PROCESS FOR DNA INTEGRATION USING RNA-GUIDED ENDONUCLEASES
20200224160 ยท 2020-07-16
Inventors
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12N2750/14143
CHEMISTRY; METALLURGY
C12N15/90
CHEMISTRY; METALLURGY
C12N15/111
CHEMISTRY; METALLURGY
C12N2800/30
CHEMISTRY; METALLURGY
C12N2800/70
CHEMISTRY; METALLURGY
International classification
C12N15/90
CHEMISTRY; METALLURGY
Abstract
There is disclosed an improved, safer and commercially efficient process for developing genetically engineered cells. More specifically, there is disclosed a process comprises introducing a donor DNA construct, a guide RNA, and an RNA-guided nuclease with the host cells to be transfected; and introducing the three components into the host cell. There is further disclosed a donor DNA construct designed for inserting a CAR (chimeric antigen receptor) into a defined genomic site of a host cell. Further, the present disclosure provides a host cell transfected with a CAR that lacks viral vectors that can present a safety concern. The disclosure provides for more efficient and more cost-effective process for engineering T cells to express CAR constructs.
Claims
1. A method for site-specific integration of a donor DNA into a target DNA molecule, comprising introducing into a cell: an RNA-guided endonuclease or a nucleic acid molecule encoding an RNA-guided endonuclease; at least one engineered guide RNA or at least one nucleic acid molecule encoding an engineered guide RNA; and a donor DNA molecule comprising at least two nucleic acid modifications; wherein the guide RNA comprises a target sequence designed to hybridize with a target site in the target DNA and the donor DNA is inserted into the target DNA molecule at the target site.
2. A method according to claim 1, wherein the at least two nucleic acid modifications are on a single strand of the donor DNA molecule.
3. A method according to claim 1, wherein one or more nucleic acid modifications are a modification of one or more nucleotides or nucleotide linkages within 10 nucleotides of the 5 end of the modified strand of the donor DNA molecule.
4. A method according to claim 1, wherein one or more nucleic acid modifications is a backbone modification.
5. A method according to claim 3, wherein one or more nucleic acid modifications is a phosphorothioate modification.
6. A method according to claim 1, wherein one or more nucleic acid modifications is a modification or substitution of a nucleobase.
7. A method according to claim 1, wherein one or more nucleic acid modifications is a modification or substitution of a sugar.
8. A method according to claim 7, wherein one or more nucleic acid modifications is a 2-O-methyl group modification of deoxyribose.
9. A method according to claim 1, wherein the donor DNA molecule is a double stranded DNA molecule.
10. A method according to claim 1, wherein the donor DNA molecule has a 5 terminal phosphate on the strand opposite to the modified strand.
11. A method according to claim 9, wherein the donor molecule has between one and three phosphorothioate modifications on the backbone within ten nucleotides of the 5 terminus of one strand of the donor molecule and between one and three 2-O-methyl nucleotide modifications within ten nucleotides of the 5 terminus of one strand of the donor molecule.
12. A method according to claim 10, wherein the donor molecule has between one and three phosphorothiorate modifications on the backbone within five nucleotides of the 5 terminus of one strand of the donor molecule and between one and three 2-O-methyl nucleotide modifications within five nucleotides of the 5 terminus of one strand of the donor molecule.
13. A method according to claim 1, wherein the donor DNA molecule includes homology arms flanking a sequence for integration into the genome.
14. A method according to claim 1, wherein the guide RNA is a crRNA.
15. A method according to claim 13, wherein the method further comprises introducing a tracr RNA into the cell.
16. A method according to claim 1, wherein the guide RNA is a chimeric guide RNA.
17. A method according to claim 1, wherein the RNA-guided endonuclease is Cas9, Cas12a, Cas12b, Cas13, Cas14, or CasX.
18. A method according to claim 1, wherein at least one guide RNA is introduced into the cell.
19. A method according to claim 1, wherein an RNA-guided endonuclease is introduced into the cell.
20. A method according to claim 19, wherein the RNA-guided endonuclease is introduced into the cell as a ribonucleoprotein.
21. A system for targeted integration of a donor DNA into a target locus, comprising, an RNA-guided endonuclease or a nucleic acid molecule encoding an RNA guided endonuclease; a guide RNA or a nucleic acid molecule encoding a guide RNA; and a double-stranded donor DNA molecule, wherein the donor DNA molecule includes one or more phosphorothioate bonds on a single strand of the double stranded DNA molecule within five nucleotides of the 5 terminus of the modified strand of the nucleic acid molecule.
22. The system of claim 1, wherein the system comprises an RNA-guided endonuclease.
23. The system of claim 1, wherein the system comprises a guide RNA.
24. The system of claim 1, wherein the donor DNA molecule further comprises at least one modification of a sugar moiety or nucleobase of the modified strand within five nucleotides of the 5 terminus of the modified strand of the nucleic acid molecule.
25. The system of claim 1, wherein the donor DNA has homology arms flanking a sequence of interest for integration into the genome.
26. A composition for generating a donor DNA molecule comprising a first primer having one or more phosphorothioate bonds and one or more modified nucleotides on a single strand of the double stranded DNA molecule within five nucleotides of the 5 terminus of the modified strand of the nucleic acid molecule; and a second primer having a 5 terminal phosphate.
27. A composition according to claim 26, wherein the first and second primers are homologous to sequences on opposite sides of a target site for an RNA-guided endonuclease in a target genome.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0023]
[0024]
[0025]
[0026] Negative control: no donor DNA was transformed into the target cells; No modificationthe donor DNA had no chemical modifications; PS modification: three phosphorothioate bonds occurred within the 5-most five nucleotide backbone positions; PS +2-OMe: in addition to phosphorothioate bonds, the three nucleotides within the 5-most five nucleotides of the donor included 2-OMe in addition to PS modifications; TCR KO/retroviral construct: the cells were transfected with the RNP in the absence of donor DNA to knock out the TCR gene and transduced with a retrovirus to express the anti-CD38 CAR.
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
DETAILED DESCRIPTION
Definitions
[0038] Unless specifically indicated otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art. In addition, any method or material similar or equivalent to a method or material described herein can be used in the practice of the present disclosure.
[0039] The terms a, an, or the as used herein not only include aspects with one member, but also include aspects with more than one member. For instance, the singular forms a, an, and the include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to a cell includes a plurality of such cells and reference to the agent includes reference to one or more agents known to those skilled in the art, and so forth.
[0040] The term primary cell refers to a cell isolated directly from a multicellular organism. Primary cells typically have undergone very few population doublings and are therefore more representative of the main functional component of the tissue from which they are derived in comparison to continuous (tumor or artificially immortalized) cell lines. In some cases, primary cells are cells that have been isolated and then used immediately. In other cases, primary cells cannot divide indefinitely and thus cannot be cultured for long periods of time in vitro.
