BORDETELLA VACCINE

20200222523 ยท 2020-07-16

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention provides genetically engineered strains of the Bordetella species to include one or more mutations preventing expression of the gene encoding the Bordetella Sigma Regulator (also referred to as bsr, btrS, and brpL), compositions and vaccines thereof, and the use of such engineered strains in methods to protect against Bordetella spp, including but not limited to Bordetella bronchiseptica, B. pertussis, B. parapertussis, B. homelsii, or B. avium. In some aspects, the present invention provides the Bordetella bronchiseptica strain RB50bsr, compositions and vaccines thereof, and the use of Bordetella bronchiseptica strain RB50fer in methods to protect against Bordetella spp, including but not limited to Bordetella bronchiseptica, B. pertussis, B. parapertussis, B. homelsii, or B. avium.

    Claims

    1. An isolated strain of the Bordetella species, the isolated strain of the Bordetella species comprising a mutation preventing expression of the bsr sigma factor (also known as the btrS gene product or the brpL gene product).

    2. The isolated strain of the Bordetella species of claim 1, wherein the mutation comprises an in frame deletion of the gene encoding the bsr sigma factor.

    3. The isolated strain of the Bordetella species of claim 1, wherein the Bordetella species is selected from Bordetella bronchiseptica, B. pertussis, B. parapertussis, B. homelsii, or B. avium.

    4. The isolated strain of the Bordetella species of claim 1, wherein the Bordetella species comprises Bordetella bronchiseptica strain RB50.

    5. The isolated strain of the Bordetella species of claim 1, wherein the Bordetella species comprises Bordetella bronchiseptica and the mutation comprises an in frame deletion of the gene encoding the bsr sigma factor.

    6. The isolated strain of the Bordetella species of claim 5, wherein the isolated Bordetella species comprises the Bordetella bronchiseptica RB50 strain.

    7. The isolated strain of the Bordetella species of claim 6, wherein the isolated strain of the Bordetella species is RB50bsr deposited at the ATCC under Patent Designation XXXX.

    8. (canceled)

    9. A composition comprising the isolated strain of the Bordetella species of claim 1.

    10. The composition of claim 7 formulated for intranasal, oral, intradermal, or intramuscular administration.

    11. A vaccine comprising the isolated strain of the Bordetella species of claim 1.

    12. A vaccine comprising the isolated strain of the Bordetella species of claim 7.

    13. A composition comprising the isolated strain of the Bordetella species of claim 7.

    14. A method of generating an immune response to Bordetella in a subject, the method comprising administering the isolated strain of the Bordetella species of claim 1 to the subject.

    15. The method of claim 14 demonstrating reduced persistence and/or reduced colonization in the lung and/or nasal cavity of the subject.

    16. A method of vaccinating a subject against Bordetella infection, the method comprising administering the isolated strain of the Bordetella species of claim 1 to the subject.

    17. A method of vaccinating a subject against Bordetella bronchiseptica, B. pertussis, B. parapertussis, B. homelsii, or B. avium, the method comprising administering the isolated strain of the Bordetella species of claim 14 to the subject.

    18. The method of claim 14 comprising intranasal, oral, intradermal, or intramuscular administration.

    19. The method of claim 14, wherein the subject is livestock or domestic pet.

    20. The method of claim 19, wherein the subject is a cow, pig, chicken, dog, cat, sheep, or horse.

    21. The method of claim 14, wherein the subject is a human.

    Description

    BRIEF DESCRIPTION OF THE FIGURES

    [0025] FIGS. 1A-1C. bsr is required to persist in lung and nasal cavity of C57Bl/.sub.6J mice. C57BL/6J mice were intranasally inoculated with 50 L of 510.sup.7 bacteria either RB50 or RB50bsr. Mice were harvest at days 3, 7, 10, 14, 21, 28, 35, 42, 49, and 56 and organs were plated in BGS. The results showed that bsr is required to persist in lungs (FIG. 1A), trachea (FIG. 1B) and nasal cavity (FIG. 1C).

    [0026] FIGS. 2A-2C. RB50bsr induces higher immune cells recruitment than RB50. C57BL/6J mice were intranasally inoculated with 50 L of 510.sup.7 bacteria either RB50 or RB50bsr. Mice were harvest at days 3, 7, 10, 14, and 21. Spleen and lung were processes following previously published protocols. FIG. 2A shows the number of macrophages isolated from spleen. FIG. 2B shows the number of B cells isolated from spleen. FIG. 2C shows the number of neutrophils isolated from lung (site of infection). The results indicate a higher cell recruitment induced by the bsr mutant suggesting an earlier and stronger response.

    [0027] FIGS. 3A-3C. RB50bsr induces sterilizing immunity against B. bronchiseptica, B. pertussis, and B. parapertussis. C57BL/6J mice were intranasally inoculated with 50 L of 510.sup.7 of RB50bsr or IP vaccinated with Adacel (2 dosages 14 days apart and diluted 1:5) and a third group was inoculated IP with PBS as a control. 62 days post-inoculation each group of mice were challenged with 50 L 10.sup.5 of B. bronchiseptica, B. pertussis, or B. parapertussis. 7 days post-inoculation mice were euthanized and organs harvested. A control group was challenged first with RB50bsr and not re-challenge to confirm clearance. FIG. 3A shows the results obtained for the challenge with B. bronchiseptica. FIG. 3B shows the results for the challenge with B. pertussis. FIG. 3C shows the result for the challenge with B. parapertussis. The results showed that none of the three classical Bordetellae colonizes any organ of the mice previously challenged with RB50bsr suggesting that previous infection with the bsr mutant provides sterilizing immunity against further encounter with classical Bordetella spp.

    [0028] FIGS. 4A and 4B. RB50bsr induces antibody protection even with lower dosages of inoculum. C57BL/6J mice were intranasally inoculated with 50 L of 510.sup.7 bacteria either RB50 or RB50bsr. Mice were harvest at 28 days and serum was collected. 150 L of serum was IP injected in nave animals versus PBS as control. Three hours later mice were intranasally challenged with RB50 or BP536. Three days post-inoculation, mice were harvest and organs plated in BGS. FIG. 4A shows the log 10 CFU recovered in trachea and lung of mice challenged with RB50. FIG. 4B shows the log 10 CFU of mice challenged with BP536. The results revealed a 3 logs reduction in the CFU of those animals that were passive transferred with antibodies of RB50 bsr, indicating that bsr induces a more robust and protective set of antibodies.

    [0029] FIG. 5. Clearance requires adaptive immunity. Mice were intranasally challenged with 5 l of PBS containing 150 CFU. In blue is presented RB50 wild-type strain of B. bronchiseptica and in red the strain RB50btrS mutant. In black boxes are indicated the significant differences between both sets of treatments. Statistical difference was determine using Two-Way Anova test ***=p<0.001.

    [0030] FIGS. 6A and 6B. BtrS down-regulates T cell recruitment to lungs. In blue is represented RB50 wild-type strain of B. bronchiseptica and in red the strain RB50btrS mutant and in grey the mock control (uninfected group). The black boxes indicate significant differences between treatments. Statistical difference was determine using Two-Way Anova test ***=p<0.001 and ****=p<0.0001. FIG. 6A shows CD4+ numbers (10.sup.3) recruited in lungs of mice expose to different bacteria. FIG. 6B shows CD8+ numbers (10.sup.3) recruited in lungs of mice expose to RB50, the mutant RB50btrS or naive group.

    [0031] FIGS. 7A-7C. btrS down-regulates B cell recruitment in lungs. The black boxes indicate significant differences between treatments. Statistical difference was determine using Two-Way Anova test ****=p<0.0001 or *=p<0.1. FIG. 7A shows B cell numbers in lungs (10.sup.6). FIG. 7B shows IgG antibody titers in lungs of infected mice with each strain. FIG. 7C shows IgA antibody titers in lungs of infected mice with each strain.

    [0032] FIG. 8. The btrS mutant induces sterilizing immunity against Bordetella bronchiseptica. Shown in pg/ml are the cytokines produced by RAW 264.7 challenged with RB50btrS and RB50. The MOI was 1:100 and the macrophages were exposed to bacteria during 4 hours. Statistical significance was calculated using Two-Way Anova *=p<0.1 and ****=p<0.0001.

    [0033] FIGS. 9A and 9B. The btrS mutant induces sterilizing immunity against Bordetella bronchiseptica. FIG. 9A shows the workflow of experiment. The top line shows the PBS control group timeline, the middle line shows the Adacel vaccination ( dose) timeline, and the bottom line shows the btrS mutant timeline. Challenge indicates when the mice were expose to a high dose high volume of bacteria. FIG. 9B shows the CFUs of the nasal cavity after challenge with high dose of RB50. Statistical significance was calculated using Two-Way Anova ****=p<0.0001.

    [0034] FIG. 10. RB50btrS induces sterilizing immunity against B. pertussis and B. parapertussis. Black circles indicate the PBS control group, grey circles indicate the group that was vaccinated with of the dose of the current Adacel vaccine, and grey squares along the bottom axis indicate the group of the mice previously challenged with the mutant btrS. Statistical significance was calculated using Two-Way Anova ****=p<0.0001.

    [0035] FIGS. 11A-11C. Low dose of RB50btrS can induce robust protection against classical Bordetellae. FIG. 11A shows the log.sub.10 CFU values isolated after infection with RB50 B. bronchiseptica. FIG. 11B shows the log.sub.10 CFU values isolated after infection with 536 B. pertussis. FIG. 11C shows the log.sub.10 CFU values isolated after infection with 12822 B. parapertussis.

    [0036] FIG. 12A-12C. Chromosomal location and in-frame deletion mutant of brpL gene. FIG. 12A shows location of the brpL gene in B. bronchiseptica. FIG. 12B shows location of the brpL gene in B. pertussis. FIG. 12C shows location of shows location of the brpL gene B. pertussis.

    DETAILED DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS

    [0037] The present invention provides genetically engineered strains of the Bordetella species, including a mutation preventing expression of the gene encoding the Bordetella Sigma Regulator, also referred to herein as bsr and the use of such mutant Bordetella species as vaccines to protect against Bordetella spp. infections. In some aspects, the mutation is an in frame deletion of the gene encoding the bsr sigma factor. The bsr gene encoding the Bordetella sigma regulator is also referred to as the btrS gene or the brpL gene.

    [0038] Bordetella spp. are gram-negative coccobacilli and are important respiratory pathogens, commonly isolated from the respiratory tract of humans and animals. The genus Bordetella is currently subclassified into nine species: Bordetella pertussis, B. bronchiseptica, B. parapertussis, B. avium, B. hinzii, B. holmesii, B. trematum, B. petrii, and B. ansorpii. A Bordetella bsr deletion mutant of the present invention includes a bsr deletion of bsr in B. pertussis, B. bronchiseptica, B. parapertussis, B. avium, B. hinzii, B. holmesii, B. trematum, B. petrii, or B. ansorpii.

    [0039] A Bordetella bsr deletion mutant of the present invention may be, for example, a genetically engineered mutant of Bordetella bronchiseptica, B. pertussis, B. parapertussis, B. homelsii, or B. avium.

