The medium was then changed to pre-warmed PHH culture medium containing 4% polyethylene glycol (PEG) MW8000 (Sigma, Cat. P1458-50 ML) and 1% DMSO (Sigma, Cat. D2650). 5.8×10.sup.6 genomic equivalents of HBV were added into the medium.

(855) At 24 hours post-infection, the cells were gently washed with PBS and refreshed with PHH culture medium supplemented with 1% DMSO, and 0.25 mg/mL Matrix gel (Corning, Cat. 356237) at 200 μL per well. All plates were immediately placed in at 37° C. CO.sub.2 incubator.

(856) 24 hours later, serial dilutions of compounds made with DMSO were further diluted with the same culture medium (PHH culture medium supplemented with 1% DMSO and 0.25 mg/mL Matrix gel as described above) before they were added to the cells to reach desired final compound concentrations and 1% DMSO concentration. The medium containing the compounds were refreshed every three days.

(857) At 9 days post-compound treatment, extracellular HBsAg level were measured with Chemiluminescence Immuno Assay (CLIA) kit (Autobio, HBsAg Quantitative CLIA). Extracellular HBV DNA was extracted by MagNA Pure 96 system (Roche) and then determined by quantitative PCR with the following primers and probe:

(858) TABLE-US-00015 HBV-Forward Primer (SEQ ID NO: 1):  AAGAAAAACCCCGCCTGTAA (5′ to 3′); HBV-Reverse Primer (SEQ ID NO: 2): CCTGTTCTGACTACTGCCTCTCC (5′ to 3′); HBV-Probe: 5′ + tetramethylrhodamine + SEQ ID NO: 3 + black hole quencher 2-3′, wherein SEQ ID NO: 3 is CCTGATGTGATGTTCTCCATGTTCAGC.

(859) HBsAg IC.sub.50 and HBV DNA IC.sub.50 values were derived from the dose-response curve using 4 parameter logistic curve fit method. The compounds of formula (I) have HBsAg IC.sub.50<20 μM, particularly <1 μM; and HBV DNA IC.sub.50<50 μM. Results of Cryopreserved PHH assay are given in Table D2.

(860) TABLE-US-00016 TABLE D2 HBsAg IC.sub.50 data in Cryopreserved PHH assay Example No. HBsAg IC.sub.50 (μM) A001 1.19 A002 1.82 A004 6.61 A005 0.553 A006 1.08 A007 2.73 A008 0.948 A009 1.48 A010 3.0 A011 0.931 A012 2.11 A013 1.91 A016 0.828 A017 1.84 A020 7.5 A022 0.754 A024 4.09 A026 2.97 A039 7.08 A040 7.94 A043 6.69 A044 1.77 A049 1.26 A052 6.91 A053 3.57 A054 4.21 A055 2.38 A056 9.21 A057 9.76 A083 9.74 A084 1.02 A090 9.35 A092 2.8 A096 1.24 A097 4.03 A099 0.14 B001 1.03 B002-A 2.02 B002-B 3.35 B003 4.37 B004 5.52 B005 6.97 B007 2.24 B010 7.08 B011-A 2.32 B012-A 6.01 B012-B 2.56 B013-A 7.3 B013-B 1.02 B015-A 2.57 B017 4.87 B018-A 0.887 B018-B 4.7 B019-A 3.96 B022-A 3.83 B024 6.84 B025-B 3.06 B026-A 4.97 B026-B 3.19 B035-A 1.46 B036-A 9.5 B037-A 2.04 B043-B 3.7 B047-A 5.54 B050-B 9.46 B051-A 3.21 B051-B 5.3 B052-A 8.48 B052-B 7.98 B055-B 4.0 B070 0.788 B071 4.95 B073 5.97 B076 1.31 B082 4.8 B083 3.24 C002 2.43 C003-A 8.77 C006 3.74 C010 9.38 C011 8.5 C013 9.32 C014 7.8 C015 3.36 C016 7.14 C017 2.94 C019 3.0 C025-A 2.58 C025-B 2.02 C026 8.95 C031-A 1.16 C033-A 1.97 C033-B 4.33 C034-A 4.69 C034-B 9.11 C036-A 2.42 C036-B 5.58 C038-A 8.61 C041-A 5.93 C042-B 8.96 C043-A 8.67 C043-B 5.2 C044-A 9.58 C049-A 7.31 C055-A 9.27 C062 6.79 C063-A 6.61 C067-B 4.74 C073 7.56 C077 9.37 C078 6.32 C080 3.51 C081 8.77 C082 9.52 C084 5.21 C085 9.02 C086 5.46 C096 7.78 C103 7.56 C113 8.89 C114 9.19 C119 7.21 C120 4.12 C122 4.81 C125 7.17