[0041] The term genome editing refers to a type of genetic engineering in which DNA is inserted, replaced, or removed from a target DNA, e.g., the genome of a cell, using one or more nucleases. The nucleases create specific double-strand breaks (DSBs) at desired locations in a genome and harness a cell's endogenous mechanisms to repair the induced break by homology-directed repair (HDR) (e.g., homologous recombination) or by nonhomologous end joining (NHEJ). Any suitable nuclease can be introduced into a cell to induce genome editing of a target DNA sequence including, but not limited to, CRISPR-associated protein (Cas) nucleases, zinc finger nucleases (ZENs), transcription activator-like effector nucleases (TALENs), meganucleases, other endo- or exo-nucleases, variants thereof, fragments thereof, and combinations thereof. Nuclease-mediated genome editing of a target DNA sequence can be induced or modulated (e.g., enhanced) using the modified single guide RNAs (sgRNAs) described herein in combination with Cas nucleases (e.g., Cas9 polypeptides or Cas9 mRNA), to improve the efficiency of precise genome editing via homology-directed repair (HDR).
[0042] The term homology-directed repair or HDR refers to a mechanism in cells to accurately and precisely repair double-strand DNA breaks using a homologous template to guide repair. The most common form of HDR is homologous recombination (HR), a type of genetic recombination in which nucleotide sequences are exchanged between two similar or identical molecules of DNA.
[0043] The term nonhomologous end joining or MID refers to a pathway that repairs double-strand DNA breaks in which the break ends are directly ligated without the need for a homologous template.
[0044] The term nucleic acid, nucleotide, or polynucleotide refers to deoxyribonucleic acids (DNA), ribonucleic acids (RNA) and polymers thereof in either single-, double- or multi-stranded form. The term includes, but is not limited to, single-, double- or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer comprising purine and/or pyrimidine bases or other natural, chemically modified, biochemically modified, non-natural, synthetic or derivatized nucleotide bases. In some embodiments, a nucleic acid can comprise a mixture of DNA, RNA and analogs thereof. The term also encompasses nucleic acids containing known analogs of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. A particular nucleic acid sequence also encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, single nucleotide polymorphisms (SNPs), and complementary sequences as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al, Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al, J. Biol. Chem. 260:2605-2608 (1985); and Rossolini et al, Mol. Cell. Probes 8:91-98 (1994)). The term nucleic acid is used interchangeably with gene, cDNA, and mRNA encoded by a gene.
[0045] The term nucleotide analog or modified nucleotide refers to a nucleotide that contains one or more chemical modifications (e.g., substitutions), in or on the nitrogenous base of the nucleoside (e.g., cytosine (C), thymine (T) or uracil (U), adenine (A) or guanine (G), in or on the sugar moiety of the nucleoside (e.g., ribose, deoxyribose, modified ribose, modified deoxyribose, six-membered sugar analog, or open-chain sugar analog), or the phosphate.
[0046] The term gene or nucleotide sequence encoding a polypeptide means the segment of DNA involved in producing a polypeptide chain. The DNA segment may include regions preceding and following the coding region (leader and trailer) involved in the transcription/translation of the gene product and the regulation of the transcription/translation, as well as intervening sequences (introns) between individual coding segments (exons),
[0047] The terms polypeptide, peptide, and protein are used interchangeably to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymers. The terms encompass amino acid chains of any length, including full-length proteins, wherein the amino acid residues are linked by covalent peptide bonds.
[0048] The term variant refers to a form of an organism, strain, gene, polynucleotide, polypeptide, or characteristic that deviates from what occurs in nature.
[0049] The term complementarity refers to the ability of a nucleic acid to form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson-Crick or other non-traditional types. A percent complementarity indicates the percentage of residues in a nucleic acid molecule which can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%, and 100% complementary). Perfectly complementary means that all the contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence. Substantially complementary as used herein refers to a degree of complementarity that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%. 97%, 98%, 99%, or 100% over a region of 8, 9, 10, 11, 12, 13, 14, 15. 16, 17, 18, 19, 20, 21, 22, 23. 24, 25, 30, 35, 40, 45, 50, or more nucleotides, or refers to two nucleic acids that hybridize under stringent conditions.
[0050] The term stringent conditions for hybridization refers to conditions under which a nucleic acid having complementarily to a target sequence predominantly hybridizes with the target sequence, and substantially does not hybridize to non-target sequences. Stringent conditions are generally sequence-dependent and vary depending on a number of factors. in general, the longer the sequence, the higher the temperature at which the sequence specifically hybridizes to its target sequence. Non-limiting examples of stringent conditions are described in detail in Tijssen (1993), Laboratory Techniques In Biochemistry And Molecular BiologyHybridization With Nucleic Acid Probes Part 1, Second Chapter Overview of principles of hybridization and the strategy of nucleic acid probe assay, Elsevier, N.Y.
[0051] The term hybridization refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues. The hydrogen bonding may occur by Watson Crick base pairing, Hoogstein binding, or in any other sequence specific manner. The complex may comprise two strands forming a duplex structure, three or more strands forming a multi stranded complex, a single self-hybridizing strand, or any combination of these.
[0052] A recombinant expression vector is a nucleic acid construct, generated recombinantly OF synthetically, with a series of specified nucleic acid elements that permit transcription of a particular polynucleotide sequence in a host cell. An expression vector may be part of a plasmid, viral genome, or nucleic acid fragment. Typically, an expression vector includes a polynucleotide to be transcribed, operably linked to a promoter.
[0053] Operably linked means two or more genetic elements, such as a polynucleotide coding sequence and a promoter, placed in relative positions that permit the proper biological functioning of the elements, such as the promoter directing transcription of the coding sequence.
[0054] The term promoter refers to an array of nucleic acid control sequences that direct transcription of a nucleic acid. As used herein, a promoter includes necessary nucleic acid sequences near the start site of transcription, such as, in the case of a polymerase 11 type promoter, a TATA element. A promoter also optionally includes distal enhancer or repressor elements, which can be located as much as several thousand base pairs from the start site of transcription. Other elements that may be present in an expression vector include those that enhance transcription (e.g., enhancers) and terminate transcription (e.g., terminators), as well as those that confer certain binding affinity or antigenicity to the recombinant protein produced from the expression vector. Recombinant refers to a genetically modified polynucleotide, polypeptide, cell, tissue, or organism. For example, a recombinant polynucleotide (or a copy or complement of a recombinant polynucleotide) is one that has been manipulated using well known methods. A recombinant expression cassette comprising a promoter operably linked to a second polynucleotide (e.g., a coding sequence) can include a promoter that is heterologous to the second polynucleotide as the result of human manipulation (e.g., by methods described in Sambrook et al, Molecular CloningA Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., (1989) or Current Protocols in Molecular Biology Volumes 1-3, John Wiley & Sons, Inc. (1994-1998)). A recombinant expression cassette (or expression vector) typically comprises polynucleotides in combinations that are not found in nature. For instance, human manipulated restriction sites or plasmid vector sequences can flank or separate the promoter from other sequences. A recombinant protein is one that is expressed from a recombinant polynucleotide, and recombinant cells, tissues, and organisms are those that comprise recombinant sequences (polynucleotide and/or polypeptide).