    [0040] In some aspects, a Bordetella bsr deletion mutant may be constructed in the Bordetella bronchiseptica strain RB50. B. bronchiseptica strain RB50 has been extensively characterized in a variety of animal species. First described by Cotter and Miller, RB50 is a B. bronchiseptica strain isolated from the naris of a 3-month-old New Zealand White rabbit. In the Bvg.sup.+ phase, RB50 expresses FHA and has hemolytic activity (due to adenylate cyclase toxin) and produces small domed colonies on BG agar. In the Bvg.sup. phase, resulting from modulation with MgSO.sub.4, nicotinic acid, or growth at low temperature, FHA and hemolytic activity are no longer produced, colonies are large and flat, and the phenotype of motility appears. Bvg.sup.-phase RB50 expresses a 40-kDa flagellin protein, which corresponds to one of the two identified B. bronchiseptica flagellin isotypes that differ in electrophoretic mobility. Additionally, RB50 is oxidase, catalase, urease, and citrate positive and does not ferment glucose or lactose, characteristics consistent with the identification of this strain as B. bronchiseptica (Cotter and Miller, 1994, Infection and Immunity, 62(3):3381-3390).

    [0041] A knock out mutant (in frame deletion) of the brpL gene (also referred to herein as the bsr gene or the btrS gene) may be constructed using standard allelic exchange technology, as previously reported in the literature. See Inatsuka et al., 2010, Infect Immun; 78:2901-2909 (doi:10.1128/IAI.00188-10). Primers as detailed in Table 1 of Example 1 may be used. Alternatively, in some applications, UpStream region primers UF_btrS (ATA GGA TCC AGA TCG GAA CCA GCC TGG (SEQ ID NO: 5)) and UR_btrS (ATT GAA TTC CCC CTG CCC GGG CCA (SEQ ID NO: 6)) and DownStream region primers DF_btrS (ATA GAG CTC GCA AAG CGA TAC CAA GTG AAA GGG TG (SEQ ID NO: 7)) and DR_btrS (TAT ACT AGT CAG GCG AGC AGT TCC AGG TCA (SEQ ID NO: 8)) may be used.

    [0042] Amongst the regulatory systems are the bacterial sigma factors that can control gene expression by directly binding to the promotor regions of genes. Their activity responds to environmental or developmental signals, changing patterns of gene expression. In Bordetella spp., several sigma factors have been reported, one of which is the sigma factor known as brpL. See Moon et al., 2017, Mbio; 8(5):e01526-17; Nicholson, 2007, BMC Genomics; 8:220; Ahuja et al., 2016, Proc Natl Acad Sci USA; 113:2341-2348; and Mattoo et al., 2004, Mol Microbiol; 52:1201-1214. This sigma factor plays an important role in the regulation of Type III Secretion System (T3 SS), but it remains unclear what other genes might be regulated by it as well as its particular role during infection it is unknown. The brpL gene (locus_tag BB1638) encodes a BvgAS-regulated extracytoplasmic function (ECF) sigma factor. The brpL gene is located immediately downstream of T3SS (BB1608 to BB1637) in reverse orientation. It is also known as btrS and is the first gene of the btr locus (9 genes) that is involved in transcriptional regulation of the T3SS and other virulence-associated genes (Ahuja et al., 2016, Proc Natl Acad Sci USA; 113:2341-2348). Chromosomal locations of the brpL gene are shown in FIGS. 12A-12C.

    [0043] A Bordetella spp. bsr deletion mutant as described herein may be put on deposit with the American Type Culture Collection (ATCC), 10801 University Boulevard, Manassas, Va. 20110-2209, USA. Such a deposit may be in accordance with the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure.

    [0044] In some aspects, the present invention includes the Bordetella bronchiseptica strain RB50bsr isolate described herein. The Bordetella bronchiseptica strain RB50bsr isolate described herein may be put on deposit with the American Type Culture Collection (ATCC), 10801 University Boulevard, Manassas, Va. 20110-2209, USA under ATCC Patent Designation number XXXX. Such a deposit may be in accordance with the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure.

    [0045] Also included in the present invention are compositions including one or more of the isolated Bordetella spp. bsr deletion mutants, as described herein. Such a composition may include a pharmaceutically acceptable carrier. As used, a pharmaceutically acceptable carrier refers to one or more compatible solid or liquid fillers, diluents or encapsulating substances, which are suitable for administration to a human or other vertebrate animal. Carriers include, for example, stabilizers, preservatives and buffers. Suitable stabilizers include, for example, SPGA, carbohydrates (such as sorbitol, mannitol, starch, sucrose, dextran, glutamate or glucose), proteins (such as dried milk serum, albumin or casein) or degradation products thereof. Suitable buffers include, for example, alkali metal phosphates. Suitable preservatives include, for example, thimerosal, merthiolate and gentamicin. Diluents include, but are not limited to, water, aqueous buffer (such as buffered saline), alcohols, and polyols (such as glycerol). Such compositions and/or carriers may be pyrogen free. The formulation of such compositions is well known in the art.

    [0046] Compositions of the invention may include an adjuvant, including, but not limited to aluminum hydroxide; aluminum phosphate; QS-21 Stimulon; 3-O-deacylated monophosphoryl lipid A; IL-12; N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP); N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine (CGP 11637, referred to as nor-MDP); N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1-2-dip-almitoyl-sn-glycero-3-hydroxyphos-phoryloxy)-ethylamine (CGP 19835A, referred to a MTP-PE); cholera toxin; and non-toxic derivatives of cholera toxin, including its B subunit; procholeragenoid, and fungal polysaccharides. Compositions of the present invention may include additional active immunogens, including other immunologically active antigens against other pathogenic species. The other immunologically active antigens may be replicating agents or non-replicating agents. The formulation of such compositions is well known in the art.

    [0047] The present invention also includes methods of making and using the compositions described herein. The compositions of the present disclosure may be formulated in pharmaceutical preparations in a variety of forms adapted to the chosen route of administration. One of skill will understand that the composition will vary depending on mode of administration and dosage unit. The agents of this invention can be formulated for administration in a variety of ways, including, but not limited to, intravenous, topical, oral, intranasal, subcutaneous, intraperitoneal, and intramuscular delivery. In some aspects, a composition is formulated for needle-less administration to the mucosa, for example for intranasal administration to the upper respiratory tract. It is expected that mucosal administration of the pharmaceutical composition to a mammalian subject will stimulate an immune response in mucosal tissues, including mucosal tissues that are remote from the site of administration, in addition to producing a systemic immune response in the subject.

    [0048] The present invention also includes methods of inducing an immune response in a subject by administering a Bordetella spp. bsr deletion mutant or composition, as described herein to the subject. The immune response may or may not confer protective immunity. An immune response may include, for example, a humoral response and/or a cell mediated response. Such an immune response may be a humoral immune response, a cellular immune response, and/or a mucosal immune response. A humoral immune response may include an IgG, IgM, IgA, IgD, and/or IgE response. The determination of a humoral, cellular, or mucosal immune response may be determined by any of a variety of methods, including, but not limited to, any of those described herein. The induction of an immune response may include the priming and/or the stimulation of the immune system to a future challenge with an infectious agent, providing immunity to future infections. The induction of such an immune response may serve as a protective response, generally resulting in a reduction of the symptoms. The immune response may enhance an innate and/or adaptive immune response. Immunogenicity may be assayed in any of a variety of animal models, including, but not limited to, mouse and/or non-human primates model systems, such as the baboon model system.

    [0049] The present invention also includes methods of vaccinating a subject by administering a Bordetella spp. bsr deletion mutant as described herein to the subject. With administration, one or more of the effects described in the Examples included herewith may be observed in the subj ect.

    [0050] With the methods of the present invention, any of a variety of modes of administration may be used. For example, administration may be intravenous, topical, oral, intranasal, subcutaneous, intraperitoneal, intramuscular, or intratumor. In some aspects, administration is the needleless administration to a mucosal membrane, for example, by the intranasal administration to the upper respiratory tract by spray, droplet or aerosol or oral, sublingual or buccal administration.

    [0051] An agent of the present disclosure may be administered at once or may be divided into a number of multiple doses to be administered at intervals of time. For example, agents of the invention may be administered repeatedly, e.g., at least 2, 3, 4, 5, 6, 7, 8, or more times, or may be administered by continuous infusion. It is understood that the precise dosage and duration of treatment is a function of the disease being treated and may be determined empirically using known testing protocols or by extrapolation from in vivo or in vitro test data. It is to be noted that concentrations and dosage values may also vary with the severity of the condition to be alleviated. It is to be further understood that for any particular subject, specific dosage regimens should be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the compositions, and that any concentration ranges set forth herein are exemplary only and are not intended to limit the scope or practice of the claimed compositions and methods.

    [0052] By a therapeutically effective amount is meant a sufficient amount of the compound to treat the subject at a reasonable benefit/risk ratio applicable to obtain a desired therapeutic response. It will be understood, however, that the total daily usage of the compounds and compositions of the present invention will be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose level for any particular patient will depend upon a variety of factors including, for example, the disorder being treated and the severity of the disorder, activity of the specific compound employed, the specific composition employed, the age, body weight, general health, sex and diet of the patient, the time of administration, route of administration, and rate of excretion of the specific compound employed, the duration of the treatment, drugs used in combination or coincidentally with the specific compound employed, and like factors well known in the medical arts.

    [0053] In some therapeutic embodiments, an effective amount of an agent is an amount that results in a reduction of at least one pathological parameter. Thus, for example, in some aspects of the present disclosure, an effective amount is an amount that is effective to achieve a reduction of at least about 10%, at least about 15%, at least about 20%, or at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95%, compared to the expected reduction in the parameter in an individual not treated with the agent.

    [0054] As used herein, the term subject includes, but is not limited to, humans and non-human vertebrates. In preferred embodiments, a subject is a mammal, particularly a human. A subject may be an individual. A subject may be an individual, patient, or host. Non-human vertebrates include livestock animals, companion animals, and laboratory animals. Non-human subjects also include non-human primates as well as rodents, such as, but not limited to, a rat or a mouse. Non-human subjects also include, without limitation, chickens, horses, cows, pigs, goats, dogs, cats, guinea pigs, hamsters, ferrets, mink, and rabbits.

    [0055] As used herein in vitro is in cell culture and in vivo is within the body of a subject.

    [0056] As used herein, isolated refers to material that has been either removed from its natural environment (e.g., the natural environment if it is naturally occurring), produced using recombinant techniques, or chemically or enzymatically synthesized, and thus is altered by the hand of man from its natural state. For instance, a polypeptide, a polynucleotide, or a cell can be isolated. Preferably, a substance is purified, i.e., is at least 60% free, preferably at least 75% free, and most preferably at least 90% free from other components with which they are naturally associated.

    [0057] The present invention is illustrated by the following examples. It is to be understood that the particular examples, materials, amounts, and procedures are to be interpreted broadly in accordance with the scope and spirit of the invention as set forth herein.