Biological Example 3: cccDNA Southern Blot Assay

(861) HepDES19 cells were seeded at 4*10.sup.6 cells per T150 in the culture medium (Dulbecco's Modified Eagle Medium: Nutrient Mixture F-12 [DMEM-F12, Gibco Cat. 11320-82], 10% Fetal Bovine Serum [FBS, Clontech Cat. 631101], 0.1 mM Non-Essential Amino Acids Solution [NEAA, Gibco Cat. 11140-050], 50 μg/mL Penicillin-Streptomycin [PS, Invitrogen Cat. 15140-163], 500 μg/mL Geneticin [G418, Invitrogen Cat. 10131-027]) in the absence of Tet for 8 days. These cells were seeded at the density of 1×10.sup.6 cells per well in 6-well plate. At 24 hours after seeding, serial dilutions of compounds made with DMSO (Sigma, Cat. D2650) were further diluted with the same culture medium as described above before they were added to the cells to reach desired final compound concentrations and 1% DMSO concentration. After 5 days' compound treatment, the cells growing in one well from 6-well plate were re-suspended with 500 μL re-suspension buffer (50 mM tris [hydroxymethyl]amino methane pH 7.5), 10 mM ethylenediaminetetraacetic acid (EDTA), 50 μg/mL RNase A [Qiagen, Cat. 158922], 500 μL of 1.2% sodium dodecyl sulfate (SDS) was then added into the re-suspended cells to lyse the cells. After 15 minutes' incubation, 700 μL precipitation buffer (3M cesium chloride, 1M potassium acetate, 0.67M acetic acid) was added and the lysate was incubated at 4° C. for 2 h. The lysate was centrifuged at 15000 revolutions per minute (RPM) at 4° C. for 15 minutes. The supernatant was collected and loaded onto Qiagen miniprep columns (QIAprep spin Mini prep kit, Cat. No. 27016). After centrifugation for 1 minute at 15000 RPM, the column was washed once with 750 μL wash buffer PE (QIAprep spin Mini prep kit, Cat. No. 27016). 80 μL of double distilled water was loaded to the columns to elute Hirt DNA.

(862) Hirt DNA of each sample was loaded into 1.2% lx tris-acetate electrophoresis (TAE) agarose gel and separated at 90 voltages for 3 hours. The gel was then treated in 50 mM NaAc—HAc, pH4.2 for 30 min at room temperature (RT), and then denatured by soaking in denaturation buffer (0.5 M sodium hydroxide, 1.5 M sodium chloride) at room temperature for 30˜45 minutes. The gel was then treated with neutralization buffer (1M tris [hydroxymethyl]amino methane pH7.4 and 1.5M NaCl) at room temperature for 30˜45 minutes.

(863) The gel was transferred onto a pre-wet Nylon membrane (GE life science, Hybond N+) by capillary transfer method overnight, followed by UV crosslinking. The membrane was transferred into a hybridization tube, then rinsed with double distilled water at 60° C. for 5 min. 10 mL of hybridization buffer (Lab kits, China) was added, the resulting sample was rotated in hybridization oven at 60° C. for 1 hour. Digoxigenin (DIG)-labelled HBV probe was denatured at 95° C. for 10 minutes, and then 7 μL of denatured probe was added to the hybridization tube, which was rotated in hybridization oven at 60° C. overnight.

(864) On the second day, the membrane was washed according to the procedure of DIG wash and block buffer set kit (Roche, Cat. 11 585 762 001), and then incubated with 50 mL antibody solution (Antibody anti-Digoxigenin-AP Fab fragment [Roche Cat. 11093274910] diluted in fresh lxblocking buffer at 1:10,000) for 1 hour. The membrane was washed with 50 mL washing buffer (1×Maleic buffer with 0.3% Tween-20) for 15 minutes twice, and equilibrated with 20 mL detection buffer (0.1M tris [hydroxymethyl]amino methane pH9.5, 0.1M sodium chloride) for 5 minutes. CDP-Star substrate (Roche, Cat. 12041677001) was added to the membrane for 5 minutes, and then the membrane was scanned by Bio-Rad Visualize Image System (Biorad, ChemiDoc-MP, Serial No. 731BR00916).

(865) Results of cccDNA Southern Blot assay are given in FIG. 1. The results indicate that the compounds of this invention dose-dependently reduced cccDNA level in HepDES19 cells.

Biological Example 4: Human Microsome Stability Assay

(866) The human microsomal stability assay is used for early assessment of metabolic stability of a test compound in human liver microsomes.

(867) Human liver microsomes (Cat. NO.: 452117, Corning, USA; Cat. NO.: H2610, Xenotech, USA) were preincubated with test compound for 10 minutes at 37° C. in 100 mM potassium phosphate buffer, pH 7.4. The reactions were initiated by adding NADPH regenerating system. The final incubation mixtures contained 1 μM test compound, 0.5 mg/mL liver microsomal protein, 1 mM MgCl.sub.2, 1 mM NADP, 1 unit/mL isocitric dehydrogenase and 6 mM isocitric acid in 100 mM potassium phosphate buffer, pH 7.4. After incubation times of 0, 3, 6, 9, 15 and 30 minutes at 37° C., 300 μL of cold ACN (including internal standard) was added to 100 μL incubation mixture to terminate the reaction. Following precipitation and centrifugation, the amount of compound remaining in the samples was determined by LC-MS/MS. Controls of no NADPH regenerating system at zero and 30 minutes were also prepared and analyzed. The compounds of present invention showed good human liver microsome stability determined in the above assay, results are shown in Table D3 below.