[0055] The term single nucleotide polymorphism or SNP refers to a change of a single nucleotide with a polynucleotide, including within an allele. This can include the replacement of one nucleotide by another, as well as deletion or insertion of a single nucleotide. Most typically, SNPs are biallelic markers although tri- and tetra-allelic markers can also exist. By way of non-limiting example, a nucleic acid molecule comprising SNP AT may include a C or A at the polymorphic position.
[0056] The terms culture, culturing, grow, growing, maintain, maintaining, expand, expanding, etc., when referring to cell culture itself or the process of culturing, can be used interchangeably to mean that a cell (e.g., primary cell) is maintained outside its normal environment under controlled conditions, e.g., under conditions suitable for survival. Cultured cells are allowed to survive, and culturing can result in cell growth, stasis, differentiation or division. The term does not imply that all cells in the culture survive, grow, or divide, as some may naturally die or senesce. Cells are typically cultured in media, which can be changed during the course of the culture.
[0057] The terms subject, patient, and individual are used herein interchangeably to include a human or animal. For example, the animal subject may be a mammal, a primate (e.g., a monkey), a livestock animal (e.g., a horse, a cow, a sheep, a pig, or a goat), a companion animal (e.g., a dog, a cat), a laboratory test animal (e.g., a mouse, a rat, a guinea pig, a bird), an animal of veterinary significance, or an animal of economic significance.
[0058] The term administering includes oral administration, topical contact, administration as a suppository, intravenous, intraperitoneal, intramuscular, intralesional, intrathecal, intranasal, or subcutaneous administration to a subject. Administration is by any route, including parenteral and transmucosal (e.g., buccal, sublingual, palatal, gingival, nasal, vaginal, rectal, or transdermal). Parenteral administration includes, e.g., intravenous, intramuscular, intra-arteriole, intradermal, subcutaneous, intraperitoneal, intraventricular, and intracranial. Other modes of delivery include, but are not limited to, the use of liposomal formulations, intravenous infusion, transdermal patches, etc.
[0059] The term treating refers to an approach for obtaining beneficial or desired results including but not limited to a therapeutic benefit and/or a prophylactic benefit. By therapeutic benefit is meant any therapeutically relevant improvement in or effect on one or more diseases, conditions, or symptoms under treatment. For prophylactic benefit, the compositions may be administered to a subject at risk of developing a particular disease, condition, or symptom, or to a subject reporting one or more of the physiological symptoms of a disease, even though the disease, condition, or symptom may not have yet been manifested.
[0060] The term effective amount or sufficient amount refers to the amount of an agent (e.g., Cas nuclease, modified single guide RNA, etc.) that is sufficient to effect beneficial or desired results. The therapeutically effective amount may vary depending upon one or more of: the subject and disease condition being treated, the weight and age of the subject, the severity of the disease condition, the manner of administration and the like, which can readily be determined by one of ordinary skill in the art. The specific amount may vary depending on one or more of: the particular agent chosen, the target cell type, the location of the target cell in the subject, the dosing regimen to be followed, whether it is administered in combination with other agents, timing of administration, and the physical delivery system in which it is carried.
[0061] The term pharmaceutically acceptable carrier refers to a substance that aids the administration of an agent (e.g., Cas nuclease, modified single guide RNA, etc.) to a cell, an organism, or a subject. Pharmaceutically acceptable carrier refers to a carrier or excipient that can be included in a composition or formulation and that causes no significant adverse toxicological effect on the patient. Non-limiting examples of pharmaceutically acceptable carrier include water, NaCl, normal saline solutions, lactated Ringer's, normal sucrose, normal glucose, binders, fillers, disintegrants, lubricants, coatings, sweeteners, flavors and colors, and the like. One of skill in the art will recognize that other pharmaceutical carriers are useful in the present invention.
[0062] The term increasing stability, with respect to components of the CRISPR system, refers to modifications that stabilize the structure of any molecular component of the CRISPR system. The term includes modifications that decrease, inhibit, diminish, or reduce the degradation of any molecular component of the CRISPR system.
[0063] The term increasing specificity, with respect to components of the CRISPR system, refers to modifications that increase the specific activity (e.g., the on-target activity) of any molecular component of the CRISPR system. The term includes modifications that decrease, inhibit, diminish, or reduce the non-specific activity (e.g., the off-target activity) of any molecular component of the CRISPR system.
[0064] The term decreasing toxicity, with respect to components of the CRISPR system, refers to modifications that decrease, inhibit, diminish, or reduce the toxic effect of any molecular component of the CRISPR system on a cell, organism, subject, and the like.
[0065] The term enhanced activity, with respect to components of the CRISPR system and in the context of gene regulation, refers to an increase or improvement in the efficiency and/or the frequency of inducing, modulating, regulating, or controlling genome editing and/or gene expression.
[0066] The term about in relation to a reference numerical value can include a range of values plus or minus 10% from that value. For example, the amount about 10 includes amounts from 9 to 11, including the reference numbers of 9, 10, and 11. The term about in relation to a reference numerical value can also include a range of values plus or minus 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% from that value IV.
Non-Viral Transfection Process
[0067] Disclosed herein is a process that provides a high efficiency targeted gene integration approach. The methods can be used for genome engineering of any cell type, and can be used, for example, in applications where engineered cells are introduced into a patient.
[0068] In some embodiments, the methods provided herein can be used for installing a cancer treating construct, e.g. a CAR, for example against any of CD38, CD19, CD20, CD123, BCMA and the like into T cells. The efficiency of gene transfer can reach 40-80%. This approach, employing a targeted gene integration, can be used for both autologous and allogenic approaches, and importantly, does not carry a risk of secondary and unwanted cell transformation when engineered cells are introduced into a patient and is therefore safer than current conventional approaches. Additional advantages include a modified guide strand, reliable gene integration, integration of large genes, gene integration of a CAR, and gene integration of a CAR with high expression.