    EXAMPLES

    Example 1

    Construction of a RB50brpL Knock Out in Frame Deletion

    [0058] A knock out mutant (in frame deletion) of the brpL gene (also referred to herein as the bsr gene or the btrS gene) was constructed and the construction confirmed by PCR followed by whole genome sequencing. The knock out generation utilized standard allelic exchange technology, as previously reported in the literature. See Inatsuka et al., 2010, Infect Immun; 78:2901-2909 (doi:10.1128/IAL00188-10). Briefly, 500-bp DNA fragments flanking the brpL gene to be deleted were amplified and cloned into the vector, flanking gentamicin resistance gene on both sides. For conjugation, B. bronchiseptica was mated with E. coli SM10pir donor strain on BG agar with 50 mM MgSO4, to inhibit expression of the vector-based Scel restriction enzyme. Mutant colonies were subsequently selected for by growth on gentamicin containing BG agar, and incorporation of the mutant allele was verified by PCR. Mutations were complemented using pBBR1 as the vector. The primers used in the generation of this mutant are shown in Table 1.

    TABLE-US-00001 TABLE1 Frag- Temp. ment Name Sequence(5-3) (Celsius) size UP-Fw GGATCCGACAGCGTGCCGTAGGGG 62 428 (SEQIDNO:1) UP-Rv CGTCCTCCCTTGGCGGCGCTGCAG 66 (SEQIDNO:2) DW-Fw GAATTCGCGGCTGTGGCGGCCG 64 550 (SERQIDNO:3) DW-Rv ATATGCGTTGTCCGGTTTTTCGGGATCC 64 (SEQIDNO:4)

    [0059] After the allelic exchange, hemolytic colonies were screened by PCR using the same primers expecting changes in band size of the indicated fragment size. Once a clone was selected, it was named RB50brpL (also referred to herein as RB50bsr, RB50btrS, and BBvac). Frozen stocks were made and sent for confirmation by whole genome sequencing.

    [0060] The chromosomal location and in-frame deletion mutant of brpL gene is shown in FIGS. 12A-12C and FIG. 13.

    Example 2

    Genetic Determinants of Intracellular Survival and Growth of Bordetellae

    [0061] This example shows that Bordetella species utilize intracellular survival within host immune cells as the mechanism for persisting at undetected levels. This mechanism could account for vaccine failure and the increased persistence of clinical disease.

    [0062] From 20 candidate genes of unknown function and that are highly up-regulated when Bordetella spp. is exposed to blood or serum, the gene that showed most promise was bsr. RB50bsr is a mutant of the Bordetella species Bordetella bronchiseptica strain RB450 with a deletion of the gene encoding for a small regulator. Results showed that the presence of this gene is required for persistence of Bordetella bronchiseptica, an established model organism for B. pertussis. In mice, RB50bsr was completely cleared from all organs, while wild type B. bronchiseptica colonized chronically. When studying the immune response, it was also detected that the strains evoked different immune responses, suggesting a difference in the adaptive immunity.

    [0063] Bacterial strains and growth conditions. The strains used in this work are the wild type Bordetella bronchiseptica strain RB50, and a mutant strain that is a knock out for one of the regulators present in Bordetellae. This mutant is called RB50bsr (Bordetella Sigma Regulator). Bacteria were grown in Bordet-Gengou agar (Difco) supplemented with 5% sheep blood. Culture in liquid media was performed in Stainer-Scholte (SS) starting at optical densities of 0.1 or lower and grown overnight at 37 degrees and shaking (200 rpm).

    [0064] Animal Experiments. C57Bl/6J mice (Jackson) were used for the time course infection. Mice were challenged intranasally with 50 L of a bacterial suspension (10.sup.6) under 5% isoflurane anesthesia. Mice were sacrificed at days 3, 7, 14, 21, 28, 35, 42, 49, and 56 post-challenge and harvested the organs. The killing was CO.sub.2 followed by cervical dislocation. To test the role of adaptive immunity in the progression of the disease, B6.129S7-Rag1.sup.TmMom/J mice were challenged with 50 mL of a bacterial suspension (10.sup.6) and sacrificed them at 21 days postchallenge. Organs were harvested, and dilutions were plated on BGS agar. All plates were incubated for 48 hours at 37 degrees.

    [0065] Immunology Assay. Mice were harvested at 21 days post-inoculation and their spleens and lungs were collected and processed. ACK-Lysing Buffer (Gibco for Life Technologies) was used to digest the erythrocytes and tryptan blue (COUNTESS cell counting chamber, V Invitrogen) was performed as previously described to count the total and live cells. To estimate granulocytes, B cell and T cells populations, and the assays were performed using standard protocols (Maecker et al., 2005, BMC Immunology; 6:13).

    Results and Discussion

    [0066] Papers have been published showing the role of different Bordetella sigma factors in siderophore formation or regulation of expression of Type 3 Secretion System. To study the role of bsr in B. bronchiseptica, a series of in vitro assays were performed to test duplication time and antibiotic susceptibility. No differences were found between wild type Bordetella bronchiseptica strain RB450 and the mutant RB50bsr in in vitro assays. In contrast, other mutants of sigma factors, such as the SigE mutant, fail to form a successful cell envelope stress response (Barchinger et al., 2012, BMC Microbiology; 12:179). This implies that this sigma factor plays an important role in evading immune response and other stressful situations such as temperature, antibiotic susceptibility, and others.

    [0067] To further investigate the role of bsr (Bordetella Sigma Regulator) in colonization, persistence and outcome of the disease, a time course infection was performed using black mice C57Bl/6J and challenging them with 50 L of a 10.sup.6 bacterial suspension (RB50 or RB50bsr). Mice were then harvested at different times and organs were plated in dilutions on BGS plates.

    [0068] The results show that the mutant strain significantly decreases persistence in the lung. These results have great implications as this is the first virulent Bordetella bronchiseptica mutant that fails to persist in the nasal cavity of mice, indicating bsr is required for persistence in mice. The results showed that RB50bsr is nearly cleared from the lungs at day 14 post-inoculation while RB50 is cleared at nearly 50 days post-infection. The results also showed that RB50bsr is completely clear from nasal cavity at day 56 post-inoculation while the wild type strain RB50 is not clear even at 100 days post-inoculation. Previous papers have shown that RB54 fails to persist in nasal cavity, however this mutant is in Bvg phase, which means that it is not expressing virulence factors (Harvill et al., 1999, Infection and Immunity; 67: 1493-1500). The bsr mutant expresses virulence factors, however, it fails to persist in these areas.

    [0069] As discussed above, the mutant strain does not show differences in vitro. Moreover, in vivo, it is isolated in the same level as the wild type at the beginning of the infection (e.g., Day 3 post-inoculation), but it does not persist. This indicates that there are differences in the immune response generated by the wild type strain or the mutant, which results in clearance of infection in the mutant strain. To investigate the interactions with the immunity, cytokine production was studied in mice challenged with wild-type strain or the bsr mutant.

    [0070] Spleens of the mice were collected at day 21 post-inoculation and processed. Flow cytometry was used to analyze the samples. The results showed that the number of cells and percentage of cells producing IL-17 is significantly higher in the mice challenged with RB50 (**95% confidence.

    [0071] These results allow one to visualize precisely how these two strains interact differently with the immune response. Infecting mice with the bsr mutant led to a higher number of cells producing IL-10. This cytokine is associated with an anti-inflammatory immune response or Th-2. The mutant strain was cleared more rapidly from the organs due to it evoking robust host immune attack. In contrast, infecting mice with wildtype RB50 led to a higher percentage of cells producing IL-17. This cytokine is associated with chronic infection.

    [0072] These results showed a novel interaction with the immunity leading one to ask if adaptive immunity is playing an important role in the clearance of bsr mutant. If the bsr mutant is cleared by a more robust immune response, then it should not be cleared more rapidly in mice lacking an adaptive immune response.

    [0073] Because of the differences in clearance times from the lungs and the lack of persistence of the mutant in the nasal cavity, it was speculated that the mutant strain must be interacting differently with the adaptive immune response. To test this, immunocompromised mice, lacking in B and T cells, were challenged with the bsr mutant and the wildtype strain. If the bsr mutant in fact interacting with the adaptive immune response, then removing this line of defense should eliminate its defect. This is supported by the data. B6.129S7-Rag1.sup.TmMom/J mice were challenged with 50 mL of 10.sup.6 bacteria. 21 days post-challenge the mice were sacrificed and organs were harvested and plated on BGS agar. The results showed that the numbers of CFU isolated from nasal cavity and trachea in mice challenged with both strains were similar. The fact that the mutant is defective in wild type mice but not in mice lacking B/T cells indicates that the bsr mutant was rapidly cleared by B and/or T cell-dependent mechanisms.

    Conclusion

    [0074] It can be concluded that bsr is required for persistence in mice. This can be seen by the early clearance of the bsr mutant from the lungs and its lack of persistence in the nasal cavity. Mice challenged with wild type RB50 induce higher production of IL-17 while mice challenge with the mutant strain produce more IL-10. Clearance of the mutant strain is mediated by B and T cells that are affected by such cytokines.

    Example 3

    B50bsr Confers Protection Against Colonization and Induces Long Lasting Immunity

    [0075] Bacterial strains and culture conditions. Bacteria were grown in Bordet-Gengou agar (Difco) supplemented with 10% sheep blood. Culture in liquid media was performed in Stainer-Scholte (SS) starting at optical densities OD600 of 0.1 or lower and grown overnight, shaking (220 rpm) at 37 C. Strains used in this study included strains of B. bronchiseptica, B. pertussis and B. parapertussis as well as some mutants.

    [0076] Animal experiments. Wild type C57BL/6J mice were obtained from Jackson Laboratories, Bar Harbor, Me. All experiments were carried out in accordance with all institutional guidelines (AUP: A2016 02-010-Y2-A3) and following previously published protocols (Bendor et al., 2015, PLoS One; 10(10):e0140743; and Weyrich et al., 2012, PLoS One; 7(10):e45892). Briefly, the number of bacterial colony forming units in liquid cultures was calculated based on the optical density measured by absorbance of light at 600 nm. Bacteria were then diluted to 10.sup.8 CFU/ml in sterile PBS. After that, dilutions were made up to 10.sup.5 bacteria/mL. Plating dilutions on BGS agar and counting the resulting colonies after two days of growth at 37 C. Mice were sedated with 5% isoflurane (IsoFlo, Abbott Laboratories) in oxygen and 50 l were inoculated intranasally.

    [0077] Mice were euthanized with CO.sub.2 inhalation followed by cervical dislocation on days 3, 7, 10, 14, 21, 28, 35, 42, 49, 56, 60, and 72 and respiratory tract and systemic organs, were extracted. Tissues were homogenized in PBS, serially diluted and plated onto BG agar plates with 200 g/mL streptomycin, and colonies were counted after 2 days of growth at 37 C. for B. bronchiseptica and 4 days for B. pertussis or B. parapertussis.