(868) TABLE-US-00017 TABLE D3 Human liver microsome stability of the compounds of present invention Example No. Clearance of Human microsome (mL/min/kg) A001 10.0 A003 6.15 A004 6.15 A005 6.66 A007 6.15 A008 6.15 A009 6.57 A010 6.15 A015 6.15 A017 9.98 A018 6.15 A019 6.15 A021 6.15 A022 6.15 A024 6.61 A026 6.15 A031 6.15 A032 6.15 A033 6.15 A034 6.15 A039 6.37 A040 6.15 A041 6.15 A042 6.15 A043 6.15 A044 6.15 A046 6.15 A047 6.15 A049 6.15 A050 6.15 A051 6.15 A052 8.01 A053 7.66 A054 6.15 A056 6.15 A057 6.15 A058 6.15 A059 8.34 A060 6.15 A061 8.78 A062 9.88 A063 6.15 A064 9.5 A065 6.15 A067 6.15 A069 6.15 A070 6.15 A071 7.4 A073 6.15 A074 6.15 A075 6.15 A076 6.15 A077 8.57 A078 6.15 A079 6.6 A080 6.15 A081 6.15 A082 6.15 A083 6.15 A084 7.5 A085 6.15 A086 9.68 A088 7.09 A089 6.69 A091 6.15 A093 6.15 A094 6.15 A095 9.59 A096 6.15 A097 8.78 A099 9.53 B002-A 6.15 B002-B 6.15 B003 6.15 B004 6.15 B005 6.15 B007 6.15 B009 6.19 B010 6.15 B011-A 8.35 B012-A 6.15 B015-A 6.15 B016 6.15 B018-A 6.15 B019-B 8.92 B020-B 8.46 B021 6.15 B022-B 6.15 B022-A 6.15 B023 6.15 B024 7.41 B026-A 6.15 B026-B 6.15 B027-B 6.15 B028-B 9.98 B029 6.15 B035-A 8.46 B05-B 6.51 B036-A 6.15 B037-A 9.86 B038-A 6.84 B038-B 9.59 B039-B 6.15 B040-B 6.29 B041 6.15 B042 6.15 B043-A 6.15 B043-B 6.15 B044-A 6.15 B044-B 6.15 B047-A 6.15 B047-B 6.15 B048-A 6.15 B048-B 6.15 B049-A 7.5 B050-A 6.15 B050-B 7.69 B051-A 6.15 B051-B 6.97 B052-A 6.15 B052-B 6.15 B053-A 6.15 B053-B 6.15 B054 6.15 B056-A 6.48 B057 6.15 B072 8.89 B073 6.15 B076 6.15 B077 6.15 B078 6.15 B080 6.15 B082 6.15 B083 6.15 B084 6.15 B086 6.15 B087 6.15 B088 6.15 C001 6.15 C002 6.15 C003a 6.15 C005 8.08 C006 6.15 C009 6.15 C011 6.15 C012 6.15 C013 6.15 C014 8.04 C015 6.15 C016 6.15 C017 6.15 C018 6.74 C019 6.71 C020 6.15 C021 7.66 C022 6.15 C023 6.15 C024 6.15 C025-A 6.15 C025-B 6.15 C026 6.81 C027 6.15 C028 8.85 C032-A 9.6 C033-A 6.15 C033-B 6.15 C034-A 6.15 C034-B 6.75 C035-A 8.64 C035-B 9.78 C036-A 6.15 C036-B 6.15 C037-A 6.15 C037-B 6.15 C038-A 6.15 C038-B 6.15 C039-A 6.15 C039-B 6.15 C040-A 8.52 C042-A 7.57 C042-B 6.15 C043-A 6.15 C043-B 7.72 C044-A 6.15 C044-B 9.33 C045-A 6.53 C045-B 9.43 C046-A 6.15 C046-B 6.15 C047-A 6.15 C047-B 6.15 C050 6.15 C050-B 6.15 C051-A 6.15 C051-B 7.85 C052-A 9.08 C054 6.52 C056-A 6.15 C057-A 8.0 C060 6.15 C063-A 9.09 C068 6.15 C070 9.42 C071 6.15 C072 6.15 C073 7.85 C074 6.15 C075 6.15 C076 6.15 C077 6.15 C078 6.15 C079 6.15 C080 6.15 C081 6.15 C082 6.15 C083 6.15 C084 6.15 C085 6.15 C086 6.15 C087 6.15 C088 6.15 C089 6.15 C092 6.15 C093 6.15 C094 6.15 C095 9.62 C096 6.15 C098 6.15 C099 7.11 C100 6.15 C101 6.15 C102 7.11 C103 6.15 C104 6.15 C105 6.15 C110-A 6.15 C110-B 6.15 C111 6.15 C112 6.15 C113 6.15 C115 6.15 C116 6.15 C117 7.45 C118 6.15 C119 6.39 C120 6.15 C121 8.68 C122 7.32 C125 6.15