[0069] The examples disclose making CAR-T cells via RNA-guided endonuclease-mediated genome editing that uses phosphorothioate and 2 O-methyl modified single-stranded or double-stranded donor DNA synthesized by PCR. Preferably, the modified single-stranded (ss) or double-stranded (ds) DNA is produced by adding three PS bonds to the nucleotides within 10 nucleotides or five nucleotides of the 5-end of one primer. Without limiting the invention to any particular mechanism, it is believed the PS modification inhibits exonuclease degradation of the modified strand of the donor DNA. Nucleotides within ten or within five nucleotides of the 5 end of the primer were also modified with 2 O-methyl to avoid the non-specific binding which is caused by phosphorothioate bonds. The phosphorothioate and 2 O-methyl modified ds donor DNA and ss donor DNA can be made through PCR, asymmetric PCR or reverse transcription. In the alternative, the final ds DNA product of a synthesis can be modified with phosphorothioate and 2 O-methyl and dsDNA can be produced with modification on one strand only. There is further disclosed a donor DNA construct, such as a donor DNA construct having chemical modifications such as phosphorothioate and 2 O-methyl that include a CAR construct, i.e., are designed for inserting a CAR (chimeric antigen receptor) into a defined genomic site of a host cell. Further, the present disclosure provides a host cell transfected with a CAR that lacks viral vectors that can present a safety concern.
[0070] This processusing a donor DNA with modifications on one strandcan increase knock-in efficiency at least two-fold, which is comparable with viral vector methods and has advantages for site specificity of integration and very stable for CAR expression in T cells compared to conventional retrovirus or lentivirus approaches. At least double modification of one donor chain with phosphorothioate and/or 2 O-methyl can increase knock-in efficiency. This one step knock-out/knock-in method provides a faster and cheaper CAR-T production process for multiple cancer therapy. The ability to use double stranded DNA and avoid nuclease treatment of the donor construct and recovery of the single strand which is laborious and reduces yields is another benefit of the method.
[0071] In this application, we present a simple and robust method for knock in long dsDNA or ssDNA (e.g. 3 kb Anti-CD38 CAR and CD19 CAR) by modified dsDNA or ssDNA donor with phosphorothioate and 2 O-methyl modification. We show that modified long dsDNA and ssDNA sequences are highly efficient HDR templates for the integration of CAR into primary T cells. Further we demonstrate that this method has advantages for site specificity of integration and very stable for CAR expression in T cells compared to conventional retrovirus or lenti-virus approaches.
[0072] The present disclosure provides methods for expressing a CAR gene in cell, method comprising introducing into the primary cell:
(a) a single guide RNA (sgRNA) comprising a first nucleotide sequence that is complementary to the selected knockout nucleic acid and a second nucleotide sequence that interacts with a CRISPR-associated protein (Cas) polypeptide, wherein one or more of the nucleotides of the sgRNA sequence are optionally modified nucleotides; and
(b) a Cas polypeptide, an mRNA encoding a Cas polypeptide, and/or a recombinant expression vector comprising a nucleotide sequence encoding a Cas polypeptide, or Cas polypeptide wherein the modified sgRNA guides the Cas polypeptide to the site of knockout nucleic acid, and (c) a donor target DNA comprising a 5 HA sequences, a promoter sequence, a CAR construct, and 3HA sequence, wherein the donor target DNA is preferably double-stranded and has both or preferably one strand modified with at least one phosphothioate bond within five nucleotides of the 5-end of the donor for reducing; 5 exonuclease cleavage, and optionally includes one, two three, or four 2-O-methyl-modified nucleotides within 5 nucleotides of the 5 end. Preferably the opposite strand to the modified strand has a 5 terminal phosphate.
[0073] The present disclosure provides a method for inducing gene expression of a CAR gene in a primary cell, the method comprising introducing into the primary cell:
(a) a tracrRNA and a crRNA comprising a first nucleotide sequence that is complementary to the selected target knockout nucleic acid, wherein one or more of the nucleotides in the tracrRNA and a crRNA are optionally modified nucleotides; and
(b) a Cas polypeptide, an mRNA encoding a Cas polypeptide, and/or a recombinant expression vector comprising a nucleotide sequence encoding a Cas polypeptide, or a Cas polypeptide; wherein the crRNA guides the Cas polypeptide to the site of knockout nucleic acid; and (c) a donor target DNA comprising a 5 HA sequences, a promoter sequence, a CAR construct, and 3HA sequence, wherein the donor target DNA is preferably double-stranded and has both or preferably one strand modified with at least one phosphothioate bond within five nucleotides of the 5-end of the donor for reducing 5 exonuclease cleavage, and optionally includes one, two three, or four 2-O-methyl-modified nucleotides within 5 nucleotides of the 5 end. Preferably the opposite strand to the modified strand has a 5 terminal phosphate.
EXAMPLES
[0074] The examples show the advantages of the disclosed process to provide high transfection efficiency without the use of viral vectors for knocking in donor DNA and knocking out a targeted endogenous gene such as a T cell receptor (TCR) or PD-1 gene.
[0075] Buffy coats from healthy volunteer donors were obtained from the San Diego blood bank. Some fresh whole blood or leukapheresis products were obtained from StemCell Technologies. Peripheral blood mononuclear cells (PBMCs) were isolated by density gradient centrifugation. PBMCs were activated with CD3 antibody (BioLegend, San Diego, Calif.) 100 ng/mL for two days in AIM-V medium (ThermoFisher Scientific, Waltham, Mass.) supplemented with 5% fetal bovine serum (Sigma, St. Louis, Mo.) with 300 U/mL IL-2 (Proleukin) at a density of 106 cells per mL. The medium was changed every two to three days, and cells were re-plated at 10.sup.6 per mL. This treatment selectively amplifies T cells in the culture. In some experiments, cells were cultured in CTS OpTmizer T Cell Expansion SFM (ThermoFisher) supplemented with 5% CTS Immune Cell SR (Thermofisher scientific) with 300 U/mL IL-2 (Proleukin) at a density of 10{circumflex over ()}6 cells per mL. In some experiments T cells were isolated from PBMCs using magnetic negative selection using EasySep Human T Cell Isolation Kit or CD3 positive selective kit (Stemcell Technology Inc.) according to the manufacturer's instructions.
[0076] For use in cytotoxicity assays, RPMI-8226 multiple myeloma cell line) cells, which express CD38, were transduced to express green fluorescent protein (GFP). K562 (human immortalized myelogenous leukemia) cells, which do not express CD38, were transduced to express R-phycoerythrin (RPE). Both cell lines were cultured in RPMI1640 medium (ATCC) supplemented with 10% fetal bovine serum (Sigma). CAR plasmids were generated with an In-Fusion HD Cloning Kit (Takara Bio USA, Inc, Mountain View, Calif.). Backbone plasmid pAAV-MCS was purchased from Cell Biolabs (San Diego, Calif.).