    [0078] For the vaccination study, 1:5 dilution of Adacel (Sanofi Pasteur) was prepared. Mice were injected intraperitoneally with 500 L of the vaccine dilution. For the controls of this experiment, PBS was intraperitoneally injected in the same conditions and volumes as the vaccinated group. Vaccinated group and PBS control were boosted at 14 days following the same protocol. The third group were mice challenged as previously described with RB50bsr. 60 days later, mice were challenged intranasally with 50 L of PBS containing 10.sup.5 bacteria of B. bronchiseptica RB50; B. pertussis Tohama I; or B. parapertussis 12829. Mice were harvest 7 days post-challenge. Other controls used included: 1) mice challenged with RB50bsr and harvest 60 days after challenge to confirm complete clearance from all mice organs; and 2) mice infected with RB50bsr kept with no second challenge until the end of the experiment to control clearance and cross-contamination.

    [0079] For the passive transfer experiments, injection of 200 l of immune serum intraperitoneal into naive mice was immediately followed by intranasal inoculation. Animals were sacrificed on the indicated day post-transfer and inoculation and colonization determined as described.

    [0080] Animals were handled following institutional guidelines, in keeping with full accreditation from the Association for Assessment and Accreditation of Laboratory Animal Care International.

    [0081] Flow cytometer. Spleen and lung were collected to study cells number and cytokine production. Spleen was collected from the mouse and homogenized and passed through the cell strainer. Number of total cells and live cells was assessed with the hemocytometer and using the tryptan blue stain as previously described. 2010.sup.6 live cells were plated in a 96 well plate for staining following the protocols recommended by the manufacture.

    [0082] Previously published protocols were followed to obtain cells from lung. Number of total cells and live cells was assessed with the hemocytometer and using the tryptan blue stain as previously described. 1010.sup.6 live cells were plated in a 96 well plate for staining. For the staining, previously reported methods were followed.

    [0083] Ethics Statement. This study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was approved by the Institutional Animal Care and Use Committee at University of Georgia, Athens (A2016 02-010-Y2-A3 Bordetella-Host Interactions). All animals were anesthetized using 5% isoflourane and euthanized using carbon dioxide inhalation followed by cervical dislocation to minimize animal suffering.

    Results

    [0084] bsr is required to persist in respiratory tract. To determine whether bsr is important in the interaction with the host, a time course infection was performed using C57Bl/6J mice from Jackson. 50 L of 10.sup.5 bacterial suspension in PBS, were inoculated intra-nasally and groups of 4 mice were euthanized at different time points. These results are shown in FIGS. 1A-1C.

    [0085] The results showed that RB50bsr fails to persist in middle and low respiratory tract. Mice challenged with RB50 clear trachea by day 56, while mice challenged with RB50bsr clear trachea by day 42 (FIG. 1B). Importantly, this difference is most impressive when studying lungs, and RB50 clears at day 56 while RB50 bsr clears at day 14; which means that infection is clear in the lower respiratory tract, 42 days in advance when challenge with RB50bsr (FIG. 1A).

    [0086] Importantly, the results showed that RB50bsr is also cleared from the nasal cavity by day 56 post-infection (FIG. 1C). No mutant that initially colonized mice has been observed to be later cleared by adaptive immunity. The only mutant reported to fail in persistence was one that failed to colonize mice altogether, Bvg phase locked mutant which is a-virulent (Harvill et al., 1999, Infect Immun; 67(3):1493-500). This is the first report of a Bvg+ mutant strain that is able to colonize the host efficiently but is completely cleared from nasal cavity.

    [0087] All together these results indicate that RB50bsr fails to persist in respiratory tract, and excitingly it is completely cleared from nasal cavity 56 days post-inoculation.

    [0088] To determine whether bsr is important in the interaction with the host immunity, a time course infection was performed using C57Bl/.sub.6J mice from Jackson. 50 L of 10.sup.5 bacterial suspension in PBS, were inoculated intra-nasally and groups of 4 mice were euthanized at different time points to analyze immune cells count in lungs and spleen as well as some cytokines (FIG. 2A-2C).

    [0089] These results indicate that RB50bsr induces a more robust and earlier immune response than RB50. The numbers of T cells, CD4, macrophages and B cells where higher in spleen for those mice challenged with RB50bsr; while the numbers of CD4, CD8, macrophages, neutrophils and B cells where higher on lungs for those mice challenged with RB50bsr than in those challenged with wild type RB50.

    [0090] Interestingly neutrophil recruitment was higher in the mice challenged with RB50bsr in day 3 and 7; but by day 14 the value is similar to those mice challenged with RB50. Similarly, macrophages numbers where high in spleen and lung of the mice challenge with RB50bsr.

    [0091] Further, the number of CD4 and B cells was significantly higher in the mouse challenged with the mutant strain (RB50bsr) indicating that this might confer protective immunity against other Bordetella strains. It has been previously reported that CD4 and B cells are required for a protective immunity against B. pertussis (Leef et al., 2000, J Exp Med; 191(11):1841-52).

    [0092] This example also found the CD8 number was high in lungs. It has been previously reported that CD8 promote protective immunity to respiratory infection with B. pertussis (Dunne et al., 2009, J Immunol; 183(1):400-10). All these data together indicate that challenge with RB50bsr induces a higher and more robust immune response. Thus, it is likely that RB50bsr can confer protection against further encounters with other Bordetella spp.

    [0093] RB50bsr induces more diverse and robust antibody response. To determine whether RB50bsr induces a high antibody response, the antigenic profile of RB50 versus RB50bsr was compared using as primary antibodies serum from mice challenged with RB50 or RB50bsr. The results showed that RB50bsr induces the production of novel antibodies that do not appear in RB50 or when incubating with the serum of mice challenged with RB50. This indicates that there is production of completely novel antibodies after challenge with RB50bsr.

    [0094] As shown in FIG. 3A-3C, RB50bsr confers sterilizing immunity against all classical Bordetellae. To determine whether RB50bsr confers protection against further Bordetellae infection; 3 groups of mice where or vaccinated and boosted with 1/20 dose of Adacel, challenged with RB50bsr or controls (intraperitoneal PBS). 60 days later, three 3 mice that were challenged with RB50bsr were euthanized to confirm clearance from nasal cavity and rest of the organs. The next step was to challenge groups of 4 mice of each condition with B. bronchiseptica RB50, B. pertussis Tohama I or B. parapertussis 12829. Seven days post-challenge, mice were euthanized, and organs were harvested to enumerate CFUs. As shown in FIGS. 3A-3C, Adacel vaccination protects from disease and colonization of the lungs and trachea, however it allows for colonization of the nasal cavity, as previously described (Gaillard et al., 2014, Vaccine; 32(8):931-7; Smallridge et al., 2014, J Infect Dis; 209(12):1981-8; and Goebel et al., 2009, PLoS One; 4(8):e6778). However, previous challenge with RB50bsr induced sterilizing immunity against further infection with any of the 3 classical Bordetellae. Following the same experimental setting, we infected with clinical strains of B. pertussis, B. parapertussis and B. bronchiseptica. Our results indicate that we can provide sterilizing immunity against multiple strains of B. pertussis and B. parapertussis (including BPPS which is ovine). In addition, prior exposure to the bsr mutant successfully conferred sterilizing immunity of trachea and lungs against multiple B. bronchiseptica strains and significantly reduced the levels of colonization in the nasal cavity.

    [0095] To further investigate if this protection is conferred by antibodies, passive transfer of antibodies from mice challenged with RB50bsr was performed. Intraperitoneal injection of 150 L of serum was performed and 3 hours later mice were challenged with either B. bronchiseptica RB50 or B. pertussis Tohama I. Mice were sacrificed 3 days post-challenge and organs were harvested to enumerate CFUs. As shown in FIG. 4A and FIG. 4B, passive transfer of serum from mice challenged with RB50bsr decreased the number of colonies in the lung by 99.9%.

    [0096] To further investigate if smaller dosages will also confer protection, SCFU of RB50bsr was tested to determine if it will confer protection against further encounters with Bordetella spp. Groups of 4 mice were challenged with 5 1 of PBS containing SCFU of RB50bsr, 60 days after each group was re-challenge with 50 L of PBS containing 510.sup.5 Bordetella spp. 7 days later, mice were euthanized, and organs were harvest and plated on BGS. The results show that full protection is conferred against B. bronchiseptica and B. parapertussis in the trachea and lungs. Low levels of colonization of nasal cavity indicating that although really low dosages confer broad and strong protection, more studies need to be done to determine the lowest dosage at which complete sterilizing immunity is conferred.

    [0097] Antibody production in TLR4 deficient mice was further explored. LPS is one of the most antigenic components of Bordetella spp. RB50bsr generates a robust antibody response independent of LPS recognition. Results showed that at day 10 TLR4 deficient mice generate a robust antibody response with antibody titers that are approximately 20,000 as early as day 10 post-inoculation. On the other hand, mice challenge with RB50 had no detectable antibodies on day 10 post-inoculation. RB50 did not induce comparable antibody titer until day 21 post-infection, indicating that bsr mediates a substantial delay in the generation of antibodies in these mice. Similarly, in C57BL/6J wild-type mice, the antibody titers induced by RB50bsr spike at day 7 post-infection, but mice infected with RB50 do not make detectable antibodies at this early time point.

    Example 4

    Immunomodulation Suppresses Adaptive Immunity to Bordetella Infection

    [0098] To successfully persist in the face of the many anti-microbial weapons of the host immune system, pathogens must either defend against them or disrupt their expression. Classical Bordetellae are very closely related subspecies that are known to immunomodulate as an aspect of their successful strategies allowing them to either persist for life (B. bronchiseptica) or induce highly fulminant disease, facilitating rapid transmission and repeated infection (B. pertussis). Exploring the hypothesis that conditions signaling engagement with immune cells would induce important immunomodulatory mechanisms, a putative regulator implicated in their control was identified. Deleting it did not affect colonization of the host but profoundly affected the generation of adaptive immune response, conferring robust sterilizing immunity against reinfection with all Classical Bordetella species. These finding both reveal new bacterial immunomodulatory abilities and demonstrate that disrupting regulators of immunomodulatory pathways can lead to better protective immunity than vaccines or natural infection.

    Introduction

    [0099] Host immunity has evolved into a sophisticated array of mechanisms that attempt to maintain the host in a homeostatic healthy state. A central feature of host immune response is the dynamic surveillance systems of innate immunity that coordinate an antimicrobial response particular to the set of pathogen associated molecular patterns (PAMPs) detected by the aggregate set of pattern recognition receptors (PRRs). The combination of PRR and other signals received by immune cells at or near the site of infection can have a profound effect on the generation of protective immunity.

    [0100] To evade these robust antimicrobial defenses, many microorganisms have developed sophisticated mechanisms to modulate the immune responses in order to persist, efficiently transmit to other hosts and subsequently re-infect the same host (Nicholson et al., 2014, Infect Immun; 82:1092-1103; Buboltz et al., 2009, Infect Immun; 77:3969-3977; Fennelly et al., 2008, Infect Immun; 76:1257-1266; Skinner et al., 2004, J Immunol; 173:1934-1940; Stockbauer et al., Cell Microbiol; 5:123-132; Perez Vidakovics et al., 2006, FEMS Immunol Med Microbiol; 48:140-147; Ross et al., 2004, Infect Immun; 72:1568-1579; Dadaglio et al., J Immunol; 193:1787-1798; Pilione and Harvill, 2006, Infect Immun; 74:1043-1049; Gorgojo et al., 2017, PLoS One; 12:e0169936; Skinner et al., 2005, J Immunol; 175:4647-4652; Dewan et al., 2017, J Infect Dis; 216:899-906; Liu et al., 2012, Mucosal Immunol; 5:320-331; Liu et al., 2011, Front Microbiol; 2:52; Liu et al., 2014, Mucosal Immunol; 7:165-176; VanCott et al., 1998, Nat Med; 4:1247-1252; and Azuma, 2006, J Periodontal Res; 41:361-373). There is growing evidence that bacteria can sense many cues of aspects of the host response, allowing them to evade or subvert immunity. We reasoned that to optimally manipulate the host response a successful persistent pathogen might sense cues associated with contact with host immune cells and respond with increased expression of key immunomodulators.

    [0101] The Bordetella-mouse experimental system provides an optimal model in which to study specific aspects of bacterial-host immunomodulation (Pilione and Harvill, 2006, Infect Immun; 74:1043-1049; Dewan et al., 2017, J Infect Dis; 216:899-906; Pishko et al., 2004, Eur J Immunol; 34:184-193; Preston et al., 2003, Mol Microbiol; 48:725-736; Goebel et al., 2009, PLoS One; 4:e6778; and Kirimanjeswara et al., 2005, J Immunol; 175:7504-7511). The genus Bordetella comprises several closely related organisms (B. bronchiseptica, B. pertussis, and B. parapertussis) causing respiratory diseases that can either be acute, persistent or chronic, demonstrating that these species effectively modulate immunity in robust but poorly understood ways (Perez Vidakovics et al., 2006, FEMS Immunol Med Microbiol; 48:140-147; Ross et al., 2004, Infect Immun; 72:1568-1579; Pilione and Harvill, 2006, Infect Immun; 74:1043-1049; Gorgojo et al., 2017, PLoS One; 12:e0169936; Skinner et al., 2005, J Immunol; 175:4647-4652 Kirimanjeswara et al., 2005, J Immunol; 175:7504-7511; Gorgojo et al., 2012, Infect Immun; 80:4309-4316; Wolfe et al., 2010, J Immunol; 184:1392-1400; Thakar et al., 2007, PLoS Comput Biol; 3:e109; Yuk et al., 2000, Mol Microbiol; 35:991-1004; Kirimanjeswara et al., 2005, J Clin Invest; 115:3594-3601; Bendor et al., 2015, PLoS One; 10:e0140743; Weyrich et al., 2012, PloS One; 7:e45892; Hickey et al., 2008, J Leukoc Biol; 84:234-243; Siciliano et al., 2006, J Immunol; 177:7131-7138; Perkins et al., 2007, Mol Microbiol; 66:1003-1015; Cerny et al., 2015, J Immunol; 194:4901-4913; and Hasan et al., 2018, Infect Immun; 86(3):pii: e00445-17).

    [0102] Since B. bronchiseptica and other Bordetella species naturally and highly efficiently infect mice, the details of their immunomodulatory functions can be studied in the context of natural infection. B. bronchiseptica can persist for life in the airways of healthy mice, but fulminant infection can expose them to extensive inflammation, with its many antimicrobial challenges. Exposure to such immune cells also presents the opportunity to modulate innate and adaptive immunity. Reasoning that well adapted pathogens like the Bordetellae should have evolved a response to such challenges/opportunities, we recently examined their response to exposure to blood or serum, as markers of inflammation and/or of lymphoid organs. This example demonstrates that all three classical Bordetella species respond to exposure to blood or serum by inducing the expression of several known immunomodulators, as well as many uncharacterized genes.

    [0103] Amongst the blood- and serum-induced genes was an apparent sigma factor previously referred to as btrS or bprL and shown to regulate the type III secretion system. This analysis implicated this gene in broader regulation of immunomodulatory functions. Deleting btrS did not affect the efficient colonization and growth within the respiratory tract of its host but resulted in a dramatically increased immune response that was able to completely clear infection. The mutant induced much more robust recruitment into the lungs of B and T cells that are required for its clearance. Wild-type mice convalescent from infection with the mutant were protected from colonization by B. bronchiseptica, B. pertussis, or B. parapertussis. The sterilizing immunity to all three pathogens is substantially stronger and more complete than that conferred by current vaccines, indicating that better protection can be attained. Understanding the immunomodulatory mechanisms involved in these effects are likely to allow dramatic improvements in treatments and vaccines, which are desperately needed.

    Materials and methods

    [0104] Bacterial strains and culture conditions. Bacteria were grown in plates of Bordet-Gengou agar (Difco) supplemented with 10% sheep defibrinated blood and 200 g/mL of streptomycin (Gestal et al., 2018, Front Microbiol; 9:1969). Strains used in this study are the same strains of B. bronchiseptica, B. pertussis, and B. parapertussis used are as previously published (Gestal et al., 2018, Front Microbiol; 9:1969). Knock out mutants were generated as previously described (Dewan et al., 2017, J Infect Dis; 216:899-906; Bendor et al., 2015, PLoS One; 10:e0140743; Barchinger et al., 2012, BMC Microbiol; 12:179; Zhang et al., 2009, PLoS One; 4:e6989; and Pilione et al., 2004, Infect Immun; 72:2837-2842).

    [0105] Enzyme-linked immunosorbent assays. 96-well microtiter plates (Costar) were coated with heat-killed B. bronchiseptica or the mutant and incubated in a humidified chamber at 35 C. for four hours, then blocked with PBST and 1% BSA and left overnight at 40 C. Assays were performed according to previously published protocol (Hester et al., 2012, PLoS One; 7:e47635). Superblue was added to start the reaction, which was terminated with HCL after ten minutes. The plates were read at an OD of 450nm. The titer was determined to be the reciprocal of the lowest dilution greater than zero.

    [0106] Animal experiments. Wild-type C57BL/6J and Rag/ (B6.129S7 Rag1tm1Mom/J) mice were obtained from Jackson Laboratories, Bar Harbor, Me. or our breeding colony (established from Jackson laboratories mice). Mice were bred and maintained at Coverdell Building, University of Georgia, Ga., (AUP: A2016 02-010-Y2-A3) (Preston et al., 2003, Mol Microbiol; 48:725-736; and Kirimanjeswara et al., 2005, J Immunol; 175:7504-7511). All experiments were carried out in accordance with all institutional guidelines (Bordetella Host Interactions AUP: A2016 02-010-Y2-A6) and following previously published protocols to enumerate CFUs (Dewan et al., 2017, J Infect Dis; 216:899-906; Hester et al., 2015, PLoS One; 10:e0130964; Weyrich et al., 2014, J Infect Dis; 209:913-921; and Taylor-Mulneix et al., 2017, PloS Blob; 15: e2000420), passive transfer studies (Kirimanjeswara et al., 2005, J Immunol; 175:7504-7511; Zhang et al., 2009, Infect Immun; 77:5050-5058; Wolfe et al., 2005, Infect Immun; 73:6508-6513; and Leef et al., 2000, J Exp Med; 191:1841-1852) and vaccination studies (Smallridge et al., 2014, J Infect Dis, 209: 1981-1988). All results were graph in GraphPrism and statistical significance was calculated using two-way ANOVA.

    [0107] Flow cytometry. Spleen and lungs were processed and stained as previously described (Boehm et al., 2018, Infect Immun; 86(10):pii: e00857-17). For staining, previously reported methods were followed (Halim and Takei, 2014, Current Protocols in Immunology; 3.25:1-13 (Wiley online library); and Rolin, et al., 2014, PLoS One; 9:e85229) using commercially available antibodies. The acquisition of the data was performed in FACS and analysis was performed with FlowJo 10.0 following standard gating strategy. Statistical significance was calculated using two-way ANOVA in GraphPrism.

    [0108] Histopathology. Mice tissue was process as previously reported (McHale et al., 2018, J Vet Diagn Invest; 30:260-262; and McKeithen et al., 2017, PLoS One; 12:e0188643). The heads were decalcified in Kristensen's solution and sectioned through the nose, brain, and ear. Tissues were subsequently processed and stained with hematoxylin and eosin. A board-certified pathologist performed blindly all microscopic evaluations of these HE-stained sections at the AVDL. The codes and abbreviations used as entries in these tables are explained at the bottom of each table.

    [0109] Ethics Statement. This study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was approved by the Institutional Animal Care and Use Committee at the University of Georgia, Athens (A2016 02-010-Y2-A3 Bordetella-Host Interactions and A2016 07-006-Y2-A5 Breeding protocol). All animals were anesthetized using 5% isoflurane and euthanized using carbon dioxide inhalation followed by cervical dislocation to minimize animal suffering. Animals were handled following institutional guidelines, in keeping with full accreditation from the Association for Assessment and Accreditation of Laboratory Animal Care International.

    Results

    [0110] btrS is implicated in immunomodulation. We have hypothesized that Bordetellae can detect signals in blood/serum and respond with their most potent immunomodulatory functions. Our recent description of sets of genes induced by blood and serum allowed us to search this set for key regulators of unknown mechanisms of immunomodulation. Using a STRING analysis, we identified a network of induced genes that are linked in a variety of ways that suggest coordinated functions, including genomic proximity, co-expression under various conditions, etc.

    [0111] This analysis revealed a network with nodes of particular interest for their connections to many other factors, some of which are known to be involved in complex interactions with the host. This analysis revealed a particularly intriguing and well-connected gene named brpL/btrS that is known to be involved in regulation of important immunomodulators, including the Type 3 Secretion System, important virulence regulators such as hfq or sigE (RpoE), iron and heme sensors and transporters and other unknown proteins. These analyses led us to consider btrS as a potential key regulator of immunomodulatory functions. To further support our hypothesis, we observed this gene is up-regulated 2.5 folds when B. bronchiseptica is internalized in macrophages but not when internalized in the amoeba Dyctiostelium discoideum. This evidence that btrS responds to signals associated with contact with immune cells and is connected in various ways to known immunomodulators suggested it may be a key regulator of known and novel immunomodulatory mechanisms.

    [0112] btrS is required for respiratory tract persistence. To investigate the role of btrS in multiple aspects of colonization, growth, persistence and pathogenesis, we generated a clean, in-frame deletion of the btrS gene in the B. bronchiseptica strain RB50, following previously established protocols (Harvill et al., 1999, Infect Immun; 67: 1493-1500). The construction was verified by PCR and whole genome sequencing. No differences in growth rate in laboratory media, hemolytic activity, or survival in serum were observed between wild-type and the mutant strain.

    [0113] To examine the effects of this mutation in vivo, we evaluated the course of infection in wild-type C57Bl/6J mice (FIG. 1A-1C). Both RB50 and the mutant (RB50btrS) colonized and grew efficiently in the lower respiratory tract (LRT) during the first few days of infection, inducing similar modest inflammation. But after about a week the mutant began to demonstrate profound defects. Wild-type bacteria persisted in the lungs up to 56 days, whereas the mutant was nearly cleared by day 14 and was absent on day 21 and every day thereafter. Even more striking was the phenotype of the mutant in the nasal cavity. Wild-type B. bronchiseptica persisted in the nasal cavity of mice for at least 56 days in this experiment and consistently persisted for life in all previous experiments (Barchinger et al., 2012, BMC Microbiol; 12:179). In contrast, the btrS mutant was completely cleared from the nasal cavity by day 56. This is the first B. bronchiseptica mutant described that efficiently colonizes and grows within mice but is completely cleared from the upper and lower respiratory tract. The timing of this clearance coincided with the timing of the generation of early B and T cell responses, suggesting a dramatically different interaction with adaptive immunity that allows for the generation of more effective protection.