[0077] In some experiments, retrovirus-transduced T cells were compared with cas-mediated knock-in cells. Transduction of T cells with the retroviral construct was performed essentially as described in Ma et al., 2004 The Prostate 61:12-25; and Ma et al., The Prostate 74 (3):286-296, 2014 (the disclosures of which are incorporated by reference herein in their entireties). In brief, the anti-CD38 CAR MFG retroviral vector plasmid DNA was transfected into Phoenix-Eco cell line (ATCC) using FuGene reagent (Promega, Madison, Wis.) to produce Ecotropic retrovirus, then harvested transient viral supernatant (Ecotropic virus) was used to transduce PG13 packaging cells with Gal-V envelope to produce retrovirus to infect human cells. Viral supernatant from PG13 cells was then used to transduce activated T cells (or PBMCs) two to three days after CD3 or CD3/CD28 activation. Activated human T cells were prepared by activating normal healthy donor peripheral blood mononuclear cells (PBMC) with 100 ng/ml mouse anti-human CD3 antibody OKT3 (Orth Biotech, Raritan, N.J.) or anti-CD3,anti-CD28 TransAct (Miltenly Biotech, German) as manufacturer's manual and 300-1000 U/ml IL2 in AIM-V growth medium (GIBCO-Thermo Fisher scientific, Waltham, Mass.) supplemented with 5% FBS for two days. 510.sup.6 activated human T cells were transduced in a 10 g/ml retronectin (Takara Bio USA) pre-coated 6-well plate with 3 ml viral supernatant and were centrifuged at 1000 g for 1 hour at 32 C. After transduction, the transduced T cells were expanded in AIM-V growth medium supplemented with 5% FBS and 300-1000 U/ml IL2.
TABLE-US-00001 TABLE1 Primersusedforgeneratingdouble-strandeddonorDNAs: anasteriskindicatesaphosphorothioate(PS)linkage;Am,2-O-methylated deoxyadenosine;Cm,2-O-methylateddeoxycytosine;Gm,2-O-methylateddeoxyguanosine Primer Sequence SEQIDNO Forwardprimerforgeneratinganti-CD38 5-T*Gm*Gm*AmGCTAGGGCACCATATT-3 8 donorDNAhaving660and650ntHAs fromTRACgeneexon1 Reverseprimerforgeneratinganti-CD38 p-5-CAACTTGGAGAAGGGGCTT-3 9 donorDNAhaving660and650ntHAs fromTRACgeneexon1 Forwardprimerforgeneratinganti-CD38 5-C*Cm*Am*TGmCCTGCCTTTACTCTG-3 14 donorDNAhaving375and321ntHAs fromTRACgeneexon1 Reverseprimerforgeneratinganti-CD38 p-5-TCCTGAAGCAAGGAAACAGC-3 15 donorDNAhaving375and321ntHAs fromTRACgeneexon1 Forwardprimerforgeneratinganti-CD38 5-A*TCm*Am*CmGAGCAGCTGGTTTCT-3 18 donorDNAhaving171and161ntHAs fromTRACgeneexon1 Reverseprimerforgeneratinganti-CD38 p-5-GACCTCATGTCTAGCACAGTTTTG-3 19 donorDNAhaving171and161ntHAs fromTRACgeneexon1 Forwardprimerforgeneratinganti-CD38 5-ATCACGAGCAGCTGGTTTCT-3 20 donorDNAhaving171and161ntHAs fromTRACgeneexon1-unmodified Reverseprimerforgeneratinganti-CD38 5-GACCTCATGTCTAGCACAGTTTTG-3 21 donorDNAhaving171and161ntHAs fromTRACgeneexon1-unmodified Forwardprimerforgeneratinganti-CD38 5-T*Am*T*GmCmACAGAAGCTGCAAGG-3 28 donorDNAhaving183and140ntHAs fromTRACgeneexon3 Reverseprimerforgeneratinganti-CD38 p-5-TTAGGATGCACCCAGAGACC-3 29 donorDNAhaving183and140ntHAs fromTRACgeneexon3 Forwardprimerforgeneratinganti-CD38 p-5-CTCCCCATCTCCTCTGTCTC-3 34 donorDNAhaving326and380ntHAs fromPD-1locus Reverseprimerforgeneratinganti-CD38 5-Cm*Cm*T*GmACCCGTCATTCTACAG-3 35 donorDNAhaving326and380ntHAs fromPD-1locus Forwardprimerforgeneratinganti-CD38 5-TGGAGCTAGGGCACCATATT-3 36 donorDNAhaving660and650ntHAs fromTRACgeneexon1-unmodified Forwardprimerforgeneratinganti-CD38 5-ATCACGAGCAGCTGGTTTCT-3 37 donorDNAhaving171and161ntHAs fromTRACgeneexon1
Example 1. Simultaneous Knockout of the T-Cell Receptor Gene and Knock-In of anti-CD38 CAR in Human T Cells
[0078] In this example, the T cell receptor alpha constant (TRAC) gene was targeted with an anti-CD38 CAR construct as the donor DNA. The pAAV-TRAC-anti-CD38 construct was designed with approximately 1.3 kb of genomic DNA sequence of the T cell receptor alpha constant (TRAC) that flanks the target sequence (CAGGGTTCTGGATATCTGT (SEQ ID NO:1)) in the genome. The target sequence was identified as a site upstream of the Cas9 PAM in exon 1 of the TRAC gene for Cas9-mediated gene disruption and insertion of the donor construct. The anti-CD38 CAR gene construct (SEQ ID NO:2) comprised a sequence encoding a single chain variable fragment (scFv) specific for human CD38, followed by CD8 and CD28 hinge-CD28 transmembrane-CD28 intracellular regions and a CD3 zeta intracellular domain. An exogenous JeT promoter (U.S. Pat. No. 6,555,6674; SEQ ID NO:3) was used to initiate transcription of the anti-CD38 CAR.
[0079] To construct the pAAV-anti-CD38A2 donor plasmid which was used as a PCR template for generating donor fragments for genome editing, the anti-CD38A2 CAR construct with 650-660 bp homology arms (SEQ ID NO:4) was synthesized by Integrated DNA Technologies (IDT, Coralville, Iowa). An in-fusion cloning reaction was performed at room temperature, containing pAAV-MCS vector double digested with MluI and BstEII (50 ng), the anti-CD38A2 CAR fragment with flanking homology arms (SEQ ID NO:4) (50 ng), 1 ul 5 In-Fusion HD Enzyme Premix (Takara Bio), and nuclease-free water. The reaction was briefly vortexed and centrifuged prior to incubation at 50 C. for 30 min. Stellar Competent Cells (Takara Bio USA) were then transformed with the in-fusion product and plated on ampicillin-treated agar plates. Multiple colonies were chosen for Sanger sequencing (Genewiz, South Plainfield, N.J.) to identify the correct clones using the primers CTTAGGCTGGGCATTAGCAG (SEQ ID NO:5), CATGGAATGGTCATGGGTCT (SEQ ID NO:6), and GGCTACGTATTCGGTTCAGG (SEQ ID NO:7). Correct clones were cultured and the DNA plasmids from these clones were purified.