    [0114] Clearance requires adaptive immunity. To investigate if clearance of RB50btrS is mediated by adaptive immunity, we challenged Rag/ mice, which are deficient in B and T cells. Sets of 4 mice were inoculated with either wild-type or the btrS mutant and euthanized 21 days later. Both, wild-type and mutant strains were recovered in similar numbers from all organs of the respiratory tract, indicating that RB50btrS is not defective in the absence of B and T cells and supporting the hypothesis that its rapid and complete clearance is T/B cell-mediated.

    [0115] To investigate the possibility that these striking results were somehow dependent on the unnaturally large inoculum, overcoming the remnant immune functions in these immunodeficient animals, a second challenge was performed in which mice were intranasally inoculated with 5 l of PBS containing 100 bacteria. 24 days later RB50 and RB50btrS were both recovered in similarly high numbers, indicating that the mutant is not defective in any of the functions necessary for colonization, growth and spread to lower respiratory tract, although it is recovered in somewhat lower numbers in the nasal cavity (FIG. 5). The observations that btrS is required for persistence in wild-type mice but does not affect infection and persistence in trachea and lungs of Rag/ mice indicates that btrS is involved in the disruption of a robust host adaptive immune response that, in its absence, is able to completely clear this notoriously persistent bacteria.

    [0116] btrS down-regulates T cell recruitment to lungs. To investigate potentially different roles of T cells in the control of wild-type and clearance of the btrS mutant, we analyzed via flow cytometry the T cell populations present in the lungs 14 days post-inoculation with each. Wild type RB50 did not increase CD4+ T cell numbers in the lungs but did significantly increase CD8+ T cells over the non-infected control (FIGS. 6A and 6B). Interestingly, challenge with RB50btrS significantly increased recruitment of both CD4+ and CD8+ T cells. It is important to highlight that at this time point (day 14) the btrS induces much greater T cell response even though it is present at roughly 1/1000 the numbers of the wild type. Conversely, the wild type bacteria, via mechanisms that require btrS, substantially block T cell responses while growing and persisting at high numbers in the lungs.

    [0117] btrS down-regulates B cell recruitment. To examine the role of B cells in the rapid clearance of the mutant, we analyzed the B cell populations present in lungs 14 days post-inoculation with wild-type or RB50btrS. Standard high dose inoculation with wild-type RB50 only slightly increased B cell numbers in lungs compared with the non-infected control, whereas RB50btrS increased B cells numbers in lungs two-fold (FIGS. 7A-7C). The anti-B. bronchiseptica serum antibody titers induced by the mutant were measurably higher as early as day 7 post-infection. This is a striking finding, since antibodies to Bordetellae are generally not detected this early after infection and suggests that btrS mediates some B cell suppressive mechanisms that Bordetellae use to reduce antibody titers. Additionally, the mutant induced significantly higher anti-B. bronchiseptica IgA and IgG antibody titers in the lung homogenate 14 days post-infection, indicating that these effects accumulate over the course of infection (FIGS. 7A-7C).

    [0118] BtrS blocks effective sterilizing immunity to classical Bordetellae. The results above support the hypothesis that BtrS is induced by exposure to signals in blood/serum and turns on the expression of immunomodulatory functions that dampen the adaptive immune response, allowing longer persistence. Reasoning that these effects could be mediated by interactions with phagocytic antigen presenting cells, we investigated the effects of BtrS on macrophage signaling by exposing RAW 264.7 macrophages to wild type or mutant bacteria (MOI 1:100) and measuring IL-4 (Th2 response), INF (stimulation of lymphocytes) and TNF (MAPK signaling pathway) 4 hours later. These results demonstrated that BtrS suppresses the production of IL-4 and INF, potentially modulating both inflammatory and subsequent adaptive immune response by altering cytokine production of phagocytic cells (FIG. 8).

    [0119] The RB50btrS mutant induces sterilizing protective immunity to B. bronchiseptica. To determine whether RB50btrS induces robust immunity that can protect against subsequent infection, groups of mice were either challenged with RB50btrS or vaccinated with the commercial acellular pertussis vaccine Adacel or PBS as a control. Two months later mice were intranasally challenged with 510.sup.5 wild-type B. bronchiseptica in 50 l of PBS (FIGS. 9A and 9B). PBS-treated mice (control group) showed high levels of colonization across the entire respiratory tract seven days post-inoculation. Mice previously vaccinated with the acellular vaccine had eliminated bacteria from the trachea and lungs, demonstrating the known protection against disease conferred by this vaccination. However, Adacel vaccination provided no significant reduction in the number of colonies isolated from the nasal cavity. Thus, despite conferring protection of the lower respiratory tract, the acellular vaccine does not stop colonization of the nasal cavity, allowing for transmission of the disease, as shown previously in mice (Smallridge et al., 2014, J Infect Dis; 209: 1981-1988) and baboons (Warfel et al., 2014, Proc Natl Acad Sci USA; 111: 787-792). Importantly, mice convalescent from challenge with the btrS mutant strain were completely free of B. bronchiseptica in lungs, trachea and nasal cavity, indicating that this mutant confers completely protective sterilizing immunity against B. bronchiseptica throughout the respiratory tract (FIGS. 9A and 9B). This is qualitatively and quantitatively greater protective immunity than has been previously reported for any vaccine against B. bronchiseptica.

    [0120] The RB50btrS mutant induces sterilizing protective immunity to B. pertussis and B. parapertussis. Since the immune response generated by the btrS mutant is substantially improved over that conferred by vaccines, we tested whether it could protect against the closely related and antigenically similar important human pathogens, B. pertussis and B. parapertussis. PBS treated mice challenged with B. pertussis or B. parapertussis contained high numbers of each in all respiratory organs (FIG. 10). Adacel vaccinate reduce the numbers of bacteria in the lower respiratory tract but all three Bordetella species persisted in the nasal cavity. These findings are consistent with clinical and laboratory findings that acellular vaccination confers protection against disease but is not completely successful at preventing colonization. In contrast, mice convalescent from prior exposure to the btrS mutant strain were completely protected against B. pertussis and B. parapertussis disease and colonization, having developed fully sterilizing immunity against all three species (FIG. 10).

    [0121] To determine if a low dose of RB50btrS will provide protection against the classical Bordetella strains, mice were challenged with 5 CFU of the mutant and were then intranasally challenged with high doses of either B. bronchiseptica, B. pertussis, or B. parapertussis. Even this very low dose of the RB50btrS mutant was sufficient to completely protect the trachea and lungs of all mice from all three species. Small numbers of B. bronchiseptica and B. pertussis were observed in the nasal cavities, indicating incomplete protection at this very low dose. But colonization was decreased relative to that seen in mice vaccinated with the commercial acellular pertussis vaccine, Adacel (FIGS. 11A-11C). This indicates that even a very small inocula of the RB50btrS is sufficient to elicit a robust and protective immune response and immunity against both B. pertussis and B. parapertussis.

    [0122] To summarize, we discovered that previous challenge with RB50btrS led to protection against the three classical Bordetellae in the entire respiratory tract including the nasal cavity, conferring sterilizing immunity against further infection with any of the three classical Bordetellae. Extraordinarily, this is the first Bordetella spp. mutant that confers sterilizing immunity against not only B. bronchiseptica but also other Bordetella species.

    Discussion

    [0123] Despite under-reporting, recent increases in total cases and regional outbreaks of whooping cough have led both CDC and NIH to prioritize efforts at a response. Vaccines developed to protect against disease are effective in preventing illness in fully and recently vaccinated individuals but do not prevent colonization and transmission, allowing the pathogens to continue to spread. The observed increase in the mean age of infection (Kilgore et al., 2016, Clin Microbiol Rev; 29:449-486) is of concern, as is the risk to newborns before vaccination can protect them from disease. Thus, despite the widespread use with high coverage of vaccines that protect against disease, the failure to protect against infection allows the pathogen to continue to circulate. Without a strategy to provide complete, sterilizing immunity, it is hard to envision that an altered vaccine would have much impact. Adding another antigen is unlikely to change the basic problem that such vaccines protect against disease, but do not provide herd immunity by preventing colonization of individuals and circulation within populations. This example reports on a putative regulator that is induced by blood, serum and when Bordetella spp. are intracellular in macrophages, are implicated in regulation of immunomodulation.

    [0124] Current vaccines were designed on the assumption that immune response generated by infection is the gold standard against which vaccines should be measured. However, well-adapted pathogens that persist or re-infect have tools to modulate the immune system and there is strong and consistent selection against presentation to the immune system of antigens that can confer protective immunity (Liu et al., 2012, Mucosal Immunol; 5:320-331; VanCott et al., 1998, Nat Med; 4:1247-1252; and Ercoli et al., 2018, Nat Microbiol; 3:600-610). From this standpoint, the view that the measure of the ideal vaccine should be how closely it resembles convalescent immunity is flawed. In this work we present evidence that there are substantial undiscovered Bordetella mechanisms for immunomodulation and that these appear to be carefully choreographed in response to exposure to blood and immune cells. Deleting a single regulator disrupts this profound modulation of adaptive immunity, leading to substantially better protective immunity.

    [0125] This example demonstrates that a robust immune response that provides sterilizing immunity and cross-protection against different species of the same genus is achievable. These data support the view that Bordetella spp. vaccines can be substantially improved and opens the door to further analysis of the mechanisms of this more protective immunity. Understanding how Bordetella spp. prevent effective adaptive immunity will likely inform our views of the reasons for incomplete or imperfect sterilizing immunity against these and likely other pathogens.

    Example 5

    Livestock Vaccine Against Bordetella Species

    [0126] Bordetella spp. infections constitute a great burden in agricultural livestock settings, but the current live attenuated vaccine lacks efficiency and only provides limited immunity. Outbreaks of Bordetella spp. infections have been reported in pigs, sheep, horses and poultry as well as other mammals. As shown in the previous examples, RB50bsr (also referred to herein as RB50brpL, RB50btrS and Bbvac), a new genetically engineered attenuated strain of Bordetella bronchiseptica confers sterilizing immunity against several Bordetella species including B. bronchiseptica, which is the major cause of athropic rhinitis and other respiratory diseases. The RB50bsr vaccine strain has been tested in mice and the results indicate RB50bsr confers robust protection.