[0080] For RNA guide-directed targeting of the TCR alpha (TRAC) gene, the tracr RNA (ALT-R CRISPR-Cas9 tracrRNA) and crispr RNA (ALT-R CRISPR-Cas9 crRNA) were purchased from IDT (Coralville, Iowa), where the crRNA was designed to include the target sequence CAGGGTTCTGGATATCTGT (SEQ ID NO:1) that occurs directly upstream of a cas9 PAM sequence (NGG) in first exon of the TRAC gene.
[0081] To make donor fragment DNA, PrimeSTAR Max Premix (Takara Bio USA) was used for PCR reactions. The AAV donor plasmid pAAV-anti-CD38A2 described above was used as a template. To generate a donor fragment with homology arms of 660 nt and 650 nt, the forward primer had the sequence: TGGAGCTAGGGCACCATATT (SEQ ID NO:36), and the reverse primer had the sequence: CAACTTGGAGAAGGGGCTTA (SEQ ID NO:9). In various experiments to test the effectiveness of different homology arm lengths, primers having sequences hybridizing to specific positions within the homology arms of the pAAV-anti-CD38A2 construct were used to produce donor fragments with homology arms of desired lengths by PCR. Phosphorothioate bonds (
[0082] To generate TCR knockouts/anti-CD38 CAR knock-ins, T cells were activated by adding CD3 to the cultures. About 48 to 72 hours after initiating T-cell activation with CD3, the PBMC cultures including activated T cells were electroporated with SpCas9 protein plus crRNA (containing guide sequence SEQ ID NO:1) and tracrRNA using a Neon Transfection System (ThermoFisher Scientific) and 10-l tip or 100-l tips. Briefly, Alt-R CRISPR-Cas9 crRNA and Alt-R tracrRNA (IDT) were first mixed and heated at 95 C. for 5 min. The mixture was then removed from heat and allow to cool to room temperature (15-25 C.) on the bench top for about 20 min. For each transfection, 10 g SpCas9 protein (IDT) was mixed with 200 pmol crRNA:tracrRNA duplex to form RNPs. 110.sup.6 cells were mixed with the RNP and electroporated with 1700 V, 20 ms pulse width, 1 pulse. One to two hours later, 10 ug single-stranded donor DNA was electroporated into the cells with 1600 V, 20 ms pulse width, 1 pulse. In some cases, T cells were mixed with the RNP and donor DNA and RNP and donor were electroporated at the same time. Following electroporation cells were diluted into culture medium and incubated at 37 C., 5% CO.sub.2.
[0083] As controls for the cas-mediated knock-in methods, CAR-expressing PBMCs were generated by transduction of T cells with a retrovirus that included the same anti-CD38A2 expression cassette (SEQ ID NO:2) in the retroviral vector that was used to make the donor fragment employed in CRISPR targeting.
[0084] To determine knock-in efficiency by detecting CAR expression of transformed cells by FACS, transfected or transduced PBMCs were washed with DPBS/5% human serum albumin, then stained with anti-CD3-BV421 antibody SK7 (BioLegend) and PE conjugated anti-CD38-Fc protein (Chimerigen Laboratories, Allston, Mass.) for 30-60 min at 4 C. CD3 and anti-CD38 CAR expression were analyzed using iQue Screener Plus (Intellicyte Co.) Negative controls were cells that had been transfected with an RNP that included cas9 protein complexed with a hybridized tracrRNA and crRNA targeting the first exon of the TRAC gene, but were not transfected with the anti-CD38 CAR donor DNA. PBMCs that had been transfected with the RNP that included the guide targeting the TRAC locus were subsequently transduced with a retrovirus that included the anti-CD38 CAR construct as described above and analyzed for expression of the anti-CD38 CAR as well.
[0085] Increased expression of the anti-CD38 CAR was observed over time in cultures that had been transfected with anti-CD38 CAR donor fragments plus RNPs targeting the TRAC gene. At 10 days post-transfection, flow cytometry of PBMC cultures transfected with unmodified single-stranded donor or single-stranded donor modified to include PS linkages on the 5-most three nucleotides demonstrated that among all cultures that were transfected with the TRAC-targeting RNP, at least 80% of the cells did not express the TCR. Moreover, in cultures transfected with the anti-CD38 CAR donor in addition to the TRAC-targeting RNP, at least 42% of the cells that did not express the TCR expressed the anti-CD38 construct (
[0086] To confirm the occurrence of homology directed repair (HDR) at the targeted locus in Exon 1 of the TRAC gene, PCR was performed on DNA isolated from cultures to verify that the donor fragment had inserted into the TRAC site targeted by the guide RNA. Genomic DNA was amplified from non-transfected activated T cells (ATCs), TRAC knockout cells that were transformed with the RNP that included the TRAC Exon 1 guide RNA, and from T cells transfected with the RNP plus phosphorothioate and 2 O-Methyl modified donor DNA to detect targeted insertion of an anti-CD38 CAR transgene into the TRAC locus. To confirm the position of the donor DNA in the genome, oligonucleotide primers were targeted to sequences outside of the TRAC homology arms but adjacent to the homology arm sequences in the genome. A total of 110.sup.5 cells were resuspended in 30 L of Quick Extraction solution (Epicenter) to extract the genomic DNA. The cell lysate was incubated at 65 C. for 5 min and then at 95 C. for 2 min and stored at 20 C. The concentration of genomic DNA was determined by NanoDrop (Denovix). Genomic regions containing the TRAC target sites were PCR-amplified using the following primer sets: 5 PCR forward primer on TRAC: CTGCTTTCTGAGGGTGAAG (SEQ ID NO:10), 5 PCR Reverse primer on CAR: CTTTCGACCAACTGGACCTG (SEQ ID NO:11); 3 Forward primer on CAR: CGTTCTGGGTACTCGTGGTT (SEQ ID NO:12), 3 Reverse primer on TRAC: GAGAGCCCTTCCCTGACTTT (SEQ ID NO:13) (see
[0087] The concentration of genomic DNA was determined by NanoDrop (Denovix). Both primer sets were designed such that one primer of the pair annealed to a site in the genome outside of the homology arm, and the other primer of the pair annealed to a site within the coding region of the construct (i.e., not in a homology arm). The PCR contained 400 ng of genomic DNA and Q5 high fidelity 2 mix (New England Biolabs). The thermocycler setting consisted of one cycle of 98 C. for 2 min, 35 cycles of 98 C. for 10 s, 65 C. for 15 s, 72 C. for 45 s and one cycle of 72 C. for 10 min. The PCR products were purified on 1% agarose gel containing SYBR Safe (Life Technologies). The PCR products were then eluted from the agarose gel and isolated using NucleoSpin Gel and PCR Clean-up kit (MACHEREY-NAGEL GmbH & Co. KG). The PCR products were submitted for Sanger sequencing (Genewiz).
[0088] To test for function of transfected cells, three weeks after electroporation, the activated T cells that had been transfected with the anti-CD38 CAR targeted to the TRAC locus were starved with IL-2 overnight and tested in specific killing assays (
[0089] The transfected activated T cells (ATCs) were also tested for cytokine secretion (
[0090] In summary, in vitro cellular functional studies did not reveal any notable differences between TRAC-site-specific integrated anti-CD38A2 CAR achieved by this novel and efficient process and virus-mediated randomly integrated anti-CD38A2 CAR, in terms of both specific killing assay (
Example 2. Reducing Length of Homology Arms of Donor DNAs
[0091] When synthesizing donor DNA by PCR, the nuclease reaction and resulting purification of the single stranded donor fragment is time consuming, typically results in losses in the yield of donor fragment for transfections, and can be difficult to control the length of homology arms (homology can be over-chewed). In further experiments testing the efficiency of directed gene knockouts and antibody construct knock-ins, double-stranded donor DNAs were tested to eliminate the nuclease digestion of the PCR-synthesized donor.
[0092] For knock-in of the anti-CD38 CAR construct, donor fragments having homology arms (HAs) of different lengths were produced. The pAAV-TRAC-anti-CD38 construct described in Example 1 that included the anti-CD38 cassette plus TRAC exon 1 homology arms of 660 and 650 nts (SEQ ID NO:4) was used as the template. A first set of primers, SEQ ID NO:8 and SEQ ID NO:9, was used to generate a donor fragment having homology arms of 660 nt and 650 nt from this template. A second set of primers, SEQ ID NO:14 and SEQ ID NO:15, was used to generate a donor fragment having homology arms of approximately 350 nt (375 and 321 nucleotides), where the primer of SEQ ID NO:14 had PS linkages between the between first and second, second and third, and third and fourth nucleotides from the 5 terminus and had 2-O-methyl-modified nucleotides at positions 2, 3, and 5. A third set of primers, SEQ ID NO:18 and SEQ ID NO:19, was used to generate a donor fragment having homology arms of approximately 165 nt (171 and 161 nts), where the primer of SEQ ID NO:18 had PS linkages between the between first and second, third and fourth, and fourth and fifth nucleosides from the 5 terminus and had 2-O-methyl-modified nucleotides at positions 3, 4, and 5. In each case, the forward primer (SEQ ID Nos: 8, 14, and 18) was designed to have three PS linkages within the 5terminal-most five nucleotides (for example, between any of the first and second, second and third, third and fourth, and fourth and fifth nucleosides from the 5 terminus of the primer, and three 2-O-methyl groups occurring in any of the five 5terminal-most nucleotides. In each case, the reverse primer (SEQ ID Nos: 9, 15, and 17) had a 5 terminal phosphate (see Table 1).
[0093] Each of the primer sets was used to generate a donor DNA molecule having multiple PS and 2-O methyl modifications proximal to the 5end of one strand of the donor and a 5 phosphate at the 5 terminus of the opposite strand of the donor. RNPs were assembled to include tracr and crRNAs as described in Example 1, where the crRNA included the target sequence of SEQ ID NO:1, a sequence found in exon 1 of the TRAC gene. The donor molecules, having homology arms of approximately 665, 350, and 165 base pairs in length, were independently transfected into activated T cells as described in Example 1 except that donor fragments and RNPs were transfected in the same electroporation under conditions for electroporating the RNP (using a Neon Transfection System (ThermoFisher Scientific) 1700 V, 20 ms pulse width, 1 pulse). As a control, activated T cells were transfected with the RNP in the absence of a donor fragment, which should result in knockout of the targeted TRAC locus, but without donor DNA insertion. To test for expression of the T cell receptor and the anti-CD38 CAR construct, flow cytometry was performed as provided in Example 1.
Example 3. Modified Versus Non-Modified Double-Stranded Donor DNA
[0094] Donor DNAs that included anti-CD38 CAR and having the approximately 165 nt TRAC exon 1 homology arms as set forth in Example 2, above, were synthesized using primers with and without nucleotide modifications to test their relative effectiveness in promoting HDR. In the first case, primer SEQ ID NO:18 had three PS linkages, occurring between first and second, third and fourth, and fourth and fifth nucleosides and three 2-O-methyl-modified nucleotides within the first five nucleotides of the 5 terminus of the primer (at nucleotide positions 2, 3, and 5) and primer SEQ ID NO:19 had a 5 terminal phosphate (Table 1). These primers were used to generate a donor DNA with the corresponding nucleotide modifications (i.e., three PS linkages and three 2-O-methyl groups within five nucleotides of the 5 terminus of the first strand of the donor DNA product, and a phosphate on the 5 end of the second strand of the donor DNA product). In the second case, primer SEQ ID NO:37 was identical to primer SEQ ID NO:18 except that primer SEQ ID NO:37 lacked chemical modifications see Table 1). The SEQ ID NO:37 primer and the SEQ ID NO:19 primer lacking a 5 terminal phosphate were used to generate a donor DNA with no nucleotide modifications having the anti-CD38 CAR cassette. These donor DNAs were transfected as double-stranded DNA molecules (with no denaturation or nuclease digestion of either strand) along with RNPs that included a tracr RNA and a crRNA that included the target sequence of SEQ ID NO:1 (within exon 1 of the TRAC gene) into activated T cells. In the electroporations with double stranded DNA as donor, 5 ug dsDNA was used to transfect one million activated T cells.
[0095] As in Example 2, control activated T cells were transfected with the RNP in the absence of a donor fragment, which should result in knockout of the targeted TRAC locus without construct insertion. To test for expression of the T cell receptor and the anti-CD3 CAR construct, flow cytometry was performed essentially as provided in Example 1. The results, shown in
[0096] Sequencing of PCR products produced using primers to diagnose the insertion locus (see
Example 4. HDR-Mediated Knock-In of Anti-CD19 and Anti-BCMA CAR Constructs with Simultaneous TCR Knockout
[0097] Additional donor DNAs that included anti-CD19 CAR and anti-BCMA CAR expression constructs were also tested for insertion into the TRAC locus.
[0098] An anti-CD19 CAR construct that included an anti-CD19 CAR cassette (SEQ ID NO:22) that included the Jet promoter (SEQ ID NO:3), and intron, an anti-CD19 CAR construct, and an SV40 polyA sequence was made essentially as described for the anti-CD38 CAR pAAV construct described in Example 1 and was cloned in a vector flanked by the TRAC gene exon 1 homology arms (HAs) of SEQ ID NO:20 and SEQ ID NO:21. The anti-CD19 CAR with HAs pAAV construct was used as a template in PCR reactions as provided in Example 1 using the primers provided as SEQ ID NO:18 and SEQ ID NO:19 that result in the production of modified donor DNA having HAs of approximately 170 and 160 nucleotides (see Table 1). The forward primer (SEQ ID NO:18) had three PS bonds between the first and second, third and fourth, and fourth and fifth nucleosides and three 2-O-methyl modifications at nucleotides 3, 4, and 5 when numbering from the 5-terminus of the primer. The reverse primer (SEQ ID NO:19) had a 5-terminal phosphate. The resulting double-stranded donor DNA was therefore synthesized to have the corresponding modifications, a first strand with three PS and three 2-O-methyl modifications within five nucleotides of the 5-terminus, and a second strand with a 5-terminal phosphate.