    [0127] With this example, pre-clinical trials will be performed to evaluate the protection conferred by this strain against the several Bordetella species that cause diseases in various animals. The nature of the immune protection conferred will then be determined. First, T cell populations and antibody response in C57 wild-type mice will be evaluated by monitoring the levels of IgA and IgG pre-vaccine, post-vaccine and post-challenge. Similarly, T cell populations and antibody response (IgA and IgG) will be evaluated using heat-killed bacteria as a vaccine. Finally, a cat model will be used to evaluate the RB50bsr vaccine using antibody titters as a marker to evaluate protection and response to the challenge. This example will provide us an improved, more efficient and robust vaccine against Bordetella spp. infection in livestock.

    Background

    [0128] Bordetellosis, atrophic rhinitis (de Jong, 1991, Tijdschr Diergeneeskd; 116(24):1221-30), and Kennel cough are caused by Bordetella spp., mainly B. bronchiseptica (McCandlish et al., 1976, Vet Rec; 98(8):156-7). These respiratory diseases affect a broad range of animals including, but not limited to, pigs (Duncan et al., 1966, Am J Vet Res; 27(117):457-66), horses (Mohan and Obwolo, 1991, Trop Anim Health Prod; 23(3):155-6; and Leissinger et al., 2013, Vet Clin Pathol; 42(4):529-30), sheep, poultry and aquatic life (Leissinger et al., 2013, Vet Clin Pathol; 42(4):529-30). In many cases, the disease begins as rhinitis or bronchitis, but due to co-infection or host factors, can progress to fatal bronchopneumonia. The disease can be transmitted to humans, and cases have been reported of cross-transmission between animals and their caretakers (Rath et al., 2008, Clin Infect Dis; 46(6):905-8). Bordetellosis can cause a high burden in domestic livestock, which are essential to the nation's food supply and the welfare of producers and consumers of animal products. Unfortunately, there is no good vaccine available. The vaccines that are presently on the market confer only limited protection and are not recommended for most animals. For example, there is no vaccine for equine or poultry. In addition, the available vaccines do not protect against all Bordetella strains, and the strength and length of protection after vaccination is sub-optimal (Smith et al., 1982, Res Vet Sci; 32(2):248-52; Sakano et al., 1984, Am J Vet Res; 45(9):1814-7; and de Jong et al., 1987, Vet Q; 9(1):49-59).

    [0129] As shown in the previous examples, RB50bsr, a genetically engineered strain of B. bronchiseptica, delivered intranasally in low dose, is a remarkably effective live vaccine, conferring sterilizing immunity against all three classical Bordetella species, B. bronchiseptica, B. pertussis and B. parapertussis. This example will study the strength and spectrum of protection. Pre-clinical studies will be performed in mice (a natural host of B. bronchiseptica) to assess the strength and coverage of protection and to evaluate cross-protection against other Bordetella spp. It is expected that RB50bsr will be a safe and effective vaccine that can readily be used in animal production settings. First, the immune response of vaccinated mice challenged with B. bronchiseptica will be characterized. Second, the immune response of vaccinated mice challenged with B. avium will be characterized.

    [0130] Aim 1Investigate the strength of protection of the RB50bsr vaccine strain against Bordetella bronchiseptica and other classical Bordetellae. To determine if RB50bsr confers stronger and longer-lasting protection than current vaccines, mice will be vaccinated with the RB50bsr vaccine strain, with the current vaccine (Nobivac Intra-Trac KC-Intranasal 25 ds Tray, Kennel-Jec 2 Nasal Vaccine for Dogs and Puppies w/Dropper, Solo-Jec KC Single Dose or Bronchicine CAe, 10 ds vial), or with a PBS control and then challenged with B. bronchiseptica 60 days post vaccination. T cell populations as well IgG and IgA antibody titers will be evaluated pre-vaccination, 3, 7, 10, 14 and 21 days post-vaccination and after challenge with B. bronchiseptica to study response patterns and to determine memory protection conferred by the vaccine. Thus, the efficacy of the RB50bsr engineered vaccine strain in comparison with the current vaccine and determine the efficiency of the response will be determined.

    [0131] C57B6/L wild-type mice 4-6 weeks old will be vaccinated and challenged to evaluate the protection conferred by RB50bsr. Pre-samples will be taken to establish baseline antibody titers (IgA and IgG) against B. bronchiseptica in naive mice. Mice will be exposed to: 1)

    [0132] RB50bsr vaccine (a genetically engineered strain RB50bsr), 2) the current vaccine (Bordetella bronchiseptica Intranasal (MVP); Rhini Shield TX4; Ingelvac AR4 or Parapleuro Shield P+BE), or 3) a PBS control group. Antibody titers (IgA and IgG) will be measured at days 7, 21, 35, 49 and 60 post-vaccination.

    [0133] After 60 days post-vaccination, mice will be challenged with B. bronchiseptica to test protective immunity, by quantifying T cell populations (from lung and spleen using Flow cytometer), antibody titters (IgA and IgG) and CFU in respiratory tract organs at days 3, 7, 10, 14, and 21 post-challenge. This will test the efficiency of the RB50bsr our genetically engineered strain in comparison with the current vaccines and to characterize the immune response that confers better protection.

    [0134] Aim 2. Investigate the strength of protection and coverage of the RB50bsr vaccine strain against B. avium and other non-classical Bordetellae. As shown in the previous examples, RB50bsr, a genetically engineered strain of B. bronchiseptica can fully protect, conferring sterilizing immunity against different Bordetella species (B. bronchiseptica, B. pertussis and B. parapertussis), making it the first vaccine that has a broad spectrum of protection as well as the only vaccine that confers sterilizing immunity. It is expected that RB50bsr will also confer strong protection against other non-classical Bordetella spp. To test this, mice will be vaccinated with the RB50bsr vaccine strain, with PBS (mock control) or the current vaccine. After 60 days, the mice will be challenged with B. avium. Different T cell populations and IgG and IgA titers will be evaluated prior to and after vaccination as well as after challenge with Bordetella strains to study response patterns and cross protection. Memory response will be evaluated after challenge with B. avium. This will test the efficiency of the RB50bsr engineered vaccine strain in comparison with the current vaccine and determine the efficiency of the response.

    [0135] C57B6/L wild-type mice 4-6 weeks old will be used to evaluate the protection conferred by RB50bsr against B. avium. Pre-bleed samples will be collected to study antibody titers (IgA and IgG) against B. avium in naive mice. Mice will be first exposed to: 1) the RB50bsr vaccine (s genetically engineered strain), 2) the current vaccine (live attenuated B. avium non-resistant strain), and 3) a PBS control group. Antibody titers (IgA and IgG) will be measured at days 7, 21, 35, 49 and 60 post-vaccination.

    [0136] After 60 days post-vaccination mice will be challenges with B. avium to test protective immunity, by quantifying T cell populations (from lung and spleen using Flow cytometer), antibody titters (IgA and IgG) and CFU in respiratory tract organs at days 3, 7, 10, 14, and 21 post-challenge. This will allow the testing of the efficiency of the RB50bsr genetically engineered strain in comparison with the current vaccines and determine the efficiency of the response.

    Example 6

    Novel and More Efficient Vaccine Against Feline Bordetellosis

    [0137] Bordetella bronchiseptica infection of dogs, most commonly known as Kennel cough, is very common and several vaccines are available and required by most kennels. Although studies have shown that sero-prevalence of B. bronchiseptica in cats in the US is 47%, and Bordetellosis can progress to fatal bronchopneumonia, no vaccine is currently available for cats. As shown in the previous examples, RB50bsr (also referred to herein as RB50brpL, RB50btrS and Bbvac), is the genetically engineered a strain of B. bronchiseptica that confers robust, sterilizing immunity against B. bronchiseptica, making it a promising vaccine candidate. With this example, RB50bsr will be tested as a vaccine that can provide robust protection against B. bronchiseptica infection in felines. Pre-clinical trials will be performed to evaluate the protection conferred by RB50bsr in comparison to the commercially available dog vaccine. Antibody (both IgA and IgG) levels and T-cell responses will be characterized. Protective antigens will be identified to allow for further refinement of vaccines. Finally, RB50bsr will be tested in cats and the protection conferred by Bbvac compared to that from the standard dog vaccine.

    [0138] Upper respiratory infections are the most serious type of ailment in cats. The bacterium Bordetella bronchiseptica, which is known as the causative agent of Kennel Cough in dogs, has been frequently isolated from cats with tracheobronchitis, rhinitis conjunctivitis and pneumonia and has been recognized as one of the main causative agents of respiratory problems in the feline population (Garbal et al., 2016, Pol J Vet Sci; 19(2):353-8; Foley et al., 2002, Prey Vet Med; 54(2):141-56; Bannasch and Foley, 2005, J Feline Med Surg; 7(2):109-19; and Helps et al., 2005, Vet Rec; 156(21):669-732-4). Bordetellosis is particularly dangerous in co-infection with other pathogens, including Mycoplasma species and herpesvirus, and can culminate in fatal bronchopneumonia. The most severe Bordetellosis affects young cats, encompassing 64% of all feline deaths (Welsh, 1996, J Am Anim Hosp Assoc; 32(2):153-8). There are few studies about the prevalence and epidemiology of this diseases within the feline population (Garbal et al., 2016, Pol J Vet Sci; 19(2):353-8). B. bronchiseptica has a prevalence as high as 46% among cats in California (Foley et al., 2002, Prey Vet Med; 54(2):141-56) indicating that nearly half of the cat population represents a reservoir for these bacteria and is at risk of developing disease, particularly within the first weeks of their life.

    [0139] Interestingly, cats recovering from infection were shown to shed B. bronchiseptica intermittently without showing clinical symptoms (Coutts et al., 1996, Vet Microbiol; 48(1-2):19-27), indicating that they were still able to transmit the bacteria to other animals and thus spread the disease. Although dog vaccines were developed long ago (Bercovich and De Jong, 1977, Tijdschr Diergeneeskd; 102(7):448-55 and Phillips, 1980, Vet Rec; 106(4):89) and kennels generally require their use, the protection conferred by them is yet not clear (Ellis, 2015, Vet J; 204(1):5-16). Limited published data suggest that these widely used vaccines may help to control symptoms and to decrease tissue damage (Kobisch and Pennings, 1989, Vet Rec; 124(3):57-61; de Jong et al., 1987, Vet Q; 9(1):49-59; and de Jong 1987, Vet Q; 9(2):123-33), but the protection period can be as short as 6 months. Recent vaccine studies have focused on improving delivery and penetration by using nanotechnology, mainly chitosan (Kang et al., 2008, Microbiol Biotechnol; 18(6):1179-85 and Jiang et al., 2004, Eur J Pharm Biopharm; 58(3):471-6) but there is a lack of research focused on the development of novel vaccines.

    [0140] The previous examples demonstrate that transient colonization with a genetically engineered strain of B. bronchiseptica (RB50bsr) induces sterilizing immunity against B. bronchiseptica. This example includes pre-clinical studies to better define immunological mechanisms in mice and then demonstrate effective protection from disease and from carriage in cats. Together, these aims will result in compelling evidence that RB50bsr can serve as an effective vaccine against feline bordetellosis that can prevent both disease and carriage.

    [0141] This example will first characterize the immune response of vaccinated mice challenged with B. bronchiseptica. Secondly, it will demonstrate that the novel vaccine strain protects against infection with a broad variety of B. bronchiseptica representing the genetic variability of the species. And finally, it will include a pilot study using the RB50bsr vaccine in cats. The completion of this proposal will provide robust results to promote this novel vaccine to clinical trials.