[0099] The double-stranded chemically modified donor fragment having the sequence of SEQ ID NO:38 with the nucleotide modifications of primers SEQ ID NO:18 and SEQ ID NO:19 described above incorporated was used to transfect cells along with an RNP that was produced according to the methods provided in Example 1, where the crRNA of the RNP included the target sequence of SEQ ID NO:1, targeting exon 1 of the TRAC gene. As a control, activated T cells were transfected with the RNP in the absence of a donor fragment, which should result in knockout of the targeted TRAC locus without construct insertion. Flow cytometry was performed essentially as described in Example 1 to evaluate the efficiency of introducing a different construct into the TRAC locus, except that anti-CD19 CAR expression was detected by CD19-Fc (Speed Biosystem) followed by APC anti-human IgG Fc (Jackson Immunoresearch). The results are shown in
[0100] An anti-BCMA CAR construct was made through replacing the CD38 CAR with BCMA CAR based on the anti-CD38 CAR pAAV construct described in Example 1. The BCMA CAR fragment was synthesized by IDT. The sequence of the insert is provided as SEQ ID NO:23. The anti-BCMA CAR construct was used as a template in PCR reactions as set forth in Example 1 using the primers provided as SEQ ID NO:18 and SEQ ID NO:19 that result in the production of donor DNA having HAs of approximately 160-170 nucleotides (see Table 1). The forward primer (SEQ ID NO:18) had three PS and three 2-O-methyl modifications within five nucleotides of the 5-terminus of the primer. The reverse primer (SEQ ID NO:19) had a 5-terminal phosphate. The resulting double-stranded donor DNA was therefore synthesized to have a first strand with three PS and three 2-O-methyl modifications within five nucleotides of the 5-terminus, and a second strand with a 5-terminal phosphate.
[0101] The double-stranded donor fragment having the sequence of SEQ ID NO:37, having modified nucleotides by incorporation of chemically modified primers as provided above, was used to transfect cells along with an RNP that was produced according to the methods provided in Example 1, where the crRNA of the RNP included the target sequence of SEQ ID NO:1, targeting exon 1 of the TRAC gene. As a control, activated T cells were transfected with the RNP in the absence of a donor fragment, which should result in knockout of the targeted TRAC locus without construct insertion. Flow cytometry was performed as described in Example 1 to evaluate the efficiency of introducing a different construct into the TRAC locus, except that anti-BCMA CAR expression was detected by PE or APC conjugated BCMA-Fc (R&D). The results are shown in
Example 5. HDR Mediated Knock-In Targeting TRAC Exon 3
[0102] To test the efficiency of inserting donor DNAs into loci other than exon 1 of the TRAC gene using the methods for donor insertion provided herein, an anti-CD38 CAR construct was made for producing a donor DNA having HAs from Exon 3 of the TRAC gene. In this case, the construct was produced essentially as described in Example 1 for the TRAC exon 1 targeting construct, except that the HAs (5 HA SEQ ID NO:24 (183 nt) and 3 HA SEQ ID NO:25 (140 nt)) were sequences surrounding the exon3 target site (SEQ ID NO:26). The sequence of the insert of the pAAV construct that was then produced as a donor DNA with TRAC gene exon 3 homology arms is provided as SEQ ID NO:27. To generate the donor fragment, the forward primer (SEQ ID NO:28) included PS linkages between first and second, second and third, and third and fourth nucleosides and 2-O-methyl modifications on the second, fourth, and fifth positions from the 5-terminus, and the reverse primer (SEQ ID NO:29) had a 5-terminal phosphate. The resulting double-stranded donor DNA that incorporated the primers had a first strand with corresponding PS and 2-O-methyl modifications on the 5-terminal most nucleotides, and a second strand having a 5-terminal phosphate.
[0103] The double-stranded donor fragment having modified nucleotides by incorporation of the primers above and having the sequence of SEQ ID NO:27 was used to transfect cells along with an RNP that was produced according to the methods provided in Example 1, where the crRNA included the target sequence of SEQ ID NO:26, targeting exon 3 of the TRAC gene. As a control, activated T cells were transfected with the RNP in the absence of a donor fragment, which should result in knockout of the targeted TRAC locus without construct insertion. A further control was non-transfected activated T cells (ATCs). Flow cytometry was performed essentially as described in Example 1. The results are shown in
[0104] Sequencing of PCR products produced using primers to diagnose the insertion locus (see
[0105]
[0106] The donor fragments were independently transfected into activated T cells with RNPs. RNPs were produced as described in Example 1, except that for targeting TRAC gene exon 1, the target sequence of the crRNA was SEQ ID NO:1, and for targeting TRAC gene exon 3, the target sequence of the crRNA was SEQ ID NO:26. As can be seen in
Example 6. HDR Mediated Knock-In Targeting PD-1 Gene
[0107] The PD-1 locus was also targeted with a CAR construct. In this case the anti-CD38 CAR cassette (SEQ ID NO:2) was juxtaposed with homology arms (SEQ ID NO:30 and SEQ ID NO:31) having sequences of the PD-1 locus that surround a target site (SEQ ID NO:32) using the methods essentially as described in Example 1 to provide a template for producing donor DNA.
[0108] Donor DNA was produced essentially as described in Example 1, using a forward primer (SEQ ID NO:34) that included a 5 phosphate and a reverse primer that included phosphorothioate linkages between first and second, second and third, and third and fourth nucleosides from the 5 end as well as 2-O-methyl groups on the first, second, and fourth nucleosides from the 5 end (SEQ ID NO:35), see Table 1.
[0109] The double-stranded chemically modified donor fragment (SEQ ID NO:33) was used to transfect cells along with an RNP produced according to the methods provided in Example 1, where the crRNA included the target sequence of SEQ ID NO:32, targeting the PD-1 gene. As a control, activated T cells were transfected with the RNP in the absence of a donor fragment, which generates a knockout of the targeted TRAC locus without CAR construct insertion. A further control was non-transfected activated T cells (ATCs). Flow cytometry was performed essentially as described in Example 1, where an additional control of nontransfected activated T cells (ATCs) was included. A BV421-conjugated antibody to PD-1(EH12.2H7, BioLegend) was used to detect PD-1 expression.
[0110] The results are shown in
[0111] Sequencing of PCR products produced using primers to diagnose the insertion locus (see
[0112]