    Research Design and Methods

    [0142] Aim 1. Determine the strength of protection of RB50bsr against Bordetella bronchiseptica. Based on data sown in the previous examples, the genetically engineered strain RB50bsr can protect against further colonization with B. bronchiseptica by conferring sterilizing immunity. It is expected that RB50bsr will provide strong immune protection and can be used as a vaccine to prevent Bordetellosis. To test this hypothesis, a mouse model will be used, noting that both cats and mice are natural hosts for B. bronchiseptica. B. bronchiseptica-specific T-cell populations as well as IgG and IgA antibody titers will be evaluated and protection against challenge with B. bronchiseptica assessed. This aim will evaluate the efficiency of the genetically engineered vaccine RB50bsr in comparison with the currently used dog vaccine in generating protective immunity.

    [0143] 4-6 weeks old C57B6/L wild-type mice will be vaccinated and challenged to evaluate the protection conferred by strain RB50bsr. Pre-vaccination blood samples will be collected to establish baseline antibody titers (IgA and IgG) against B. bronchiseptica in naive mice. Anesthetized mice will be 1) exposed to the potential vaccine strain Bbvac by pipetting 25 l PBS containing 150 bacteria (CFUColony Forming Units) into the external nares, or 2) treated with PBS (mock control), or 3) vaccinated by application of the currently used vaccine Nobivac Intra-Trac KC onto the external nares. Nobivac Intra-Trac KC is a modified live intranasal vaccine containing attenuated canine parainfluenza virus and Bordetella bronchiseptica avirulent live culture for the vaccination of healthy susceptible puppies and dogs for prevention of canine infectious tracheobronchitis (kennel cough) due to canine parainfluenza virus and B. bronchiseptica. Before Nobivac Intra-Trac KC is used, the bacterial numbers will be determined in the preparation by sequential plating and the concentration of the inoculum will subsequently be adjusted to contain 150 CFU in 25 l.

    [0144] At days 7, 21, 35, 49 and 60 post-vaccination blood will be collected (by cheek bleed) from all three groups of mice to measure antibody titers (IgA and IgG). 60 days post-vaccination, when strain RB50bsr has been cleared from all respiratory organs including the nasal cavity, anesthetized mice will be challenged with B. bronchiseptica strain RB50 by pipetting 150 CFU 25 l onto the external nares. Groups of mice will be euthanized with CO.sub.2 followed by cervical dislocation at days 3, 7, 10, 14, and 21 post-challenge to test the conferred immunity by quantifying B cell and T cell populations (from lung and spleen using Flow cytometer), antibody titers (IgA and IgG) and bacterial numbers in respiratory tract organs. This will allow for an estimate of the efficiency of the potential vaccine strain RB50bsr in comparison to the Nobivac Intra-Trac KC live vaccine and to characterize the immune response that confers protection against infection with B. bronchiseptica.

    [0145] Aim 2. Test protective immunity against various B. bronchiseptica strains. Based on data presented in the previous examples, that RB50bsr can protect against further colonization with B. bronchiseptica by conferring sterilizing immunity, it is expected that RB50bsr will protect against colonization by any other B. bronchiseptica strains. To test this, protection against challenge with multiple different B. bronchiseptica strains that represent the genetic variation of the species will be assessed.

    [0146] The protection provided by strain RB50bsr will be accessed by challenging vaccinated mice with different B. bronchiseptica strains. To this end, groups of 6 mice vaccinated with RB50bsr and 3 mice with PBS (mock control) will be challenged 60 days post vaccination with either of 12 B. bronchiseptica strains that represent the genetic variation of the species in terms of nucleotide diversity, gene content and host range. 7 days (3Bbvac and 3PBS) post-challenge and 14 day post challenge (3RB50bsr), mice will be euthanized and B. bronchiseptica numbers in the nasal cavity and lungs will be enumerated to evaluate whether Bbvac protected against colonization.

    [0147] Aim 3. Test protective immunity provided by strain RB50bsr in a cat model. Based on data presented in the previous examples, demonstrating robust sterilizing immunity in mice, it is expected that RB50bsr will provide a robust immune protection to prevent Bordetellosis in felines. This will be tested by vaccinating cats with either RB50bsr or the currently used dog vaccine and will evaluate T-cell response and antibody titers and protection from challenge with B. bronchiseptica. These data will provide for a comparison of RB50bsr and the currently used vaccine in their efficiency of providing protection.

    [0148] The cat part of this proposal will be performed under close supervision of an animal resources veterinarian, adhering to the highest standards of animal work. To minimize animal discomfort, the cats will be lightly sedated for all procedures, including blood draws and inoculation with the vaccine and challenge strains.

    [0149] Three cats will be vaccinated intranasally with the currently used dog vaccine Nobivac Intra-Trac KC using half the dosage recommended for dogs, and 3 cats will be vaccinated with a similar CFU the vaccine strain RB50bsr. Blood samples will be taken from the jugular vein pre-vaccine and at days 7, 21, 35, 49 and 60 post-vaccination to estimate antibody titers and T cell populations. The pre-vaccination samples are essential to confirm a negative serology and to establish a baseline in cats. While the cats are sedated, nasal swabs will be collected at the same days, using a Dacron-polyester swab (30 swipes), to enumerate the bacteria recovered from the external nares by dilution plating of resuspended swab samples on BG agar. The shedding of bacteria from mouse nares over time can be monitored using this approach and this measure of shedding strongly correlates with colonization (Rolin et al., 2014, Infect Immun; 82(2):491-9 and Rolin et al., 2014, PLoS One; 9(1):e85229). This same approach will be used in the case of this example. At day 60 post vaccination, the vaccinated animals will be challenged with B. bronchiseptica strain RB50 with a similar CFU than the previously administered vaccine.

    [0150] At days 7, 14, 21 post challenge, nasal swabs and blood will be collected to assess bacterial colonization (from the nasal swabs) as well as T cells response and antibody titers (from blood). From these data it will be assessed whether the vaccines allowed colonization or prevented it by providing sterilizing immunity. In addition, it will provide for a comparison of RB50bsr and the currently used vaccine in their efficiency of providing protection against bordetellosis in felines.

    [0151] At the end of the experiment, it is anticipated that cats vaccinated with RB50bsr will be B. bronchiseptica-free. In contrast, cats vaccinated with the commercially available dog vaccine will likely carry bacteria from the challenge. Infected cats will be cured from B. bronchiseptica colonization by treatment with antibiotics.

    Example 7

    Vaccine Against B. pertussis and other Human Bordetellae

    [0152] This example will develop a broader and more protective vaccine against Bordetella pertussis, B. parapertussis, and B. homelsii. The increase in the recent years of whooping cough despite the high vaccination rates forces the need of a novel and more effective vaccine that protects not only against symptoms but also colonization and transmission. This example will test vaccine safety, strength and length of protection of the RB50bsr (also referred to herein as RB50brpL, RB50btrS, and Bbvac) vaccine first in a robust mouse model. Then, parameters will be further assessed in the baboon model that is the accepted model to study pertussis vaccine prior clinical trials.

    [0153] In this example a novel and more efficient vaccine against whooping cough and whooping cough like disease (B. parapertussis and B. homelsii) will be developed by using a live recombinant bacteria, which historically have been proven to be more efficient generating long-lasting immunity. Disrupting bacterial immune-modulators is expected to induce better and longer lasting immune response. Results of the previous examples show that the genetically engineered strain (RB50bsr) confers long lasting protection and sterilizing immunity against diverse Bordetella spp. including B. bronchiseptica, B. pertussis, and B. parapertussis. Importantly, no other vaccine in development has successfully protected against all classical Bordetellae. RB50bsr induces an earlier and more robust immune response increasing numbers of neutrophil, macrophages and CD4 and CD8 in lung; as well as increasing differentiation in spleen of those cells. These are all immune cells that have been previously identified as key in B. pertussis clearance. Interestingly the B cells number is also higher in lung and spleen and using western blot, novel bands that are recognized as novel antigens in BP can be recognized when using sera raised against RB50bsr. First, in this example, the dosage needed to induce sterilizing immunity, the length of protection, the immune response generated and the safety of the RB50bsr vaccine (by testing in mice lacking one or more components of the immunity) will be determined in a robust mouse model. Second, pilot studies will be started in baboons to test the strength and length of protection of RB50bsr, in comparison with the current acellular vaccine, the whole cell vaccine and a control group.

    [0154] As shown in the previous examples, the genetically engineered strain RB50bsr confers long lasting protection and sterilizing immunity against diverse Bordetella spp. including B. pertussis and B. parapertussis (great human threats), indicating that it can be further developed as a vaccine. RB50bsr provides more effective and robust protection than the current acellular vaccine to prevent pertussis disease. This example will take a major step towards the development of a new vaccine that protects against B. pertussis, B. parapertussis, and B. homelsii in human populations. The main objectives are to perform studies using a robust mouse model to determine the strength and length of the protection and a first pilot study in a non-primate model, which will provide sufficient data to proceed to clinical trials with this novel vaccine candidate. This example includes the following objectives/aims.

    [0155] Aim 1. Determine the strength and length of protection of RB50bsr. As shown in the previous example, RB50bsr confers sterilizing immunity against different species of Bordetellae. It is expected that RB50bsr will provide a robust immune protection against several clinical isolates of pertussis and provide a safe vaccine that confers robust protection. This example will first optimize the dose of RB50bsr needed to induce a sterilizing immune protection. Secondly, this example will study the protection against clinical strains of B. pertussis, B. parapertussis, and B. homelsii. Finally, this example will use immunocompromised mice to study the safety of RB50bsr.

    [0156] Aim 2. Determine the strength and length of protection of RB50bsr in a baboon model. Based on the results of the previous examples, it is expected that RB50bsr is a better vaccine than the current acellular vaccine to confer long lasting and robust immune protection. To test this, baboons will be vaccinated with the current vaccine (an acellular vaccine), whole cell vaccine, RB50bsr, or with PBS (mock control). Three months later, baboons will be challenged with B. pertussis D240 and clinical isolates of B. pertussis. Different T cell populations and IgM, IgG, and IgA titers will be evaluated prior to and after vaccination as well as after challenge to study response patterns and cross protection.

    [0157] The complete disclosure of all patents, patent applications, and publications, and electronically available material (including, for instance, nucleotide sequence submissions in, e.g., GenBank and RefSeq, and amino acid sequence submissions in, e.g., SwissProt, PIR, PRF, PDB, and translations from annotated coding regions in GenBank and RefSeq) cited herein are incorporated by reference. In the event that any inconsistency exists between the disclosure of the present application and the disclosure(s) of any document incorporated herein by reference, the disclosure of the present application shall govern. The foregoing detailed description and examples have been given for clarity of understanding only. No unnecessary limitations are to be understood therefrom. The invention is not limited to the exact details shown and described, for variations obvious to one skilled in the art will be included within the invention defined by the claims.

    [0158] All headings are for the convenience of the reader and should not be used to limit the meaning of the text that follows the heading, unless so specified.